KR102438044B1 - Recombinant Porcine Circovirus type 2 Antigen and Uses Thereof - Google Patents

Abstract

The present invention relates to a recombinant expression vector comprising a gene encoding a porcine circovirus capsid protein, a recombinant plant cell transformed by the vector, and a porcine circovirus comprising a porcine circovirus capsid protein obtained from the recombinant plant cell. A vaccine composition and a composition for diagnosing porcine circovirus are provided. When the recombinant plant cell of the present invention is used, plant-derived porcine circovirus antigen protein can be produced with high efficiency, and the method for producing porcine circovirus antigen protein using the recombinant plant cell shows superior safety and stability compared to other antigen production methods. Since the composition for diagnosing porcine circovirus of the present invention uses a recombinant antigen protein, it is safe because there is no possibility of contamination due to handling of live viruses, and it is possible to quickly diagnose porcine circovirus infection from a large amount of samples.

Description

Recombinant Porcine Circovirus type 2 Antigen and Uses Thereof

The present invention relates to recombinant porcine circovirus antigens and uses thereof.

Porcine circovirus is a 1.76 kb, small, envelope-free, single-strand circular DNA virus. It is a non-pathogenic virus type 1 that continuously infects the PK-15 cell line, and was first discovered in Canada in 1991 and is a new disease in pigs. It is classified into type 2 (porcine circovirus type 2, PCV2), which is known to cause

PCV2 mainly targets immune cells in pigs, and lymphocyte loss is observed histologically in lymph nodes of infected pigs. Therefore, infection with this virus causes immunosuppression, which increases the chance of secondary infection with other viruses and bacteria, thereby increasing the susceptibility to disease.

Postweaning multisystemic wasting syndrome (PMWS) is a disease caused by PCV2, which is the main cause, other causative agents, and environmental factors. of characteristic clinical symptoms. In the case of PMWS generated through natural or experimental infection, PCV2 antigen and nucleic acid were found in monocytes and antigen-presenting cells of lymphatic organs, which are major target organs for PCV2 proliferation. Typical histopathologic findings of PMWS are lymphocyte loss and monocyte infiltration of lymphoid organs. Suppression of the immune system due to severe damage to lymphatic organs causes changes in the white blood cell count, such as a decrease in blood B lymphocytes and a decrease in CD4+ and CD8+ T lymphocytes in PMWS-affected pigs. In addition, the expression of IL-2 and IL-4 secreted from peripheral blood mononuclear cells (PBMC) in the blood is decreased, the expression of proinflammatory cytokines such as IL-1beta and IL-8 is activated, and the thymus IL By increasing the expression of -10, it interferes with the maturation of thymocytes and induces immunosuppression.

Although the etiology related to the occurrence of PMWS has not been clearly identified so far, it is thought that PMWS may be expressed by vaccination that induces immunity, mixed infection with other viruses, and stress caused by environmental factors.

The incidence of PMWS is steadily increasing worldwide, and the disease is causing enormous economic damage to pig farms in Korea. However, systematic studies on the etiology of PMWS caused by isolated PCV2 in Korea are insufficient.

GenBank Accession No.: KX828216; GenBank Accession No.: KX828235; GenBank Accession No.: KX828228

The present inventors made intensive research efforts to develop a recombinant type 2 porcine circovirus antigen protein having excellent antigenicity and immunogenicity as an antigen protein. As a result, the porcine circovirus capsid antigen protein obtained from plant cells transformed with a recombinant expression vector synthesized by optimizing the codon of the porcine circovirus ORF2 gene has high productivity and immunogenicity. The present invention was completed by finding that it has.

Accordingly, it is an object of the present invention to provide a polynucleotide encoding a capsid protein of porcine circovirus type 2 .

Another object of the present invention is to provide a recombinant expression vector comprising a polynucleotide encoding the capsid protein of the type 2 porcine circovirus.

Another object of the present invention is to provide a plant cell expressing a capsid protein of porcine circovirus type 2 transformed with the recombinant expression vector.

Another object of the present invention is to provide a capsid protein of type 2 porcine circovirus type 2 expressed by the plant cells.

Another object of the present invention is to provide a composition for a type 2 porcine circovirus vaccine comprising a capsid protein of type 2 porcine circovirus type 2, expressed by the plant cells.

Another object of the present invention is to provide a composition or kit for diagnosis of type 2 porcine circovirus, which comprises a capsid protein of type 2 porcine circovirus type 2, expressed by the plant cells. .

Another object of the present invention is to provide a method for producing a type 2 porcine circovirus capsid protein comprising the steps of:

Contains a polynucleotide encoding a capsid protein of porcine circovirus type 2 represented by any one nucleotide sequence selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 transforming plant cells with a recombinant expression vector to culturing the plant cells; and extracting the capsid protein of type 2 porcine circovirus from the plant cells.

Another object of the present invention is to provide a method for diagnosing type 2 porcine circovirus using porcine circovirus capsid protein as an antigen, and detecting an antibody to type 2 porcine circovirus capsid protein through an antigen-antibody reaction in a sample. will provide

The present inventors have synthesized by optimizing the codon of the porcine circovirus ORF2 gene, and the porcine circovirus capsid antigen protein obtained from recombinant plant cells transformed with a recombinant expression vector containing the same has high productivity and immunogenicity. was found to have

According to one aspect of the present invention, the present invention provides a capsid of porcine circovirus type 2 represented by any one nucleotide sequence selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 A polynucleotide encoding a (capsid) protein is provided.

In one embodiment of the present invention, the nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 is the porcine circovirus ORF2 gene encoding the VP2 capsid protein of PCV2a, PCV2b, and PCV2d, respectively, for expression in plant cells. optimized to fit.

In one embodiment of the present invention, the plant cell is Nicotiana benthamiana ( Noicotiana benthamiana ).

The gene encoding the type 2 porcine circovirus capsid protein may have a nucleotide sequence represented by the nucleotide sequence of SEQ ID NOs: 10, 11, and 12 or a nucleotide sequence functionally equivalent thereto.

The "functionally equivalent" means at least 70% or more, preferably 80% or more, of the nucleotide sequence represented by SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 as a result of addition, substitution, or deletion of bases. A protein having a sequence homology of 90% or more, more preferably 95% or more, and exhibiting physiological activity substantially identical to the protein encoded by the nucleotide sequence represented by SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 means a nucleotide sequence capable of encoding For example, a variant in which some nucleotide sequences have been modified by deletion, substitution, or insertion, but capable of functioning functionally the same as a nucleic acid molecule encoding a type 2 porcine circovirus capsid protein (variants) may be included.

As used herein, the "polynucleotide" includes DNA (gDNA and cDNA) and RNA molecules inclusively, and includes not only natural nucleotides, but also analogs in which sugar or base sites are modified (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).

According to another aspect of the present invention, the present invention provides a recombinant expression vector comprising the type 2 porcine polynucleotide.

As used herein, the term “vector” refers to a means for expressing a target gene in a host cell, including a plasmid vector; cozmid vector; and viral vectors such as bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors, and the like.

According to a specific embodiment of the present invention, in the vector of the present invention, the polynucleotide encoding the type 2 swine circovirus capsid protein is operatively linked to the promoter of the vector.

As used herein, the term "operably linked" refers to a functional association between a nucleic acid expression control sequence (eg, a promoter, signal sequence, or array of transcriptional regulator binding sites) and another nucleic acid sequence, whereby the Regulatory sequences will control the transcription and/or translation of said other nucleic acid sequences.

The recombinant vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are disclosed in Sambrook et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001). , this document is incorporated herein by reference.

The vector of the present invention can typically be constructed as a vector for gene cloning or a vector for expression of a protein. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host.

For example, when the vector of the present invention is an expression vector and a eukaryotic cell is a host, a promoter derived from the genome of a mammalian cell (eg, a metallotionine promoter, a beta-actin promoter, a human hegglobin promoter and human muscle creatine promoter) or promoters derived from mammalian viruses (eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk promoter of HSV, mouse mammary tumor virus (MMTV) promoter, LTR promoter of HIV, promoter of Moloney virus, promoter of Epstein Barr virus (EBV) and promoter of Loose sarcoma virus (RSV)) can be used, which generally have a polyadenylation sequence as a transcription termination sequence .

The vector of the present invention may be fused with other sequences to facilitate purification of the polypeptide or protein expressed therefrom. The sequence to be fused includes, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA).

On the other hand, the expression vector of the present invention includes an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neo There is a gene for resistance to mycin and tetracycline.

According to another aspect of the present invention, the present invention provides a recombinant plant cell expressing a porcine circovirus capsid protein transformed with the recombinant expression vector of the present invention.

As used herein, the terms “transformed”, “transduced” or “transfected” refer to the process by which an exogenous nucleic acid is transferred or introduced into a host cell. An "infected" cell is a cell that has been transformed, transduced, or transfected with an exogenous nucleic acid, including the cell and progeny cells resulting from passage thereof.

In one embodiment of the present invention, the plant cell may be a Nicotiana benthamiana cell, but is not limited thereto.

The recombinant plant cells transformed with the recombinant expression vector containing the gene encoding the porcine circovirus capsid protein according to the present invention can express the porcine circovirus capsid protein. When using the plant cells, a large amount of protein can be easily produced in a general laboratory capable of cell culture, has a unique biological function of the porcine circovirus antigen protein, and is safe without the possibility of contamination due to handling of infectious live viruses And it is possible to mass-produce the antigen very quickly and accurately compared to the conventional antigen preparation process.

The porcine circovirus capsid antigen protein according to the present invention can be usefully used to diagnose porcine circovirus.

According to another aspect of the present invention, the present invention provides a composition for diagnosing porcine circovirus and a diagnostic kit comprising the type 2 porcine circovirus capsid protein expressed by the recombinant plant cells.

In the present invention, "diagnosis" means confirming the presence or characteristics of a pathological condition. For the purpose of the present invention, the diagnosis is to determine whether or not the onset of the porcine circovirus or the possibility of the onset.

The diagnostic kit may be prepared using a method commonly used in the art. Such a diagnostic kit includes tools, reagents, etc. commonly used in the art used for immunological analysis as well as porcine circovirus capsid antigen protein. Such tools/reagents include, but are not limited to, suitable carriers, labels capable of generating a detectable signal, solubilizers, detergents, buffers, stabilizers, and the like. When the labeling material is an enzyme, it may include a substrate capable of measuring enzyme activity and a reaction terminator. Suitable carriers include, but are not limited to, soluble carriers such as physiologically acceptable buffers known in the art such as PBS, insoluble carriers such as polystyrene, polyethylene, polypropylene, polyester, Polyacrylonitrile, fluororesin, crosslinked dextran, polysaccharide, polymer such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof.

In addition, the present invention is characterized in that the antibody to the porcine circovirus capsid protein is detected through an antigen-antibody reaction in a sample by using the porcine circovirus capsid protein expressed by the recombinant plant cells as an antigen. A method for diagnosing porcine circovirus is provided.

The antigen-antibody reaction may use any method commonly used in the art, for example, tissue immunostaining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting (Western Blotting), immunoprecipitation At least one method selected from the group consisting of Immunoprecipitation Assay, Immunodiffusion Assay, Complement Fixation Assay, Fluorescence-activated cell sorter (FACS) and protein chip analysis may be used. can

The sample includes, but is not limited to, cells, blood, urine, feces, saliva, tissue, etc., which are expected to be infected or infected with porcine circovirus.

According to another aspect of the present invention, there is provided a vaccine composition against type 2 porcine circovirus, comprising the type 2 porcine circovirus capsid protein expressed by the recombinant plant cell.

As used herein, the term 'vaccine composition' refers to a composition that positively affects the immune response of a subject. The vaccine composition provides a subject with an enhanced systemic or local immune response elicited by a cellular immune response, eg, a Cytotoxic T Lymphocyte (CTL) or a humoral immune response, eg, an antibody.

The vaccine composition may further include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers that may be included in the composition of the present invention are commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, silicic acid. calcium, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. it is not

The composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like, in addition to the above components. Suitable pharmaceutically acceptable carriers and agents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The vaccine composition of the present invention may contain other components, such as stabilizers, excipients, other pharmaceutically acceptable compounds or any other antigen or portion thereof. Vaccines may be in the form of freeze-dried preparations or suspensions, all of which are common in the field of vaccine production.

The dosage form of the vaccine composition of the present invention may be in the form of an enteric coating unit, inoculation for intraperitoneal, intramuscular or subcutaneous administration, aerosol spray, oral or intranasal use. It is also possible to administer in drinking water or as edible pellets.

The vaccine composition of the present invention may be delivered as a single vaccine by expressing heterologous antigens and immune modulating molecules such as cytokines in the same recombinant, or may be administered together with an adjuvant. As used herein, the term "adjuvant" generally refers to any substance that increases a humoral or cellular immune response to an antigen (eg, alum, Freund's complete adjuvant, Freund's incomplete adjuvant, LPS, poly IC , poly AU, etc.).

The features and advantages of the present invention are summarized as follows:

(A) The present invention relates to a recombinant expression vector comprising a gene encoding a porcine circovirus capsid protein, a recombinant plant cell transformed by the vector, and a porcine circovirus capsid protein obtained from the recombinant plant cell. A vaccine composition for viruses and a composition for diagnosing porcine circovirus are provided.

(b) when the recombinant plant cell of the present invention is used, plant-derived porcine circovirus antigen protein can be produced with high efficiency, and the method for producing porcine circovirus antigen protein using the recombinant plant cell has superior safety and stability compared to other antigen production methods indicates

(c) Since the composition for diagnosing porcine circovirus of the present invention uses a recombinant antigen protein, there is no possibility of contamination due to handling of a live virus, so it is safe and can rapidly diagnose porcine circovirus infection from a large amount of samples.

1 is a schematic diagram of a structure of a recombinant expression vector including a gene encoding a porcine circovirus capsid protein.
2 is a diagram showing the results of confirming the expression of recombinant capsid proteins for each type of porcine circovirus (PCV2a, PCV2b, PCV2d) with codon-optimized western blot.
3 is a diagram showing the results of confirming the expression of recombinant capsid proteins for each type of porcine circovirus (PCV2b, PCV2d) that have not been subjected to codon optimization through Western blot.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Example 1. Porcine Circovirus Antigen Synthesis

In order to target the capsid protein of porcine circovirus type 2 (PCV2), which has the highest antigenicity, an experiment was conducted with a sample of a fetus similar to that of pigs. The sequence and Genbank Accession No. of the ORF2 gene of each PCV2 sample are shown in SEQ ID NOs: 1, 2, 3 (SEQ ID NO: 1: PCV2a Accession No: KX828216; SEQ ID NO: 2: PCV2b Accession No: KX828235; PCV2D Accession No: KX828228 ).

The ORF2 nucleotide sequence of PCV2 was cloned through polymerase chain reaction (PCR). The forward and reverse primers shown in Table 1 below were designed to amplify the ORF2 nucleotide sequence for PCV2a, b, and d types.

Primer name Base sequence (5' to 3') SEQ ID NO: PCV2a-F GATCCTTCATCACCATCACCATCACGGAGGC ATGACTTATCCTCGAAGG 4 PCV2a-R GACCCACCCTTGAAACCCTAACCCGGG 5 PCV2b-F GGATCCTT CATCACCATCACCATCACGGAGGCATG ACG TATCCACGTCGT 6 PCV2b-R GATCCACCCTTGAAACCATAACCCGGG 7 PCV2D-F GGATCCTTCATCACCATCACCATCACGGAGGC ATGACTTACCCCAGAAGA 8 PCV2D-R GACCCTCCGTTAAACCCTTAACCCGGG 9

A total of 50 μl PCR mixture containing 5 μl of 10x buffer (Invitrogen, Inc), 1 μl of each primer (10 pmole), 0.2 μl of Pfu DNA polymerase, and 1 μl of template DNA was reacted in a PCR machine (Thermo cycler). For the PCR reaction, the mixture was preheated at 95°C for 3 minutes, denatured at 95°C for 30 seconds, annealed at 55°C for 30 seconds, and extended at 68°C for 1 minute, followed by 29 cycles. Thereafter, the final expansion step was completed at 68° C. for 5 minutes.

Recombinant genes were synthesized after codon optimization. The nucleotide sequences of the optimized ORF2 gene are shown in SEQ ID NOs: 10, 11, and 12.

Example 2. Vector construction for porcine circovirus antigen

To obtain a large amount of protein in plants, the recombinant capsid protein was targeted to the chloroplast (CLC) by including a transit peptide and His at the N-terminus (Fig. 1).

Polynucleotide encoding a RuBisCO transit peptide between the CaMV 35S promoter gene and the NOS terminator of the pCAMBIA1300 vector for plant expression of the porcine circovirus VP2 antigen (SEQ ID NO: 13), 6 Recombinant porcine circovirus VP2 by sequentially ligating a polynucleotide encoding a continuous histidine (SEQ ID NO: 14), and a polynucleotide encoding a porcine circovirus VP2 capsid protein (SEQ ID NO: 10, 11, or 12) A capsid protein plant expression vector was constructed.

Example 3. Production of recombinant porcine circovirus antigen protein

3-1. Transformation of recombinant porcine circovirus antigen protein

Nicotiana benthamiana was used to express the recombinant porcine circovirus antigen protein. About 4 weeks after planting Nicotiana benthamiana seeds in the soil, the recombinant porcine circovirus capsid protein was transformed with Agrobacterium tumefaciens strain GV3101 (Clough and Bent 1998) by electroporation. Plants were grown at 22° C. for 3 days (14 hr light/10 hr dark cycle).

3-2. Expression and identification of recombinant porcine circovirus antigen protein in plants

R.T. et al. After 3 days from the transformed Nicotiana benthamiana plant with reference to the 2003 method, leaves were sampled, protein extracted, and Western blot was performed. The protein sample (10 μg) was separated on an SDS-PAGE gel, and the protein was transferred to an electrotransferred to polyvinylidene fluoride (PVDF) membrane and blocked with non-fat dried milk in TBST buffer for 1 hour. Then, it was reacted with monoclonal His antibody (1:1,000 dilution, Invitrogen) or PCV2 antibody at room temperature for 1 hour, and then washed with TBST buffer for 10 minutes for a total of 3 times. After reacting with HRP-conjugated mouse or rabbit serum for 1 hour, washed with TBST buffer for 10 minutes a total of 3 times, and then detected with Chemiluminescent Substrate (FIG. 2). As shown in FIG. 2 , it was confirmed that the VP2 antigen of the recombinant porcine circovirus of the present invention was expressed at the predicted size. The results are shown in FIG. 2 .

However, in the vector for the porcine circovirus antigen prepared in Example 2, instead of the codon-optimized polynucleotide sequence, the non-codon-optimized PCV2b and PCV2d polynucleotide sequences (SEQ ID NO: 2 and SEQ ID NO: 3) were included. In the case of the vector, it was confirmed that the VP2 antigen was not detected (FIG. 3).

Therefore, from the above results, polynucleotides that are not optimized as in the present invention are not expressed in plant cells, but polynucleotides optimized for expression of plant cells of the present invention, specifically, cells of Nicotiana benthamiana, have antigen productivity. It can be seen that it is very good.

Example 4. Immunogenicity evaluation of recombinant porcine circovirus antigen protein

VP2 capsid proteins of porcine circoviruses 2a, 2b, and 2d expressed in Example 3 above, three healthy 8-week-old pigs without antibodies specific to porcine circovirus were divided into one group and mixed with adjuvant A. A porcine circovirus vaccine was prepared as an antigen and immunized. Specifically, the porcine circovirus vaccine was intramuscularly inoculated and inoculated twice at an interval of 2 weeks. Two weeks after inoculation, blood samples were collected, coagulated at 37°C for 2 hours, and serum was collected and inactivated at 56°C for 30 minutes. For the porcine circovirus antibody test, porcine circovirus antibody positivity was confirmed in the serum of three pigs by porcine circovirus ELISA (PCV2 AB ELISA, VDPro®, Mediandinostics, Korea). As a result, it was possible to confirm the positive porcine circovirus antibody in three pigs inoculated with the recombinant porcine circovirus protein expressed in plants (Table 2).

division Pig 1 (PCV2a) Pig 2 (PCV2b) Pig 3 (PCV2D) voice positivity ELISA results
(absorbance) 2.473 2.315 2.361 0.046 1.172 2.429 2.284 2.348 0.046 1.183

From the above results, the VP2 capsid protein antigen of porcine circovirus 2a, 2b, and 2d of the present invention has an excellent effect of inducing the production of an antibody that specifically binds to the VP2 capsid protein of PCV2. As a vaccine composition for preventing PCV2 It can be seen that it can be usefully used.

<110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Recombinant Porcine Circovirus type 2 Antigen and Uses Thereof <130> PN180301 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 702 <212> DNA <213> Artificial Sequence <220> <223> PCV2a Accession No: KX828216 <400> 1 atgacgtatc caaggaggcg ttaccgaaga agaagacacc gcccccgcag ccatcttggc 60 cagatcctcc gccgccgccc ctggctcgtc cacccccgcc accgctaccg ttggagaagg 120 aaaaatggca tattcaacac ccgcctctcc cgcaccttcg gatatactgt caaggctacc 180 acagtcagaa cgccctcctg ggcggtggac atgatgagat ttaatcttga cgactttgtt 240 cccccgggag gggggaccaa caaaatctct ataccctttg aatactacag aataagaaaa 300 gttaaagttg aattctggcc ctgctccccc atcacccagg gtgatagggg agtgggctcc 360 actgctgtta ttctagatga taactttgta ccaaaggtca atgcccaaac ctatgaccca 420 tatgtaaact actcctcccg ccatacaatc ccccaaccct tctcctacca ctcccgttac 480 ttcacaccca aacctgttct tgactccact attgattact tccaaccaaa taacaaaagg 540 aatcagcttt ggctgaggct acaaacctct agaaatgtgg accacgtagg cctcggcact 600 gcgttcgaaa acagtatata cgaccaggac tacaatatcc gtgtaaccat gtatgtacaa 660 ttcagagaat ttaatcttaa agacccccca cttaaaccct aa 702 <210> 2 <211> 702 <212> DNA <213> Artificial Sequence <220> <223> PCV2b Accession No: KX828235 <400> 2 atgacgtatc caaggaggcg ttaccggaga agaagacacc gcccccgcag ccatcttggc 60 cagatcctcc gccgccgccc ctggctcgtc cacccccgcc accgttaccg ctggagaagg 120 aaaaatggca tcttcaacac ccgcctctcc cgcaccttcg gatatactat caagcgaacc 180 acagtcagaa cgccctcctg ggcggtggac atgatgcgat tcaatattaa tgactttctt 240 cccccaggag ggggctcaaa cccccgctct gtgccctttg aatactacag aataagaaag 300 gttaaggttg aattctggcc ctgctccccg atcacccagg gtgacagggg agtgggctcc 360 agtgctgtta ttctagatga taactttgta acaaaggcca cagccctcac ctatgacccc 420 tatgtaaact actcctcccg ccataccata acccagccct tctcctacca ctcccgctac 480 tttaccccca aacctgtcct agattccact attgattact tccaaccaaa caacaaaaga 540 aatcagctgt ggctgagact acaaactgct ggaaatgtag accacgtagg cctcggcact 600 gcgttcgaaa acagtatata cgaccaggaa tacaatatcc gtgtaaccat gtatgtacaa 660 ttcagagaat ttaatcttaa agacccccca cttaaacctt aa 702 <210> 3 <211> 701 <212> DNA <213> Artificial Sequence <220> <223> PCV2D Accession No: KX828228 <400> 3 atgacgtatc caaggaggcg tttccgcaga cgaagacacc gcccccgcag ccatcttggc 60 cagatcctcc gccgccgccc ctggctcgtc cacccccgcc accgttaccg ctggagaagg 120 aaaaatggca tcttcaacac ccgcctctcc cgcaccatcg gttatactgt caagaaaacc 180 acagtcagaa cgccctcctg gaatgtggac atgatgagat ttaatattaa tgattttctt 240 cccccaggag ggggctcaaa ccccctcact gtgccctttg aatactacag aataaggaag 300 gtgaaggttg aattctggcc ctgctcccca atcacccagg gtgacagggg agtgggctcc 360 actgctgtta ttctagatga taactttgta acaaaggcca atgccctaac ctatgacccc 420 tatgtaaact actcctcccg ccataccata acccagccct tctcctacca ctcccggtac 480 tttaccccga aacctgtcct tgataggaca atcgattact tccaacccaa taacaaaaga 540 aatcaactct ggctgagact acaaactact ggaaatgtag accatgtagg cctcggcact 600 gcgttcgaaa acagtatata cgaccaggac tacaatatcc gtataaccat gtatgtacaa 660 ttcagagaat ttaatcttaa agacccccca cttaacccta a 701 <210> 4 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> PCV2a-F <400> 4 gatccttcat caccatcacc atcacggagg catgacttat cctcgaagg 49 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCV2a-R <400> 5 gacccaccct tgaaacccta acccggg 27 <210> 6 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> PCV2b-F <400> 6 ggatccttca tcaccatcac catcacggag gcatgacgta tccacgtcgt 50 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCV2b-R <400> 7 gatccaccct tgaaaccata acccggg 27 <210> 8 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> PCV2D-F <400> 8 ggatccttca tcaccatcac catcacggag gcatgactta ccccagaaga 50 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCV2D-R <400> 9 gaccctccgt taaaccctta acccggg 27 <210> 10 <211> 699 <212> DNA <213> Artificial Sequence <220> <223> codon optimized PCV2a ORF2 <400> 10 acttatcctc gaaggcgtta caggagaaga aggcatcgac cgaggtcaca tcttggacag 60 attttgcgtc gtagaccttg gttagtccac cctaggcaca gatacagatg gcgacgtaag 120 aatgggattt tcaacacgag gctcagcagg actttcggtt acacagtaaa agcaacgact 180 gtgagaacgc catcttgggc agtcgatatg atgaggttta atttagatga tttcgtccct 240 ccgggaggcg gtacgaataa gataagcata ccatttgaat attacagaat acgaaaagta 300 aaggtcgagt tctggccctg tagccctatt acccagggcg acagaggggt cggctcaacc 360 gcagtcatcc ttgacgataa ttttgtgcca aaggtgaatg cccagactta cgatccctat 420 gttaactaca gctcaaggca cacaattccg cagcctttta gctatcactc taggtacttc 480 acacctaagc ccgtattgga tagcacgata gattattttc aaccaaataa caaacgaaac 540 caactttggc tccgtcttca gacctcacga aatgtggatc acgtcggtct tggtactgct 600 tttgagaatt caatctatga ccaagattat aatattcgtg ttactatgta tgtccaattc 660 agggagttca atctcaaaga cccacccttg aaaccctaa 699 <210> 11 <211> 702 <212> DNA <213> Artificial Sequence <220> <223> codon optimized PCV2b ORF2 <400> 11 atgacgtatc cacgtcgtag atacagacga cgaaggcata ggcccagaag ccatcttggt 60 caaatattga ggaggagacc gtggctggtc cacccccgtc atcgatacag atggcgtagg 120 aaaaacggga ttttcaacac aagattatca agaacatttg gatatacggt gaaggctacc 180 acggttcgaa cacctagttg ggctgtcgac atgatgcgtt tcaatttgga tgatttcgtc 240 ccgcccggag gcggcacaaa taagataagc attcctttcg aatattacag aatccgaaag 300 gtaaaggtcg agttttggcc ctgttctccg ataacaaag gagacagagg cgtgggctcc 360 actgcagtta tcttagatga taactttgtg cctaaagtta acgcccagac ttacgatccc 420 tacgtaaatt attctagccg acatacaatc ccgcagccgt tttcttatca tagcagatac 480 tttacgccta aacccgtgct tgacagtact atagactact ttcagcctaa taacaagcgt 540 aatcagttgt ggttaaggct ccagaccagt aggaatgtag atcacgttgg cttaggaacg 600 gcctttgaga atagtattta cgaccaagac tacaatatca gggtcacaat gtatgttcaa 660 ttcagggaat ttaacctcaa agatccaccc ttgaaaccat aa 702 <210> 12 <211> 702 <212> DNA <213> Artificial Sequence <220> <223> codon optimized PCV2d ORF2 <400> 12 atgacttacc ccagaagaag atttaggagg aggaggcaca gaccccgttc tcaccttggg 60 caaatacttc gtcgaagacc gtggctcgtc catccccgtc atagatatcg atggagaagg 120 aaaaacggaa tcttcaacac aaggcttagt cgaaccatag ggtatacggt taagaaaact 180 acagtgcgaa cgccgtcctg gaatgttgac atgatgaggt tcaatatcaa tgacttcctg 240 cccccaggcg gtggcagcaa ccccttgaca gttcccttcg aatattatcg aatccgtaag 300 gtaaaggtgg agttctggcc atgttcccca atcacacaag gggatcgagg ggtcggttct 360 accgcagtaa tattagatga taatttcgta accaaagcta acgccctcac ttacgatccc 420 tacgtaaact acagcagcag gcacaccatc acccaaccat tttcatacca ttccagatac 480 tttactccaa agcccgtcct tgatcgaacc atcgactatt tccagccgaa caataaacgt 540 aaccaactct ggttgcgttt gcagaccaca ggcaatgtag accatgtcgg actcggtact 600 gccttcgaga actccatcta cgaccaggat tacaacatac gtataactat gtatgtccaa 660 tttagggagt tcaatttgaa ggaccctccg ttaaaccctt aa 702 <210> 13 <211> 231 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of Rubisco transit peptide <400> 13 atggcttcct ctatgctctc ttccgctact atggttgcct ctccggctca ggccactatg 60 gtcgctcctt tcaacggact taagtcctcc gctgccttcc cagccacccg caaggctaac 120 aacgacacta cttccatcac aagcaacggc ggaagagtta actgcatgca ggtgtggcct 180 ccgattggaa agaagaagtt tgagactctc tcttaccttc ctgaccttac c 231 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of 6XHis <400> 14 caccaccatc accaccat 18

Claims (15)

A polynucleotide encoding a capsid protein of porcine circovirus type 2 represented by the nucleotide sequence of SEQ ID NO: 12.
A polynucleotide encoding a RuBisCO transit peptide between the CaMV 35S promoter gene and the NOS terminator of the pCAMBIA1300 vector containing the nucleotide sequence of SEQ ID NO: 13, the nucleotide sequence of SEQ ID NO: 14 A recombinant VP2 capsid protein plant expression vector constructed by sequentially linking six consecutive histidine-encoding polynucleotides including the polynucleotide encoding the porcine circovirus VP2 capsid protein of claim 1 to claim 1.
A plant cell expressing the VP2 capsid protein of porcine circovirus type 2, transformed with the recombinant VP2 capsid protein plant expression vector of claim 2 .

The plant cell of claim 3, wherein the recombinant plant cell is a Nicotiana benthamiana cell.
delete A composition for a type 2 porcine circovirus vaccine, comprising the VP2 capsid protein of claim 3 or claim 4, which is expressed by the plant cells of claim 2, porcine circovirus type 2).
A composition for diagnosing type 2 porcine circovirus, comprising the VP2 capsid protein of claim 3 or claim 4, which is expressed by the plant cells of claim 2, porcine circovirus type 2).
A kit for diagnosing type 2 porcine circovirus, comprising the VP2 capsid protein of claim 3 or claim 4, which is expressed by the plant cells of claim 2, porcine circovirus type 2).
A recombinant VP2 capsid protein plant expression vector comprising a polynucleotide encoding a VP2 capsid protein of porcine circovirus type 2 represented by the nucleotide sequence of SEQ ID NO: 12 in plant cells transforming;
culturing the plant cells; and
A method for producing a type 2 porcine circovirus VP2 capsid protein, comprising extracting the VP2 capsid protein of the type 2 porcine circovirus from the plant cells.
An agent for detecting an antibody to type 2 porcine circovirus VP2 capsid protein through an antigen-antibody reaction in a sample using the porcine circovirus VP2 capsid protein expressed by the plant cells of claim 3 or 4 as an antigen A method for diagnosing type 2 porcine circovirus.
11. The method of claim 10, wherein the antigen-antibody reaction is tissue immunostaining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting (Western Blotting), immunoprecipitation assay (Immunoprecipitation Assay), immunodiffusion assay (Immunodiffusion) Assay), complement fixation assay (Complement Fixation Assay), FACS (Fluorescence-activated cell sorter) and protein chip (protein chip) to be performed using one or more methods selected from the group consisting of, type 2 pig circo How to diagnose a virus.
The method of claim 10, wherein the sample is at least one selected from the group consisting of cells, blood, urine, feces, saliva, and tissue. A composition for type 2 porcine circovirus vaccine comprising the following as an active ingredient:
i) VP2 capsid protein of porcine circovirus type 2 encoded by the nucleotide sequence of SEQ ID NO: 12;
ii) the VP2 capsid protein of porcine circovirus type 2 encoded by the nucleotide sequence of SEQ ID NO: 12 and the VP2 capsid protein of porcine circovirus type 2 encoded by the nucleotide sequence of SEQ ID NO: 10;
iii) the VP2 capsid protein of porcine circovirus type 2 encoded by the nucleotide sequence of SEQ ID NO: 12 and the VP2 capsid protein of porcine circovirus type 2 encoded by the nucleotide sequence of SEQ ID NO: 11; or
iv) the VP2 capsid protein of porcine circovirus type 2 encoded by the nucleotide sequence of SEQ ID NO: 12, the VP2 capsid protein of porcine circovirus type 2 encoded by the nucleotide sequence of SEQ ID NO: 10, and the base of SEQ ID NO: 11 VP2 capsid protein of porcine circovirus type 2 encoded by the sequence.
The composition for a vaccine according to claim 13, wherein the protein is expressed by plant cells.
15. The method of claim 14, wherein the plant cells are Nicotiana benthamiana ( Nicotiana benthamiana ) Cells, vaccine composition.

Images