WO2008151215A1 - Production of porcine circovirus proteins in plants - Google Patents

Abstract

The present application is based on the development of a technology related to plant transformation and to the expression of non-plant proteins in a plant host, hi particular, the technology can be used for the generation of transgenic plants that can express and produce animal proteins useful for inducing an immune response against viruses. One such virus is porcine circovirus type II (PCVII), which has been associated with diseases such as postweaning multisystemic wasting syndrome (PMWS) that threatened swine populations. Provided is a transgene construct that can be used in the transformation of a plant host, and the gene expression products expressed by the transformed plants. Also provided are immunogenic compositions and vaccines, vaccine kits, and immunization or vaccination methods that make it possible to use such immunization or vaccination programs.

Description

TITLE OF THE INVENTION

PRODUCTION OF PORCINE CIRCOVIRUS PROTEINS IN PLANTS

INCORPORATION BY REFERENCE

This application claims priority to provisional U.S. application Serial No. 60/933,105, filed June 4, 2007.

The foregoing application, and all documents cited therein or during their prosecution ("application cited documents") and all documents cited or referenced in the application cited documents, and all documents cited or referenced herein ("herein cited documents"), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention.

FIELD OF THE INVENTION

The present invention is based on the development of a technology related to plant transformation and to the expression of non-plant proteins in a plant host. In particular, the technology can be used for the generation of transgenic plants that can express and produce animal proteins useful for inducing an immune response against viruses. One such virus is porcine circovirus type II (PCVII), which is a causative agent of postweaning multisystemic wasting syndrome (PMWS). The present invention provides constructs that can be used in the transformation of a plant host, as well as the expression products expressed by the transformed plants. These products are useful for the protection of the swine population against viral infections. The invention includes, therefore, immunogenic compositions and vaccines, vaccine kits, and immunization or vaccination methods for amelioration or prevention of symptoms associated with PCVII.

BACKGROUND OF THE INVENTION

Postweaning multisystemic wasting syndrome (PMWS) is a recently recognized disease of young pigs. The PMWS syndrome detected in Canada, the United States and France is clinically characterized by a gradual loss of weight and by manifestations such as tachypnea, dyspnea and jaundice. From the pathological point of view, it is manifested by lymphocytic or granulomatous infiltrations, lymphadenopathies and, more rarely, by hepatitis and lymphocytic or granulomatous nephritis (E Clark Proc. Am. Assoc. Swine Prac. 1997, 499-501; La Semaine Veterinaire No. 26, supplement to La Semaine Veterinaire 1996 , 834; La Semaine Veterinaire 1997, 857, 54. PCVII is etiologic agent of PMWS (Ellis et al. Can. Vet. J. 1998, 39, 44-51). . Circo viruses, the common name for a family of viruses named Circoviridae and that is found in a range of plant and animal species, are characterized as round, non- enveloped virions with mean diameters from 17 to 23.5 nm containing circular, single- stranded deoxyribonucleic acid (ssDNA). The ssDNA genome of the circoviruses represents the smallest viral DNA replicons known. As disclosed in WO 99/45956, at least six viruses have been identified as members of the family according to The Sixth Report of the International Committee for the Taxonomy of Viruses (Lukert et al. 1995. The Circoviridae. pp. 166-168; in Murphy, et al. (eds.) Virus Taxonomy, Sixth Report of the International Committee on Taxonomy of Viruses, Arch. Virol. 10 Suppl.).

A variety of circoviruses have been identified in a range of animal species including PCV, chicken anemia virus (CAV), beak and feather disease virus (BFDV) of psittacine birds, and plant viruses, including subterranean clover stunt virus (SCSV), coconut foliar decay virus (CFDV) and banana bunch top virus (BBTV). There are no apparent DNA sequence homologies or common antigenic determinants among the currently recognized circoviruses (Todd et al. Arch. Virol. 991, 117, 129-135). Members in the circovirus family have been shown to cause anemia, immunodeficiency-related diseases and to infect macrophage cells in vitro.

PCV type II ("PCVII"), in contrast to PCV type I ("PCVI"), is closely associated with PMWS in weaning pigs (see Allan et al. Eur. J. Vet. Diagn. Investig. 1998, 10, 3-10; Ellis et al. Can. Vet. J. 1998, 39, 44-51 and Morozov et al. J. Clin. Microbiol. 1998, 36, 2535-2541). Pigs with naturally acquired or experimentally induced PCV-II infections present with progressive weight loss, tachypnea, dyspnea, and jaundice (Allan et al. 1998; Allan et al. 1999; Ellis et al. 1998; Ellis et al. 1999). Gross pathologic findings that have been directly associated with PCV-II antigen include, lymphadenopathy, interstitial pneumonia, hepatitis and nephritis (Allan et al. 1998; Allan et al. 1999; Ellis et al. 1998; Ellis et al. 1999).

Infectious agents of swine, especially viruses, not only profoundly affect the farming industry, but pose potential public health risks to humans, due to the increased interest in the use of pig organs for xenotransplantation in humans. Therefore, the development of preventions of PMWS and vaccinations for PCV are essential. Recently, plants have been investigated as a source for the production of therapeutic agents such as vaccines, antibodies, and biopharmaceuticals. Compared to mammalian recombinant systems, the use of plants to generate these agents has several advantages. For example, deriving vaccines from plant expression products can eliminate the risk of contamination with animal pathogens, provide a heat-stable environment, and would avoid injection-related hazards if administered as an edible agent (Thanavala et al. Expert Rev. Vaccines 2006, 5, 249-260). In addition, plants can be grown on a large scale and can utilize existing cultivation, harvest, and storage facilities. Furthermore, there is a lower cost of production and processing to derive therapeutic agents from plants (Giddings et al. Nature Biotech. 2000, 18, 1151-1155).

There are three primary transformation approaches for the production of recombinant therapeutic agents in plants. The first approach is stable nuclear transformation, which involves the integration of recombinant DNA into the nuclear genome of the plant cell to produce transgenic plants. DNA can be transferred through either an indirect or a direct method. The indirect method involves a natural plant pathogen, such as Agrobacterium tumefaciens, which can infect and transport a plasmid containing foreign DNA into the plant cells (Zambryski Annu. Rev. Genet. 1998, 22, 1- 30). The direct method involves transferring "naked" DNA into plant cells through such technologies as electroporation, which causes temporary pores to be formed in membranes, microinjection, and microprojectile bombardment (Nigel et al. DNA Cell Biol. 2002, 21, 963-977). Examples of plants that can be subjected to stable nuclear transformation and be used as a model expression system include Nicotiana tabacum, Nicotiana bethamiana, Arabidosis thaliana, tomato, banana, turnip, black-eyed bean, oilseed rape, Ethiopian mustard, potato, rice, wheat, and maize (Giddings et al., 2000). The second approach to producing recombinant therapeutic agents in plants is stable chloroplast transformation. This method entails using biolistic bombardment to introduce foreign DNA fragments into the chloroplast, where the DNA is integrated into the chloroplast genome by homologous recombination (Swab et al. Proc. Natl. Acad. Sci. USA 1993, 90, 913-917). Compared to stable nuclear transformation, stable chloroplast transformation can have several advantages - a large chloroplast genome copy number in plant cells may provide high expression of recombinant proteins, and the effect of the gene position is eliminated since the use of homologous recombination allows for site- specific integration within the chloroplast genome. However, chloroplast transformation has been successful in a limited number of plant species, while stable nuclear transformation is widely applicable in a variety of plants (Thanavala et al., 2006).

The third approach is viral transient infection, which involves the infection of plant cells with plant viruses. This technique can result in a high level of recombinant DNA expression in a short amount of time. The viral vector can be designed to display an antigenic peptide on the surface of the resulting viral product (known as an epitope presentation system), or the vector can be designed to express a recombinant protein that accumulates within the plant (polypeptide expression system) (Canizares et al. Immunol. Cell Biol. 2005, 83, 263-270). Viruses used for transient infection include cowpea mosaic virus, tobacco mosaic virus, tomato bushy stunt virus, plum pox virus, potato virus X, and alfalfa mosaic virus (Canizares et al., 2005). The viruses can be introduced into the plant cell through various methods that include inoculation with in vitro transcribed RNA (Ahlquist et al. MoI. Cell. Biol. 1984, 4, 2876-2882), Agrobacterium- mediated infection (Turpen et al. J. Virol. Methods 1993, 42, 227-239), or direct injection of a DNA plasmid carrying a cDNA copy of the viral genome (Marusic et al. J. Virol. 2001, 75, 8434-8439).

Plant transformation technology can be utilized to generate therapeutic agents such as vaccines, antibodies, and biopharmaceuticals. hi vivo studies have demonstrated the efficacy of plant-derived vaccines to induce an immunological response. Zhou JY et al. reported expression of the Sl glycoprotein of infectious bronchitis virus (EBV) in potatoes, which induced production of anti-Si antibodies in mice and protected chickens from virulent IBV (J. Virol. 2003, 77, 9090-9093). Tuboly et al. expressed the S-protein of transmissible gastroenteritis virus (TGEV) in tobacco plants. Immunization of pigs with the 5-protein induced the production of antibodies to TGEV (Vaccine 2000, 18, 2023-2028). In addition, clinical studies have shown the utility of plant-derived vaccines. For example, in Tacket et al., ingested transgenic potatoes expressing a bacterial enterotoxin induced the production of antibodies in humans as measured in serum (Nature Med. 1998, 4, 607-609).

Plant transformation technology can also be used for the generation of antibodies. After it was first demonstrated by Hiatt et al. in 1989 (Nature 342, 76-78), many groups have expressed antibody molecules ranging from single chain molecules to multimeric secretory antibodies in plants. Larger molecules, such as IgG antibodies, whose generation is associated with the endoplasmic reticulum (ER), can be produced in plants by using plant leader sequences to target antibody secretion through the ER (Ma et al. Vaccine 2005, 23, 1814-1818). For example, immunoglobulin G (IgG) and secretory immunoglobulin A (IgA) antibodies for the prevention of Streptococcus mutans colonization were generated in tobacco plants (Ma et al. Eur. J. Immunol. 1994, 24, 131- 8). Additional antibodies that have been produced in plants include single-chain variable fragment gene fusions of IgG from mouse B-cell lymphoma generated in tobacco for the treatment of non Hodgkin's lymphoma (McCormick et al. Proc. Natl. Acad. Sci. USA 1999, 96, 703-708), and antibodies expressed in soybean for humanized anti-herpes simplex virus and corn (Zeitlin et al. Nat. Biotechnol. 1998, 16, 1361-4).

Transgenic plants are also a source of biopharmaceutical proteins and peptides. Proteins generated in transgenic plant systems include hirudin, which is an anticoagulant (Parmenter et al. Plant MoI. Biol. 1995, 29, 1167-1180); granulocyte-macrophage colony- stimulating factor for treating neutropenia; epidermal growth factor for wound repair, α- interferon for the treatment of hepatitis B and C (Goddjin et al., 1995), and glucocerebrosidase for the treatment of Gaucher' s disease (Cramer et al. Curr. Topics Microbiol. Immunol. 1999, 240, 95-118.).

Yet, development of vaccines from plants is far from a remedial process, and there are numerous obstacles that are commonly associated with such vaccine production. Limitations to successfully producing plant vaccines include low yield of the bioproduct or expressed antigen (Chargelegue et al Trends in Plant Science 2001, 6, 495-496), protein instability, inconsistencies in product quality (Schillberg et al Vaccine 2005, 23, 1764-1769), and insufficient capacity to produce viral-like products of expected size and immunogenicity (Arntzen et al Vaccine 2005, 23, 1753-1756). In order to address these problems, codon optimization, careful approaches to harvesting and purifying plant products, use of plant parts such as chloroplasts to increase uptake of the material, and improved subcellular targeting are all being considered as potential strategies (Koprowski Vaccine 2005, 23, 1757-1763).

In light of the advancements in transgenic plant technologies, and despite of the obstacles associated with plant production of vaccines, the transgenic plant system offers an effective and safe method for developing therapeutic agents. Importantly, transgenic plants can be used to generate vaccines and immunogenic compositions against such viruses as porcine circovirus.

Citation or identification of any document in this application is not an admission that such document is available as prior art to the present invention. SUMMARY OF THE INVENTION

The present invention is based on the development of technology to insert exogenous DNA into plant transformation vectors. The resulting construct can be used to transform a plant host and develop transgenic plants that express the exogenous DNA. In particular, the technology can be used to insert DNA from PCVII into the plant transformation vector and express the products associated with PCVII in plants. These expression products may either serve as immunological compositions, vaccines or diagnostic reagents, or as intermediates in the production of monoclonal antibody (Mab) preparations useful in passive immunotherapy against PMWS, or as intermediates in the production of antibodies useful as diagnostic reagents.

Accordingly, the invention relates to an expression system capable of effecting the production of a desired gene expression product encoded by polynucleotide sequences derived from the PCVII genome. Examples of PCVII isolates suitable for use in the invention include, but are not limited to:

Table 1: Exemplary PCVII isolates suitable for use in the invention

The polynucleotide sequence may encode an immunogenic PCVII polypeptide having at least about 85 % identity to a polypeptide selected from the group consisting of a polypeptide derived from open reading frame ORFs 1 to 13, and immunogenic fragments of ORFs 1- to 13 comprising at least about 5 amino acids. In an advantageous embodiment, the polynucleotide encodes the ORF 2 polypeptide or immunogenic fragments thereof.

It is noted that in this application there are three ORF numbering systems: the Meehan ORF numbering system (J Gen Virol 1997, 78, 221-227), the Wang ORF numbering system (Wang et al., and the Allan-Ellis ORF numbering system. (Allan et al.; Ellis et al.) A comparison of the numbering systems is shown in Table 2. The Meehan ORF numbering system is employed throughout the SUMMARY OF THE INVENTION and the DETAILED DESCRIPTION. The numbering system used in the BRIEF DESCRIPTION OF THE DRAWINGS and the EXAMPLES is specified for each figure and example, respectively.

Table 2: Comparison of the Meehan, Wang, and Allan-Ellis ORF Numbering Systems

In an embodiment of the invention, the expression system can comprise a vector capable of transforming a plant host. In a preferred embodiment, the plant transformation vector may be selected from the group consisting of, but no limited to, pAUX, pSAT, pBIN, or pCAMBIA, most preferably pBIN or pCAMBIA. In one embodiment, the plant transformation vector may be inserted by a promoter, preferably a promoter from a plant virus, more preferably the cauliflower mosaic virus, most preferably the 35S long promoter. In yet another preferred embodiment, the vector comprises a terminator, preferably the nopaline synthase terminator.

In yet another aspect, the invention relates to a recombinant host transformed with the vectors of the invention. In one particular embodiment, the recombinant host may be a plant selected from the group consisting of, but not limited to, Nicotiana tabacum, Nicotiana bethamiana, Arabidopsis thaliana, Dichanthium annulatum, Lemna gibba, Spirodela oligorrhiza, tomato, banana, turnip, black-eyed bean, soybean, oilseed rape, Ethiopian mustard, potato, rice, tobacco, wheat, maize, and lettuce, preferably Lemnaceae plants, tissue or callus and more preferably of the genus Lemna or Spirodela. In a further aspect, the invention relates to an expression product produced by the transformed host. In one particular embodiment, the expression product is encoded by polynucleotide sequences of ORFS 1 to 13. In a preferred embodiment, the expression product may be encoded by the polynucleotide sequences derived from ORF 2. In another preferred embodiment, the expression product may be a polypeptide. The invention relates to the methods of preparing polypeptide compositions, such as vaccines, immunogenic compositions, and diagnostic compositions. The invention also provides immunoglobulins, immunoassays and kits for assays containing the primers, probes, polypeptides, and / or immunoglobulins. In one embodiment, the invention pertains to a method of detecting PCVII antibodies in a biological sample comprising (a) providing a biological sample; (b) reacting the biological sample with an immunogenic PCVII polypeptide, under conditions which allow PCVII antibodies, when present in the biological sample, to bind to the PCVII polypeptide to form an antibody/antigen complex; and (c) detecting the presence or absence of the complex, thereby detecting the presence or absence of PCVII antibodies in the sample. Another aspect of the invention encompasses an immunogenic composition for eliciting an immunological response against a porcine circovirus comprising at least one porcine circovirus antigen, and a veterinarily acceptable vehicle or excipient. In one embodiment of the invention, the porcine circovirus antigen comprises at least one porcine circovirus type II antigen, hi another embodiment of the invention, the porcine circovirus type II antigen is an expression product produced by the expression system described above. hi one embodiment of the invention, the antigen of porcine circovirus comprises antigens of a plurality of porcine circoviruses. Another embodiment of the invention further comprises a pharmaceutically or veterinarily acceptable adjuvant and, optionally, a freeze-drying stabilizer.

Yet another aspect of the invention is a kit for preparing an immunogenic composition encompassing at least one porcine circovirus antigen. Preferably, the porcine circovirus antigen comprises at least one porcine circovirus type II antigen.

It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as "comprises," "comprised," "comprising" and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean "includes," "included," "including," and the like; and that terms such as "consisting essentially of and "consists essentially of have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.

These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.

BRIEF DESCRIPTION QF THE DRAWINGS

The following Detailed Description, given by way of example, but not intended to limit the invention to specific embodiments described, may be understood in conjunction with the accompanying drawings, incorporated herein by reference, in which: FIG. 1 shows a diagram of PCVII 412, indicating the location of the open reading frames under the Wang ORF numbering system.

FIGS. 2A-2C show the nucleotide sequence for the PCVII 412 genome (SEQ ID No: 1). Both senses are shown. The amino acid sequences corresponding to the translation products of the various ORFs are also shown as indicated using the Wang ORF numbering system: ORF 1 (SEQ ID NO: 3); ORF 2 (SEQ ID NO: 9); ORF 3 (SEQ ID NO: 7); ORF 4 (SEQ ID NO: 20); ORF 5 (SEQ ID NO: 21); and ORF 6 (SEQ ID NO: 5).

FIGS. 3A-3D show comparisons of amino acid sequences from open reading frames of PCVII 412 under the Wang ORF numbering system versus corresponding open reading frames of PCVI isolated from PK15 cells. FIG. 3A shows the amino acid sequence of ORF 1 of PCVII 412 (top line, SEQ ID NO: 3) compared to the corresponding ORF from PCVI (bottom line, SEQ ED NO: 4). FIG. 3B shows the amino acid sequence of ORF 6 of PCVII 412 (top line, SEQ ID NO: 5) compared to the corresponding ORF from PCVI (bottom line, SEQ ID NO: 6). FIG. 3C shows the amino acid sequence of ORF 3 of PCVII 412 (top line, SEQ ID NO: 7) compared to the corresponding ORF from PCVI (bottom line, SEQ ED NO: 8). FIG. 3D shows the amino acid sequence of ORF 2 of PCVII 412 (top line, SEQ ED NO: 9) compared to the corresponding ORF from PCVI (bottom line, SEQ ED NO: 10).

FIGS. 4A-4B show comparisons of the nucleotide sequences of various PCV isolates: PCVI from PKl 5 cells (SEQ ED NO: 2), PCVII 412 (SEQ ID NO: 1), PCVII 9741 (SEQ ED NO: 11) and PCVII B9 (SEQ ED NO: 12).

FIGS. 5A-5D show comparisons of the nucleotide sequences of PCV PK/15 (top line, SEQ ED NO: 2), Lmp.999 (second line, SEQ ED NO: 27), Lmp.lOlO (third line, SEQ ED NO: 24), Lmp.1011-48121 (fourth line, SEQ ID NO: 25), and Lmp.1011-48285 (bottom line, SEQ ED NO: 26).

FIG. 6 shows the results of multiplex PCR used for the detection of PCV infection. The assay both identified PCV infection and distinguished between the presence of PCVI and PCVII. Lane 1 is a molecular weight marker. Lanes 2-4 are controls in the order of PCVII, PCVI and negative. Lanes 5-13 are blood samples collected from piglets from a PMWS-affected herd.

FIG. 7 shows the results of multiplex PCR conducted on various tissue samples from a PMWS-affected piglet. Lane 1 in both rows is a molecular weight marker. Lane 2 in the top row is a positive PCVII control while lane 3 is a negative control. The remaining lanes are various tissue samples collected from the PMWS-affected piglet.

FIG. 8 shows schematic representations of the binary vectors used to introduce synthetic PCVII ORF2 genes (under the Meehan numbering system). The top panel shows pLG042, which has a pBIN backbone, and the bottom panel shows pLG144, which has a pCAMBIA backbone. These plasmids contain a gene coding for kanamycin resistance in plants (no-nptII-T35S)

FIG.9A-9B shows schematic representations of the final binary vectors used to transform Spriodela, wherein ORF2 (under the Meehan ORF numbering system) has been inserted into pLG042 or pLG144. The first panel shows pLG152 comprised of the native coding sequence of ORF2 inserted into pLG042. The second panel shows pLG153 comprised of the mutated coding sequence of ORF2 inserted into pLG042. The third panel shows pLG154 comprised of the native coding sequence of ORF2 inserted into pLG144. Finally, the last panel shows pLG155 comprised of the mutated coding sequence of 0RF2 inserted into pL144. FIG. 10 shows the results of Northern blot analysis used for the detection of ORF2 mRNA (under the Meehan ORF numbering system) in sampling of the transgenic lines. The arrowhead shows the expected position of the PCVII mRNA.

FIG. 11 shows expression of ORF2 in kanamycin-resistant Spirodela lines. RT- PCR was performed on total RNA using VP2 specific primers (top panel) for 32 cycles, amplicon length: 311 bp; or using GAPDH specific primers as control of RNA quantity (bottom panel) for 27 cycles, amplicon length: 261 bp.

FIG. 12 shows ORF2 (under the Meehan ORF numbering system) protein production measured as optical density (OD) values using ELISA. OD values from a wild type line used as a control was subtracted from the OD values of the transgenic lines. A ranking system featuring grades of + to +++ was applied to highlight the most expressing lines (+++) which were further analyzed to determine the antigen titer.

FIG. 13 shows the ORF2 (under the Meehan ORF numbering system) titration curve for plant extracts using ELISA. Samples included an antigen reference solution (R0021-030506), a wild type, and two transgenic lines. The data is shown as the absorbance versus LOg_1O (I/dilution).

FIG. 14 shows the results of purifying 0RF2 (under the Meehan ORF numbering system) by affinity chromatography (AC) for the transgenic line that showed the highest titer (Tl 15-12-4). Lane 1 is the broad range molecular weight markers. Lanes 2 and 3 are the results before and after AC. Lane 4 shows results after AC and wash 1. Lanes 5 and 6 show elution fractions 1 and 2, respectively, after AC. Lane 7 shows the results after AC and wash 3.

DETAILED DESCRIPTION OF THE INVENTION The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA technology, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, VoIs. I, II and III, Second Edition (1989); DNA Cloning, VoIs. I and II (D. N. Glover ed. 1985); Oligonucleotide Synthesis (M. J. Gait ed. 1984); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Animal Cell Culture (R. K. Freshney ed. 1986); Immobilized Cells and Enzymes (IRL press, 1986); Perbal, B., A Practical Guide to Molecular Cloning (1984); the series, Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); and Handbook of Experimental Immunology, VoIs. I-IV (D. M. Weir and C. C. Blackwell eds., 1986, Blackwell Scientific Publications).

Before describing the present invention in detail, it is to be understood that this invention is not limited to particular DNA, polypeptide sequences or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.

It must be noted that, as used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "an antigen" includes a mixture of two or more antigens, reference to "an excipient" includes mixtures of two or more excipients, and the like.

A. Definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although a number of methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein.

In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.

The terms "PCVII protein/gene expression product," "PMWS protein/gene expression product" or a nucleotide sequence encoding the same, intend a protein, gene expression product, or a nucleotide sequence, respectively, which is derived from a novel PCVπ isolate, as described herein. The nucleotide sequences of several PCVII isolates are shown in FIGS. 4A-4B and the amino acid sequences corresponding to the six identified PCVII ORFs are shown in FIGS. 2A-2C. In particular, a "PCVII protein" is a polypeptide that is specific to PCVII, i.e. not encoded by a polynucleotide sequence in the PCVI genome. However, PCVII or PMWS proteins or gene expression products, or genes encoding the same, as defined herein are not limited to the depicted sequences. Further, as used herein, a nucleotide sequence "derived from" a PCVII genome or its complement refers to a sequence which retains the essential properties of the illustrated polynucleotide, representing a portion of the entire sequence from which it is derived, for the purpose intended. A specific, but nonlimiting, example of such derivation is represented by a sequence which encodes an identical or substantially identical amino acid sequence, but, because of codon degeneracy, utilizes different specific codons; another example is a sequence complementary to the viral DNA. A probe or oligonucleotide useful in diagnostic tests needs to retain the complementarity of the sequence shown but may be shorter than the entire sequence or may skip over portions of it. However, for use in manipulation or expression, nucleotide changes are often desirable to create or delete restriction sites, provide processing sites, or to alter the encoded amino acid sequence in ways which do not adversely affect functionality. The terms "nucleotide sequence" and "polynucleotide" refer both to ribonucleotide and a deoxyribonucleotide sequences and include both the genomic strand and its complementary sequence.

A sequence "derived from" the nucleotide sequence which comprises the genome of a PCVII isolate therefore refers to a sequence which is comprised of a sequence corresponding to a region of the genomic nucleotide sequence (or its complement), or a combination of regions of that sequence modified in ways known in the art to be consistent with its intended use. These sequences are, of course, not necessarily physically derived from the nucleotide sequence of the gene, but refer to polynucleotides generated in whatever manner which are based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. For example, regions from which typical DNA sequences can be "derived" include regions encoding specific epitopes. Similarly, a peptide "derived from" a PCVII ORF refers to an amino acid sequence substantially identical to that of these polypeptides or a portion thereof, having the same biological properties as that portion.

Furthermore, the derived protein or nucleotide sequences need not be physically derived from the genes described above, but may be generated in any manner, including for example, chemical synthesis, isolation (e.g., from a PCVII isolate) or by recombinant production, based on the information provided herein. Additionally, the term intends proteins having amino acid sequences substantially homologous (as defined below) to contiguous amino acid sequences encoded by the genes, which display immunological activity. Thus, the terms intend full-length, as well as immunogenic, truncated and partial sequences, and active analogs and precursor forms of the proteins. Also included in the term are nucleotide fragments of the particular gene that include at least about 8 contiguous base pairs, more preferably at least about 10-20 contiguous base pairs, and even at least about 25 to 50 or 75 or more contiguous base pairs of the gene. Such fragments are useful as probes, in diagnostic methods, and for the recombinant production of proteins, as discussed more fully below.

The terms also include proteins in neutral form or in the form of basic or acid addition salts depending on the mode of preparation. Such acid addition salts may involve free amino groups and basic salts may be formed with free carboxyls.

Pharmaceutically acceptable basic and acid addition salts are discussed further below. In addition, the proteins may be modified by combination with other biological materials such as lipids and saccharides, or by side chain modification, such as acetylation of amino groups, phosphorylation of hydroxyl side chains, oxidation of sulfhydryl groups, glycosylation of amino acid residues, as well as other modifications of the encoded primary sequence.

The term therefore intends deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein. In this regard, particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids. For example, amino acids are generally divided into four families: (1) acidic—aspartate and glutamate; (2) basic—lysine, arginine, histidine; (3) non-polar— alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar-- glycine, asparagine, glutamine, cystine, serine threonine, and tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. For example, it is reasonably predictable that an isolated replacement of leucine with isoleucine or valine, or vice versa; an aspartate with a glutamate or vice versa; a threonine with a serine or vice versa; or a similar conservative replacement of an amino acid with a structurally related amino acid, will not have a major effect on the biological activity. Proteins having substantially the same amino acid sequence as the reference molecule, but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein, are therefore within the definition of the reference polypeptide.

By "postweaning multisystemic wasting syndrome" or "PMWS" is meant a disease of vertebrate animals, in particular pigs, which is characterized clinically by progressive weight loss, tachypnea, dyspnea and jaundice. Consistent pathologic changes include lymphocytic to granulomatous interstitial pneumonia, lymphadenopathy, and, less frequently, lymphocytic to granulomatous hepatitis and nephritis. See, e.g., Clark, E. G. Proc. Am. Assoc. Swine Pract. 1997, 499-501; and Harding, J. Proc. Am. Assoc. Swine Pract. 1997, 503.

An "isolated" nucleic acid molecule is a nucleic acid molecule separate and discrete from the whole organism with which the molecule is found in nature; or a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences (as defined below) in association therewith.

The term "vaccine composition" intends any pharmaceutical composition containing an antigen, which composition can be used to prevent or treat a disease or condition in a subject. The term thus encompasses both subunit vaccines, as described below, as well as compositions containing whole killed, attenuated or inactivated microbes.

By "subunit vaccine composition" is meant a composition containing at least one immunogenic polypeptide, but not all antigens, derived from or homologous to an antigen from a pathogen of interest. Such a composition is substantially free of intact pathogen cells or particles, or the lysate of such cells or particles. Thus, a "subunit vaccine composition" is prepared from at least partially purified (preferably substantially purified) immunogenic polypeptides from the pathogen, or recombinant analogs thereof. A subunit vaccine composition can comprise the subunit antigen or antigens of interest substantially free of other antigens or polypeptides from the pathogen.

The compositions of the invention can include any pharmaceutically acceptable carrier known in the art.

An "epitope" or "antigenic determinant" is a region on the surface of an antigenic molecule that stimulates an immune response. The epitope is the site on the antigenic molecule to which antibodies specific for the epitope bind, or to which specific B cells and/or T cells respond. Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen. Epitopes preferably comprise at least 8 or 9 amino acids. Epitopes of 12, 13, 15, 18, 20 or 25 amino acids may also be identified. Methods of identifying epitopes are known in the art. Procedures such as generating overlapping peptide libraries, epitope mapping, Pepscan, electronically available bioinformatics tools, and X-ray crystallography can be used in the practice of the invention, without undue experimentation. See, e.g., Peters et al., Immunogenetics 2005, 57, 326-36; De Groot et al., Novartis Found Symp. 2003, 254, 57-72; Reijonen et al., Methods 2003, 29, 282-88; De Groot et al. Nat. Biotechnol. 1999, 17, 533-34; Hemmer et al. J. Pept. Res. 1998, 52(5), 338-45; Geysen et al. Southeast Asian J Trop Med Public Health 1990, 21, 523-33; Van der Zee et al. Eur. J. Immunol. 1989, 19, 43-47; Geysen et al., Proc. Natl Acad. Sci. USA 1985, 82, 178-82; Geysen et al., Proc. Natl Acad. Sci. USA 1984, 81, 3998-4002. Other documents cited and incorporated herein may also be consulted for methods for determining epitopes of an immunogen or antigen and thus nucleic acid molecules that encode such epitopes.

An "immunological response" to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to the composition or vaccine of interest. Usually, an "immunological response" includes but is not limited to one or more of the following effects: the production of antibodies, B cells, helper T cells, suppressor-T cells, and/or cytotoxic T cells and / or γδ T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will display either a therapeutic or protective immunological response such that resistance to new infection will be enhanced and / or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction or lack of symptoms normally displayed by an infected host, a quicker recovery time and/or a lowered viral titer in the infected host.

The terms "immunogenic" protein or polypeptide refer to an amino acid sequence which elicits an immunological response as described above. An "immunogenic" protein or polypeptide, as used herein, includes the full-length sequence of the protein, analogs thereof, or immunogenic fragments thereof. By "immunogenic fragment" is meant a fragment of a protein which includes one or more epitopes and thus elicits the immunological response described above. Such fragments can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996) Humana Press, Totowa, NJ. For example, linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described in, e.g., U.S. Pat. No. 4,708,871; Geysen et al. Proc. Natl. Acad. Sci. USA 1984, 81, 3998-4002; Geysen et al. Molec. Immunol. 1986, 23, 709-715, all incorporated herein by reference in their entireties. Similarly, conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., X-ray crystallography and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols, supra.

Synthetic antigens are also included within the definition, for example, polyepitopes, flanking epitopes, and other recombinant or synthetically derived antigens. See, e.g., Bergmann et al. Eur. J. Immunol. 1993, 23, 2777-2781; Bergmann et al. J. Immunol. 1996, 157, 3242-3249; Suhrbier, A. Immunol, and Cell Biol. 1997, 75, 402- 408; Gardner et al. 12th World AIDS Conference, Geneva, Switzerland, Jun. 28- JuI. 3, 1998. Immunogenic fragments, for purposes of the present invention, will usually include at least about 3 amino acids, preferably at least about 5 amino acids, more preferably at least about 10-15 amino acids, and most preferably 25 or more amino acids, of the molecule. There is no critical upper limit to the length of the fragment, which could comprise nearly the full-length of the protein sequence, or even a fusion protein comprising two or more epitopes of the protein.

Any of the above immunogenic proteins, immunogenic polypeptides, synthetic antigens, or immunogenic fragments can be used to raise antibodies in a host.

"Native" proteins or polypeptides refer to proteins or polypeptides isolated from the source in which the proteins naturally occur. "Recombinant" polypeptides refer to polypeptides produced by recombinant DNA techniques; i.e., produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide. "Synthetic" polypeptides are those prepared by chemical synthesis.

A "vector" is an agent such as a virus plasmid, phage, or cosmid, used to transmit genetic material to a cell or organism. Vectors are useful for the in vitro or in vivo expression of polypeptides. Vectors can also transmit genetic material having an inhibitory effect on protein expression such as RNAi.

A "coding sequence" or a "nucleotide sequence encoding" a particular protein, or an "open reading frame" or "ORF" is a polynucleotide sequence which can be transcribed and/or translated into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory elements. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, procaryotic sequences, cDNA from eucaryotic mRNA, genomic sequences from eucaryotic (e.g., mammalian) DNA or RNA, and synthetic sequences. A transcription termination sequence will usually be located 3' to the coding sequence.

DNA "control elements" refers collectively to promoters, ribosome binding sites, polyadenylation signals, transcription termination sequences, upstream regulatory domains, enhancers, and the like, which collectively provide for the transcription and translation of a coding sequence in a host cell. Not all of these control sequences need always be present in a recombinant vector so long as the desired gene is capable of being transcribed and translated.

"Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, control elements operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The control elements need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter and the coding sequence and the promoter can still be considered "operably linked" to the coding sequence.

A control element, such as a promoter, "directs the transcription" of a coding sequence in a cell when RNA polymerase will bind the promoter and transcribe the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.

A "host cell" is a cell which has been transformed, or is capable of transformation, by an exogenous nucleic acid molecule.

A cell has been "transformed" by exogenous DNA when such exogenous DNA has been introduced inside the cell membrane. Exogenous DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell, hi procaryotes and yeasts, for example, the exogenous DNA may be maintained on an episomal element, such as a plasmid. With respect to eucaryotic cells, a stably transformed cell is one in which the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eucaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.

"Homology" refers to the percent identity between two polynucleotide or two polypeptide moieties. Two sequences are "substantially homologous" to each other when the sequences exhibit at least about 80 %-85 %, preferably at least about 90 %, and most preferably at least about 95 %-98 % sequence identity over a defined length of the molecules. As used herein, substantially homologous also refers to sequences showing complete identity to the specified DNA or polypeptide sequence.

Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100. Readily available computer programs can be used to aid in the analysis, such as ALIGN, Dayhoff, M. O. in Atlas of Protein Sequence and Structure M. O. Dayhoff ed., 5 Suppl. 3, 353-358, National biomedical Research Foundation, Washington, D. C, which adapts the local homology algorithm of Smith and Waterman Advances in Appl. Math. 1981, 2, 482-489 for peptide analysis. Programs for determining nucleotide sequence identity are available in the Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, Wis.) for example, the BESTFIT, FASTA and GAP programs, which also rely on the Smith and Waterman algorithm. These programs are readily utilized with the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package referred to above.

Alternatively, homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.

Two nucleic acid fragments are considered to be "selectively hybridizable" to a PCVπ polynucleotide, if they are capable of specifically hybridizing to a PCVII nucleic acid or a variant thereof (e.g., a probe that hybridizes to a PCVII nucleic acid but not to polynucleotides from other members of the circo virus family) or specifically priming a polymerase chain reaction: (i) under typical hybridization and wash conditions, as described, for example, in Sambrook et al., supra and Nucleic Acid Hybridization, supra, (ii) using reduced stringency wash conditions that allow at most about 25-30 % basepair mismatches, for example: 2x SSC, 0.1 % SDS, room temperature twice, 30 minutes each; then 2x SSC, 0.1 % SDS, 37°C once, 30 minutes; then 2x SSC room temperature twice, 10 minutes each, or (iii) selecting primers for use in typical polymerase chain reactions (PCR) under standard conditions (described for example, in Saiki, et al. Science 1988, 239, 487-491), which result in specific amplification of sequences of PCVII or its variants. The term "functionally equivalent" intends that the amino acid sequence of a protein is one that will elicit a substantially equivalent or enhanced immunological response, as defined above, as compared to the response elicited by a reference amino acid sequence, or an immunogenic portion thereof.

A "heterologous" region of a DNA construct is an identifiable segment of DNA within or attached to another DNA molecule that is not found in association with the other molecule in nature. Thus, when the heterologous region encodes a viral gene, the gene will usually be flanked by DNA that does not flank the viral gene in the genome of the source virus. Another example of the heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene). Allelic variation or naturally occurring mutational events do not give rise to a heterologous region of DNA, as used herein.

The term "treatment" as used herein refers to either (i) the prevention of infection or reinfection (prophylaxis), or (ii) the reduction or elimination of symptoms of the disease of interest (therapy). As used herein, a "biological sample" refers to a sample of tissue or fluid isolated from a subject, including but not limited to, for example, blood, plasma, serum, fecal matter, urine, bone marrow, bile, spinal fluid, lymph tissue and lymph fluid, samples of the skin, external secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies and also samples of in vitro cell culture constituents including but not limited to conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components. As used herein, the terms "label" and "detectable label" refer to a molecule capable of detection, including, but not limited to, radioactive isotopes, fluorescers, chemiluminescers, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, chromophores, dyes, metal ions, metal sols, ligands (e.g., biotin or haptens) and the like. The term "fluorescer" refers to a substance or a portion thereof which is capable of exhibiting fluorescence in the detectable range. Particular examples of labels which may be used under the invention include fluorescein, rhodamine, dansyl, umbelliferone, Texas red, luminol, NADPH and α-β-galactosidase.

By "vertebrate subject" is meant any member of the subphylum cordata, including, without limitation, mammals such as cattle, sheep, pigs, goats, horses, and man; domestic animals such as dogs and cats; and birds, including domestic, wild and game birds such as cocks and hens including chickens, turkeys and other gallinaceous birds. The term does not denote a particular age. Thus, adult and newborn animals, as well as fetuses, are intended to be covered.

The term "plant host" refers to any cell or parts thereof, such as the nucleus or plastids (chloroplasts, chromoplasts, etc), which are derived from a member of the kingdom plantae, and in particular, an embryophyte. The cell can derive from any part of a plant, including but not limited to roots, stem/trunk, flower, leaves, fruit, and the like. The plant can be at any stage of development, from a seedling to a fully matured plant. . B. General Methods Relevant to the present invention is circovirus PCVII, isolated from PMWS- affected pigs. The useful materials and processes of the present invention are made possible by the discovery of a family of nucleotide sequences, each containing an entire genome of a PCVII virus. The availability of this family of polynucleotides, first, permits the isolation of other members of the genome family which differ by small heterogeneities. Second, it permits the construction of DNA fragments and proteins useful in diagnosis. For example, oligomers of at least about 8-10 nucleotides or more, preferably, oligomers comprising at least about 15-20 nucleotides, are useful as hybridization probes in disease diagnosis. Such probes may be used to detect the presence of the viral genome in, for example, sera of subjects suspected of harboring the virus. Similarly, the genes encoding the proteins can be cloned and used to design probes to detect and isolate homologous genes in other viral isolates.

The PCVII sequences also allow the design and production of PCVII-specific polypeptides which are useful as diagnostic reagents for the presence of antibodies raised against PCVII in serum or blood. Antibodies against these polypeptides are also useful as diagnostics. Because several open reading frames can be deciphered in the context of the complete genome, the primary structures of PCVII-related proteins can be deduced. Finally, knowledge of the gene sequences also enables the design and production of vaccines effective against PCVII and hence useful for the prevention of PMWS and also for the production of protective antibodies.

Sequencing information available from the genome allows the amino acid sequence of the various polypeptides encoded by the viral genome to be deduced and suitable epitopes identified. The full-length proteins encoded by the several ORFs identified in the PCVII genome, or suitable portions thereof, can be produced using fragments of the relevant DNA which are obtained and expressed independently, thus providing desired polypeptides using recombinant techniques. Epitopes may be produced linked to a protein conferring immunogenicity. The proteins thus produced may themselves be used as vaccines, or may be used to induce immunocompetent B cells in hosts, which B cells can then be used to produce hybridomas that secrete antibodies useful in passive immunotherapy.

The sequences shown in Table 3, portions thereof, or sequences having all of the identifying characteristics of the sequences shown in Table 3, or portions thereof, are suitable for use in the invention.

The main cellular targets for PCVII are mononuclear cells in the peripheral blood, likely macrophage cells, although the virus is also found in various tissues and organs in infected animals. The affected macrophages lose their normal function, causing damage to the host immune system, leading to death. The cloning and sequencing of the circo viruses has provided information about the causative agent of PMWS. As explained above, the sequencing information, as well as the clones and its gene products, are useful for diagnosis and in vaccine development. In particular, PCR and antibody-based diagnostic methods are useful in the diagnosis of the disease and were used herein to specifically identify and differentiate this novel PCVπ virus from PCVI derived from persistently infected PKl 5 cells. The sequencing information is also useful in the design of specific primers, to express viral-specific gene products, to study the viral structure, to generate specific antibodies and to identify virulent genes in porcine circovirus-related diseases. B.I. Preparation of the PCVII Gene Sequence The new viral genomes of PCVII were obtained from viruses isolated from tissue of PMWS-affected pigs. Viral DNA was extracted from variable sources, including pellets of infected Dulac and Vero cells, peripheral blood buffy-coat cells, tissues from infected animals and serum. DNA was extracted from the samples using techniques discussed more fully in the examples. By comparing the sequence and structural similarity among the known viruses in the circovirus family, a unique primer was designed taking advantage of the complementary sequences of a conserved stem loop structure. One-primer PCR was then performed and the products cloned. Two full-length viral genomes in different orientations inserted into a plasmid vector were completely sequenced in both directions. Additional PCR products were made and sequenced to ensure the fidelity of the primer/stem loop region.

Using similar primers, other PCVII isolates, including PCVII 9741, and PCVII B9, were obtained. . The description of the method to retrieve the PCVII genome is, of course, mostly of historical interest. The resultant sequence is provided herein, and the entire sequence, or any portion thereof, could also be prepared using synthetic methods, or by a combination of synthetic methods with retrieval of partial sequences using methods similar to those here described. B.2. Deposits of Isolates Useful in Practicing the Invention

A deposit of biologically pure cultures of clone B9WTA, a clone including the full-length nucleic acid sequence of PCVII B9 as depicted in FIGS. 4A-4B, was made with the American Type Culture Collection, 10801 University Boulevard, Manassas, Va. on May 5, 1999 and assigned Accession No. PTA-24. Additional isolates were deposited under the Budapest Treaty at the ECACC (European Collection of Cell Cultures, Centre for Applied Microbiology & Research, Porton Down, Salisbury, Wiltshire SP4 OJG, United Kingdom) on Thursday Oct. 2, 1997 as accession Nos. V97100219 (called here Imp.1008); V97100218 (called here Imp.lOlO); V97100217 (called here Imp.999); and, on Friday Jan. 16, 1998: accession Nos. V98011608 (called here hnp.1011-48285); V98011609 (called here Imp. 1011-48121).

The deposits were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty). The organisms will be made available by the ATCC under the terms of the Budapest Treaty, which assures permanent and unrestricted availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 U.S. C. §122 and the Commissioner's rules pursuant thereto (including 37 C.F.R. §1.12 with particular reference to 886 OG 638). Upon the granting of a patent, all restrictions on the availability to the public of the deposited cultures will be irrevocably removed. These deposits are provided merely as convenience to those of skill in the art, and are not an admission that a deposit is required under 35 U.S. C. §112. The nucleic acid sequences of these genes, as well as the amino acid sequences of the molecules encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with the description herein.

B.3. Production of PCVII Proteins

The availability of PCVII genomic sequences permits construction of expression vectors encoding viral polypeptides and antigenically active regions thereof, derived from the PCVII genome. Analysis of the genome shows the presence of at least six open reading frames, at least one of which encodes the putative DNA replicase gene. Fragments encoding the desired proteins can be obtained from cDNA clones using conventional restriction digestion or by synthetic methods and are ligated into vectors. Any desired portion of the PCVII genome containing an open reading frame can be obtained as a recombinant protein, such as a mature or fusion protein, or can be provided by chemical synthesis or general recombinant means. The particular focus of the present invention is expression of PCVII proteins in plant hosts. The recombinant host may be a plant selected from the group consisting of, but not limited to, Nicotiana tabacum, Nicotiana bethamiana, Arabidopsis thaliana, Dichanthium annulatum, Lemnaceae, tomato, banana, turnip, black-eyed bean, soybean, oilseed rape, Ethiopian mustard, potato, rice, tobacco, wheat, and maize, lettuce, preferably Lemnaceae plants, tissue or callus and more preferably of the genus Lemna or Spirodela. The plant transformation can lead to insertion of the foreign gene either into the nuclear genome or into the plastid, e.g. chloroplast, amyloplast, chromoplast, proplastid, genome.

It is readily apparent that PCVII proteins encoded by the above-described DNA sequences, and chimeric proteins derived from the same, can be produced by a variety of methods. Recombinant products can take the form of partial protein sequences, full- length sequences, precursor forms that include signal sequences, mature forms without signals, or even fusion proteins (e.g., with an appropriate leader for the recombinant host, or with another subunit antigen sequence for another pathogen). Gene libraries can be constructed and the resulting clones used to transform an appropriate host cell. Colonies can be pooled and screened using polyclonal serum or monoclonal antibodies to the PCVII protein.

Alternatively, once the amino acid sequences are determined, oligonucleotide probes which contain the codons for a portion of the determined amino acid sequences can be prepared and used to screen genomic or cDNA libraries for genes encoding the subject proteins. The basic strategies for preparing oligonucleotide probes and DNA libraries, as well as their screening by nucleic acid hybridization, are well known to those of ordinary skill in the art. See, e.g., DNA Cloning: Vol. I, supra; Nucleic Acid Hybridization, supra; Oligonucleotide Synthesis, supra; Sambrook et al., supra. Once a clone from the screened library has been identified by positive hybridization, it can be confirmed by restriction enzyme analysis and DNA sequencing that the particular library insert contains a PCVII protein gene or a homolog thereof. The genes can then be further isolated using standard techniques and, if desired, PCR approaches or restriction enzymes employed to delete portions of the full-length sequence.

Similarly, genes can be isolated directly from viruses using known techniques, such as phenol extraction and the sequence further manipulated to produce any desired alterations. See, e.g., the examples herein and Hamel et al. J. Virol. 1998, 72, 5262-5267, for a description of techniques used to obtain and isolate viral DNA. Alternatively, DNA sequences can be prepared synthetically rather than cloned.

The DNA sequences can be designed with the appropriate codons for the particular amino acid sequence if the sequences are to be used in protein production. In general, one will select preferred codons for the intended host if the sequence will be used for expression. The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g., Edge Nature 1981, 292, 756; Nambair et al. Science 1984, 223, 1299; Jay et al. J. Biol. Chem. 1984, 259, 6311.

The codons can be modified in order to improve compatibility between the DNA sequence and the intended host, e.g., sequence encoding animal proteins to be modified to plant codon usage, such as Monocotyledon codon usage, for transformation of plant cells. In addition, codon optimization can also be used to enhance protein expression by increasing the translational efficiency of the sequence, e.g., removal of codons that are rarely used in the desired host or contain expression-limiting regulatory elements. Codon optimization strategies can include modification of translation initiation regions, alteration of mRNA structural elements and use of different codon biases. See, e.g., Gustafsson et al. Trends Biotechnol. 2004, 22, 346.

The DNA sequences can also be modified to feature mutations. For example, mutations can change the cellular compartment target of the expressed protein. The cellular target of ORF2 can be changed from the nucleus to the cytosol due to the presence of 6 mutations in the nuclear localization sequence.

Once coding sequences for the desired proteins have been prepared or isolated, they can be cloned into any suitable vector or replicon. Numerous cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice. Examples of recombinant DNA vectors for use in plants include pAUX, pSAT, pBIN, and pCAMBIA. See, e.g., Chung et al. Trends Plant Sci. 2005, 10, 357. Plant viral vectors that can infect plant cells and replicate to very high copy numbers include cowpea mosaic virus, tobacco mosaic virus, tomato bushy stunt virus, plum pox virus, potato virus X, and alfalfa mosaic virus. See, e.g., Canizares et al. Immunol. Cell Biol. 2005, 83, 263.

The gene can be placed under the control of a promoter and, optionally, an operator (collectively referred to herein as "control" elements), so that the DNA sequence encoding the desired protein is transcribed into RNA in the host cell transformed by a vector containing this expression construction. For transformation of plant cells, the promoter can be a promoter from a plant virus, such as the cauliflower mosaic virus, or preferably the 35S promoter from the Cauliflower Mosaic Virus (R. Fraley et al. WO 84/02913; P. Sanders et al. Nucleic Acid Res. 1987, 15, 1543-1558) but also the 16S ribosomal promoter (Prrn) (E. Sun et al. MoI. Cell. Biol. 1989, 9, 5650-5659; R. Keus et al. Nucleic Acids Res. 1983, 11, 6565-6474; N. Tohdoh et al. Nucleic Acids Res. 1981, 9, 5399-5406; H. Daniell et al. Proc. Natl. Acad. Sci. USA 1990, 87, 88-92), the plastid operon promoter PpsaA or PpsaB (M. Chen et al. Plant Cell Physiol. 1983, 34, 577-584), the psbA gene promoter (W. Gruissem et al. EMBO 1985, 4, 3375-3383); maize ubiquitin 1 promoter (A. Christensen et al. Transgenic Res. 1996, 5, 213-218); synthetic promoter (M. Ni et al. Plant J. 1995, 7, 661-676) or RhbP carboxylase small subunit promoter (J. Silverthorne et al. Plant MoI. Biol. 1990, 15, 49-58). The coding sequence may or may not contain a signal peptide (N. Pogrebnyak et al. Proc. Natl. Acad. Sci. USA 2005, 102, 9062-9067; P. Sijmons et al Biotechnol. 1990, 8, 217-221; E. Tackaberry et al. Genome 2003, 46, 521-526) or leader sequence, e.g. the Tobacco Mosaic Virus 5'leader sequence Ω (D. Gallie Nucleic Acid Res. 2002, 30, 3401-3411; Proc. Acad. Natl. Sci. USA 1989, 86, 129-132); atpB leader (H. Kuroda et al. Plant Physiol. 2001, 125, 430-436); Tobacco Etch Virus leader (R. Allison et al. Virology 1986, 154, 9-20; J. Dong et al Virology 2005, 339, 153-163); maize alcohol deshydrogenase 1 leader (V. Bourdon et al. EMBO Reports 2001, 21, 394-398). In addition, a terminator can also be included in the construction of the vector. This terminator or untranslated polyadenylation signal, for example, can be the nopaline synthase terminator, octopine synthetase terminator, 16S ribosomal terminator, psbA terminator, ubiquitin terminator and Cauliflower Mosaic virus polyadenylation sequence (F. Guerineau et al. MoI. Genet. 1991, 226, 141-144; B. Mogen et al. Plant Cell 1990, 2, 1261 - 1272).

The vector for transformation may include an expression cassette encoding a selectable marker polypeptide conferring antibiotic resistance, as well as resistance to herbicidal compounds, e.g. neomycin phosphotransferase II (P. Sanders et al. Nucleic Acid Res. 1987, 15, 1543-1558); hygromycin phosphotransferase (Y. Shimizu et al. MoI. Cell Biol. 1986, 6, 1074-1087), gene conferring resistance to glufosinate (J. Leemans et al. WO 87/05629)

Other regulatory sequences may also be desirable which allow for regulation of expression of the protein sequences relative to the growth of the host cell. Regulatory sequences are known to those of skill in the art, and examples include those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Other types of regulatory elements may also be present in the vector, for example, enhancer sequences.

The control sequences and other regulatory sequences may be ligated to the coding sequence prior to insertion into a vector, such as the cloning vectors described above. Alternatively, the coding sequence can be cloned directly into an expression vector which already contains the control sequences and an appropriate restriction site.

In some cases it may be necessary to modify the coding sequence so that it may be attached to the control sequences with the appropriate orientation; i.e., to maintain the proper reading frame. It may also be desirable to produce mutants or analogs of the desired PCVII protein. Mutants or analogs may be prepared by the deletion of a portion of the sequence encoding the protein, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence. Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are described in, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra. The expression vector is then used to transform an appropriate host cell using various methods. For example, stable transformation can transform cells, involving either an indirect method, which can involve a natural plant pathogen such as Agrobacterium twnefaciens (A. Stomp et al. WO 99/07210), or a direct method, which can involve "biolistic" or microprojectile bombardment. See, e.g., P. Zambryski Annu. Rev. Genet. 1988, 22,1-30; J. Sanford et al. Methods Enzymol 1993, 217, 483-509; T. Klein et al. Proc. Natl. Acad. Sci. USA 1988, 85, 8502-8505; A. Stomp et al. WO 99/07210. Alternatively, plant cells can be transformed through stable chloroplast transformation (see, e.g., Svab et al. Proc. Natl. Acad. Sci.USA 1993, 90, 913-917; Z. Svab et al. Proc. Natl. Acad. Sci. USA 1990, 87, 8526-8530), electroporation (M. Fromm et al. Proc. Natl. Acad. Sci. USA 1985, 82, 5824-5828; D. Mattanovich et al. Nucleic Acid Res. 1989, 17, 6747; W. Shen et al. Nucleic Acid Res. 1989, 17, 8385; M. Mersereau et al. Gene 1990, 90, 149-151), or microinjection (J. Neuhaus et al. Theor. Appl. Genet. 1987, 74, 30-36). If the expression vector is a viral vector, then the plant cells can be transformed by inoculation with in vitro transcribed RNA, by Agrobacterium-mediated infection, or by direct injection. See, e.g., T. Turpen et al. J. Virol. Methods 1993 42:227-239; G. An et al. EMBO J. 1985, 4, 277-284; G. An Plant Physiol. 1985, 79, 568-570; M. Hayford et al. Plant Physiol. 1988, 86, 1216-1222D. Valverkens et al. Proc. Natl. Acad. Sci. USA 1988, 85, 5536-5540; R. Offringa et al. EMBO J. 1990, 9, 3077-3084. For chloroplast transformation see, e.g. M. De Block et al. EMBO J. 1985, 4, 1367-1372; K. Venkateswarlu et al. Biotechnology 1991, 9, 1103-1105.

According to the invention Agrobacteήum, e.g. A. tumefasciens, is engineered so as to contain the DNA to be inserted into the target plant. The whole plant or the plant cell tissue or callus are then put in contact with Agrobacterium cells and incubated together. The plant tissue are selected for those containing the foreign DNA by testing for phenotypic expression of the marker gene

Depending on the expression system, the plant cells selected for transformation can be from varying types of plant materials such as seeds, leaves, fruits, vegetable, and calli. The type of plant can include, but is not limited to, Nicotiana tabacum, Nicotiana bethamiana, Arabidopsis thaliana, Lemnaceae, Dichanthium annulatum, tomato, banana, turnip, black-eyed bean, soybean, oilseed rape, Ethiopian mustard, potato, rice, lettuce, wheat, and maize, preferably Lemnaceae plants including Lemna or Spirodela. Methods to transform Lemna plants are described in K. Cox et al. WO 2005/005643 ; D. Spencer et al. WO 2005/078109 and methods to transform Spirodela plants are described in M. Edelman et al. WO 99/19498.

Depending on the expression system and host selected, the proteins of the present invention may be produced by culturing host cells transformed by an expression vector described above under conditions whereby the protein of interest is expressed. The protein is then isolated from the host cells and purified. If the expression system secretes the protein into the growth media, the protein can be purified directly from the media. If the protein is not secreted, it is isolated from cell lysates. The selection of the appropriate growth conditions and recovery methods are within the skill of the art (see, for instance, Menkhaus et al. Biotechnol Prog 20: 1001-1014, 2004; Balasubramaniam et al. J Chromat A 2003, 989, 119-129; Tuboly et al.. Vaccine 2000, 18, 2023-2028; Zhong et al. J Agric Food Chem 2006, 54, 8086-8092; Streatfield et al. Int J Parsitol 2003, 33, 479- 493; Walmsley et al. Curr Opin Biotechnol 2003, 14, 124-150; Johnson Nat Biotechnol 1996, 14, 1532-1533; Blaszczyk et al. Plant Sci 2002, 162, 589-597; Desai et al. Prot Expression Purif 2002, 25, 195-202; Aguilera et al. hi Microstructural Principles of Food Processing and Engineering, 2nd ed., Aspen Publishers: Gaithersburg, MD, 325-372, 1999; Bay et al. Biotechnol Prog 2001, 17, 168-174; Witcher et al. MoI Breed 1998, 4, 301-312; Jervis et al. J Biotechnol 1989, 11, 161-198; Austin et al. Ann NY Acad Sci 1994, 721, 234-244; Bai et al. Biotechnol Bioeng 2003, 81, 855-864; Menkhaus et al. Biotechnol Bioeng 2004, 87, 324-336). For plants specifically, the proteins may be produced by generation or regeneration of the plant. The method of plant regeneration may depend on the starting plant tissue and the plant species that is being regenerated. Plants can be regenerated from, for example, callus tissue, leaves, and protoplasts.

The plant material containing the protein can be processed, extracted, and purified. The potential operations regarding the processing of the plant material can include, but are not limited to, cleaning, conditioning, flaking/dry milling, oil extraction, and storage in various states. The potential operations regarding protein extraction can include, but is not limited to, solid/liquid extraction, wet milling, vacuum filtration, centrifugation, ultrafiltration, expanded bed adsorption, solids drying, and extract storage. The potential operations regarding protein purification can include, but is not limited to precipitation, aqueous two-phase extraction, adsorption, chromatography, diafiltration, expanded bed adsorption, freeze drying, and crystallization. The degree of protein processing, extraction, and purification can depend on the intended use of the protein. For instance, if the protein is to be used as a vaccine, the plant itself may be the final form administered. If the protein is to be used in pharmaceutical applications, the protein may be 95-98 % pure.

B.4. Preparation of Antigenic Polypeptides

The antigenic region of peptides is generally relatively small-_^typically 10 amino acids or less in length. Fragments of as few as 5 amino acids may typically characterize an antigenic region. Accordingly, using the genome of PCVII as a basis, DNAs encoding short segments of polypeptides, derived from any of the various ORFs of PCVII, such as ORFs 1-13, and particularly ORF2, can be expressed recombinantly either as fusion proteins or as isolated peptides. The fusion protein, when injected into suitable subjects, will result in the production of antisera which contain immunoglobulins specifically reactive against fusion proteins carrying the analogous portions of the sequence, and against appropriate determinants within whole PCVII.

B.5. Production of Antibodies Proteins encoded by the viruses of the present invention, or their fragments, can be used to produce antibodies, both polyclonal and monoclonal. If polyclonal antibodies are desired, a selected mammal, (e.g., mouse, rabbit, goat, horse, etc.) is immunized with an antigen of the present invention, or its fragment, or a mutated antigen. Serum from the immunized animal is collected and treated according to known procedures. See, e.g., Jurgens et al. J. Chrom. 1985, 348, 363-370. If serum containing polyclonal antibodies is used, the polyclonal antibodies can be purified by immunoaffinity chromatography, using known procedures.

Monoclonal antibodies to the proteins and to the fragments thereof, can also be readily produced by one skilled in the art. The general methodology for making monoclonal antibodies by using hybridoma technology is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e.g., M. Schreier et al., Hybridoma Techniques (1980); Hammerling et al., Monoclonal Antibodies and T-cell Hybridomas (1981); Kennett et al., Monoclonal Antibodies (1980); see also U.S. Pat. Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,452,570; 4,466,917; 4,472,500, 4,491,632; and 4,493,890. Panels of monoclonal antibodies produced against the desired protein, or fragment thereof, can be screened for various properties; i.e., for isotype, epitope, affinity, etc. Monoclonal antibodies are useful in purification, using immunoaffinity techniques, of the individual antigens which they are directed against. Both polyclonal and monoclonal antibodies can also be used for passive immunization or can be combined with subunit vaccine preparations to enhance the immune response. Polyclonal and monoclonal antibodies are also useful for diagnostic purposes.

B.6. Immunological Composition and Vaccine Formulations and Administration The novel viral proteins of the present invention can be formulated into immunological compositions or vaccines, either alone or in combination with other antigens, for use in immunizing subjects as described below. Methods of preparing such formulations are described in, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania, 18 Edition, 1990. Typically, the immunological compositions and vaccines of the present invention are prepared as injectables, either as liquid solutions or suspensions. The preparation may also be emulsified or the active ingredient encapsulated in liposome vehicles. The active immunogenic ingredient is generally mixed with a compatible pharmaceutical vehicle, such as, for example, water, saline, or the like,. In addition, if desired, the vehicle may contain minor amounts of auxiliary substances such as wetting or emulsifying agents and pH buffering agents.

Adjuvants which enhance the effectiveness of the immunological composition or vaccine may also be added to the formulation. Such adjuvants include, without limitation, aluminium hydroxide, aluminium phosphate, aluminium oxide, block copolymers such as Pluronic®, acrylic or methacrylic acid polymers, preferably carbomers such as Carbopol®, anhydride maleic and alkenyl copolymers such as EMA®, avidine and dimethyldioctadecyl ammonium bromide (DDA), monophosphoryl lipid A (MPL) (Imoto et al. Tet. Lett. 1985, 26, 1545-1548), trehalose dimycolate (TDM), adjuvants derived from the CpG family of molecules, CpG dinucleotides and synthetic oligonucleotides which comprise CpG motifs (see, e.g., Krieg et al. Nature 1995, 374, 546 and Davis et al. J. Immunol. 1998, 160, 870-876); and synthetic adjuvants such as PCPP (Poly di(carboxylatophenoxy)phosphazene) (Payne et al. 1998. Vaccines 1998, 16, 92-98), oil-emulsions such as water-in-oil, oil-in-water and water-in-oil-in-water emulsions, saponins, QuilA (U.S. Pat. No. 5,057,540), or particles generated from saponins such as ISCOMs (immunostimulating complexes), and their combinations, such as combinations of aluminum hydroxide and saponin.

The oil-emulsion may notably be an oil-in-water emulsion, in particular the emulsion SPT described p 147 "Vaccine Design, The Subunit and Adjuvant Approach" edited by M. Powell, M. Newman, Plenum Press 1995, and the emulsion MF59 described p 183 in the same book. The oil-in-water emulsion may in particular be based on light liquid paraffin oil (European Pharmacopeia type, e.g. of Drakeol®, Bayol F® or Marcol 52®); isoprenoid oil such as squalane, squalene; oil resulting from the oligomerization of alkenes, in particular of isobutene or of decene; esters of acids or alcohols containing a linear alkyl group, more particularly vegetable oils, ethyl oleate, propylene glycol di(caprylate/caprate), glyceryl tri(caprylate/caprate), propylene glycol dioleate; esters of branched fatty alcohols or acids, in particular esters of isostearic acid. The oil is used in combination with emulsifiers to form the emulsion. The emulsifiers are preferably nonionic surfactants, in particular the esters of sorbitan, mannide, glycerol, polyglycerol, propylene glycol and of oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, the polyoxypropylene-polyoxyethylene block copolymers, in particular the Pluronic® copolymers, especially L121.

Immunological composition and vaccine formulations will contain a "therapeutically effective amount" of the active ingredient, that is, an amount capable of eliciting an immune response in a subject to which the composition is administered. Such a response will be demonstrated by either a reduction or lack of symptoms normally displayed by an infected host and/or a quicker recovery time.

The exact amount is readily determined by one skilled in the art using standard tests. The protein concentration will typically range from about 10 μg to about 1 mg or even higher or lower if appropriate.

To induce an immunogenic response or immunize a subject, the immunological composition or vaccine is generally administered parenterally, usually by intramuscular injection. Other modes of administration, however, such as subcutaneous or intradermal injection, are also acceptable. The quantity to be administered depends on the animal to be treated, the capacity of the animal's immune system to synthesize antibodies, and the degree of protection desired. Effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response curves. The subject is immunized by administration of the vaccine in at least one dose, and preferably two doses. Moreover, the animal may be administered as many doses as is required to maintain a state of immunity to infection.

Additional immunological composition and vaccine formulations which are suitable for other modes of administration include oral formulations, and sustained release formulations Controlled or sustained release formulations are made by incorporating the protein into carriers or vehicles such as liposomes, nonresorbable impermeable polymers such as ethylenevinyl acetate copolymers and Hytrel® copolymers, swellable polymers such as hydrogels, or resorbable polymers such as collagen and certain polyacids or polyesters such as those used to make resorbable sutures. The proteins can also be delivered using implanted mini-pumps, well known in the art. B.7. Diagnostic Assays

As explained above, the proteins of the present invention may also be used as diagnostics to detect the presence of reactive antibodies of PCVII in a biological sample in order to determine the presence of PCVII infection. For example, the presence of antibodies reactive with the proteins can be detected using standard electrophoretic and immunodiagnostic techniques, including immunoassays such as competition, direct reaction, or sandwich type assays. Such assays include, but are not limited to, Western blots; agglutination tests; enzyme-labeled and mediated immunoassays, such as ELISAs; biotin/avidin type assays; radioimmunoassays; immunoelectrophoresis; immunoprecipitation, etc. The reactions generally include revealing labels such as fluorescent, chemiluminescent, radioactive, enzymatic labels or dye molecules, or other methods for detecting the formation of a complex between the antigen and the antibody or antibodies reacted therewith.

The aforementioned assays generally involve separation of unbound antibody in a liquid phase from a solid phase support to which antigen-antibody complexes are bound. Solid supports which can be used in the practice of the invention include substrates such as nitrocellulose (e.g., in membrane or microtiter well form); polyvinylchloride (e.g., sheets or microtiter wells); polystyrene latex (e.g., beads or microtiter plates); polyvinylidine fluoride; diazotized paper; nylon membranes; activated beads, magnetically responsive beads, and the like.

Typically, a solid support is first reacted with a solid phase component (e.g., one or more PCVII proteins) under suitable binding conditions such that the component is sufficiently immobilized to the support.

After reacting the solid support with the solid phase component, any non- immobilized solid-phase components are removed from the support by washing, and the support-bound component is then contacted with a biological sample suspected of containing ligand moieties (e.g., antibodies toward the immobilized antigens) under suitable binding conditions. After washing to remove any non-bound ligand, a secondary binder moiety is added under suitable binding conditions, wherein the secondary binder is capable of associating selectively with the bound ligand. The presence of the secondary binder can then be detected using techniques well known in the art. More particularly, an ELISA method can be used, wherein the wells of a microtiter plate are coated with a desired protein. A biological sample containing or suspected of containing anti-protein immunoglobulin molecules is then added to the coated wells. After a period of incubation sufficient to allow antibody binding to the immobilized antigen, the plate(s) can be washed to remove unbound moieties and a detectably labeled secondary binding molecule added. The secondary binding molecule is allowed to react with any captured sample antibodies, the plate washed and the presence of the secondary binding molecule detected using methods well known in the art. Thus, in one particular embodiment, the presence of bound anti-antigen ligands from a biological sample can be readily detected using a secondary binder comprising an antibody directed against the antibody ligands. A number of anti-porcine immunoglobulin (Ig) molecules are known in the art which can be readily conjugated to a detectable enzyme label, such as horseradish peroxidase, alkaline phosphatase or urease, using methods known to those of skill in the art. An appropriate enzyme substrate is then used to generate a detectable signal, hi other related embodiments, competitive-type ELISA techniques can be practiced using methods known to those skilled in the art.

Assays can also be conducted in solution, such that the proteins and antibodies specific for those proteins form complexes under precipitating conditions. In one particular embodiment, proteins can be attached to a solid phase particle (e.g., an agarose bead or the like) using coupling techniques known in the art, such as by direct chemical or indirect coupling. The antigen-coated particle is then contacted under suitable binding conditions with a biological sample suspected of containing antibodies for the proteins. Cross-linking between bound antibodies causes the formation of particle-antigen-antibody complex aggregates which can be precipitated and separated from the sample using washing and/or centrifugation. The reaction mixture can be analyzed to determine the presence or absence of antibody-antigen complexes using any of a number of standard methods, such as those immunodiagnostic methods described above.

In yet a further embodiment, an immunoaffinity matrix can be provided, wherein a polyclonal population of antibodies from a biological sample suspected of containing antibodies to the protein of interest is immobilized to a substrate, hi this regard, an initial affinity purification of the sample can be carried out using immobilized antigens. The resultant sample preparation will thus only contain anti-PCVII moieties, avoiding potential nonspecific binding properties in the affinity support. A number of methods of immobilizing immunoglobulins (either intact or in specific fragments) at high yield and good retention of antigen binding activity are known in the art. Not being limited by any particular method, immobilized protein A or protein G can be used to immobilize immunoglobulins. Accordingly, once the immunoglobulin molecules have been immobilized to provide an immunoaffinity matrix, labeled proteins are contacted with the bound antibodies under suitable binding conditions. After any non-specifically bound antigen has been washed from the immunoaffinity support, the presence of bound antigen can be determined by assaying for label using methods known in the art. Additionally, antibodies raised to the proteins, rather than the proteins themselves, can be used in the above-described assays in order to detect the presence of antibodies to the proteins in a given sample. These assays are performed essentially as described above and are well known to those of skill in the art.

Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

EXAMPLES

Example 1 : Isolation and Characterization of PCV Isolates Cell Cultures

The Dulac cell line, a PCV-free PK 15 derivative, was obtained from Dr. John Ellis (University of Saskatchewan, Saskatoon, Saskatchewan). The Vero cell line was obtained from American Type Culture Collection (ATCC), Manassas, VA. These cells were cultured in media as suggested by the ATCC and incubated at 37°C with 5 % CO₂. Porcine Circoviruses

Isolate PCVII 412 was obtained from lymph nodes of a piglet challenged with the lymph node homogenate from PMWS-affected piglets. This challenged piglet had been diagnosed with PMWS. Isolate PCVII 9741 was isolated from the buffy-coat of peripheral blood from a PMWS-affected piglet of the same herd after the isolation of PCVII 412. Isolate PCVII B9 was isolated from an affected piglet in a United States swine herd with a PMWS clinical outbreak in the fall of 1997. Other isolates such as PCVπ 1008, PCVII IOIO, PCVπ 999, PCVII IOI 1-48285, and PCVII 1011-48121 were isolated from lung and lymph node tissues collected from piglets in France, Canada, and the United States. Culture of the Field Isolates (PCVII)

The isolate PCVII 412 was cultured and purified in a similar manner as PCVI, except Dulac cells were used. The isolate PCVII B9 was grown in heterogenic Vero cells transfected with self-ligated full-length PCR products from the United States PMWS outbreak. Therefore, the possibility of contamination from other pig pathogens was eliminated. The B9-transfected Vero cells were continuously passed and treated with 300 mM D-glucosamine. Viral DNA Isolation

Viral DNA was extracted from variable sources, including pellets of infected Dulac and Vero cells, peripheral blood buffy-coat cells, tissues from infected animals and serum. The tissue samples were treated with proteinase K and viral DNA was extracted using either phenol/chloroform or Qiagen tissue kit (Qiagen, Santa Clarita, CA). DNA from peripheral blood buffy coat cells of heparinized blood and serum was similarly collected using the Qiagen blood kit. Culture and Isolation of PCV from Tissue Samples

In an alternative method, PCV can also be cultured and isolated from tissue. Tissue samples were collected in France, Canada and the USA from lung and lymph nodes of piglets. These piglets exhibited clinical signs typical of the post- weaning multisystemic wasting syndrome. To facilitate the isolation of the viruses, tissue samples were frozen at -7O⁰C. immediately after autopsy. Viruses 1103 and 1021 were isolated respectively in Alberta, respectively Saskatoon, Canada, from abortive cases according to the method described in J. Ellis et al. Can. J. Vet. 1998, 39, 44-51.

For the viral isolation, suspensions containing about 15 % tissue sample were prepared in a minimum medium containing Earle's salts (EMEM, BioWhittaker UK Ltd., Wokingham, UK), penicillin (100 IU/ml) and streptomycin (100 μg/ml) (MEM-SA medium), by grinding tissues with sterile sand using a sterile mortar and pestle. This ground preparation was then taken up in MEM-SA, and then centrifuged at 3000g for 30 minutes at +4°C in order to harvest the supernatant.

Prior to the inoculation of the cell cultures, a volume of 100 μl of chloroform was added to 2 ml of each supernatant and mixed continuously for 10 minutes at room temperature. This mixture was then transferred to a microcentrifuge tube, centrifuged at 3000g for 10 minutes, and then the supernatant was harvested. This supernatant was then used as inoculum for the viral isolation experiments. All the viral isolation studies were carried out on PK 15 cell cultures, known to be uncontaminated with the porcine circovirus (PCV), pestiviruses, porcine adenoviruses and porcine parvoviruses (G. Allan et al., Vet. Microbiol. 1995, 44, 49-64).

The isolation of the porcine circo viruses was carried out according to the following technique: Monolayers of PK 15 cells were dissociated from confluent cultures by trypsinization with a trypsin-versene mixture and taken up in MEM-SA medium containing 15 % fetal calf serum not contaminated by pestivirus (MEM-G medium) in a final concentration of about 4 x 10⁵ cells per ml. aliquot fractions of 10 ml each of this cell suspension were then mixed with 2 ml aliquot fractions of the inoculate described above, and the final mixtures were aliquoted in 6 ml volumes in two Falcon flasks of 25 cm2. These cultures were then incubated at 37°C for 18 hours under an atmosphere containing 10 % CO2.

After incubation, the culture medium of the semi-confluent monolayers were treated with 300 mM D-glucosamine (Cat # G48175, Sigma- Aldrich Company Limited, Poole, UK) (I. Tischer et al., Arch. Virol. 1987, 96, 39-57), then incubation was continued for an additional period of 48-72 hours at +37°C. One of the two Falcons of each inoculum was then subjected to 3 successive freeze/thaw cycles. The PKl 5 cells of the remaining Falcon were treated with a trypsin-versene solution, resuspended in 20 ml of MEM-G medium, and then inoculated into 75 cm2 Falcons at a concentration of 4 10⁵ cells/ml. The freshly inoculated flasks were then "superinfected" by addition of 5 ml of the corresponding lysate obtained after the freeze/thaw cycles. Infection of Piglets

Piglets were derived from specific pathogen-free sows. At one day of age, each piglet received approximately one gram of lymph nodes collected from PMWS-affected piglets. The tissue homogenate was distributed equally between the oral and intraperitoneal routes. Ten piglets were used in each of the experimental groups and observed daily for 7 weeks. Two groups were challenged and 2 were uninfected controls. Two groups, one challenged and one control, were also treated with cyclosporin A (2 mg/kg) at Day 0 and Day 14. The piglets were fed canned milk (Carnation) and water (50:50) until they self-weaned to high nutrient density commercially prepared feed. PCR, cloning and sequencing of the field PCV isolates

A two-step approach was used for the initial cloning of isolate PCVII 412 viral genomic DNA. A primer that hybridized to the conserved loop stem sequences, Loop^" (Table 3), was designed to perform a single-primed PCR taking advantage of the complementary sequences and the circular nature of PCV genomic DNA. The PCR reaction for the single-primed PCR was a two-stage process. The first stage consisted of 5 cycles of denaturing at 94° C for 1 minute, annealing at 37°C for 30 seconds and extension at 72°C for 2 minutes. The second stage consisted of 25 cycles of a similar program except the annealing temperature was increased to 52°C. The PCR products were cloned into a TA cloning vector (Invitrogen, Carlsbad, CA.). Both strands of three different clones were sequenced to ensure sequence fidelity. Based on the sequences obtained, primer 1000-and RlF were designed in the noncoding region of the viral DNA sequences and used to clone the full-length viral genome. The sequences of all the primers used in this study are shown in Table 3 below. The sequences of the loop region were then obtained from the full-length clone. Sequences of isolates PCVII 9741 and PCVII B9 were obtained from purified PCR products. Automated DNA sequencing performed by Plant Biotechnology Institute of NRC, Canada was used with several internal primers. The sequences of isolates PCVII 412 (AF085695; SEQ ID NO: 1), PCVπ 9741 (AF086835; SEQ ID NO: 11) and PCVII B9 (AF086834 SEQ ID NO: 12) were deposited with the National Center for Biotechnology Information (NCBI).

Table 3: Sequences of Primers Used in the Studies

Sequence Analyses

The sequences of other circoviruses were obtained from NCBI. Various public domains were used for the sequence analysis, such as Biology workbench, Blast search, DNA/protein analysis tools, etc. The sequence alignments were generated using Clustal W program and phylogenetic trees were created by PAUP 3.1 program (David L. Swofford, Laboratory of Molecular Systematics, MRC534, MRC at Smithsonian Institution, Washington, D. C). Multiplex PCR

Two sets of primers were designed to identify the PCV group-specific sequences and isolate-specific sequences. The primer pair 1710+/850- is PCV-group specific and 1100+/1570- is the novel PCV strain-specific pair, which differentiates the novel PCV from the one derived from PKl 5 cells. The two sets of primers have similar annealing temperatures for the PCR reaction and were used together at 0.5 μM concentration in a standard hot start PCR reaction. Either Ampli Taq Gold (Perkin Elmer) or Plentinum Taq (Gibco) was used. Antiserum

Rabbit anti-PC VII 412 pooled serum was obtained from two rabbits injected with purified isolate PCVII 412 at 50 μg/dose in an oil-in- water emulsion. The injection was repeated 3 times at 21 -day intervals. Pig anti-PMWS serum was collected from convalescent pigs from PMWS affected herds. ELISA

Purified PCV was diluted in sodium carbonate buffer (0.05 M) pH 9.6 to a concentration of 0.5 μg per 100 μL and used to coat Immulon II plates (Dynatech Laboratories, Inc.). The plates were washed six times with TTBS (20 mM Tris-HCl, 500 mM NaCl, 0.05 % of Tween 20, pH 7.5) before serially diluted primary rabbit or pig antibody was added. After six washes with TTBS, alkaline phosphatase-conjugated secondary antibodies (1/5000 dilution), either anti-rabbit or anti-pig (Kirkegaard & Perry), were added. Plates were developed with 100 μL/well of p-Nitrophenyl Phosphate (PNPP, 3 g/L) in 1 M diethanolamine, 0.5 MgCl₂, pH 9.8 and the plates were read on an ELISA reader (BioRad) at 405/490 nm.

FACS Analysis of lymphocyte surface markers

Blood samples were collected from PMWS affected piglets in the field and negative control. The RBC was lysed and WBC was stained with anti-pig CD3, CD4 and CD8 monoclonal antibodies, and followed by fluorescence labeled anti-mouse secondary antibody. The specifically labeled cells were fixed with 2% formaldehyde and 5000 cells were counted using FACS system (Becton Dickinson).

Example 2: PMWS Reproduction Lymph nodes displayed the most apparent gross lesions, histopathological changes and circovirus infection was confirmed by immunostaining. Accordingly, the lymph nodes were used in the challenge experiments described above.

The challenge experiments, conducted as described in Example 1 were successful in producing PMWS in pigs. In particular, some piglets died of the infection and asymptomatically infected piglets developed PMWS-like microscopic lesions by the end of the trial.

In another challenge experiment, the starting material used was lung tissue of pig with chronic wasting and lymph node enlargement. These clinical signs are characteristic of PMWS. The tissue was combined with sterile 0.1 M phosphate-buffered saline (PBS) and homogenized by passage through a polytron mixer. The crude tissue homogenate was used to challenge pigs. In particular, a total of 40 piglets (approximately 1 day of age) were randomly (balanced by litter of birth, gender and body weight) assigned to "tissue challenge," "tissue challenge with Cyclosporin- A," "control," or "Cyclosporin-A" treatment groups. The cyclosporin treatment had no clinical or hematological effect on the treated pigs except that cyclosporin was detected in the blood of those pigs three hours after the drug was administered. Hence, groups were collapsed across cyclosporin treatment for analysis.

In general, postmortem signs of PMWS disease in the challenged pigs included enlarged lymph nodes and incomplete collapse of lung tissue. Postmortem signs of

PMWS disease were detected in significantly (p<0.01; two-tailed Fishers exact-test) more pigs in the group treated with tissue extract (7 pigs out of 9) than in the group treated with placebo (2 pigs out of 18). The average daily gain in the group treated by injection of tissue extract (212 g/d) was not substantially different from the group given the placebo (202 g/d).

Blood samples were obtained throughout the experiment and tissue samples were taken postmortem. The samples were tested for PCVII viral DNA by PCR that resulted in an 830 base pair product. Four of the pigs given the lung tissue extract had positive blood samples; whereas none of the pigs given placebo had PCVII DNA detected in their blood. PCVII was detected in one or more tissues from 7 of the 8 surviving pigs in the "virus challenge" treatment group whereas all tissues from pigs in the control group were negative for PCVII. Contingency table analysis showed a significant difference (pO.001; two-tailed Fishers exact-test). In another challenge experiment, lung tissue of pig with chronic wasting and lymph node enlargement was collected and tissue debris removed by centrifugation (8000 rpm for 30 minutes). The supernatant was applied to a cesium chloride step-gradient and centrifuged at 10O₅OOOg. Bands appeared between 41 % CsCl₂ (1.28 gm/ml) and 63 % (1.40 gm/ml). These bands were applied to a 30% CsCl₂ "foot" and centrifuged for 2 hours at 100,000 x g. The pellet was resuspended in 15 ml of sterile 0.1 M PBS.

A total of 20 weaned piglets (approximately three weeks of age) were randomly (balanced by litter of birth, gender and body weight) assigned to "control" or "virus challenge" treatment groups. Pigs were weaned on Day 0 at approximately three weeks of age. In general, clinical signs of PMWS disease included enlarged lymph nodes and wasting or poor growth. Enlarged lymph nodes were detected in significantly (p<0.02; two-tailed Fisher exact-test) more pigs in the group treated with virus (7 pigs) than in the group treated with placebo (1 pig). The average daily gain in the group treated by virus injection (580 gm/d) tended to be less than the group given the placebo (616 gm/d), but the difference was not significant (p-0.17; two-tailed paired t-Test). There was no difference between groups in the relative mass of internal organs (liver, lung, heart, spleen, kidneys).

Blood samples that were obtained throughout the experiment and tissue samples that were taken post-mortem were tested for PCVII viral DNA using the PCR techniques described above.

All blood samples including those taken just prior to euthanasia were negative for PCVII. PCVII was detected in one or more tissues for 8 of the 10 pigs in the "virus challenge" treatment group whereas all tested tissues from pigs in the control group were negative for PCVII. Contingency table analysis showed that this was a significant difference (pO.OOl ; two-tailed Fishers exact-test).

In conclusion, these experiments confirm that injection of weaned piglets with tissue extracts and gradient-purified viral material containing PCVII results in infection of multiple tissues. The infection persists for a duration of at least eight weeks.

Example 3: Isolation and Propagation of PCVII

To determine the presence of an infectious causative agent(s) for PMWS, various tissues from pig #412, an experimentally challenged piglet sacrificed 21 days postinfection, were used for viral isolation. After continued passage of lymph node samples from pig #412 in Dulac cells, virus accumulation or adaptation was observed. A unique pattern of cytopathic effect initially developed, followed by increasing virus titer, as determined by ELISA using the standard Berlin anti-PCV antibody, as described above.

The existence of circovirus in Dulac cells infected with isolate PCVII 412 was then detected by electron microscopic examination. After six passages, viral structure proteins could be detected consistently, using a western blot assay.

Example 4: Isolation, Cloning and Sequencing of PCVII Virus and Viral Genomic DNA

In order to explore genetic differences between the two strains of porcine circo viruses, viral DNA was extracted from infected Dulac cells. Considering the possible genetic unrelatedness between PCVI and PCVII, the approach was to design primer(s) from the most conserved region. Previous analysis of the PKl 5 PCV DNA sequences (Mankertz et al. J. Gen. Virol. 1997, 71, 2562-2566; Meehan et al. J. Gen. Virol. 1997, 78:221-227) revealed a stem loop structure in the origin of replication. A single primer, targeting the inverted repeat sequence of the stem loop region, Loop^" (see Example 1, Table 3), was designed because of the highly conserved nature of this important domain. The amplification of the PCVII 412 viral DNA by single primer PCR was successful. After cloning into a TA cloning vector, the viral genomic sequence was obtained by automated sequencing from several clones and both senses to ensure fidelity. The actual sequence of the stem loop or primer region was then obtained from a second full-length clone generated by primers of 1000- and RlF from the only non-coding region of the virus. The nucleotide sequence for PCV 412 is shown in the top line of FIGS. 2A- 2C. It is noted that discussion of any ORFs herein Example 5 is in view of the Wang ORF numbering system. Using similar primers, other PCVII isolates, including PCVII 9741 from the same herd as PCVII 412, and PCVII B9 from a PMWS outbreak in the United States, were obtained. These isolates were sequenced and compared to PCVII 412 and PCVI. See FIGS. 2A-2C for a comparison of PCVII 412 with PCVI and FIGS. 4A-4B for comparisons of the PCVII 412 sequence with the various PCV isolates. The results of a phylo genetic analysis using the PAUP 3.1 program suggested that the new PMWS isolates were closely related and in a different cluster with PCVI. These isolates were therefore termed "PCVII" isolates. The percent nucleotide sequence homologies among isolates of the novel porcine circovirus were more than 99 % identical. In contrast, comparison of these nucleotide sequences with the PKl 5 PCVI showed only 75.8 % overall nucleotide sequence homology. Comparative analysis of nucleotide sequences in different regions further revealed that the putative replication- associated protein gene of these two viruses share 81.4 % homology, while the nucleotide sequences of the other large ORF was only 67.6 % homologous. Furthermore, nucleotide insertions and deletions were found in three regions.

There are 13 base insertions in the new isolates between PCVI sequence 38-61 that flank the start codon for the putative 35.8 kd protein encoded by ORF 1. The area of PCVI 915-1033, containing 15 base indels, was at the ends and the joint region of the two largest ORFs (the other ORF was antisense) of the porcine circo viruses. The third region, covering PCVI sequence from 1529-1735 with 15 base indels, locates at the amino end of a putative 27.8 kd protein encoded by ORF 6. PCVI sequences were also compared with the available sequences of the rest of the members of Circoviridae. PCVI is more closely related to banana bunch top virus (BBTV), a plant virus, than to chicken anemia virus (CAV) and beak and feather disease virus (BFDV) (both of which are avian circoviruses). The gene map of isolate PCVII 412 is shown in FIG. 1. There are a total of six potential ORFs encoding proteins larger than 50 amino acid residues. A comparison between PCVII 412 and PK15 PCVI revealed homologies in four of the ORFs (Table 4). The function of the 35.8 kd, namely the putative DNA replicase protein, has been previously predicted (Meehan et al. J. Gen. Virol. 1997, 78, 221-227). Analysis of these proteins predicted that both of the 35.8 kd and the antisense 27.8 kd proteins are nuclear proteins. Nucleotide sequence analysis also indicated that the start codons for the two proteins are within 33 bases of the origin of replication, which could also be the promoter. In addition, both ORFs ended with legitimate stop codons and poly A tail signals. Since some of the predicted proteins (based on size) could be found in western blots, these findings suggest that porcine circoviral mRNA can be transcribed from both senses of the replicated forms. However, there is no coding sequence long enough to code for the common 31 kd protein and the additional 20 kd protein for the PCVII 412 isolate detected by western blot analysis. This suggests that post-translational cleavage and/or RNA splicing may be involved in the expression of some of the porcine circo virus proteins.

Table 4. Putative Amino Acid Sequence Comparison Between PKl 5 PCVI and PCVII 412

Example 5: Purification of PCVII Using Molecular Cloning Method

Dulac cells were infected with porcine retrovirus that is also found in many pig origin cell lines, hi addition, other porcine pathogens were also found inconsistently associated with PCVII in PMWS-affected piglets. Thus, to obtain pure PCVII cultures, genetically cloned PCVII DNA was transferred to the susceptible non-porcine origin Vero cells using liposomes. After two passages, amplified PCV antigens were detected in the cells. The PCVII was seen to replicate and accumulate in the nuclei and was released into cytoplasm and other cells during cell mitosis.

Example 6: Multiplex PCR in PCVII Identification and PMWS Diagnosis hi order to differentiate the two strains of porcine circo viruses, PCVI and PCVII, two sets of primers were designed based upon the comparative analysis of the viral DNA sequences. The PCV group-specific pair of 1710+/850, and PCVII 412 isolate-specific 1100+/1570-, were used in multiplex PCR for testing field samples. These primer sets were used with frozen tissues and buffy coat cells of peripheral blood. As judged by the multiplex PCR, using those primer sets, not only was PCVII infection identified in these samples but the genetic relatedness of the field samples was also determined. The presence of circovirus was later confirmed by electron microscopy.

The potency of this diagnostic method was further tested with another group of samples collected from a PMWS-affected herd (see FIG. 6). The PCVII DNA sequences could also be identified in almost all the tissues in PMWS-affected piglets (FIG. 7).

Example 7: Sequencing of a Genomic DNA (Double-Stranded Replicative Form) of the PCV Imp.999 Isolate

The nucleotide sequence of two EcoRI Imp.999 clones (clones pGEM-7/2 and pGEM-7/8) was determined according to Sanger's dideoxynucleotide technique using the sequencing kit "AmpliTaq DNA polymerase FS" (Cat # 402079 PE Applied Biosystems, Warrington, UK) and an Applied BioSystems AB 1373 A automatic sequencing apparatus according to the supplier's recommendations. The initial sequencing reactions were carried out with the M 13 "forward" and "reverse" universal primers. The following sequencing reactions were generated according to the "DNA walking" technique. The oligonucleotides necessary for these subsequent sequencings were synthesized by Life Technologies (Inchinnan Business Park, Paisley, UK). The sequences generated were assembled and analysed by means of the

MacDNASIS version 3.2 software (Cat # 22020101, Appligene, Durham, UK). The various open reading frames were analysed by means of the BLAST algorithm available on the "National Center for Biotechnology Information" (NCBI, Bethesda, Md., USA) server. The complete sequence (EcoRI-EcoRI fragment) obtained initially from the clone ρGEM-7/8 is presented as SEQ ID NO: 28. It starts arbitrarily after the G of the EcoRI site and exhibits a few uncertainties from the point of view of the nucleotides.

The sequencing was then optimized and the SEQ ID NO: 27 (FIG. 5) gives the total sequence of this isolate, which was made to start arbitrarily at the beginning of the EcoRI site, that is to say the G as the first nucleotide.

The procedure was carried out in a similar manner for obtaining the sequence of the other three isolates according to the invention (see SEQ ID NO: 24, 25 and 26 and FIGS. 5A-5D).

The sizes of the genomes of these four isolates are: Imp.lOl 1-48121 1767 nucleotides

Imp.lOl 1-48285 1767 nucleotides

Imρ.999 1768 nucleotides

Imp.1010 1768 nucleotides

Example 8: Analysis of the Sequence of the PCV Imp.999 Isolate

When the sequence generated from the Imp.999 isolate was used to test for homology with respect to the sequences contained in the GenBank databank, the only significant homology which was detected is a homology of about 76 % (at nucleic acid level) with the sequence of the PKl 5 strain (accession numbers Y09921 and U49186) (see FIGS. 5A-5D).

At the amino acid level, the test for homology in the translation of the sequences in the 6 phases with the databanks (BLAST X algorithm on the NCBI server) made it possible to demonstrate a 94 % homology with the open reading frame corresponding to the theoretical replicase of the BBTV virus similar to the circo viruses of plants (GenBank identification number 1841515) encoded by the GenBank U49186 sequence.

No other sequence contained in the databanks show significant homology with the sequence generated from the PCV Imp.999 isolate.

Analysis of the sequences obtained from the Imp.999 isolate cultured using lesions collected from Californian piglets having clinical signs of the multisystemic wasting syndrome shows clearly that this viral isolate is a new porcine circovirus strain.

Example 9: Comparative Analysis of the Sequences

The alignment of the nucleotide sequences of the 4 new PCV isolates was made with the sequence of the PCV PKl 5 strain (FIGS. 5A-5D). A homology matrix taking into account the four new isolates and the previous PKl 5 strain was established, as shown in Table 5:

Table 5: Homology Analysis the PCV-PKl 5 Strain and the new PCV Strains

*1: Imp.1011-48121; 2: Imp.1011-48285; 3: Imp.99; 4: Imp.lOlO; 5: PK15

The homology between the two French isolates Imp.1011-48121 and hup.1011- 48285 is greater than 99 % (0.9977).

The homology between the two North American isolates Imp.999 and Imp.lOlO is also greater than 99 % (0.9949). The homology between the French isolates and the North American isolates is slightly greater than 96 %.

The homology between all these isolates and PKl 5 falls at a value between 75 and 76 %.

It is deduced that the isolates according to the invention are representative of a new type of porcine circovirus, distinct from the type represented by the PK 15 strain. This new type, isolated from pigs exhibiting the PMWS syndrome, is called type II porcine circovirus, PKl 5 representing type I. The isolates belonging to this type II exhibit remarkable nucleotide sequence homogeneity, although they have in fact been isolated from very distant geographical regions.

Example 10: Analysis of the Proteins Encoded by the Genome of the PCV Strains

The nucleotide sequence of the Imp.1010 isolate was considered to be representative of the other circovirus isolates associated with the multi-systemic wasting syndrome. This sequence was analysed in greater detail with the aid of the BLASTX algorithm (Altschul et al. J. MoI. Biol. 1990, 215, 403-410) and of a combination of programs from the set of Mac Vector 6.0 software (Oxford Molecular Group, Oxford OX44GA, UK). In view of the Meehan ORF numbering system, it was possible to detect 13 open reading frames (or ORFs) of a size greater than 20 amino acids on this sequence (circular genome). These 13 ORFs are shown in Table 6.

Table 6: ORFs within the Circular Genome

Size of the ORF Size of Protein

Name Start End Strand (nucleotides) (amino acids)

ORFl 103 210 sense 108 nt 35 aa

ORF2 1180 1317 sense 138 nt 45 aa

ORF3 1363 1524 sense 162 nt 53 aa

ORF4 398 1342 sense 945 nt 314 aa

ORF5 900 1079 sense 180 nt 59 aa

ORF6 1254 1334 sense 81 nt 26 aa

ORF7 1018 704 antisense 315 nt 104 aa

ORF8 439 311 antisense 129 nt 42 aa

ORF9 190 101 antisense 90 nt 29 aa

ORFlO 912 733 antisense 180 nt 59 aa

ORFI l 645 565 antisense 81 nt 26 aa

ORF12 1100 1035 antisense 66 nt 21 aa

ORF13 314 1381 antisense 702 nt 213 aa

The positions of the start and end of each ORF refer to the sequence presented in FIG. 5A-5D (SEQ ID No. 24), of the genome of isolate 1010. The limits of ORFs 1 to 13 are identical for isolate 999. They are also identical for isolates 1011-48121 and 1011- 48285, except for the ORFs 3 and 13 (ORF3: 1432-1539, sense, 108 nt, 35aa; ORF13: 314-1377, antisense, 705 nt, 234 aa).

Among these 13 ORFs, four have a significant homology with analogous ORFs situated on the genome of the cloned virus PCV PKl 5. Each of the open reading frames present on the genome of all the circovirus isolates associated with the multisystemic wasting syndrome was analysed. These 4 ORFs are presented in Table 7.

Table 7: ORFs with Significant Homology with Analogous ORFs of PCV-PKl 5

*The positions of the start and end of each ORF refer to the sequence presented in FIG. 4 (SEQ ID No. 2). The size of the ORF (in nucleotides=nt) includes the stop codon.

The comparison between the genomic organization of the PCV Imp.1010 and PCV PKl 5 isolates allowed the identification of 4 ORFs preserved in the genome of the two viruses. Table 8 presents the degrees of homology observed:

Table 8: Homology of the Analogous ORFs of PCV Imp.1010 andPCVPK15

The greatest sequence identity was observed between ORF4 Imp.lOlO and ORFl PKl 5 (86 % homology). This was expected since this protein is probably involved in the replication of the viral DNA and is essential for the viral replication (Meehan et al. J. Gen. Virol. 1997, 78, 221-227; Mankertz et al. J. Gen. Virol. 1998, 79, 381-384). The sequence identity between ORF13 Imp.lOlO and 0RF2 PK15 is less strong (66.4% homology), but each of these two ORFs indeed exhibits a highly conserved N- terminal basic region which is identical to the N-terminal region of the major structural protein of the CAV avian circovirus (Meehan et al. Arch. Virol. 1992, 124, 301-319). Furthermore, large differences are observed between ORF7 Imp.lOlO and ORF3 PKl 5 and between ORFlO Imp.lOlO and ORF4 PKl 5. In each case, there is a deletion of the C-terminal region of the ORF7 and ORFlO of the Imp.lOlO isolate when they are compared with ORF3 and ORF4 of PCV PKl 5. The greatest sequence homology is observed at the level of the N-terminal regions of ORF7:ORF3 (61.5 % homology at the level of the overlap) and of ORF10:ORF4 (83 % homology at the level of the overlap).

It appears that the genomic organization of the porcine circovirus is quite complex as a consequence of the extreme compactness of its genome. The major structural protein is probably derived from splicing between several reading frames situated on the same strand of the porcine circovirus genome. It can therefore be considered that any open reading frame (ORFl to ORF 13) as described in the table above can represent all or part of an antigenic protein encoded by the type II porcine circovirus and is therefore potentially an antigen which can be used for specific diagnosis and/or for vaccination. The invention therefore relates to any protein comprising at least one of these ORFs. Preferably, the invention relates to a protein essentially consisting of ORF4, ORF7, ORFlO or ORF13.

Example 11: Infectious Character of the PCV Genome Cloned from the New Strain

The plasmid pGEM-7/8 containing the complete genome (replicative form) of the hup.999 isolate was transfected into PKl 5 cells according to the technique described by Meehan B. et al., (1992) Arch. Virol. 124: 301-319). Immunofluorescence analysis (see Example 4) carried out on the first passage after transfection on noncontaminated PKl 5 cells have shown that the plasmid of the clone pGEM7/8 was capable of inducing the production of infectious PCV virus. The availability of a clone containing an infectious PCV genetic material allows any useful manipulation on the viral genome in order to produce modified PCV viruses (either attenuated in pigs, or defective) which can be used for the production of attenuated or recombinant vaccines, or for the production of antigens for diagnostic kits.

Example 12: Construction of the Plant Transformation Vector inserted by ORF2 Optimization of the ORF2 Sequence

Two different constructions were used to produce porcine circovirus type II (PCVIT) polypeptide in Spirodela. The mature sequence of ORF2 (under the Meehan ORF numbering system) was either used straight (native) or after mutation of several amino acids located inside the identified nuclear localisation sequence (NLS) of the 0RF2 involved in the targeting of the peptide to the nucleus. Both nucleotide sequences have been optimized for expression in monocotyledonous plants. The 35S promoter of the cauliflower mosaic virus (p35S) was used to drive the expression of the transgene.

The native amino acid sequence of ORF2 (SEQ ID NO: 32) was reverse-translated into a nucleotide sequence using the monocotyledonous preferred codon usage. hi the second synthetic gene, six amino acids located inside the NLS of the ORF2 were mutated: ¹²R ¹³H ¹⁴R and ³⁹R ⁴⁰R ⁴¹K were changed to a SVN motif (SEQ ID NO: 33). The mutations made should decrease the possibility of targeting ORF2 to the nucleus. This synthetic sequence was also optimized using the monocotyledonous preferred codon usage.

Cloning of the Chimeric Genes into the Binary Vectors

A binary vector based upon either the pBIN backbone (pLG042) or the pCAMBIA backbone (pLG144) was used to transform duckweeds. Both binary vectors contained two expression cassettes, as shown in FIG. 8. The first cassette, pNOS-nptll- tNOS, confers kanamycin resistance to the plant. The second cassette features multiple cloning sites wherein the gene of interest was inserted between p35S and tNOS.

Specifically, the native or mutated coding sequence of ORF2 was inserted by ligation into pLG042 using the Xbal and Smal sites to give pLG152 and pLG153, respectively. Using the same restriction sites, the two fragments were also inserted into pLG144 to give pLG154 and pLG155, respectively. These four final constructs are presented in FIG 7.

The complete sequence of the T-DNA of pLG152, pLG153, pLG154, and pLG155 is shown by SEQ ID NO: 34-37, respectively.

Example 13: Production of Transgenic Spirodela

Calli cultivated for 3.5 months were transformed by Agrobacterium tumefaciens strains A152, A153, A154, A155, carrying respectively the binary vectors pLG152 to pLG155 described above. Following transformation, calli were regularly transferred onto selective regeneration medium containing kanamycin. When of a sufficient size, plants were transferred to liquid medium containing kanamycin. Non transgenic escaped bleach very quickly. The plants remaining green after several weeks on liquid selective medium were kept for further analyses.

Following transformation, plants started to regenerate two months later. Calli can continue to regenerate plants for four months after the transformation step. On the average 2% of the calli transformed gave transgenic plants.

Example 14: mRNA Expression of ORF2 in Transgenic Spirodela

The determination of the expression of the ORF2 gene (in view of the Meehan ORF numbering system) was done using either RT-PCR or Northern blot analyses. RT-PCR

Most of the analysis of the ORF2 mRNA expression was achieved using RT-PCR. Briefly, synthesis of first strand cDNA suitable for PCR amplification was done using the RevertAid™ Kit with the RevertAid™ M-MuLV (H-) reverse transcriptase according to the instructions of the manufacturer (Fermentas). RNA was extracted from Spirodela using the NucleoSPIN RNA Plant kit according to instructions of the manufacturer (Macherey Nagel). 5μg of total RNA was used in each experiment. In a second step, a PCR reaction was prepared using lμl of diluted RT samples and primers PCVII-F (SEQ ID NO: 38) and PCVII-R (SEQ ID NO: 39), which are specific to ORF2. In order to get semi-quantitative results, the number of cycles of the PCRs was adjusted for each gene to obtain barely visible bands in agarose gels. The constitutively expressed GAPDH gene was used as an internal control of RNA quantity. The mRNA of ORF2 was detected in the transgenic plant, indicating ORF2 expression, see FIG. 11. However, the amplification of the ORF2 mRNA by RT-PCR was unexpectedly difficult. Northern Analysis

RNA was extracted from Spirodela using the NucleoSPIN RNA Plant kit according to instructions of the manufacturer (Macherey Nagel). For RNA gel blots, 10 μg of RNA were denatured in a formamide/formaldehyde buffer and separated on 1 % (w/v) agarose gels. The RNA was then transferred in 1Ox SSC to Hybond N⁺ nylon membranes and hybridized overnight at 42°C according to the instructions of the manufacturer (Amersham). Three washes in 2x SSC and 0.1 % (w/v) SDS, 65⁰C, 10 min were performed.

Probes were made from PCR products obtained using the pLG152 plasmid as template and PCVII-F and PCVII-R2 as primers (length of the product: 645 bp). This probe, which could be used for any of the cassettes, was labelled with the Ready-to-go DNA labeling beads (Amersham).

An example of analysis performed using a few lines is shown in FIG.10. A moderate level of expression of ORF2 mRNA was detected.

Example 15: Protein Expression of ORF2 in Transgenic Spriodela

Production and identification of the ORF2 protein (in view of the Meehan ORF numbering system) was assessed using ELISA, Westerm blot analysis, and affinity chromatography. Protein Extraction Fresh duckweed fronds grown for two weeks on SH medium were harvested and blotted on filter paper. They were weighted (fresh weight, FW), frozen in liquid nitrogen, and then ground to a fine powder using a mortar and pestle. Fronds reduced to powder were suspended in 50 mM Tris-HCl pH 6.5, 100 mM NaCl, 1 mM EDTA, 1 mM PMSF, 0.1 % (v/v) Triton X-100 (2 μ\ buffer/mg FW). The resulting extracts (total soluble protein fraction) were vigorously mixed

(vortex) and incubated on ice for 10-15 min. The supernatant (raw extract) was collected after centrifugation at 4°C for 20 min at 18,000g.

Raw extracts were mixed 1 to 5 (v/v) with cold acetone and stored overnight at - 2O⁰C to allow precipitation to occur. Pellets were recovered after centrifugation at 4⁰C for 20 min at 18,000g and dried in a vacuum chamber.

Protein concentration in the pellets, suspended in 5 % SDS, was determined using the Lowry method with BSA (4-40 μg in 5 % SDS) as a standard. ORF2 Detection Using ELISA

Presence of ORF2 in total soluble proteins from transformed Spirodela oligorrhiza lines was determined by an antigen-capture ELISA. A 96-well plate (ImmunoMaxiSorb, Nunc) was coated with a 1:150 dilution of a capture antibody (ROO 19-051004) for (18 ± 2) h at 4°C.

In a preliminary screening step of the 174 transformed Spirodela oligorrhiza lines, total soluble proteins were diluted 1 to 10 with 1 % BSA in TBST and thus checked at a single concentration. In a second step done to quantify ORF2 in the most promising lines, total soluble proteins from transformed lines and reference antigen solution (R0021- 030506) were serially diluted 1 to 2 with 1 % BSA in TBST (dilution ranging from 1/2 to 1/4096). Some reference antigen solution (R0021 -030506) diluted with 1 % BSA in TBST or with total soluble proteins from a wild-type line was used as a positive control and to develop the titration curve. Samples thus obtained were added in duplicates to wells and incubated for three hours at 37°C.

An HRP-conjugated revelation antibody (1/130 dilution, R0020-040316) was added and incubated for lhr at 37°C. Between each step, plates were washed with a washing solution (SYNBIOTICS). The plates were developed using a colorimetric substrate for HRP (TMB supersensitive, SIGMA) according to the manufacturer's instruction.

The optical density measured in the extract from non-transgenic plants was set as the background in the first titer analysis. Extracts from transgenic plants were considered as positive if the absorbance at 450nm was 0.2 Optical Density above background. Then a ranking system based on grades of + to +++ was applied using the following scale:

► 0.2 < ΔOD < 0.8 +

► 0.8 < ΔOD < 1.4 ++ ► ΔOD > 1.4 +++

Results of the first titer analysis for the highest producing lines are presented in Figure 12.

Lines ranking a ΔOD above 1.4 underwent a second titer analysis using a different standard operating procedure (Merial Ltd.) to determine the OD50 titer. Titration curves were resolved using software.

Data from some of the transgenic lines, expressed as the absorbance versus LoglO (I/dilution), is presented in Figure 13, which shows that the reference behaves the same as this reference plus extract from wild-type Spirodela. Analyses on all the selected lines were done by using the same test. Lines which yielded positive results were kept for further analysis; these lines are shown in Table 9. Table 9: Antigen Titer ofORF2for Selected Transgenic Lines

ORF2 Identification Using Western Blot Technology

The Western blot analysis was performed on controls and extracts from transgenic lines that exhibited the highest titers. Total soluble proteins from duckweeds and controls were denatured and reduced with Laemmli sample buffer. Protein samples were resolved in a 12 % SDS gel and electroblotted (semi-dry method using the discontinuous three buffer system described in Kyhse- Anderson J Biophys.Biochem Methods 1984, 10, 203- 209) on to a PVDF membrane. Non-specific sites were blocked with Seablock Blocking buffer (Uptima), 5 % (w/v) skimmed milk in TBST, or 1 % BSA in TBST. The proteins were probed with mouse primary antibody (1/250 dilution, 1902B IBC) and HRP- conjugated anti-mouse IgG (1/5,000 dilution, Amersham) and detected with Amersham ECL reagents according to the manufacturer's instruction. The light emission was captured using X-Ray films. hi the analysis, ORF2 was identified in controls, but a band was not visible in the transgenic plant extracts, mainly due to the co-migration of endogenous proteins which gave a very high background (data not shown). ORF 2 purification using batch affinity chromatography

Mouse monoclonal antibody (1902B1BC) was immobilized to the protein G support from Seize® X Protein G immunoprecipitation kit (PIERCE) using the cross- linker DSS according to the manufacturer's instruction. Total soluble proteins (350 μg) from transformed Spirodela oligorrhiza line 115-12-4 were then incubated with the immobilized antibody to form the immune complex [ORF2-antibody]. The affinity support was washed and the remaining ORF2 antigen was dissociated from the support according to the manufacturer's instruction. Two elution fractions were collected, put to dryness using a Speed Vac, and redissolved in Laemmli sample buffer. Samples were applied onto the electrophoresis gel (12 % SDS-PAGE) which was further developed using silver staining.

Extract from transgenic line Tl 15-12-4 (with a measured OD50 titer of 1.83) was run on the affinity chromatography gel and yielded two elution fractions containing purified ORF2 as assessed by an electrophoretic band shortly below 30 kDa on a 12 % gel (FIG. 14). It can be concluded that the band shown, which is bound to the specific monoclonal antibody and which migrates at an apparent molecular weight corresponding to that of the ORF2 protein, is in fact the recombinant ORF2.

Various modifications and variations of the described methods and products of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.

SEQ ID NO : 1

Porcine circovirus PCVII 412 accagcgcacttcggcagcggcagcacctcggcagcacctcagcagcaacatgcccagca 60 agaagaatggaagaagcggaccccaaccacataaaaggtgggtgttcacgctgaataatc 120 cttccgaagacgagcgcaagaaaatacgggagctcccaatctccctatttgattatttta 180 ttgttggcgaggagggtaatgaggaaggacgaacacctcacctccaggggttcgctaatt 240 ttgtgaagaagcaaacttttaataaagtgaagtggtatttgggtgcccgctgccacatcg 300 agaaagccaaaggaactgatcagcagaataaagaatattgcagtaaagaaggcaacttac 360 ttattgaatgtggagctcctcgatctcaaggacaacggagtgacctgtctactgctgtga 420 gtaccttgttggagagcgggattctggtgaccgttgcaaagcagcaccctgtaacgtttg 480 tcaaaaatttccgcgggctggctgaacttttgaaagtgagcgggaaaatgcaaaagcgtg 540 attggaaaaccaatgtacacttcattgtggggccacctgggtgtggtaaaagcaaatggg 600 ctgctaattttgcaaacccggaaaccacatactggaaaccacctaaaaacaagtggtggg 660 atggttaccatggtgaaaaagtggttgttattgatgacttttatggctggctgccgtggg 720 atgatctactgagactgtgtgatcgatatccattgactgtaaaaactaaaggtggaactg 780 taccttttttggcccgcagtattctgattaccagcaatcagaccccgttggaatggtact 840 cctcaactgctgtcccagctgtagaagctctctatcggaggattacttccttggtatttt 900 ggaagaatgctacaaaacaatccacggaggaagggggccagttcgtcaccctttcccccc 960 catgccctgaatttccatatgaaataaattactgagtcttttttatcacttcgtaatggt 1020 ttttattatteatttagggttcaagtggggggtctttaagattaaattctctgaattgta 1080 catacatggttacacggatattgtagtcctggtcgtatttactgttttcgaacgcagtgc 1140 cgaggcctacgtggtccacatttccagaggtttgtagcctcagccaaagctgattccttt 1200 tgttatttggttggaagtaatcaatagtggagtcaagaacaggtttgggtgtgaagtaac 1260 gggagtggtaggagaagggttgggggattgtatggcgggaggagtagtttacatatgggt 1320 cataggttagggctgtggcctttgttacaaagttatcatctaaaataacagcagtggagc 1380 ccactcccctatcaccctgggtgatgggggagcaaggccagaattcaaccttaacctttc 1440 ttattctgtagtattcaaagggtatagagattttgttggtcccccctcccgggggaacaa 1500 agtcgtcaattttaaatctcatcatgtccaccgcccaggagggcgttgtgactgtggtac 1560 gcttgacagtatatccgaaggtgcgggagaggcgggtgttgaagatgccatttttccttc 1620 tccaacggtagcggtggcgggggtggacgagccaggggcggcggcggaggatctggccaa 1680 gatggctgcgggggcggtgtcttcttctgcggtaacgcctccttggatacgtcatagctg 1740 aaaacgaaagaagtgcgctgtaagtatt

SEQ ID NO: 2 Porcine circovirus PCVI accagcgcacttcggcagcggcagcacctcggcagcgtcagtgaaaatgccaagcaagaa 60 aagcggcccgcaaccccataagaggtgggtgttcacccttaataatccttccgaggagga 120 gaaaaacaaaatacgggagcttccaatctccctttttgattattttgtttgcggagagga 180 aggtttggaagagggtagaactcctcacctccaggggtttgcgaattttgctaagaagca 240 gacttttaacaaggtgaagtggtattttggtgcccgctgccacatcgagaaagcgaaagg 300 aaccgaccagcagaataaagaatactgcagtaaagaaggccacatacttatcgagtgtgg 360 agctccgcggaaccaggggaagcgcagcgacctgtctactgctgtgagtacccttttgga 420 gacggggtctttggtgactgtagccgagcagttccctgtaacgtatgtgagaaatttccg 480 cgggctggctgaacttttgaaagtgagcgggaagatgcagcagcgtgattggaagacagc 540 tgtacacgtcatagtgggcccgcccggttgtgggaagagccagtgggcccgtaattttgc 600 tgagcctagggacacctactggaagcctagtagaaataagtggtgggatggatatcatgg 660 agaagaagttgttgttttggatgatttttatggctggttaccttgggatgatctactgag 720 actgtgtgaccggtatccattgactgtagagactaaagggggtactgttccttttttggc 780 ccgcagtattttgattaccagcaatcaggccccccaggaatggtactcctcaactgctgt 840 cccagctgtagaagctctctatcggaggattactactttgcaattttggaagactgctgg 900 agaacaatccacggaggtacccgaaggccgatttgaagcagtggacccaccctgtgccct 960 tttcccatataaaataaattactgagtcttttttgttatcacatcgtaatggtttttatt 1020 tttatttatttagagggtcttttaggataaattctctgaattgtacataaatagtcagcc 1080 ttaccacataattttgggctgtggctgcattttggagcgcatagccgaggcctgtgtgct 1140 cgacattggtgtgggtatttaaatggagccacagctggtttcttttattatttgggtgga 1200 accaatcaattgtttggtccagctcaggtttgggggtgaagtacctggagtggtaggtaa 1260 agggctgccttatggtgtggcgggaggagtagttaatataggggtcataggccaagttgg 1320 tggagggggttacaaagttggcatccaagataacaacagtggacccaacacctctttgat 1380 tagaggtgatggggtctctggggtaaaattcatatttagcctttctaatacggtagtatt 1440 ggaaaggtaggggtagggggttggtgccgcctgagggggggaggaactggccgatgttga 1500 atttgaggtagttaacattccaagatggctgcgagtatcctccttttatggtgagtacaa 1560 attctgtagaaaggcgggaattgaagatacccgtctttcggcgccatctgtaacggtttc 1620 tgaaggcggggtgtgccaaatatggtcttctccggaggatgtttccaagatggctgcggg 1680 ggcgggtccttcttctgcggtaacgcctccttggccacgtcatcctataaaagtgaaaga 1740 agtgcgctgctgtagtatt

SEQ ID NO: 3

PCVII 412 ORF 1 (under Wang ORF numbering system) Met Pro Ser Lys Lys Asn GIy Arg Ser GIy Pro GIn Pro His Lys Arg Trp VaI Phe Thr Leu Asn Asn Pro Ser GIu Asp GIu Arg Lys Lys lie Arg GIu Leu Pro lie Ser Leu Phe Asp Tyr Phe lie VaI GIy GIu GIu GIy Asn GIu GIu GIy Arg Thr Pro His Leu GIn GIy Phe Ala Asn Phe VaI Lys Lys GIn Thr Phe Asn Lys VaI Lys Trp Tyr Leu GIy Ala Arg Cys His lie GIu Lys Ala Lys GIy Thr Asp GIn GIn Asn Lys GIu Tyr Cys Ser Lys GIu GIy Asn Leu Leu lie GIu Cys GIy Ala Pro Arg Ser GIn GIy GIn Arg Ser Asp Leu Ser Thr Ala VaI Ser Thr Leu Leu GIu Ser GIy lie Leu VaI Thr VaI Ala GIu Gin His Pro VaI Thr Phe VaI Lys Asn Phe Arg GIy Leu Ala GIu Leu Leu Lys VaI Ser GIy Lys Met GIn Lys Arg Asp Trp Lys Thr Asn VaI His Phe lie VaI GIy Pro Pro GIy Cys GIy Lys Ser Lys Trp Ala Ala Asn Phe Ala Asn Pro GIu Thr Thr Tyr Trp Lys Pro Pro Lys Asn Lys Trp Trp Asp GIy Tyr His GIy GIu Lys VaI VaI VaI lie Asp Asp Phe Tyr GIy Trp Leu Pro Trp Asp Asp Leu Leu Arg Leu Cys Asp Arg Tyr Pro Leu Thr VaI Lys Thr Lys GIy GIy Thr VaI Pro Phe Leu Ala Arg Ser lie Leu lie Thr Ser Asn GIn Thr Pro Leu GIu Trp Tyr Ser Ser Thr Ala VaI Pro Ala VaI GIu Ala Leu Tyr Arg Arg lie Thr Ser Leu VaI Phe Trp Lys Asn Ala Thr Lys GIn Ser Thr GIu GIu GIy GIy GIn Phe VaI Thr Leu Ser Pro Pro Cys Pro GIu Phe Pro Tyr GIu lie Asn Tyr

SEQ ID NO: 4 PCVI ORF

Met Pro Ser Lys Lys Ser GIy Pro GIn Pro His Lys Arg Trp VaI Phe Thr Leu Asn Asn Pro Ser GIu GIu GIu Lys Asn Lys lie Arg GIu Leu Pro lie Ser Leu Phe Asp Tyr Phe VaI Cys GIy GIu GIu GIy Leu GIu GIu GIy Arg Thr Pro His Leu GIn GIy Phe Ala Asn Phe Ala Lys Lys GIn Thr Phe Asn Lys VaI Lys Trp Tyr Phe GIy Ala Arg Cys His lie GIu Lys Ala Lys GIy Thr Asp GIn GIn Asn Lys GIu Tyr Cys Ser Lys GIu GIy His lie Leu lie GIu Cys GIy Ala Pro Arg Asn GIn GIy Lys Arg Ser Asp Leu Ser Thr Ala VaI Ser Thr Leu Leu GIu Thr GIy Ser Leu VaI Thr VaI Ala GIu GIn Phe Pro VaI Thr Tyr VaI Arg Asn Phe Arg GIy Leu Ala GIu Leu Leu Lys VaI Ser GIy Lys Met GIn GIn Arg Asp Trp Lys Thr Ala VaI His VaI lie VaI GIy Pro Pro GIy Cys GIy Lys Ser GIn Trp Ala Arg Asn Phe Ala GIu Pro Arg Asp Thr Tyr Trp Lys Pro Ser Arg Asn Lys Trp Trp Asp GIy Tyr His GIy GIu GIu VaI VaI VaI Leu Asp Asp Phe Tyr GIy Trp Leu Pro Trp Asp Asp Leu Leu Arg Leu Cys Asp Arg Tyr Pro Leu Thr VaI GIu Thr Lys GIy GIy Thr VaI Pro Phe Leu Ala Arg Ser lie Leu lie Thr Ser Asn GIn Ala Pro GIn GIu Trp Tyr Ser Ser Thr Ala VaI Pro Ala VaI GIu Ala Leu Tyr Arg Arg lie Thr Thr Leu GIn Phe Trp Lys Thr Ala GIy GIu GIn Ser Thr GIu VaI Pro GIu GIy Arg Phe GIu Ala VaI Asp Pro Pro Cys Ala Leu Phe Pro Tyr Lys lie Asn Tyr

SEQ ID NO: 5

PCVII 412 ORF 6 (under Wang ORF numbering system) Met Thr Tyr Pro Arg Arg Arg Tyr Arg Arg Arg Arg His Arg Pro Arg Ser His Leu GIy GIn lie Leu Arg Arg Arg Pro Trp Leu VaI His Pro Arg His Arg Tyr Arg Trp Arg Arg Lys Asn GIy lie Phe Asn Thr Arg Leu Ser Arg Thr Phe GIy Tyr Thr VaI Lys Arg Thr Thr VaI Thr Thr Pro Ser Trp Ala VaI Asp Met Met Arg Phe Lys lie Asp Asp Phe VaI Pro Pro GIy GIy GIy Thr Asn Lys lie Ser lie Pro Phe GIu Tyr Tyr Arg lie Arg Lys VaI Lys VaI GIu Phe Trp Pro Cys Ser Pro lie Thr GIn GIy Asp Arg GIy VaI GIy Ser Thr Ala VaI lie Leu Asp Asp Asn Phe VaI Thr Lys Ala Thr Ala Leu Thr Tyr Asp Pro Tyr VaI Asn Tyr Ser Ser Arg His Thr lie Pro GIn Pro Phe Ser Tyr His Ser Arg Tyr Phe Thr Pro Lys Pro VaI Leu Asp Ser Thr lie Asp Tyr Phe GIn Pro Asn Asn Lys Arg Asn GIn Leu Trp Leu Arg Leu GIn Thr Ser GIy Asn VaI Asp His VaI GIy Leu GIy Thr Ala Phe GIu Asn Ser Lys Tyr Asp GIn Asp Tyr Asn lie Arg VaI Thr Met Tyr VaI GIn Phe Arg GIu Phe Asn Leu Lys Asp Pro Pro Leu GIu Pro

SEQ ID NO: 6 PCVI ORF

Met Thr Trp Pro Arg Arg Arg Tyr Arg Arg Arg Arg Thr Arg Pro Arg Ser His Leu GIy Asn lie Leu Arg Arg Arg Pro Tyr Leu Ala His Pro Ala Phe Arg Asn Arg Tyr Arg Trp Arg Arg Lys Thr GIy lie Phe Asn Ser Arg Leu Ser Thr GIu Phe VaI Leu Thr lie Lys GIy GIy Tyr Ser GIn Pro Ser Trp Asn VaI Asn Tyr Leu Lys Phe Asn lie GIy GIn Phe Leu Pro Pro Ser GIy GIy Thr Asn Pro Leu Pro Leu Pro Phe Gin Tyr Tyr Arg lie Arg Lys Ala Lys Tyr GIu Phe Tyr Pro Arg Asp Pro lie Thr Ser Asn GIn Arg GIy VaI GIy Ser Thr VaI VaI lie Leu Asp Ala Asn Phe VaI Thr Pro Ser Thr Asn Leu Ala Tyr Asp Pro Tyr lie Asn Tyr Ser Ser Arg His Thr lie Arg GIn Pro Phe Thr Tyr His Ser Arg Tyr Phe Thr Pro Lys Pro GIu Leu Asp GIn Thr lie Asp Trp Phe His Pro Asn Asn Lys Arg Asn GIn Leu Trp Leu His Leu Asn Thr His Thr Asn VaI GIu His Thr GIy Leu GIy Tyr Ala Leu GIn Asn Ala Ala Thr Ala GIn Asn Tyr VaI VaI Arg Leu Thr lie Tyr VaI GIn Phe Arg GIu Phe lie Leu Lys Asp Pro Leu Asn Lys

SEQ ID NO: 7

PCVII 412 ORF 3 (under Wang ORF numbering system)

Met Lys Cys Thr Leu VaI Phe GIn Ser Arg Phe Cys lie Phe Pro Leu

Thr Phe Lys Ser Ser Ala Ser Pro Arg Lys Phe Leu Thr Asn VaI Thr

GIy Cys Cys Phe Ala Thr VaI Thr Arg lie Pro Leu Ser Asn Lys VaI

Leu Thr Ala VaI Asp Arg Ser Leu Arg Cys Pro

SEQ ID NO: 8 PCVI ORF

Met Thr Cys Thr Ala VaI Phe GIn Ser Arg Cys Cys lie Phe Pro Leu Thr Phe Lys Ser Ser Ala Ser Pro Arg Lys Phe Leu Thr Tyr VaI Thr GIy Asn Cys Ser Ala Thr VaI Thr Lys Asp Pro VaI Ser Lys Arg VaI Leu Thr Ala VaI Asp Arg Ser Leu Arg Phe Pro Trp Phe Arg GIy Ala Pro His Ser lie Ser Met Trp Pro Ser Leu Leu GIn Tyr Ser Leu Phe Cys Trp Ser VaI Pro Phe Ala Phe Ser Met Trp GIn Arg Ala Pro Lys Tyr His Phe Thr Leu Leu Lys VaI Cys Phe Leu Ala Lys Phe Ala Asn Pro Trp Arg SEQ ID NO: 9

PCVII 412 ORF 2 (under Wang ORF numbering system)

Met VaI Thr lie Pro Pro Leu VaI Phe Arg Trp Phe Pro VaI Cys GIy

Phe Arg VaI Cys Lys lie Ser Ser Pro Phe Ala Phe Thr Thr Pro Arg

Trp Pro His Asn GIu VaI Tyr lie GIy Phe Pro lie Thr Leu Leu His

Phe Pro Ala His Phe GIn Lys Phe Ser GIn Pro Ala GIu lie Phe Asp

Lys Arg Tyr Arg VaI Leu Leu Cys Asn GIy His GIn Asn Pro Ala Leu

GIn GIn GIy Thr His Ser Ser Arg GIn VaI Thr Pro Leu Ser Leu Arg

Ser Arg Ser Ser Thr Phe Asn Lys

SEQ ID NO: 10 PCVI ORF

Met lie Ser lie Pro Pro Leu lie Ser Thr Arg Leu Pro VaI GIy VaI Pro Arg Leu Ser Lys lie Thr GIy Pro Leu Ala Leu Pro Thr Thr GIy Arg Ala His Tyr Asp VaI Tyr Ser Cys Leu Pro lie Thr Leu Leu His Leu Pro Ala His Phe GIn Lys Phe Ser GIn Pro Ala GIu lie Ser His lie Arg Tyr Arg GIu Leu Leu GIy Tyr Ser His GIn Arg Pro Arg Leu GIn Lys GIy Thr His Ser Ser Arg GIn VaI Ala Ala Leu Pro Leu VaI Pro Arg Ser Ser Thr Leu Asp Lys Tyr VaI Ala Phe Phe Thr Ala VaI Phe Phe lie Leu Leu VaI GIy Ser Phe Arg Phe Leu Asp VaI Ala Ala GIy Thr Lys lie Pro Leu His Leu VaI Lys Ser Leu Leu Leu Ser Lys lie Arg Lys Pro Leu GIu VaI Arg Ser Ser Thr Leu Phe GIn Thr Phe Leu Ser Ala Asn Lys lie lie Lys Lys GIy Asp Trp Lys Leu Pro Tyr Phe VaI Phe Leu Leu Leu GIy Arg lie lie Lys GIy GIu His Pro Pro Leu Met GIy Leu Arg Ala Ala Phe Leu Ala Trp His Phe His

SEQ ID NO: 11

Porcine circovirus PCVII 9741 accagcgcacttcggcagcggcagcacctcggcagcacctcagcagcaacatgcccagca 60 agaagaatggaagaagcggaccccaaccacataaaaggtgggtgttcacgctgaataatc 120 cttccgaagacaagcgcaagaaaatacgggagctcccaatctccctatttgattatttta 180 ttgttggcgaggagggtaatgaggaaggacgaacacctcacctccaggggttcgctaatt 240 ttgtgaagaagcaaacttttaataaagtgaagtggtatttgggtgcccgctgccacatcg 300 agaaagccaaaggaactgatcagcagaataaagaatattgcagtaaagaaggcaacttac 360 ttattgaatgtggagctcctcgatctcaaggacaacggagtgacctgtctactgctgtga 420 gtaccttgttggagagcgggattctggtgaccgttgcaaagcagcaccctgtaacgtttg 480 tcaaaaatttccgcgggctggctgaacttttgaaagtgagcgggaaaatgcaaaagcgtg 540 attggaaaaccaatgtacacttcattgtggggccacctgggtgtggtaaaagcaaatggg 600 ctgctaattttgcaaacccggaaaccacatactggaaaccacctaaaaacaagtggtggg 660 atggttaccatggtgaaaaagtggttgttattgatgacttttatggctggctgccgtggg 720 atgatctactgaaactgtgtgatcgatatccattgactgtaaaaactaaaggtggaactg 780 taccttttttggcccgcagtattctgattaccagcaatcagaccccgttggaatggtact 840 cctcaactgctgtcccagctgtagaagctctctatcggaggattacttccttggtatttt 900 ggaagaatgctacagaacaatccacggaggaagggggccagtttgtcaccctttcccccc 960 catgccctgaatttccatatgaaataaattactgagtcttttttatcacttcgtaatggt 1020 ttttattattcatttagggtttaagtggggggtctttaagattaaattctctgaattgta 1080 catacatggttacacggatattgtagtcctggtcgtatttactgttttcgaacgcagtgc 1140 cgaggcctacgtggtccacatttccagaggtttgtagcctcagccaaagctgattccttt 1200 tgttatttggttggaagtaatcaatagtggagtcaagaacaggtttgggtgtgaagtaac 1260 gggagtggtaggagaagggttgggggattgtatggcgggaggagtagtttacatatgggt 1320 cataggttagggctgtggcctttgttacaaagttatcatctaaaataacagcagtggagc 1380 ccactcccctatcaccctgggtgatgggggagcagggccagaattcaaccttaacctttc 1440 ttattctgtagtattcaaagggtatagagattttgttggtcccccctcccgggggaacaa 1500 agtcgtcaattttaaatctcatcatgtccaccgcccaggagggcgttgtgactgtggtac 1560 gcttgacagtatatccgaaggtgcgggagaggcgggtgttgaagatgccatttttccttc 1620 tccaacggtagcggtggcgggggtggacgagccaggggcggcggcggaggatctggccaa 1680 gatggctgcgggggcggtgtcttcttctgcggtaacgcctccttggatacgtcatagctg 1740 aaaacgaaagaagtgcgctgtaagtatt

SEQ ID NO: 12

Porcine circovirus PCVII B9 accagcgcacttcggcagcggcagcacctcggcagcacctcagcagcaacatgcccagca 60 agaagaatggaagaagcggaccccaaccacataaaaggtgggtgttcacgctgaataatc 120 cttccgaagacaagcgcaagaaaatacgggagctcccaatctccctatttgattatttta 180 ttgttggcgaggagggtaatgaggaaggacgaacacctcacctccaggggttcgctaatt 240 300

tgtggagctcctcgatctcaaggacaacggagtgacctgtctactgctgtga 420 gtaccttgttggagagcgggattctggtgaccgttgcaaagcagcaccctgtaacgtttg 480 tcaaaaatttccgcgggctggctgaacttttgaaagtgagcgggaaaatgcaaaagcgtg 540 attggaaaaccaatgtacacttcattgtggggccacctgggtgtggtaaaagcaaatggg 600 ctgctaattttgcaaacccggaaaccacatactggaaaccacctaaaaacaagtggtggg 660 atggttaccatggtgaaaaagtggttgttattgatgacttttatggctggctgccgtggg 720 atgatctactgaaactgtgtgatcgatatccattgactgtaaaaactaaaggtggaactg 780 taccttttttggcccgcagtattctgattaccagcaatcaaaccccgttggaatggtact 840 cctcaactgctgtcccagctgtagaagctctctatcggaggattacttccttggtatttt 900 ggaagaatgttacagaacaatccacggaggaagggggccagtttgtcaccctttcccccc 960 catgccctgaatttccatatgaaataaattactgagtcttttttatcacttcgtaatggt 1020 ttttattatteatttagggtttaagtggggggtctttaagattaaattctctgaattgta 1080 catacatggttacacggatattgtagtcctggtcgtatttactgttttcgaacgcagtgc 1140 cgaggcctacgtggtccacatttctagaggtttgtagcctcagccaaagctgattccttt 1200 tgttatttggttggaagtaatcaatagtggagtcaagaacaggtttgggtgtgaagtaac 1260 gggagtggtaggagaagggttgggggattgtatggcgggaggagtagtttacatatgggt 1320 cataggttagggctgtggcctttgttacaaagttatcatctagaataacagcagtggagc 1380 ccactcccctatcaccctgggtgatgggggagcagggccagaattcaaccttaacctttc 1440 ttattctgtagtattcaaagggtatagagattttgttggtcccccctcccgggggaacaa 1500 agtcgtcaattttaaatctcatcatgtccaccgcccaggagggcgttgtgactgtggtag 1560 gettgacagtatatccgaaggtgcgggagaggcgggtgttgaagatgccatttttccttc 1620 tccaacggtagcggtggcgggggtggacgagccaggggcggcggcggaggatctggccaa 1680 gatggctgcgggggcggtgtcttcttctgcggtaacgcctccttggatacgtcatagctg 1740 aaaacgaaagaagtgcgctgtaagtatt

SEQ ID NO: 13 Primer Loop ACTACAGCAGCGCACTTC

SEQ ID NO: 14

Primer 1000^"

AAAAAAGACTCAGTAATTTATTTCATATGG

SEQ ID NO: 15

Primer RIF

ATCACTTCGTAATGGTTTTTATT

SEQ ID NO: 16 Primer 1710+ TGCGGTAACGCCTCCTTG

SEQ ID NO: 17 Primer 850 CTACAGCTGGGACAGCAGTTG

SEQ ID NO: 18

Primer 1100+

CATACATGGTTACACGGATATTG

SEQ ID NO: 19 Primer 1570- CCGCACCTTCGGATATACTG

SEQ ID NO: 20

PCVII 412 ORF 4 (under Wang ORF numbering system)

Met Tyr Thr Ser Leu Trp GIy His Leu GIy VaI VaI Lys Ala Asn GIy

Leu Leu lie Leu GIn Thr Arg Lys Pro His Thr GIy Asn His Leu Lys

Thr Ser GIy GIy Met VaI Thr Met VaI Lys Lys Trp Leu Leu Leu Met

Thr Phe Met Ala GIy Cys Arg GIy Met lie Tyr

SEQ ID NO: 21

PCVII 412 ORF 5 (under Wang ORF numbering system)

Met VaI Phe lie lie His Leu GIy Phe Lys Trp GIy VaI Phe Lys lie

Lys Phe Ser GIu Leu Tyr lie His GIy Tyr Thr Asp lie VaI VaI Leu

VaI VaI Phe Thr VaI Phe GIu Arg Ser Ala GIu Ala Tyr VaI VaI His lie Ser Arg GIy Leu

SEQ ID NO: 22 Primer 1230- TCCCGTTACTTCACACCCAA

SEQ ID NO: 23 Primer 400+ CCTGTCTACTGCTGTGAGTA

SEQ ID NO: 24

Porcine circovirus PCVII 1010 aattcaaccttaacctttcttattctgtagtattcaaagggtatagagattttgttggtc 60 ccccctcccgggggaacaaagtcgtcaattttaaatctcatcatgtccaccgcccaggag 120 ggcgttgtgactgtggtacgcttgacagtatatccgaaggtgcgggagaggcgggtgttg 180 aagatgccatttttccttctccaacggtagcggtggcgggggtggacgagccaggggcgg 240 cggcggaggatctggccaagatggctgcgggggcggtgtcttcttctgcggtaacgcctc 300 cttggatacgtcatagctgaaaacgaaagaagtgcgctgtaagtattaccagcgcacttc 360 ggcagcggcagcacctcggcagcacctcagcagcaacatgcccagcaagaagaatggaag 420 aagcggaccccaaccacataaaaggtgggtgttcacgctgaataatccttccgaagacga 480 gcgcaagaaaatacgggagctcccaatctccctatttgattattttattgttggcgagga 540 gggtaatgaggaaggacgaacacctcacctccaggggttcgctaattttgtgaagaagca 600 aacttttaataaagtgaagtggtatttgggtgcccgctgccacatcgagaaagccaaagg 660 aactgatcagcagaataaagaatattgcagtaaagaaggcaacttacttattgaatgtgg 720 agctcctcgatctcaaggacaacggagtgacctgtctactgctgtgagtaccttgttgga 780 gagcgggagtctggtgaccgttgcagagcagcaccctgtaacgtttgtcagaaatttccg 840 cgggctggctgaacttttgaaagtgagcgggaaaatgcagaagcgtgattggaagaccaa 900 tgtacacgtcattgtggggccacctgggtgtggtaaaagcaaatgggctgctaattttgc 960 agacccggaaaccacatactggaaaccacctagaaacaagtggtgggatggttaccatgg 1020 tgaagaagtggttgttattgatgacttttatggctggctgccgtgggatgatctactgag 1080 actgtgtgatcgatatccattgactgtagagactaaaggtggaactgtaccttttttggc 1140 ccgcagtattctgattaccagcaatcagaccccgttggaatggtactcctcaactgctgt 1200 cccagctgtagaagctctctatcggaggattacttccttggtattttggaagaatgctac 1260 agaacaatccacggaggaagggggccagttcgtcaccctttcccccccatgccctgaatt 1320 tccatatgaaataaattactgagtcttttttatcacttcgtaatggtttttattattcat 1380 ttagggtttaagtggggggtctttaagattaaattctctgaattgtacatacatggttac 1440 acggatattgtagtcctggtcgtatttactgttttcgaacgcagcgccgaggcctacgtg 1500 gtccacatttccagaggtttgtagtctcagccaaagctgattccttttgttatttggttg 1560 gaagtaatcaatagtggagtcaagaacaggtttgggtgtgaagtaacgggagtggtagga 1620 gaagggttgggggattgtatggcgggaggagtagtttacatatgggtcataggttagggc 1680 tgtggcctttgttacaaagttatcatctagaataacagcagtggagcccactcccctatc 1740 accctgggtgatgggggagcagggccag

SEQ ID NO: 25

Porcine circovirus PCVII 1011-48121 aattcaaccttaacctttcttattctgtagtattcaaagggcacagagcgggggtttgag 60 ccccctectgggggaagaaagtcattaatattgaatctcatcatgtccaccgcccaggag 120 ggcgttctgactgtggttcgcttgacagtatatccgaaggtgcgggagaggcgggtgttg 180 aagatgccatttttccttctccagcggtaacggtggcgggggtggacgagccaggggcgg 240 cggcggaggatctggccaagatggctgcgggggcggtgtcttcttctccggtaacgcctc 300 cttggatacgtcatatctgaaaacgaaagaagtgcgctgtaagtattaccagcgcacttc 360 ggcagcggcagcacctcggcagcacctcagcagcaacatgccgagcaagaagaatggaag 420 aagcggaccccaaccccataaaaggtgggtgttcactctgaataatccttccgaagacga 480 gcgcaagaaaatacgggatcttccaatatccctatttgattattttattgttggcgagga 540 gggtaatgaggaaggacgaacacctcacctccaggggttcgctaattttgtgaagaagca 600 gacttttaataaagtgaagtggtatttgggtgcccgctgccacatcgagaaagcgaaagg 660 aacagatcagcagaataaagaatactgcagtaaagaaggcaacttactgatggagtgtgg 720 agctcctagatctcagggacaacggagtgacctgtctactgctgtgagtaccttgttgga 780 gagcgggagtctggtgaccgttgcagagcagcaccctgtaacgtttgtcagaaatttccg 840 cgggctggctgaacttttgaaagtgagcgggaaaatgcagaagcgtgattggaagactaa 900 tgtacacgtcattgtggggccacctgggtgtggtaaaagcaaatgggctgctaattttgc 960 agacccggaaaccacatactggaaaccacctagaaacaagtggtgggatggttaccatgg 1020 tgaagaagtggttgttattgatgacttttatggctggctgccctgggatgatctactgag 1080 actgtgtgatcgatatccattgactgtagagactaaaggtggaactgtaccttttttggc 1140 ccgcagtattctgattaccagcaatcagaccccgttggaatggtactcctcaactgctgt 1200 cccagctgtagaagctctttatcggaggattacttecttggtattttggaagaatgctac 1260 agaacaatccacggaggaagggggccagttcgtcaccctttcccccccatgccctgaatt 1320 tccatatgaaataaattactgagtcttttttatcacttcgtaatggtttttattattcat 1380 taagggttaagtggggggtctttaagattaaattctctgaattgtacatacatggttaca 1440 cggatattgtattcctggtcgtatatactgttttcgaacgcagtgccgaggcctacgtgg 1500 tctacatttccagcagtttgtagtctcagccacagctggtttcttttgttgtttggttgg 1560 aagtaatcaatagtggaatctaggacaggtttgggggtaaagtagcgggagtggtaggag 1620 aagggctgggttatggtatggcgggaggagtagtttacataggggtcataggtgagggct 1680 gtggcctttgttacaaagttatcatctagaataacagcactggagcccactcccctgtca 1740 ccctgggtgatcggggagcagggccag

SEQ ID NO: 26

Porcine circovirus PCVII 1011-48285 aattcaaccttaacctttcttattctgtagtattcaaagggcacagagcgggggtttgag 60 ccccctectgggggaagaaagtcattaatattgaatctcatcatgtccaccgcccaggag 120 ggcgttttgactgtggttcgcttgacagtatatccgaaggtgcgggagaggcgggtgttg 180 aagatgccatttttccttctccagcggtaacggtggcgggggtggacgagccaggggcgg 240 cggcggaggatctggccaagatggctgcgggggcggtgtcttcttctccggtaacgcctc 300 cttggatacgtcatatctgaaaacgaaagaagtgcgctgtaagtattaccagcgcacttc 360 ggcagcggcagcacctcggcagcacctcagcagcaacatgcccagcaagaagaatggaag 420 aagcggaccccaaccccataaaaggtgggtgttcactctgaataatccttccgaagacga 480 gcgcaagaaaatacgggatcttccaatatccctatttgattattttattgttggcgagga 540 gggtaatgaggaaggacgaacacctcacctccaggggttcgctaattttgtgaagaagca 600 gacttttaataaagtgaagtggtatttgggtgcccgctgccacatcgagaaagcgaaagg 660 aacagatcagcagaataaagaatactgcagtaaagaaggcaacttactgatggagtgtgg 720 agctcctagatctcagggacaacggagtgacctgtctactgctgtgagtaccttgttgga 780 gagcgggagtctggtgaccgttgcagagcagcaccctgtaacgtttgtcagaaatttccg 840 cgggctggctgaacttttgaaagtgagcgggaaaatgcagaagcgtgattggaagactaa 900 tgtacacgtcattgtggggccacctgggtgtggtaaaagcaaatgggctgctaattttgc 960 agacccggaaaccacatactggaaaccacctagaaacaagtggtgggatggttaccatgg 1020 tgaagaagtggttgttattgatgacttttatggctggctgccctgggatgatctactgag 1080 actgtgtgatcgatatccattgactgtagagactaaaggtggaactgtaccttttttggc 1140 ccgcagtattctgattaccagcaatcagaccccgttggaatggtactcctcaactgctgt 1200 cccagctgtagaagctctttatcggaggattacttccttggtattttggaagaatgctac 1260 agaacaatccacggaggaagggggccagttcgtcaccctttcccccccatgccctgaatt 1320 tccatatgaaataaattactgagtcttttttatcacttcgtaatggtttttattattcat 1380 taagggttaagtggggggtctttaagattaaattctctgaattgtacatacatggttaca 1440 cggatattgtattcctggtcgtatatactgttttcgaacgcagtgccgaggcctacgtgg 1500 tctacatttccagtagtttgtagtctcagccacagctgatttcttttgttgtttggttgg 1560 aagtaatcaatagtggaatctaggacaggtttgggggtaaagtagcgggagtggtaggag 1620 aagggctgggttatggtatggcgggaggagtagtttacataggggtcataggtgagggct 1680 gtggcctttgttacaaagttatcatctagaataacagcactggagcccactcccctgtca 1740 ccctgggtgatcggggagcagggccag

SEQ ID NO: 27

Porcine circovirus PCVII Optimized 999 aattcaaccttaaccttttttattctgtagtattcaaagggtatagagattttgttggtc 60 ccccctcccgggggaacaaagtcgtcaatattaaatctcatcatgtccaccgcccaggag 120 ggcgttctgactgtggtagccttgacagtatatccgaaggtgcgggagaggcgggtgttg 180 aagatgccatttttccttctccaacggtagcggtggcgggggtggacgagccaggggcgg 240 cggcggaggatctggccaagatggctgcgggggcggtgtcttcttctgcggtaacgcctc 300 cttggatacgtcatagctgaaaacgaaagaagtgcgctgtaagtattaccagcgcacttc 360 ggcagcggcagcacctcggcagcacctcagcagcaacatgcccagcaagaagaatggaag 420 aagcggaccccaaccacataaaaggtgggtgttcacgctgaataatccttccgaagacga 480 gcgcaagaaaatacgggagctcccaatctccctatttgattattttattgttggcgagga 540 gggtaatgaggaaggacgaacacctcacctccaggggttcgctaattttgtgaagaagca 600 aacttttaataaagtgaagtggtatttgggtgcccgctgccacatcgagaaagccaaagg 660 aactgatcagcagaataaagaatattgcagtaaagaaggcaacttacttattgaatgtgg 720 agctcctcgatctcaaggacaacggagtgacctgtctactgctgtgagtaccttgttgga 780 gagcgggagtctggtgaccgttgcagagcagcaccctgtaacgtttgtcagaaatttccg 840 cgggctggctgaacttttgaaagtgagcgggaaaatgcagaagcgtgattggaagaccaa 900 tgtacacgtcattgtggggccacctgggtgtggtaaaagcaaatgggctgctaattttgc 960 agacccggaaaccacatactggaaaccacctagaaacaagtggtgggatggttaccatgg 1020 tgaagaagtggttgttattgatgacttttatggctggctgccgtgggatgatctactgag 1080 actgtgtgatcgatatccattgactgtagagactaaaggtggaactgtaccttttttggc 1140 ccgcagtattctgattaccagcaatcagaccccgttggaatggtactcctcaactgctgt 1200 cccagctgtagaagctctctatcggaggattacttccttggtattttggaagaatgctac 1260 agaacaatccacggaggaagggggccagttcgtcaccctttcccccccatgccctgaatt 1320 tccatatgaaataaattactgagtcttttttatcacttcgtaatggtttttattattcat 1380 ttagggtttaagtggggggtctttaagattaaattctctgaattgtacatacatggttac 1440 acggatattgtagtcctggtcgtatatactgttttcgaacgcagtgccgaggcctacgtg 1500 gtccacatttctagaggtttgtagcctcagccaaagctgattccttttgttatttggttg 1560 gaagtaatcaatagtggagtcaagaacaggtttgggtgtgaagtaacgggagtggtagga 1620 gaagggttgggggattgtatggcgggaggagtagtttacatatgggtcataggttagggc 1680 tgtggcctttgttacaaagttatcatctagaataacagcagtggagcccactcccctatc 1740 accctgggtgatgggggagcagggccag SEQ ID NO: 28

Porcine circovirus PCVII First 999 gaattcaaccttaaccttttttattctgtagtattcaaagggtataaagattttgttggt 60 cccccctcccgggggaacaaagtcgtcaatattaaatctcatcatgtccaccgcccagga 120 gggcgttctgactgtggtagccttgacagtatatccgaaggtgcgggagargcgggtgtt 180 gaaaatgccatttttccttctccaacggtagcggtggcgggggtggacmanccacgggcg 240 gcggcggawgatctggccaagatggctgcgggggcggtgtcttcttctgcggtaacgcct 300 ccttggatacgtcatagctgaaaacgaaagaagtgcgctgtaagtattaccagcgcactt 360 cggcagcggcagcacctcggcagcacctcagcagcaacatgcccagcaagaagaatggaa 420 gaagcggaccccaaccacataaaaggtgggtgttcacgctgaataatccttccgaagacg 480 agcgcaagaaaatacgggagctcccaatctccctatttgattattttattgttggcgagg 540 agggtwwtgaggaangacgaacacctcacctccaggggttcgctaattttgtgaagaagc 600 aaacttttaataaagtgaagtggtatttgggtgcccgctgccacatcgagaaagccaaag 660 gaactgatcagcagaataaagaatattgcagtaaagaaggcaacttacttattgaatgtg 720 gagetectcgatctcaaggacaacggagtgacctgtctactgctgtgagtaccttgttgg 780 agagcgggagtctggtgaccgttgcagagcagcaccctgtaacgtttgtcagaaatttcc 840 gcgggctggctgaacttttgaaagtgagcgggaaaatgcagaagcgtgattggaagacca 900 atgtacacgtcattgtggggccacctgggtgtggtaaaagcaaatgggctgctaattttg 960 cagacccggaaaccacatactggaaaccacctagaaacaagtggtgggatggttaccatg 1020 gtgaagaagtggttgttattgatgacttttatggctggctgccgtgggatgatctactga 1080 gactgtgtgatcgatatccattgactgtagagactaaaggtggaactgtacnnnnnnngg 1140 cccgcagtattctgattaccagcaatcagaccccgttggaatggtactcctcaactgctg 1200 tcccagctgtagaagctctctatcggaggattacttecttggtattttggaagaatgcta 1260 cagaacaatccacggaggaagggggccagttngtcaccctttcccccccatgccctgaat 1320 ttccatatgaaataaattactgagtcttttttatcacttcgtaatggtttttattattca 1380 tttagggtttaagtggggggtctttaagattaaattctctgaattgtacatacatggtta 1440 cacggatattgtagtcctggtcgtatatactgttttcgaacgcagtgccgaggcctacgt 1500 ggtccacatttctagaggtttgtagcctcagccaaagctgattccttttgttatttggtt 1560 ggaagtaatcaatagtggagtcaagaacaggtttgggtgtgaagtaacgggagtggtagg 1620 agaagggttgggggattgtatggcgggaggagtagtttacatatgggtcataggttaggg 1680 ctgtggcctttgttacaaagttatcatctagaataacagcagtggagcccactcccctat 1740 caccctgggtgatgggggagcagggcca

SEQ ID NO: 29

Porcine circovirus PCVII 1103 accagcgcacttcggcagcggcagcacctcggcagcacctcagcagcaacatgcccagca 60 agaagaatggaagaagcggaccccaaccacataaaaggtgggtgttcacgctgaataatc 120 cttccgaagacgagcgcaagaaaatacgggagctcccaatctccctatttgattatttta 180 ttgttggcgaggagggtaatgaggaaggacgaacacctcacctccaggggttcgctaatt 240 ttgtgaagaakcaaacttttaataaagtgaagtggtatttgggtgcccgctgccacatcg 300 agaaagccaaaggaactgatcagcagaataaagaatattgcagtaaagaaggcaacttac 360 ttattgaatgtggagctcctcgatctcaaggacaacggagtgacctgtctactgctgtga 420 gtaccttgttggagagcgggagtctggtgaccgttgcagagcagcaccctgtaacgtttg 480 tcagaaatttccgcgggctggctgaacttttgaaagtgagcgggaaaatgcagaagcgtg 540 attggaagaccaatgtacacgtcattgtggggccacctgggtgtggtaaaagcaaatggg 600 ctgctaattttgcagacccggaaaccacatactggaaaccacctagaaacaagtggtggg 660 atggttaccatggtgaagaagtggttgttattgatgacttttatggctggctgccgtggg 720 atgatctactgagactgtgtgatcgatatccattgactgtagagactaaaggtggaactg 780 taccttttttggcccgcagtattctgattaccagcaatcagaccccgttggaatggtact 840 cctcaactgctgtcccagctgtagaagctctctatcggaggattacttccttggtatttt 900 ggaagaatgctacagaacaatccacggaggaagggggccagttcgtcaccctttcccccc 960 catgccctgaatttccatatgaaataaattactgagtcytttttatcacttcgtaatggt 1020 ttttattattcatttaggggttaagtggggggtctttaagattaaattccctgaattgta 1080 catacagggttacacggatattgtagtcctggtcgtatttactgttttcgaacgcagtgc 1140 cgaggcctacgtggtccacatttctagaggtttgtagcctcagccaaagctgattccttt 1200 tgttatttggttggaagtaatcaatagtggagtcaagaacaggtttgggtgtgaagtaac 1260 gggagtggtaggagaagggttgggggattgtatggcgggaggagtagtttacatatgggt 1320 catatgtttgggctgtggcctttggtacaaagttatcatctagaataacagcagtggagc 1380 ccactcccctatcaccctgggtgatgggggagcagggccagaattcaaccttaacctttc 1440 ttattctgtagtattcaaagggtatagagattttgttggtcccccctcccgggggaacaa 1500 agtcgtcaattttaaatctcatcatgtccaccgcccaggagggcgttgtgactgtggtac 1560 gcttgacagtatatccgaaggtgcgggagaggcgggtgttgaagatgccatttttccttc 1620 tccaacggtagcggtggcgggggtggacgagccaggggcggcggcggaggatctggccaa 1680 gatggctgcgggggcggtgtcttcttctgcggtaacgcctccttggatatgtcatagctg 1740 aaaacgaaagaagtgcgctgtaagtatt

SEQ ID NO: 30

Porcine circovirus PCVII 1121 accagcgcacttcggcagcggcagcacctcggcagcacctcagcagcaacatgcccagca 60 agaagaatggaagaagcggaccccaaccacataaaaggtgggtgttcacgctgaataatc 120 cttccgaagacgagcgcaagaaaatacgggagctcccaatctccctatttgattatttta 180 ttgttggcgaggagggtaatgaggaaggacgaacacctcacctccaggggttcgctaatt 240 ttgtgaagaagcaaacttttaataaagtgaagtggtatttgggtgcccgctgccacatcg 300 agaaagccaaaggaactgatcagcagaataaagaatattgcagtaaagaaggcaacttac 360 ttattgaatgtggagctcctcgatctcaaggacaacggagtgacctgtctactgctgtga 420 gtaccttgttggagagcgggagtctggtgaccgttgcagagcagcaccctgtaacgtttg 480 tcagaaatttccgcgggctggctgaacttttgaaagtgagcgggaaaatgcagaagcgtg 540 attggaagaccaatgtacacgtcattgtggggccacctgggtgtggtaaaagcaaatggg 600 ctgctaattttgcagacccggaaaccacatactggaaaccacctagaaacaagtggtggg 660 atggttaccatggtgaagaagtggttgttattgatgacttttatggctggctgccgtggg 720 atgatctactgagactgtgtgatcgatatccattgactgtagagactaaaggtggaactg 780 taccttttttggcccgcagtattctgattaccagcaatcagaccccgttggaatggtact 840 cctcaactgctgtcccagctgtagaagctctctatcggaggattacttccttggtatttt 900 ggaagaatgctacagaacaatccacggaggaagggggccagttcgtcaccctttcccccc 960 catgccctgaatttccatatgaaataaattactgagtcttttttatcacttcgtaatggt 1020 ttttattatteatttaggggttaagtggggggtctttaagattaaattctctgaattgta 1080 catacatggttacacggatattgtagtcctggtcgtatttactgttttcgaacgcagtgc 1140 cgaggcctacgtggtccacatttctagaggtttgtagcctcagccaaagctgattccttt 1200 tgttatttggttggaagtaatcaatagtggagtcaagaacaggtttgggtgtgaagtaac 1260 gggagtggtaggagaagggttgggggattgtatggcgggaggagtagtttacatatgggt 1320 cataggttagggctgtggcctttggtacaaagttatcatctagaataacagcagtggagc 1380 ccactcccctatcaccctgggtgatgggggagcagggccagaattcaaccttaacctttt 1440 ttattctgtagtattcaaagggtatagagattttgttggtcccccctcccgggggaacaa 1500 agtcgtcaattttaaatctcatcatgtccaccgcccaggagggcgttgtgactgtagtac 1560 gcttgacagtatatccgaaggtgcgggagaggcgggtgttgaagatgccatttttccttc 1620 tccaacggtagcggtggcgggggtggacgagccaggggcggcggcggaggatctggccaa 1680 gatggctgcgggggcggtgtcttcttctgcggtaacgcctccttggatacgtcatagctg 1740 aaaacgaaagaagtgcgctgtaagtatt

SEQ ID NO: 31

Porcine circovirus PCVII 1008 aattcaaccttaacctttcttattctgtagtattcaaagggcacagagcgggggtttgag 60 ccccctcctgggggaagaaagtcattaatattgaatctcatcatgtccaccgcccaggag 120 ggcgttctgactgtggttcgcttgacagtatatccgaaggtgcgggagaggcgggtgttg 180 aagatgccatttttccttctccagcggtaacggtggcgggggtggacgagccaggggcgg 240 cggcggaggatctggccaagatggctgcgggggcggtgtcttcttctccggtaacgcctc 300 cttggatacgtcatatctgaaaacgaaagaagtgcgctgtaagtattaccagcgcacttc 360 ggcagcggcagcacctcggcagcacctcggcagcaacatgcccagcaagaagaatggaag 420 aagcggaccccaaccccataaaaggtgggtgttcactctgaataatccttccgaagacga 480 gcgcaagaaaatacgggatcttccaatatccctatttgattattttattgttggcgagga 540 gggtaatgaggaaggacgaacacctcacctccaggggttcgctaattttgtgaagaagca 600 gacttttaataaagtgaagtggtatttgggtgcccgctgccacatcgagaaagcgaaagg 660 aacagatcagcagaataaagaatactgcagtaaagaaggcaacttactgatggagtgtgg 720 agctcctagatctcagggacaacggagtgacctgtctactgctgtgagtaccttgttgga 780 gagcgggagtctggtgaccgttgcagagcagcaccctgtaacgtttgtcagaaatttccg 840 cgggctggctgaacttttgaaagtgagcgggaaaatgcagaagcgtgattggaagactaa 900 tgtacacgtcattgtggggccacctgggtgtggtaaaagcaaatgggctgctaattttgc 960 agacccggaaaccacatactggaaaccacctagaaacaagtggtgggatggttaccatgg 1020 tgaagaagtcgttgttattgatgacttttatggctggctgccctgggatgatctactgag 1080 actgtgtgatcgatatccattgactgtagagactaaaggtggaactgtaccttttttggc 1140 ccgcagtattctgattaccagcaatcagaccccgttggaatggtactcctcaactgctgt 1200 cccagctgtagaagctctttatcggaggattacttccttggtattttggaagaatgctac 1260 agaacaatccacggaggaagggggccagttcgtcaccctttcccccccatgccctgaatt 1320 tccatatgaaataaattactaagtcttttttatcacttcgtaatggtttttattattcat 1380 taagggttaagtggggggtctttaagattaaattctctgaattgtacatacatggttaca 1440 cggatattgtattcctggtcgtatatactgttttcgaacgcagtgccgaggcctacgtgg 1500 tctacatttccagcagtttgtagtctcagccacagctgatttcttttgttgtttggttgg 1560 aagtaatcaatagtggaatctaggacaggtttgggggtaaagtagcgggagtggtaggag 1620 aagggctgggttatggtatggcgggaggagtagtttacataggggtcataggtgagggct 1680 gtggcctttgttacaaagttatcatctagaataacagcactggagcccactcccctgtca 1740 ccctgggtgatcggggagcagggccag

SEQ ID NO: 32

Native ORF2

MTYPRRRYRR RRHRPRSHLG QILRRRPWLV HPRHRYRWRR KNGIFNTRLS 1

RTFGYTVKRT TVTTPSWAVD MMRFKIDDFV PPGGGTNKIS IPFEYYRIRK 51

VKVEFWPCSP ITQGDRGVGS TAVILDDNFV TKATALTYDP YVNYSSRHTI 101

PQPFSYHSRY FTPKPVLDST IDYFQPNNKR NQLWLRLQTS GNVDHVGLGA 151

AFENSKYDQD YNIRVTMYVQ FREFNLKDPP LKP

SEQ ID NO: 33

Mutated ORF2

MTYPRRRYRR RSVNPRSHLG QILRRRPWLV HPRHRYRWSV NNGIFNTRLS 1

RTFGYTVKRT TVTTPSWAVD MMRFKIDDFV PPGGGTNKIS IPFEYYRIRK 51

VKVEFWPCSP ITQGDRGVGS TAVILDDNFV TKATALTYDP YVNYSSRHTI 101

PQPFSYHSRY FTPKPVLDST IDYFQPNNKR NQLWLRLQTS GNVDHVGLGA 151

AFENSKYDQD YNIRVTMYVQ FREFNLKDPP LKP

SEQ ID NO: 34 pLG152 T-DNA ctgatgggctgcctgtatcgagtggtgattttgtgccgagctgccggtcggggagctgtt 60 ggctggctggtggcaggatatattgtggtgtaaacaaattgacgcttagacaacttaata 120 acacattgcggacgtttttaatgtactggggtggtttttcttttcaccagtgagacgggc 180 aacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctg 240 gtttgccccagcaggcgaaaatcctgtttgatggtggttccgaaatcggcaaaatccctt 300 ataaatcaaaagaatagcccgagatagggttgagtgttgttccagtttggaacaagagtc 360 cactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatg 420 gcccacaaactgaaggcgggaaacgacaatctgatcatgagcggagaattaagggagtca 480 cgttatgacccccgccgatgacgcgggacaagccgttttacgtttggaactgacagaacc 540 gcaacgttgaaggagccactcagccgcgggtttctggagtttaatgagctaagcacatac 600 gtcagaaaccattattgcgcgttcaaaagtcgcctaaggtcactatcagctagcaaatat 660 ttcttgtcaaaaatgctccactgacgttccataaattcccctcggtatccaattagagtc 720 tcatattcactctcaatccaaataatctgcaccggatctggatcgtttcgcatgattgaa 780 caagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgac 840 tgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcagggg 900 cgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgag 960 gcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgtt 1020 gtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctg 1080 tcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctg 1140 catacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcga 1200 gcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcag 1260 gggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgatgat 1320 ctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttt 1380 tctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttg 1440 gctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctt 1500 tacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttc 1560 ttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcac 1620 gagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccggg 1680 acgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccacggga 1740 tctctgcggaacaggcggtcgaaggtgccgatatcattacgacagcaacggccgacaagc 1800 acaacgccacgatcctgagcgacaatatgatcgggcccggcgtccacatcaacggcgtcg 1860 gcggcgactgcccaggcaagaccgagatgcaccgcgatatcttgctgcgttcggatattt 1920 tcgtggagttcccgccacagacccggatgatccccgatcgttcaaacatttggcaataaa 1980 gtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttga 2040 attacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggttt 2100 ttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcg 2160 caaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggcctcctgtc 2220 aatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgag 2280 ggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttcc 2340 ggtgattttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgcc 2400 gatgaaaacgcgctacagtctgacgctaaaggcaaacttgattctgtcgctactgattac 2460 ggtgctgctatcgatggtttcattggtgacgtttccggccttgctaatggtaatggtgct 2520 actggtgattttgctggctctaattcccaaatggctcaagtcggtgacggtgataattca 2580 cctttaatgaataatttccgtcaatatttaccttccctccctcaatcggttgaatgtcgc 2640 ccttttgtctttggcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaa 2700 tgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaat 2760 gtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatg 2820 ttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattac 2880 gccaagctggcgcgccaagcttgcatgcctgcaggtccccagattagccttttcaatttc 2940 agaaagaatgctaacccacagatggttagagaggcttacgcagcaggtctcatcaagacg 3000 atctacccgagcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgca 3060 gtcaaaagattcaggactaactgcatcaagaacacagagaaagatatatttctcaagatc 3120 agaagtactattccagtatggacgattcaaggcttgcttcacaaaccaaggcaagtaata 3180 gagattggagtctctaaaaaggtagttcccactgaatcaaaggccatggagtcaaagatt 3240 caaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctc 3300 ttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacacttgtc 3360 tactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaa 3420 caaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttatt 3480 gtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaag 3540 gccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgagg 3600 agcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgat 3660 atctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctct 3720 atataaggaagttcatttcatttggagagaacacgggggactctagaccaccatgaccta 3780 cccgaggaggcgctaccgcaggaggaggcacaggccgaggagccacctgggccagatcct 3840 gaggaggcgcccgtggctggtgcacccgaggcaccgctaccgctggaggcgcaagaacgg 3900 catcttcaacacccgcctgagccgcaccttcggctacaccgtgaagcgcaccaccgtgac 3960 caccccaagctgggccgtggacatgatgcgcttcaagatcgacgacttcgtgccaccagg 4020 cggcggcaccaacaagatcagcatccccttcgagtactaccgcatccgcaaggtgaaggt 4080 ggagttctggccgtgctccccgatcacccagggcgacaggggcgtgggcagcaccgccgt 4140 gatcctggacgacaacttcgtgaccaaggccaccgccctgacctacgacccgtacgtgaa 4200 ctactccagccgccacaccatcccgcagccgttcagctaccacagccgctacttcacccc 4260 gaagccggtgctggacagcaccatcgactacttccagccgaacaacaagcgcaaccagct 4320 gtggctgcgcctccagaccagcggcaacgtggaccatgtgggcctgggcgctgccttcga 4380 gaacagcaagtacgaccaggactacaacatccgcgtgaccatgtacgtccagttccgcga 4440 gttcaacctgaaggacccgccgctgaagccgtgatgacccgggtaccgagctcgaatttc 4500 cccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtctt 4560 gcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaa 4620 tgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaa 4680 tacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtca 4740 tctatgttactagatcgggaattcatcgatgatgggtaccgagctcgaattcttaattaa 4800 caattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaact 4860 taatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcac 4920 cgatcgcccttcccaacagttgcgcagcctgaatggcgcccgctcctttcgctttcttcc 4980 cttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctt 5040 tagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgatttgggtgatg 5100 gttcacaaactatcagtgtttgacaggatatattggcgggtaaacctaagagaaaagagc 5160 gtttattagaataatcggatatttaaaagggcgtgaaaaggtttatccgttcgtccattt 5220 gtatgtgcatgccaaccacagg

SEQ ID NO: 35 PLG153 T-DNA ctgatgggctgcctgtatcgagtggtgattttgtgccgagctgccggtcggggagctgtt 60 ggctggctggtggcaggatatattgtggtgtaaacaaattgacgcttagacaacttaata 120 acacattgcggacgtttttaatgtactggggtggtttttcttttcaccagtgagacgggc 180 aacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctg 240 gtttgccccagcaggcgaaaatcctgtttgatggtggttccgaaatcggcaaaatccctt 300 ataaatcaaaagaatagcccgagatagggttgagtgttgttccagtttggaacaagagtc 360 cactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatg 420 gcccacaaactgaaggcgggaaacgacaatctgatcatgagcggagaattaagggagtca 480 cgttatgacccccgccgatgacgcgggacaagccgttttacgtttggaactgacagaacc 540 gcaacgttgaaggagccactcagccgcgggtttctggagtttaatgagctaagcacatac 600 gtcagaaaccattattgcgcgttcaaaagtcgcctaaggtcactatcagctagcaaatat 660 ttcttgtcaaaaatgctccactgacgttccataaattcccctcggtatccaattagagtc 720 tcatattcactctcaatccaaataatctgcaccggatctggatcgtttcgcatgattgaa 780 caagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgac 840 tgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcagggg 900 cgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgag 960 gcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgtt 1020 gtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctg 1080 tcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctg 1140 catacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcga 1200 gcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcag 1260 gggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgatgat 1320 ctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttt 1380 tctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttg 1440 gctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctt 1500 tacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttc 1560 ttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcac 1620 gagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccggg 1680 acgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccacggga 1740 tctctgcggaacaggcggtcgaaggtgccgatatcattacgacagcaacggccgacaagc 1800 acaacgccacgatcctgagcgacaatatgatcgggcccggcgtccacatcaacggcgtcg 1860 gcggcgactgcccaggcaagaccgagatgcaccgcgatatcttgctgcgttcggatattt 1920 tcgtggagttcccgccacagacccggatgatccccgatcgttcaaacatttggcaataaa 1980 gtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttga 2040 attacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggttt 2100 ttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcg 2160 caaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggcctcctgtc 2220 aatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgag 2280 ggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttcc 2340 ggtgattttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgcc 2400 gatgaaaacgcgctacagtctgacgctaaaggcaaacttgattctgtcgctactgattac 2460 ggtgctgctatcgatggtttcattggtgacgtttccggccttgctaatggtaatggtgct 2520 actggtgattttgctggctctaattcccaaatggctcaagtcggtgacggtgataattca 2580 cctttaatgaataatttccgtcaatatttaccttccctccctcaatcggttgaatgtcgc 2640 ccttttgtctttggcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaa 2700 tgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaat 2760 gtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatg 2820 ttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattac 2880 gccaagctggcgcgccaagcttgcatgcctgcaggtccccagattagccttttcaatttc 2940 agaaagaatgctaacccacagatggttagagaggcttacgcagcaggtctcatcaagacg 3000 atctacccgagcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgca 3060 gtcaaaagattcaggactaactgcatcaagaacacagagaaagatatatttctcaagatc 3120 agaagtactattccagtatggacgattcaaggcttgcttcacaaaccaaggcaagtaata 3180 gagattggagtctctaaaaaggtagttcccactgaatcaaaggccatggagtcaaagatt 3240 caaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctc 3300 ttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacacttgtc 3360 tactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaa 3420 caaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttatt 3480 gtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaag 3540 gccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgagg 3600 agcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgat 3660 atctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctct 3720 atataaggaagtteattteatttggagagaacacgggggactctagaccaccatgaccta 3780 cccgaggaggcgctaccgcaggaggagcgtgaacccgaggagccacctgggccagatcct 3840 gaggaggcgcccgtggctggtgcacccgaggcaccgctaccgctggagcgtgaacaacgg 3900 catcttcaacacccgcctgagccgcaccttcggctacaccgtgaagcgcaccaccgtgac 3960 caccccaagctgggccgtggacatgatgcgcttcaagatcgacgacttcgtgccaccagg 4020 cggcggcaccaacaagatcagcatccccttcgagtactaccgcatccgcaaggtgaaggt 4080 ggagttctggccgtgctccccgatcacccagggcgacaggggcgtgggcagcaccgccgt 4140 gatcctggacgacaacttcgtgaccaaggccaccgccctgacctacgacccgtacgtgaa 4200 ctactccagccgccacaccatcccgcagccgttcagctaccacagccgctacttcacccc 4260 gaagccggtgctggacagcaccatcgactacttccagccgaacaacaagcgcaaccagct 4320 gtggctgcgcctccagaccagcggcaacgtggaccatgtgggcctgggcgctgccttcga 4380 gaacagcaagtacgaccaggactacaacatccgcgtgaccatgtacgtccagttccgcga 4460 gttcaacctgaaggacccgccgctgaagccgtgatgacccgggtaccgagctcgaatttc 4500 cccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtctt 4560 gcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaa 4620 tgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaa 4680 tacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtca 4740 tctatgttactagatcgggaattcatcgatgatgggtaccgagctcgaattcttaattaa 4800 caattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaact 4860 taatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcac 4920 cgatcgcccttcccaacagttgcgcagcctgaatggcgcccgctcctttcgctttcttcc 4980 cttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctt 5040 tagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgatttgggtgatg 5100 gttcacaaactatcagtgtttgacaggatatattggcgggtaaacctaagagaaaagagc 5160 gtttattagaataatcggatatttaaaagggcgtgaaaaggtttatccgttcgtccattt 5220 gtatgtgcatgccaaccacagg SEQ ID NO: 36 pLG154 T-DNA tggcaggatatattgtggtgtaaacaaattgacgcttagacaacttaataacacattgcg 60 gacgtttttaatgtactgaattaacgccgaattaattcctagtgatctggattttagtac 120 tggattttggttttaggaattagaaattttattgatagaagtattttacaaatacaaata 180 catactaagggtttcttatatgctcaacacatgagcgaaaccctataggaaccctaattc 240 ccttatctgggaactactcacacattattatggagaaagatgggtcagaagaactcgtca 300 agaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgagg 360 aagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatg 420 tcctgatagcggtccgccacacccagccggccacagtcgatgaatccagaaaagcggcca 480 ttttccaccatgatattcggcaagcaggcatcgccatgtgtcacgacgagatcctcgccg 540 tcgggcatgcgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctct 600 tcgtccagatcatcctgatcgacaagaccggcttccatccgagtacgtgctcgctcgatg 660 cgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgc 720 attgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcc 780 tgccccggcacttcgcccaatagcagccagtcccttcccgcttcagtgacaacgtcgagc 840 acagctgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgcctcgtcctgg 900 agttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgcccctgcgct 960 gacagccgaaacacggcggcatcagagcagccgattgtctgttgtgcccagtcatagccg 1020 aatagcctctccacccaagcggccggagaacctgcgtgcaatccatcttgttcaatcatc 1080 tcgagagatccggtgcagattatttggattgagagtgaatatgagactctaattggatac 1140 cgaggggaatttatggaacgtcagtggagcatttttgacaagaaatatttgctagctgat 1200 agtgaccttaggcgacttttgaacgcgcaataatggtttctgacgtatgtgcttagctca 1260 ttaaactccagaaacccgcggctgagtggctccttcaacgttgcggttctgtcagttcca 1320 aacgtaaaacggcttgtcccgcgtcatcggcgggggtcataacgtgactcccttaattct 1380 ccgctcatgatcgggcccggcgcgccaagcttgcatgcctgcaggtccccagattagcct 1440 tttcaatttcagaaagaatgctaacccacagatggttagagaggcttacgcagcaggtct 1500 catcaagacgatctacccgagcaataatctccaggaaatcaaataccttcccaagaaggt 1560 taaagatgcagtcaaaagattcaggactaactgcatcaagaacacagagaaagatatatt 1620 tctcaagatcagaagtactattccagtatggacgattcaaggcttgcttcacaaaccaag 1680 gcaagtaatagagattggagtctctaaaaaggtagttcccactgaatcaaaggccatgga 1740 gtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcat 1800 acagagtctcttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacga 1860 cacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattga 1920 gacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctg 1980 tcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcga 2040 taaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggaccccc 2100 acccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtgga 2160 ttgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaaga 2220 cccttcctctatataaggaagtteatttcatttggagagaacacgggggactctagacca 2280 ccatgacctacccgaggaggcgctaccgcaggaggaggcacaggccgaggagccacctgg 2340 gccagatcctgaggaggcgcccgtggctggtgcacccgaggcaccgctaccgctggaggc 2400 gcaagaacggcatcttcaacacccgcctgagccgcaccttcggctacaccgtgaagcgca 2460 ccaccgtgaccaccccaagctgggccgtggacatgatgcgcttcaagatcgacgacttcg 2520 tgccaccaggcggcggcaccaacaagatcagcatccccttcgagtactaccgcatccgca 2580 aggtgaaggtggagttctggccgtgctccccgatcacccagggcgacaggggcgtgggca 2640 gcaccgccgtgatcctggacgacaacttcgtgaccaaggccaccgccctgacctacgacc 2700 cgtacgtgaactactccagccgccacaccatcccgcagccgttcagctaccacagccgct 2760 acttcaccccgaagccggtgctggacagcaccatcgactacttccagccgaacaacaagc 2820 gcaaccagctgtggctgcgcctccagaccagcggcaacgtggaccatgtgggcctgggcg 2880 ctgccttcgagaacagcaagtacgaccaggactacaacatccgcgtgaccatgtacgtcc 2940 agttccgcgagttcaacctgaaggacccgccgctgaagccgtgatgacccgggaattcta 3000 agaggagtccaccatggtagatctgactagtgttaacgctagccaccaccaccaccacca 3060 cgtgtgaattacaggtgaccagctcgaatttccccgatcgttcaaacatttggcaataaa 3120 gtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttga 3180 attacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggttt 3240 ttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcg 3300 caaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggaattaaact 3360 atcagtgtttgacaggatatattggcgggtaaacctaagagaaaagagcgttta

SEQ ID NO: 37 pLG155 T-DNA tggcaggatatattgtggtgtaaacaaattgacgcttagacaacttaataacacattgcg 60 gacgtttttaatgtactgaattaacgccgaattaattcctagtgatctggattttagtac 120 tggattttggttttaggaattagaaattttattgatagaagtattttacaaatacaaata 180 catactaagggtttcttatatgctcaacacatgagcgaaaccctataggaaccctaattc 240 ccttatctgggaactactcacacattattatggagaaagatgggtcagaagaactcgtca 300 agaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgagg 360 aagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatg 420 tcctgatagcggtccgccacacccagccggccacagtcgatgaatccagaaaagcggcca 480 ttttccaccatgatattcggcaagcaggcatcgccatgtgtcacgacgagatcctcgccg 540 tcgggcatgcgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctct 600 tcgtccagatcatcctgatcgacaagaccggcttccatccgagtacgtgctcgctcgatg 660 cgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgc 720 attgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcc 780 tgccccggcacttcgcccaatagcagccagtcccttcccgcttcagtgacaacgtcgagc 840 acagctgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgcctcgtcctgg 900 agttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgcccctgcgct 960 gacagccgaaacacggcggcatcagagcagccgattgtctgttgtgcccagtcatagccg 1020 aatagcctctccacccaagcggccggagaacctgcgtgcaatccatcttgttcaatcatc 1080 tcgagagatccggtgcagattatttggattgagagtgaatatgagactctaattggatac 1140 cgaggggaatttatggaacgtcagtggagcatttttgacaagaaatatttgctagctgat 1200 agtgaccttaggcgacttttgaacgcgcaataatggtttctgacgtatgtgcttagctca 1260 ttaaactccagaaacccgcggctgagtggctccttcaacgttgcggttctgtcagttcca 1320 aacgtaaaacggcttgtcccgcgtcatcggcgggggtcataacgtgactcccttaattct 1380 ccgctcatgatcgggcccggcgcgccaagcttgcatgcctgcaggtccccagattagcct 1440 tttcaatttcagaaagaatgctaacccacagatggttagagaggcttacgcagcaggtct 1500 catcaagacgatctacccgagcaataatctccaggaaatcaaataccttcccaagaaggt 1560 taaagatgcagtcaaaagattcaggactaactgcatcaagaacacagagaaagatatatt 1620 tctcaagatcagaagtactattccagtatggacgattcaaggcttgcttcacaaaccaag 1680 gcaagtaatagagattggagtctctaaaaaggtagttcccactgaatcaaaggccatgga 1740 gtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcat 1800 acagagtctcttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacga 1860 cacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattga 1920 gacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctg 1980 tcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcga 2040 taaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggaccccc 2100 acccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtgga 2160 ttgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaaga 2220 cccttcctctatataaggaagttcatttcatttggagagaacacgggggactctagacca 2280 ccatgacctacccgaggaggcgctaccgcaggaggagcgtgaacccgaggagccacctgg 2340 gccagatcctgaggaggcgcccgtggctggtgcacccgaggcaccgctaccgctggagcg 2400 tgaacaacggcatcttcaacacccgcctgagccgcaccttcggctacaccgtgaagcgca 2460 ccaccgtgaccaccccaagctgggccgtggacatgatgcgcttcaagatcgacgacttcg 2520 tgccaccaggcggcggcaccaacaagatcagcatccccttcgagtactaccgcatccgca 2580 aggtgaaggtggagttctggccgtgctccccgatcacccagggcgacaggggcgtgggca 2640 gcaccgccgtgatcctggacgacaacttcgtgaccaaggccaccgccctgacctacgacc 2700 cgtacgtgaactactccagccgccacaccatcccgcagccgttcagctaccacagccgct 2760 acttcaccccgaagccggtgctggacagcaccatcgactacttccagccgaacaacaagc 2820 gcaaccagctgtggctgcgcctccagaccagcggcaacgtggaccatgtgggcctgggcg 2880 ctgccttcgagaacagcaagtacgaccaggactacaacatccgcgtgaccatgtacgtcc 2940 agttccgcgagttcaacctgaaggacccgccgctgaagccgtgatgacccgggaattcta 3000 agaggagtccaccatggtagatctgactagtgttaacgctagccaccaccaccaccacca 3060 cgtgtgaattacaggtgaccagctcgaatttccccgatcgttcaaacatttggcaataaa 3120 gtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttga 3180 attacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggttt 3240 ttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcg 3300 caaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggaattaaact 3360 atcagtgtttgacaggatatattggcgggtaaacctaagagaaaagagcgttta

SEQ ID NO: 38 Primer PCVII-F ATGACCTACCCGAGGAGGCG

SEQ ID NO: 39

Primer PCVII-F2

ATGATGCGCTTCAAGATCGACG

SEQ ID NO: 40 Primer PCVII-R TTGTCGTCCAGGATCACGGC

Claims

CLAIMSWe claim:

1. A transgene construct comprising a plant transformation vector inserted by exogenous DNA, wherein the exogenous DNA contains a nucleotide sequence derived from porcine circo virus type II.

2. The transgene construct in claim 1, wherein said plant transformation vector is selected from a group consisting of pATJX, pSAT, pBIN, or pCAMBIA vector.

3. The transgene construct of claim 2 wherein said plant transformation vector is a pBIN or pCAMBIA vector.

4. The transgene construct of claim 1, wherein said exogenous DNA further comprises a promoter and a terminator.

5. The transgene construct of claim 4, wherein said promoter is from a plant virus.

6. The transgene construct of claim 5, wherein said promoter is from cauliflower mosaic virus.

7. The transgene construct of claim 6, wherein said promoter is long 35S promoter.

8. The transgene construct of claim 4, wherein said terminator is Nopaline Synthase Terminator.

9. The transgene construct of claim 1, wherein said nucleotide sequence is from an open reading frame.

10. The transgene construct of claim 9, wherein said open reading frame is open reading frame 1, 2, 3, or 4, or a combination thereof.

11. The transgene construct of claim 10, wherein said open reading frame is open reading frame 2.

12. The transgene construct of claims 9, wherein said open reading frame is adapted to Monocotyledon codon usage.

13. The transgene construct of claim 9, wherein said open reading frame is mutated.

14. The transgene construct of 13, wherein said open reading frame contains 6 mutations in the Nuclear Localization Sequence.

15. The transgene construct of claim 1 , wherein the construct can transform a host.

16. The transgene construct of claim 15, wherein the host is a plant host.

17. The transgene construct of claim 16, wherein plant host is selected from the group consisting of Nicotiana tabacum, Nicotiana bethamiana, Arabidopsis thaliana, Lemna gibba, Lemna minor, Spirodela oligorrhiza, Dichanthium annulatum, Lemna gibba, Lemna minor, Spirodela oligorrhiza, tomato, banana, turnip, black-eyed bean, soybean, oilseed rape, Ethiopian mustard, potato, rice, tobacco, wheat, Lemna gibba, Lemna minor, and Spirodela oligorrhiza.

18. The transgene construct of claim 17, wherein the plant host is Lemna gibba, Lemna minor, or Spirodela oligorrhiza.

19. An expression product generated in a host transformed by the transgene construct of claim 1.

20. A method for inducing an immunological response against porcine circovirus comprising administering the gene expression product of claim 19.

21. A composition for inducing an immunological response against porcine circovirus comprising the gene expression product of claim 19 and a pharmaceutically or veterinarily or medically acceptable carrier.

22. The composition of claim 21 , further comprising an adjuvant.

23. A method for inducing an immunological response against porcine circovirus comprising administering the composition of claim 21.