KR102331436B1 - Composition Comprising Glycoprotein Fraction of the Flower Extract or Hydrolysate Derived from the Glycoprotein Fraction, and Method of Producing Glycoprotein Fraction of the Flower Extract and Hydrolysate Derived from the Glycoprotein Fraction - Google Patents

Abstract

The present invention relates to a glycoprotein fraction of a flower extract or a glycoprotein fraction derived from a flower extract. A composition comprising a hydrolyzate as an active ingredient, a glycoprotein fraction of a flower extract, and a method for producing a hydrolyzate derived therefrom. More specifically, the present invention relates to a glycoprotein fraction of a flower extract having an effect of improving skin elasticity, improving skin wrinkles, improving skin moisture, enhancing skin barrier function, improving skin whitening, alleviating skin inflammation, improving hair condition, and antioxidant activity, or It relates to a composition comprising, as an active ingredient, a hydrolyzate of a glycoprotein derived from the glycoprotein fraction of the flower extract, and a method for preparing the same.

Description

A composition comprising a glycoprotein fraction of a flower extract or a hydrolyzate derived therefrom, and a method for preparing a glycoprotein fraction of a flower extract and a hydrolyzate derived therefrom Fraction, and Method of Producing Glycoprotein Fraction of the Flower Extract and Hydrolysate Derived from the Glycoprotein Fraction}

The present invention relates to a glycoprotein fraction of a flower extract or a glycoprotein fraction derived from a flower extract. A composition comprising a hydrolyzate as an active ingredient, a glycoprotein fraction of a flower extract, and a method for producing a hydrolyzate derived therefrom. More specifically, the present invention relates to a glycoprotein fraction of a flower extract having an effect of improving skin elasticity, improving skin wrinkles, improving skin moisture, enhancing skin barrier function, improving skin whitening, alleviating skin inflammation, improving hair condition, and antioxidant activity, or It relates to a composition comprising, as an active ingredient, a hydrolyzate of a glycoprotein derived from the glycoprotein fraction of the flower extract, and a method for preparing the same.

Skin condition improvement effects such as skin aging prevention, skin elasticity improvement, skin wrinkle improvement, skin moisture improvement, skin barrier function enhancement, skin whitening improvement, skin inflammation improvement, antioxidant activity effect, and hair strength improvement, hair loss prevention, hair growth promotion, hair growth Various cosmetic raw materials are being developed that have the effect of improving the condition of the scalp/hair, such as promotion, hair promotion, dandruff prevention, white hair prevention, and hair gloss improvement. There is a problem, and in the case of animal raw materials, the use of animal raw materials is rapidly decreasing due to a decline in consumer preference and ripples such as mad cow disease, so eco-friendly raw materials such as vegetable raw materials are in the spotlight.

A number of plants that can be used as a vegetable raw material are known, and in general, plant outages, roots, stems, leaves, flowers, fruits, or a combination thereof are usefully used.

According to the prior art, there are a number of prior art related to a composition for external application for skin containing an extract prepared by using a flower as a vegetable raw material (see Patent Documents 1-7 below).

However, in the prior art, extracts obtained from flowers, which are vegetable raw materials, have been simply added to skin or hair application products, and in fact, a plurality of glycoproteins and sugars (carbohydrates) that are particularly active and industrially useful in such extracts are used. There has never been a case in which a purified product containing

Under this technical background, the present inventors have made diligent efforts to develop a composition for improving skin and hair condition, preferably a pharmaceutical composition and cosmetic composition for improving skin and hair condition, as a result, brown flower, citrus flower, kandong flower, kwangnam flower, gold and silver flower, chrysanthemum , Laurel Flower, Gaehwa Flower, Green Tea Flower, Evening Primrose, Camellia Flower, Daisy, Drawing Flower, Lavender, Marigold, Plum Flower, Peony, Mugunghwa, Honeysuckle Flower, White Peony, Lily of the Valley, Balsam Flower, Hydrangea, Pomegranate Flower, Sunbok Flower, Daffodil, Water Lily, Lotus Flower, Rapeseed A glycoprotein fraction of an extract derived from at least one flower selected from the group consisting of flowers, ginseng flower, jasmine, rose, geranium, calendula, pansy and safflower, or a hydrolyzate derived from the glycoprotein fraction of the flower extract as an active ingredient The composition containing It has a skin whitening effect by inhibiting synthesis, an anti-inflammatory effect that suppresses the expression of inflammatory cytokines due to UV irradiation, an effect of improving hair strength/gloss, and an antioxidant effect of eliminating ROS, The present invention has been completed.

Republic of Korea Patent Publication No. 10-2006-0095135 (2006.08.31) Republic of Korea Patent Registration No. 10-1796710 (2017.11.06) Republic of Korea Patent Publication No. 10-2013-0050675 (2013.05.16) Republic of Korea Patent Registration No. 10-1723526 (2017.03.30) Republic of Korea Patent Registration No. 10-1499457 (2015.03.02) Republic of Korea Patent Publication No. 10-2016-0139072 (2016.12.07) Republic of Korea Patent Publication No. 10-2017-0120952 (2017.11.01)

An object of the present invention is to improve skin elasticity, improve skin wrinkles, improve skin moisture, enhance skin barrier function, improve skin whitening, relieve skin inflammation, improve hair condition, and a glycoprotein fraction of a flower extract having antioxidant activity, or derived therefrom To provide a composition comprising the hydrolyzate obtained as an active ingredient, a glycoprotein fraction of a flower extract, and a method for producing a hydrolyzate thereof.

In order to achieve the above object, the present invention provides a glycoprotein fraction of a flower extract having an isoelectric point (pI) value of 3.0 to 7.0, preferably 3.5 to 6.5, or a hydrolyzate derived from the glycoprotein fraction of the flower extract. It provides a composition for improving skin elasticity and improving skin wrinkles, preferably a composition for external application for the skin, more preferably a pharmaceutical composition for external application for the skin or a cosmetic composition for external application for skin, comprising as an active ingredient.

The present invention also improves skin moisturizing and skin dryness comprising, as an active ingredient, a glycoprotein fraction of a flower extract having an isoelectric point value of 3.0 to 7.0, preferably 3.5 to 6.5, or a hydrolyzate derived from the glycoprotein fraction of the flower extract. A composition for external application, preferably a composition for external application to the skin, more preferably a pharmaceutical composition for external application for skin or a cosmetic composition for external application for skin.

The present invention also provides a composition for enhancing skin barrier function comprising, as an active ingredient, a glycoprotein fraction of a flower extract having an isoelectric point value of 3.0 to 7.0, preferably 3.5 to 6.5, or a hydrolyzate derived from the glycoprotein fraction of the flower extract. , Preferably it provides a composition for external application to the skin, more preferably a pharmaceutical composition for external application for the skin or a cosmetic composition for external application to the skin.

The present invention also provides a composition for skin whitening comprising, as an active ingredient, a glycoprotein fraction of a flower extract having an isoelectric point value of 3.0 to 7.0, preferably 3.5 to 6.5, or a hydrolyzate derived from the glycoprotein fraction of the flower extract, as an active ingredient, preferably Preferably, it provides a composition for external application to the skin, more preferably a pharmaceutical composition for external application for the skin or a cosmetic composition for external application to the skin.

The present invention also provides a composition for alleviating skin inflammation comprising, as an active ingredient, a glycoprotein fraction of a flower extract having an isoelectric point value of 3.0 to 7.0, preferably 3.5 to 6.5, or a hydrolyzate derived from the glycoprotein fraction of the flower extract, Preferably, it provides a composition for external application to the skin, more preferably a pharmaceutical composition for external application for the skin or a cosmetic composition for external application to the skin.

The present invention also provides strength and shine of hair comprising as an active ingredient a glycoprotein fraction of a flower extract having an isoelectric point value of 3.0 to 7.0, preferably 3.5 to 6.5, or a hydrolyzate derived from the glycoprotein fraction of the flower extract. To provide a composition for improving hair condition, preferably a composition for external application to the skin, more preferably a pharmaceutical composition for external application to the skin or a cosmetic composition for external application to the skin.

The present invention also provides a method for preparing a glycoprotein fraction of a flower extract, and a hydrolyzate derived therefrom,

(a) centrifuging the raw material mixture in which flowers and water are mixed to obtain a flower extract containing the glycoprotein of the upper layer formed from the raw material mixture;

(b) adjusting the pH of the obtained flower extract to precipitate a glycoprotein having an isoelectric point of pH 3.0 to 7.0, preferably pH 3.5 to 6.5 to obtain a glycoprotein fraction;

(c) adding a hydrolase to the obtained glycoprotein fraction to obtain a hydrolyzed reaction product; and

(d) filtering the supernatant of the reaction product formed by centrifuging the obtained reaction product to obtain a hydrolyzate; and a method for preparing a hydrolyzate derived therefrom. .

According to the present invention, the flowers are brown flower, tangerine flower, kandong flower, tangerine flower, gold and silver flower, chrysanthemum, chrysanthemum flower, gooseberry, green tea flower, evening primrose, camellia flower, daisy, fig flower, lavender, marigold, plum, peony, mugunghwa, and honeysuckle flower It may be one or more selected from the group consisting of , white rhododendron, chrysanthemum, balsam, hydrangea, pomegranate, rhododendron, daffodil, water lily, lotus, rapeseed, ginseng, jasmine, rose, geranium, calendula, pansy, and safflower, but limited thereto. it's not going to be

The composition comprising the glycoprotein fraction of a flower extract according to the present invention or a hydrolyzate derived from the glycoprotein fraction of the flower extract as an active ingredient suppresses the expression of collagenase in skin cells to improve skin elasticity and improve skin wrinkles Anti-inflammatory that exerts effects, increases skin moisture, promotes lipid synthesis in skin cells, strengthens skin barrier function, inhibits melanin synthesis, has a skin whitening effect, and suppresses expression of inflammatory cytokines caused by UV irradiation It has an effect, an effect of improving the strength/gloss of hair, and an antioxidant effect of eliminating ROS.

1, 2 and 3 show glycoprotein fractions of flower extracts according to Examples 1 to 36 and Examples 37 to 72, hydrolyzates derived from the glycoprotein fractions of flower extracts according to Examples 73 to 108, Examples Collagen in skin cells of a mixture consisting of glycoprotein fractions of different flower extracts according to 109-126 and Examples 127-144 and a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145-162 The degree of the degrading enzyme (MMP-1) expression inhibitory ability is shown as a graph.
4, 5 and 6 show glycoprotein fractions of flower extracts according to Examples 1 to 36 and Examples 37 to 72, hydrolyzates derived from the glycoprotein fractions of flower extracts according to Examples 73 to 108, Examples Moisturizing in skin cells of a mixture consisting of glycoprotein fractions of different flower extracts according to 109-126 and Examples 127-144 and a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145-162 The degree of performance is shown graphically.
7, 8 and 9 show glycoprotein fractions of flower extracts according to Examples 1 to 36 and Examples 37 to 72, hydrolyzates derived from the glycoprotein fractions of flower extracts according to Examples 73 to 108, Examples Lipids in skin cells of a mixture consisting of glycoprotein fractions of different flower extracts according to 109-126 and Examples 127-144 and a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145-162 It is a graph showing the degree of skin barrier function strengthening effect according to the synthesis promotion.
10, 11 and 12 show glycoprotein fractions of flower extracts according to Examples 1 to 36 and Examples 37 to 72, hydrolysates derived from the glycoprotein fractions of flower extracts according to Examples 73 to 108, Examples Effect of reducing hair roughness of a mixture consisting of glycoprotein fractions of different flower extracts according to 109 to 126 and Examples 127 to 144, and a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162 and a graph showing the degree of hair gloss improvement effect.
13 is a photograph showing the degree of the hair roughness reduction effect and the hair gloss improvement effect of the hydrolyzate derived from the glycoprotein fraction of the rose extract according to Example 104 through a sensory test.
14 is a photograph showing the degree of hair roughness reduction effect and hair gloss improvement effect on bleached hair (or bleached hair tress) of a hydrolyzate derived from a glycoprotein fraction of a rose extract according to Example 104 using an electron microscope. (scale bar in the upper panel: 10 μm; scale bar in the lower panel: 1 μm).
15, 16 and 17 show glycoprotein fractions of flower extracts according to Examples 1 to 36 and Examples 37 to 72, hydrolysates derived from the glycoprotein fractions of flower extracts according to Examples 73 to 108, Examples Antioxidant activity by a mixture consisting of glycoprotein fractions of different flower extracts according to 109 to 126 and Examples 127 to 144 and a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162 The degree is shown graphically.
18, 19 and 20 show glycoprotein fractions of flower extracts according to Examples 1 to 36 and Examples 37 to 72, hydrolysates derived from the glycoprotein fractions of flower extracts according to Examples 73 to 108, Examples UV irradiation of a mixture consisting of glycoprotein fractions of different flower extracts according to 109-126 and Examples 127-144 and a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145-162 It is a graph showing the degree of scavenging ability for reactive oxygen species.
FIG. 21 is a UV diagram of a hydrolyzate derived from a glycoprotein fraction of a rose extract according to Example 104. FIG. The degree of clearance (effect) on ROS due to the treatment was observed with a fluorescence microscope in keratinocytes (scale bar: 1000 μm).
22, 23 and 24 show glycoprotein fractions of flower extracts according to Examples 1 to 36 and Examples 37 to 72, hydrolysates derived from the glycoprotein fractions of flower extracts according to Examples 73 to 108, Examples Oxidative stress of a mixture consisting of glycoprotein fractions of different flower extracts according to 109-126 and Examples 127-144 and a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145-162 The degree of scavenging ability for reactive oxygen species caused by this is shown in a graph.
25 is a photograph showing the degree of elimination (effect) of a hydrolyzate derived from a glycoprotein fraction of a rose extract according to Example 104 on reactive oxygen species (ROS) due to oxidative stress observed under a fluorescence microscope in keratinocytes; (scale bar: 400 μm).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is those well known and commonly used in the art.

Hereinafter, the present invention will be described in more detail.

As used herein, the term “about” used to express volume, area, length, time (period), concentration, dose (content, molecular weight, etc.), temperature, etc. has a tolerance of up to 10% in the corresponding numerical value or numerical range. means to do

In one aspect, the present invention provides a glycoprotein fraction of a flower extract having an isoelectric point (pI) value of 3.0 to 7.0, preferably an isoelectric point value of 3.5 to 6.5, or a hydrolyzate derived from the glycoprotein fraction of the flower extract. It relates to a composition comprising as an active ingredient, preferably a composition for external application to the skin, and more preferably to a pharmaceutical composition for external application for the skin or a cosmetic composition for external application to the skin.

In another aspect, the present invention is a method for producing a glycoprotein fraction of a flower extract, and a hydrolyzate derived therefrom, comprising the steps (a) to (d) below.

(a) centrifuging the raw material mixture in which flowers and water are mixed to obtain a flower extract containing the glycoprotein of the upper layer formed from the raw material mixture;

(b) adjusting the pH of the obtained flower extract to precipitate a glycoprotein having an isoelectric point of pH 3.0 to 7.0, preferably pH 3.5 to 6.5 to obtain a glycoprotein fraction;

(c) adding a hydrolase to the obtained glycoprotein fraction to obtain a hydrolyzed reaction product; and

(d) filtering the supernatant of the reaction product formed by centrifuging the obtained reaction product to obtain a hydrolyzate.

The flower extract obtained in step (a) is prepared by mixing a raw material mixture such that the weight ratio of flowers and water is 1:2 to 1:10, preferably 1:4 to 1:8, and then the raw material mixture is mixed with 20 to After standing at a temperature of 60 ° C., preferably 45-60 ° C., more preferably 50-55 ° C. for a predetermined time, preferably 2-10 hours, more preferably 4-8 hours, centrifugation is performed to It may be characterized as a flower extract containing the glycoprotein of the upper layer formed from the raw material mixture by removing the precipitate including the flower residue formed from the raw material mixture.

The reaction product obtained in step (c) is obtained by adding water to the glycoprotein fraction obtained so that the weight ratio of the glycoprotein fraction and water is 1:10 to 1:20, preferably 1:12 to 1:16. After preparing the lysate, a hydrolase is added to the lysate to prepare a hydrolysis reaction product such that the weight ratio of the lysate and the hydrolase is 1:0.1 to 1:10, and then 30 to 60° C., preferably 40 It can be characterized as obtained by hydrolysis at a temperature of ~50 ℃ for 2 to 8 hours, preferably 4 to 6 hours.

The hydrolyzate obtained in step (d) is 0.1 to 10.0 μm, preferably 1.0 to 10.0 μm, more preferably 7.0 to 9.0, a supernatant of the reaction product formed by centrifuging the obtained reaction product. It may be characterized in that it is obtained by filtration (microfiltration) to a size of μm.

In the present invention, the glycoprotein fraction obtained in step (b) is obtained as a glycoprotein fraction purified through steps (1) and (2) below, and then passes through steps (c) and (d). It can be obtained as a filtered hydrolyzate.

Specifically, in step (1), an extraction solvent is added to the glycoprotein fraction obtained in step (b), so that the weight ratio of the glycoprotein fraction and the extraction solvent is 1:2 to 1:10, preferably 1: After preparing the mixture so as to be 4 to 1:8, centrifuging the mixture to remove the solution in the upper layer formed from the mixture, and obtaining a stock solution containing the glycoprotein in the lower layer formed from the mixture,

Step (2) is a step of drying the obtained stock solution at a temperature of 40 to 60° C., preferably 45 to 55° C. to obtain a purified glycoprotein fraction.

The centrifugation may be characterized in that it is centrifuged using a centrifuge at 3,800 to 10,000 rpm or 1,500 to 15,000 x g, preferably 8,000 rpm or 5,000 x g.

In the present invention, the flowers are brown flower, tangerine flower, kandong flower, gwangnam flower, gold and silver flower, chrysanthemum, chrysanthemum flower, gooseberry, green tea flower, evening primrose, camellia flower, daisy, fig flower, lavender, marigold, plum, peony, mugunghwa, and honeysuckle flower It may be one or more selected from the group consisting of , white rhododendron, chrysanthemum, balsam, hydrangea, pomegranate, rhododendron, daffodil, water lily, lotus, rapeseed, ginseng, jasmine, rose, geranium, calendula, pansy, and safflower, but limited thereto. it's not going to be

In general, since the glycoprotein has an isoelectric point value of 3.0 to 7.0, preferably 3.5 to 6.5, fractions extracted within this range contain a high content of glycoprotein, and fractions extracted under other isoelectric point conditions may also contain glycoproteins. However, it may affect the physical properties of glycoproteins. For example, when glycoproteins are extracted at too low or too high pH, physical properties may be changed due to glycoprotein denaturation.

In the present invention, the glycoprotein fraction of the flower extract contains a plurality of glycoproteins as a main component, and a plurality of sugars, preferably a polysaccharide (polysaccharide), oligosaccharide, trisaccharide as a component , may contain one or more saccharides selected from the group consisting of disaccharides and monosaccharides, but the types of glycoproteins and saccharides may vary depending on the type of flower used.

For example, the saccharide is glucose, galactose, mannose, xylose, rhamnose, arabinose, fucose, fructose. (fructose) and the like.

In the present invention, the molecular weight range of the glycoprotein fraction may be 1,000 to 700,000 Da, but the molecular weight range of the glycoprotein fraction may vary depending on the type of flower used.

In the present invention, the molecular weight range of the hydrolyzate derived from the glycoprotein fraction of the flower extract may be 250 to 1,000 Da, preferably 250 to 750 Da, but depending on the type of flower used, the molecular weight range of the hydrolyzate is may be subject to change.

In the present invention, the hydrolyzate is a glycoprotein fraction of the flower extract protease (protease), pectinase (pectinase), α, β- glucosidase (α, β-glucosidase), amyloglucosidase ( amyloglucosidase), beta-glucanase (β-glucanase), cellulase, naringinase, α-amylase, hemicellulase, arabinase, xylanase One hydrolase selected from the group consisting of xylanase and tannase, or two or more, preferably three or more, most preferably four or more kinds of hydrolysis selected from the group It may be characterized in that it is obtained by hydrolysis with a complex hydrolase composed of enzymes, but is not limited to the type and number of the enzymes.

In one embodiment of the present invention, the complex hydrolase may be a mixture of two or more hydrolases in the same weight, but is not limited thereto.

In the present invention, the content of the glycoprotein fraction of the flower extract contained in the composition or the hydrolyzate derived from the glycoprotein fraction of the flower extract is 0.01 to 10.0% by weight, preferably 0.01 to 1.0% by weight, most preferably may be characterized in containing in an amount of 0.01 to 0.05% by weight. When the content of the glycoprotein fraction of the flower extract or the hydrolyzate derived from the glycoprotein fraction of the flower extract is less than 0.01% by weight, skin elasticity improvement and skin wrinkle improvement, skin moisture improvement, skin barrier function enhancement, skin whitening improvement, skin When the content of the glycoprotein fraction of the flower extract or the hydrolyzate derived from the glycoprotein fraction of the flower extract exceeds 10.0% by weight, the formulation has almost no inflammation improvement, hair condition improvement (improvement of hair gloss, etc.), and antioxidant effect. may adversely affect stability.

In the present invention, when the active ingredient contained in the composition is a mixture consisting of two or more different 'glycoprotein fractions of flower extracts', each 'glycoprotein fractions of flower extracts' may be mixed by the same weight. , but is not limited thereto. For example, when the active ingredient included in the composition is a mixture consisting of two different 'glycoprotein fractions of flower extracts', the weight ratio of the two types of 'glycoprotein fractions of flower extracts' included in the mixture is 1:1, 1:2, 1:5, 1:10, 1:50, 1:100, 1:1,000, and the like.

In the present invention, in the case of a mixture consisting of two or more 'hydrolysates derived from glycoprotein fractions of flower extracts' with different active ingredients included in the composition, each 'hydrolyzate derived from glycoprotein fractions of flower extracts' ' may be mixed by the same weight, but is not limited thereto. For example, when the active ingredient contained in the composition is a mixture consisting of two different 'hydrolysates derived from glycoprotein fractions of flower extracts', two types of 'derived from glycoprotein fractions of flower extracts' included in the mixture The weight ratio of 'hydrolyzate' may be 1:1, 1:2, 1:5, 1:10, 1:50, 1:100, 1:1,000, and the like.

In the present invention, the composition can inhibit the expression of collagen-degrading enzymes in skin cells.

In the present invention, the composition can promote lipid synthesis in skin cells.

In the present invention, the composition can inhibit the activity of tyrosinase in skin cells.

In the present invention, the composition may have antioxidant activity.

In one aspect of the present invention, the "flower extract" includes all substances obtained by extracting the components of flowers, regardless of the extraction method, the extraction solvent, the extracted components or the form of the extract, and in the process of extracting the components It includes a material obtained through an extraction method including a process of treatment with heat, acid, base, enzyme, etc., and further processing or processing by another method after extracting the material obtained by extracting the components of the flower It is a broad concept that includes all materials that can be obtained by doing so, preferably raw materials in a form suitable for extracting the active ingredient of flowers.

In one aspect of the present invention, "flower" may be in the form of an extract, raw flowers, pulverized raw flowers, dried flowers, or dried pulverized flowers, but is not limited thereto. In addition, the flower used in the present specification is not limited in the method of obtaining it, and it can be cultivated and used or purchased and used commercially.

The flower extract may be prepared using an appropriate extraction solvent, and any solvent acceptable in the art may be used as the extraction solvent, and water or an organic solvent may be used. For example, purified water, methanol (methanol), ethanol (ethanol), propanol (propanol), isopropanol (isopropanol), alcohols having 1 to 4 carbon atoms, including butanol (butanol), acetone (acetone), ether (ether) , benzene, chloroform, ethyl acetate, methylene chloride, hexane, cyclohexane, and various solvents such as 1,3-butylene glycol alone It can be used as or a mixture, but is not limited thereto, and preferably, it is extracted using purified water, 10-100% (v/v) ethanol, or 10-80% (v/v) methanol.

As a method for preparing the flower extract, any one of hot water extraction method, cold needle extraction method, reflux cooling extraction method, solvent extraction method (polar solvent/non-polar solvent soluble extraction), steam distillation method, ultrasonic extraction method, elution method and compression method can be selected and used However, the present invention is not limited thereto.

In addition, the flower extract may be further purified by a conventional fractionation process and/or purification method. For example, the extract is a sugar contained in the extract by adjusting the pH of the extract to 3.0 to 7.0, preferably 3.5 to 6.5, which is near the isoelectric point of the glycoprotein in the primary extract extracted by hot water extraction or solvent extraction. After precipitating the protein, it is centrifuged at 8,000 rpm or 5,000 x g to obtain a fraction (secondary extract) containing the desired glycoprotein, and can be prepared in a powder state by additional processes such as vacuum distillation and freeze drying or spray drying. have. In addition, the first extract or the second extract is added using various chromatography methods such as silica gel column chromatography, thin layer chromatography, high performance liquid chromatography, etc. It is also possible to obtain a purified fraction.

That is, the flower extract is generally a concept including all extracts, fractions and purified products obtained in each step of extraction, fractionation or purification, and dilutions, concentrates or dried products thereof.

The solvent used to adjust the pH of the extract may adjust the pH of the extract to the desired pH by using a conventional alkali or acidic reagent, if necessary. Examples of the reagent include sodium hydroxide, potassium hydroxide, calcium hydroxide, hydrochloric acid, sulfuric acid, acetic acid, citric acid, phosphoric acid, and the like, but is not limited thereto.

In the present invention, the hair is any hair or hair on the body of mammals including humans, for example, hair, eyebrows, eyelashes, mustache, beard, chest hair, back hair, arm hair, leg hair, genital hair, nose hair or ear hair. However, the present invention is not limited thereto.

The composition according to the present invention is generally a composition for external application to the skin, and may be a cosmetic composition or a pharmaceutical composition, but is preferably a cosmetic composition.

The cosmetic composition according to an embodiment of the present invention may include, for example, basic cosmetics, makeup cosmetics, hair cosmetics, body cosmetics, etc., and the formulation is not particularly limited, and may be appropriately selected according to the purpose. have. For example, the cosmetic composition may be formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation and spray, etc. , but is not limited thereto. More specifically, softening lotion, nourishing lotion, lotion, body lotion, nourishing cream, massage cream, moisture cream, hand cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, gel, patch, oil in water Basic cosmetics such as (O/W) type and water-in-oil (W/O) type cosmetics, color cosmetics such as lipstick, makeup base or foundation, shampoo, conditioner, body cleanser, toothpaste, cleaning agent such as feminine wash or mouthwash, It may be formulated as a cosmetic composition for hair, such as hair dressing agents such as hair tonics, gels or mousses, and hair dyes or hair dyes.

The cosmetic composition according to an embodiment of the present invention includes a moisturizing agent (polyol, etc.), oil, wax, viscosity adjusting agent, thickener, pH adjusting agent, fat, organic solvent, and Solubilizer, thickener, gelling agent, emollient, antioxidant, suspending agent, stabilizer, foaming agent, fragrance, surfactant, water, ionic emulsifier, non-ionic emulsifier, filler, sequestering agent, chelating agent , preservatives, vitamins, humectants, dyes, pigments, hydrophilic actives, lipophilic actives, lipid vesicles or any other ingredients commonly used in cosmetics. have. In addition, the cosmetic composition according to an embodiment of the present invention may further contain a skin absorption promoting material in order to increase the skin condition improvement effect.

Pharmaceutical compositions according to an embodiment of the present invention include pharmaceutical adjuvants and other therapeutically useful substances (carriers, excipients, diluents, etc.) may further contain, and may be formulated in the form of various parenteral administration agents (coating agents) according to a conventional method.

The term “carrier” is defined as a compound that facilitates the addition of the compound into a cell or tissue. For example, dimethylsulfoxide (DMSO) is a commonly used carrier that facilitates the introduction of many organic compounds into cells or tissues of living organisms.

The term "excipient" is a substance added to make the drug easier to eat or to have a certain color and shape when the amount of the main drug is small in the preparation process of tablets or pills, and lactose or starch is mainly used do.

The term "diluent" is defined as a compound that not only stabilizes the biologically active form of the compound of interest, but is diluted in water which will dissolve the compound. Salts dissolved in buffer solutions are used as diluents in the art. A commonly used buffer solution is phosphate buffered saline because it mimics the salt state of human solutions. Because buffer salts can control the pH of a solution at low concentrations, buffer diluents rarely modify the biological activity of a compound.

The flower extract according to the present invention, a glycoprotein fraction of the flower extract, or a glycoprotein fraction of the flower extract. A pharmaceutical composition comprising a hydrolyzate may be administered (applied) to a human patient as such or as a pharmaceutical composition admixed with other active ingredients as in combination therapy or with suitable carriers or excipients.

Carriers, excipients and diluents that may be included in the pharmaceutical composition according to an embodiment of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition according to an embodiment of the present invention may be in the form of, for example, ointment, lotion, gel, cream, spray, suspension, emulsion, patch, etc., but is not limited thereto.

The pharmaceutical composition according to an embodiment of the present invention may be administered (applied) locally. The pharmaceutical composition according to an embodiment of the present invention may be locally administered (applied) to the scalp, for example.

In addition, the pharmaceutically acceptable dose of the active ingredient, that is, the dosage (application amount), is the age, sex, and weight of the subject to be treated, the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration (the route of application) ) and at the discretion of the prescriber. Determination of dosage (application amount) based on these factors is within the level of one of ordinary skill in the art. The dosage is, for example, 0.01 to 5,000 mg per 1 kg of body weight per day, preferably 0.1 to 2,000 mg, more preferably 0.5 to 500 mg, most preferably 1 to 100 mg per 1 kg of body weight. It can be administered (applied) in one to several divided doses, but the dosage is not intended to limit the scope of the present invention in any way.

The flower extract according to the present invention, a glycoprotein fraction of the flower extract, or a glycoprotein fraction of the flower extract. Since all hydrolyzates are natural substances, they are not toxic at all, so they can be continuously used in large amounts as pharmaceuticals.

In a pharmaceutical composition suitable for use in the present invention, an active ingredient comprising a flower extract according to the present invention, a glycoprotein fraction of said flower extract or a hydrolyzate derived from said glycoprotein fraction of said flower extract achieves its intended purpose. Compositions contained in the following effective amounts are included. More specifically, a therapeutically effective amount means an amount of a compound effective to prolong the survival of the subject being treated or to prevent, alleviate or ameliorate the symptoms of a disease. Determination of a therapeutically effective amount is within the ability of one of ordinary skill in the art, particularly in light of the detailed disclosure provided herein.

The flower extract according to the present invention used in the methods of the present invention, the glycoprotein fraction of the flower extract, the hydrolyzate derived from the glycoprotein fraction of the flower extract, and the composition (compounds) comprising them as an active ingredient A therapeutically effective amount or a cosmetically effective amount (eg, an effective amount to exert a skin lightening effect upon inhibition of the activity of tyrosinase) can be initially determined from in vitro tests or cell culture assays. For example, a therapeutic dose or cosmetic dose may be administered in an animal model to obtain a circulating concentration range that includes the _{IC 50} (half maximal inhibitory concentration) or EC _{50 (half maximal effective concentration) determined in an in vitro test or in cell culture.} can be calculated from Such information can be used to more accurately determine useful doses in humans.

In addition, the toxicity and therapeutic efficacy of the flower extract according to the present invention, the glycoprotein fraction of the flower extract, the hydrolyzate derived from the glycoprotein fraction of the flower extract, and the composition (compounds) comprising them as an active ingredient are, for example, For example, to determine LD ₅₀ (lethal dose for 50% of population), ED ₅₀ (dose having a therapeutic effect on _{50% of population), IC 50} (dose with therapeutic inhibitory effect on 50% of population) For this purpose, it can be estimated by cell culture or table pharmaceutical procedures in laboratory animals. The dose ratio between the toxic and therapeutic effects is the therapeutic index, _{which can be expressed as the ratio between LD 50} and ED ₅₀ (or IC ₅₀ ), a flower extract according to the invention showing a high therapeutic index, a glycoprotein fraction of the flower extract, A hydrolyzate derived from the glycoprotein fraction of the flower extract, and a composition (compounds) comprising them as an active ingredient are preferred. The data obtained from these cell culture assays can be used to estimate a range of doses for use in humans, and include a flower extract according to the present invention, a glycoprotein fraction of a flower extract, a hydrolyzate derived from the glycoprotein fraction of the flower extract, and The dosage or application amount of the composition (compounds) containing them as an active ingredient is preferably within the range of circulating concentrations including the _{ED 50} (or IC _{50 ) in the state with little or no toxicity.}

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

[Reference Example 1] Preparation of flower raw materials

Brown flower, tangerine flower, Kandong flower, Gwangnam flower, gold and silver flower, chrysanthemum, Laurel flower, Goehwa, green tea flower, evening primrose, camellia flower, daisy, drawing, lavender, marigold, plum, peony, mugunghwa, honeydew flower, white sagebrush, chrysanthemum, balsam, hydrangea , pomegranate flower, rhododendron flower, daffodil, water lily, lotus flower, rape flower, ginseng flower, jasmine, rose, geranium, calendula, pansy, and safflower were collected, respectively, and dried using a conventional flower drying method in a well-ventilated room. .

[Examples 1-36] Preparation of glycoprotein fractions of flower extracts

The dried flower raw material of Reference Example 1 was mixed with water at a temperature of about 30° C. at a ratio of 1:6 by weight (= flower raw material: water), and then left for about 6 hours while maintaining the temperature, the flower raw material extracts were obtained.

Then, by centrifuging at 8,000 rpm or 5,000 x g using a centrifugal dehydrator to remove the pellet of the extract to obtain a liquid extract and to obtain a desired glycoprotein from the extract, the pH of the extract is adjusted to 3.0 Glycoproteins having an isoelectric point of ˜7.0, precisely 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5 were specifically precipitated and then centrifuged at 8,000 rpm or 5,000×g to obtain the desired glycoprotein fraction. In order to further purify the obtained glycoprotein fraction, ethanol, an extraction solvent, was added to the glycoprotein fraction by about 6 times the weight of the glycoprotein fraction and mixed, and then the mixture was centrifuged at 8,000 rpm or 5,000 xg to centrifuge the upper layer formed from the mixture. was removed, and a stock solution containing a glycoprotein having high viscosity in the lower layer formed from the mixture (higher viscosity than the solution in the upper layer) was obtained. Then, the stock solution was dried at a temperature of about 50° C. to obtain a glycoprotein fraction of the flower extract (yield: about 1 to 2% by weight).

The glycoprotein fractions of the obtained flower extract are shown in Examples 1 to 36 in Table 1 below.

sample Glycoprotein in Flower Extract fraction sample Glycoprotein fraction of flower extract Example 1 Glycoprotein fraction of brown algae extract Example 19 Glycoprotein fraction of wheatgrass extract Example 2 Glycoprotein fraction of citrus flower extract Example 20 Glycoprotein fraction of ringworm extract Example 3 Glycoprotein fraction of kandonghwa extract Example 21 Glycoprotein fractions of chrysanthemum extract Example 4 Glycoprotein fraction of Gwangnae flower extract Example 22 Glycoprotein fraction of Balsam extract Example 5 Glycoprotein fractions of gold leaf extract Example 23 Glycoprotein fraction of hydrangea extract Example 6 Glycoprotein fraction of chrysanthemum extract Example 24 Glycoprotein fraction of pomegranate extract Example 7 Glycoprotein fractions of the gallows extract Example 25 Glycoprotein fractions of the extract Example 8 Glycoprotein fraction of Goehwa extract Example 26 Glycoprotein fraction of narcissus extract Example 9 Glycoprotein fraction of green tea flower extract Example 27 Glycoprotein fraction of water lily extract Example 10 Glycoprotein fraction of evening primrose extract Example 28 Glycoprotein fraction of lotus flower extract Example 11 Glycoprotein fraction of camellia flower extract Example 29 Glycoprotein fraction of rape flower extract Example 12 Glycoprotein fraction of daisy extract Example 30 Glycoprotein fraction of ginseng flower extract Example 13 Glycoprotein fraction of Dohwa extract Example 31 Glycoprotein fraction of jasmine extract Example 14 Glycoprotein fraction of lavender extract Example 32 Glycoprotein fraction of rose extract Example 15 Glycoprotein fraction of marigold extract Example 33 Glycoprotein fraction of geranium extract Example 16 Glycoprotein fraction of plum extract Example 34 Glycoprotein fraction of calendula extract Example 17 Glycoprotein fraction of peony extract Example 35 Glycoprotein fraction of pansy extract Example 18 Glycoprotein fraction of Mugunghwa extract Example 36 Glycoprotein fraction of safflower extract

[ Example 37~ 72] flower Glycoproteins in the extract fraction of Produce

The dried flower raw material of Reference Example 1 was mixed with water at about 52.5° C. (temperature higher than the heating temperature used in the preparation of Examples 1-36) in a ratio of 1:6 by weight (= flower raw material: water), and then , and left for about 6 hours while maintaining the above temperature to obtain an extract of the flower raw material.

Then, by centrifuging at 8,000 rpm or 5,000 x g using a centrifugal dehydrator to remove the residue of the extract to obtain an extract and to obtain a desired glycoprotein from the extract, the pH of the extract is adjusted to 3.0 to 7.0, to be precise, 3.5, Glycoproteins having isoelectric points of 4.0, 4.5, 5.0, 5.5, 6.0, and 6.5 were specifically precipitated, and then centrifuged at 8,000 rpm or 5,000×g to obtain a desired glycoprotein fraction. In order to further purify the obtained glycoprotein fraction, ethanol, an extraction solvent, was added to the glycoprotein fraction by about 6 times the weight of the glycoprotein fraction and mixed, and then the mixture was centrifuged at 8,000 rpm or 5,000 xg to centrifuge the upper layer formed from the mixture. was removed, and a stock solution containing a glycoprotein having high viscosity in the lower layer formed from the mixture (higher viscosity than the solution in the upper layer) was obtained. Then, the stock solution was dried at a temperature of about 50° C. to obtain a glycoprotein fraction of the flower extract (yield: about 5% by weight).

The glycoprotein fractions of the obtained flower extract are shown in Examples 37 to 72 in Table 2 below.

sample Glycoprotein in Flower Extract fraction sample Glycoprotein fraction of flower extract Example 37 Glycoprotein fraction of brown algae extract Example 55 Glycoprotein fraction of wheatgrass extract Example 38 Glycoprotein fraction of citrus flower extract Example 56 Glycoprotein fraction of ringworm extract Example 39 Glycoprotein fraction of kandonghwa extract Example 57 Glycoprotein fractions of chrysanthemum extract Example 40 Glycoprotein fraction of Gwangnae flower extract Example 58 Glycoprotein fraction of Balsam extract Example 41 Glycoprotein fractions of gold leaf extract Example 59 Glycoprotein fraction of hydrangea extract Example 42 Glycoprotein fraction of chrysanthemum extract Example 60 Glycoprotein fraction of pomegranate extract Example 43 Glycoprotein fractions of the gallows extract Example 61 Glycoprotein fractions of the extract Example 44 Glycoprotein fraction of Goehwa extract Example 62 Glycoprotein fraction of narcissus extract Example 45 Glycoprotein fraction of green tea flower extract Example 63 Glycoprotein fraction of water lily extract Example 46 Glycoprotein fraction of evening primrose extract Example 64 Glycoprotein fraction of lotus flower extract Example 47 Glycoprotein fraction of camellia flower extract Example 65 Glycoprotein fraction of rape flower extract Example 48 Glycoprotein fraction of daisy extract Example 66 Glycoprotein fraction of ginseng flower extract Example 49 Glycoprotein fraction of Dohwa extract Example 67 Glycoprotein fraction of jasmine extract Example 50 Glycoprotein fraction of lavender extract Example 68 Glycoprotein fraction of rose extract Example 51 Glycoprotein fraction of marigold extract Example 69 Glycoprotein fraction of geranium extract Example 52 Glycoprotein fraction of plum extract Example 70 Glycoprotein fraction of calendula extract Example 53 Glycoprotein fraction of peony extract Example 71 Glycoprotein fraction of pansy extract Example 54 Glycoprotein fraction of Mugunghwa extract Example 72 Glycoprotein fraction of safflower extract

Since the glycoprotein extraction yield of the glycoprotein fractions prepared in Examples 37 to 72 was higher than in Examples 1 to 36, the hydrolyzate of Examples 73 to 108, which will be described later, was prepared using the sugars of the flower extracts prepared in Examples 37 to 72. The protein fraction was used.

[ Example 73~108] glycoprotein of flower extract by complex hydrolase from fractions derived hydrolyzate Produce

A lysate was prepared by dissolving the glycoprotein fraction of the flower extract prepared according to Examples 37 to 72 in water at a ratio of 1:15 to weight (= glycoprotein fraction: water), and then adding a protease (protease, Novozyme), a complex hydrolase of pectinase (Novozyme), glucosidase (Novozyme) and cellulase (Novozyme) (protease: pectinase: glucosidase: cellulase weight ratio = 1:1 1:1) by adding about 5.0% based on the weight of the lysate, and reacting the mixture at a temperature of about 45° C. for about 5 hours to hydrolyze the glycoproteins of the lysate contained in the mixture, The temperature inactivated the complex hydrolase contained in the mixture. Then, the mixture, that is, the reaction product obtained by hydrolyzing the glycoprotein of the lysate with the addition of a complex hydrolase, was centrifuged at 8,000 rpm or 5,000 x g using a centrifuge, filtered through a 5 μm filter, and concentrated. Then, the hydrolyzate of the glycoprotein derived from the glycoprotein fraction of the flower extract containing the low molecular weight peptide or amino acid of the glycoprotein was obtained by freeze-drying (yield: about 5% by weight). If purification is required after the concentration, 2-3 times the amount of ethanol is added to the concentrate to obtain a sinking hydrolyzate, and then freeze-dried to obtain a final hydrolyzate.

The glycoprotein hydrolysates derived from the glycoprotein fraction of the obtained flower extract are shown in Examples 73 to 108 in Table 3 below.

sample Glycoprotein in Flower Extract from fractions Derived hydrolyzate sample Glycoprotein in Flower Extract from fractions Derived hydrolyzate Example 73 Hydrolyzate derived from the glycoprotein fraction of the brown seaweed extract Example 91 Hydrolyzate derived from glycoprotein fraction of wheatgrass extract Example 74 Hydrolyzate derived from glycoprotein fraction of citrus flower extract Example 92 Hydrolyzate derived from glycoprotein fraction of ringworm extract Example 75 Hydrolyzate derived from glycoprotein fraction of kandonghwa extract Example 93 Hydrolyzate derived from the glycoprotein fraction of P. asiatica extract Example 76 Hydrolyzate derived from glycoprotein fraction of Kwangnae flower extract Example 94 Hydrolyzate derived from glycoprotein fraction of Balsamina extract Example 77 Hydrolyzate derived from the glycoprotein fraction of the gold leaf extract Example 95 Hydrolyzate derived from glycoprotein fraction of hydrangea extract Example 78 Hydrolyzate derived from glycoprotein fraction of Chrysanthemum extract Example 96 Hydrolyzate derived from glycoprotein fraction of pomegranate extract Example 79 Hydrolyzate derived from the glycoprotein fraction of the systemic extract Example 97 Hydrolyzate derived from the glycoprotein fraction of the ginseng extract Example 80 Hydrolyzate derived from glycoprotein fraction of Goehwa extract Example 98 Hydrolyzate derived from glycoprotein fraction of narcissus extract Example 81 Hydrolyzate derived from glycoprotein fraction of green tea flower extract Example 99 Hydrolyzate derived from glycoprotein fraction of water lily extract Example 82 Hydrolyzate derived from glycoprotein fraction of evening primrose extract Example 100 Hydrolyzate derived from glycoprotein fraction of lotus flower extract Example 83 Hydrolyzate derived from glycoprotein fraction of Camellia flower extract Example 101 Hydrolyzate derived from glycoprotein fraction of rape flower extract Example 84 Hydrolyzate derived from glycoprotein fraction of daisy extract Example 102 Hydrolyzate derived from glycoprotein fraction of ginseng flower extract Example 85 Hydrolyzate derived from glycoprotein fraction of Dohwa extract Example 103 Hydrolyzate derived from glycoprotein fraction of jasmine extract Example 86 Hydrolyzate derived from glycoprotein fraction of lavender extract Example 104 Hydrolyzate derived from glycoprotein fraction of rose extract Example 87 Hydrolyzate derived from glycoprotein fraction of marigold extract Example 105 Hydrolyzate derived from glycoprotein fraction of geranium extract Example 88 Hydrolyzate derived from glycoprotein fraction of plum extract Example 106 Hydrolyzate derived from glycoprotein fraction of Calendula extract Example 89 Hydrolyzate derived from glycoprotein fraction of peony extract Example 107 Hydrolyzate derived from glycoprotein fraction of pansy extract Example 90 Hydrolyzate derived from glycoprotein fraction of Mugunghwa extract Example 108 Hydrolyzate derived from glycoprotein fraction of safflower extract

[ Example 109~126] glycoproteins of different flower extracts in fractions preparation of a mixture consisting of

A mixture obtained by mixing the glycoprotein fractions of two types of flower extracts according to Examples 1 to 36 in a weight ratio of 1:1 is shown in Table 4 below as Examples 109 to 126.

sample Glycoproteins from different flower extracts in fractions A mixture consisting of (mixture of component 1 and component 2) Ingredient 1 Ingredient 2 Example 109 Glycoprotein fraction of rose extract (Example 32) Glycoprotein fraction of chrysanthemum extract (Example 6) Example 110 Glycoprotein fraction of rose extract (Example 32) Glycoprotein fraction of camellia flower extract (Example 11) Example 111 Glycoprotein fraction of rose extract (Example 32) Glycoprotein fraction of plum extract (Example 16) Example 112 Glycoprotein fraction of rose extract (Example 32) Glycoprotein fraction of peony extract (Example 17) Example 113 Glycoprotein fraction of rose extract (Example 32) Glycoprotein fraction of lotus extract (Example 28) Example 114 Glycoprotein fraction of rose extract (Example 32) Glycoprotein fraction of narcissus extract (Example 26) Example 115 Glycoprotein fraction of chrysanthemum extract (Example 6) Glycoprotein fraction of camellia flower extract (Example 11) Example 116 Glycoprotein fraction of chrysanthemum extract (Example 6) Glycoprotein fraction of plum extract (Example 16) Example 117 Glycoprotein fraction of chrysanthemum extract (Example 6) Glycoprotein fraction of peony extract (Example 17) Example 118 Glycoprotein fraction of chrysanthemum extract (Example 6) Glycoprotein fraction of lotus extract (Example 28) Example 119 Glycoprotein fraction of chrysanthemum extract (Example 6) Glycoprotein fraction of narcissus extract (Example 26) Example 120 Glycoprotein fraction of camellia flower extract (Example 11) Glycoprotein fraction of plum extract (Example 16) Example 121 Glycoprotein fraction of camellia flower extract (Example 11) Glycoprotein fraction of peony extract (Example 17) Example 122 Glycoprotein fraction of camellia flower extract (Example 11) Glycoprotein fraction of lotus extract (Example 28) Example 123 Glycoprotein fraction of camellia flower extract (Example 11) Glycoprotein fraction of narcissus extract (Example 26) Example 124 Glycoprotein fraction of plum extract (Example 16) Glycoprotein fraction of peony extract (Example 17) Example 125 Glycoprotein fraction of plum extract (Example 16) Glycoprotein fraction of lotus extract (Example 28) Example 126 Glycoprotein fraction of plum extract (Example 16) Glycoprotein fraction of narcissus extract (Example 26)

[ Example 127~144] glycoproteins of different flower extracts in fractions preparation of a mixture consisting of

A mixture obtained by mixing the glycoprotein fractions of two flower extracts according to Examples 37 to 72 in a weight ratio of 1:1 is shown in Table 5 below as Examples 127 to 144.

sample Glycoproteins from different flower extracts in fractions A mixture consisting of (mixture of component 1 and component 2) Ingredient 1 Ingredient 2 Example 127 Glycoprotein fraction of rose extract (Example 68) Glycoprotein fraction of chrysanthemum extract (Example 42) Example 128 Glycoprotein fraction of rose extract (Example 68) Glycoprotein fraction of camellia flower extract (Example 47) Example 129 Glycoprotein fraction of rose extract (Example 68) Glycoprotein fraction of plum extract (Example 52) Example 130 Glycoprotein fraction of rose extract (Example 68) Glycoprotein fraction of peony extract (Example 53) Example 131 Glycoprotein fraction of rose extract (Example 68) Glycoprotein fraction of lotus extract (Example 64) Example 132 Glycoprotein fraction of rose extract (Example 68) Glycoprotein fraction of narcissus extract (Example 62) Example 133 Glycoprotein fraction of chrysanthemum extract (Example 42) Glycoprotein fraction of camellia flower extract (Example 47) Example 134 Glycoprotein fraction of chrysanthemum extract (Example 42) Glycoprotein fraction of plum extract (Example 52) Example 135 Glycoprotein fraction of chrysanthemum extract (Example 42) Glycoprotein fraction of peony extract (Example 53) Example 136 Glycoprotein fraction of chrysanthemum extract (Example 42) Glycoprotein fraction of lotus extract (Example 64) Example 137 Glycoprotein fraction of chrysanthemum extract (Example 42) Glycoprotein fraction of narcissus extract (Example 62) Example 138 Glycoprotein fraction of camellia flower extract (Example 47) Glycoprotein fraction of plum extract (Example 52) Example 139 Glycoprotein fraction of camellia flower extract (Example 47) Glycoprotein fraction of peony extract (Example 53) Example 140 Glycoprotein fraction of camellia flower extract (Example 47) Glycoprotein fraction of lotus extract (Example 64) Example 141 Glycoprotein fraction of camellia flower extract (Example 47) Glycoprotein fraction of narcissus extract (Example 62) Example 142 Glycoprotein fraction of plum extract (Example 52) Glycoprotein fraction of peony extract (Example 53) Example 143 Glycoprotein fraction of plum extract (Example 52) Glycoprotein fraction of lotus extract (Example 64) Example 144 Glycoprotein fraction of plum extract (Example 52) Glycoprotein fraction of narcissus extract (Example 62)

[ Example 145~162] glycoproteins of different flower extracts from fractions derived go Preparation of mixtures of hydrolysates

A mixture obtained by mixing hydrolyzates derived from glycoprotein fractions of two types of flower extracts according to Examples 73 to 108 in a weight ratio of 1:1 is shown in Table 6 below as Examples 145 to 162.

sample Glycoproteins from different flower extracts from fractions derived hydrolyzate Mixture (mixture of component 1 and component 2) Ingredient 1 Ingredient 2 Example 145 Hydrolyzate derived from glycoprotein fraction of rose extract (Example 104) Hydrolyzate derived from glycoprotein fraction of Chrysanthemum extract (Example 78) Example 146 Hydrolyzate derived from glycoprotein fraction of rose extract (Example 104) Hydrolyzate derived from glycoprotein fraction of camellia flower extract (Example 83) Example 147 Hydrolyzate derived from glycoprotein fraction of rose extract (Example 104) Hydrolyzate derived from glycoprotein fraction of plum extract (Example 88) Example 148 Hydrolyzate derived from glycoprotein fraction of rose extract (Example 104) Hydrolyzate derived from glycoprotein fraction of peony extract (Example 89) Example 149 Hydrolyzate derived from glycoprotein fraction of rose extract (Example 104) Hydrolyzate derived from glycoprotein fraction of lotus extract (Example 100) Example 150 Hydrolyzate derived from glycoprotein fraction of rose extract (Example 104) Hydrolyzate derived from glycoprotein fraction of narcissus extract (Example 98) Example 151 Hydrolyzate derived from glycoprotein fraction of Chrysanthemum extract (Example 78) Hydrolyzate derived from glycoprotein fraction of camellia flower extract (Example 83) Example 152 Hydrolyzate derived from glycoprotein fraction of Chrysanthemum extract (Example 78) Hydrolyzate derived from glycoprotein fraction of plum extract (Example 88) Example 153 Hydrolyzate derived from glycoprotein fraction of Chrysanthemum extract (Example 78) Hydrolyzate derived from glycoprotein fraction of peony extract (Example 89) Example 154 Hydrolyzate derived from glycoprotein fraction of Chrysanthemum extract (Example 78) Hydrolyzate derived from glycoprotein fraction of lotus extract (Example 100) Example 155 Hydrolyzate derived from glycoprotein fraction of Chrysanthemum extract (Example 78) Hydrolyzate derived from glycoprotein fraction of narcissus extract (Example 98) Example 156 Hydrolyzate derived from glycoprotein fraction of camellia flower extract (Example 83) Hydrolyzate derived from glycoprotein fraction of plum extract (Example 88) Example 157 Hydrolyzate derived from glycoprotein fraction of camellia flower extract (Example 83) Hydrolyzate derived from glycoprotein fraction of peony extract (Example 89) Example 158 Hydrolyzate derived from glycoprotein fraction of camellia flower extract (Example 83) Hydrolyzate derived from glycoprotein fraction of lotus extract (Example 100) Example 159 Hydrolyzate derived from glycoprotein fraction of camellia flower extract (Example 83) Hydrolyzate derived from glycoprotein fraction of narcissus extract (Example 98) Example 160 Hydrolyzate derived from glycoprotein fraction of plum extract (Example 88) Hydrolyzate derived from glycoprotein fraction of peony extract (Example 89) Example 161 Hydrolyzate derived from glycoprotein fraction of plum extract (Example 88) Hydrolyzate derived from glycoprotein fraction of lotus extract (Example 100) Example 162 Hydrolyzate derived from glycoprotein fraction of plum extract (Example 88) Hydrolyzate derived from glycoprotein fraction of narcissus extract (Example 98)

[ comparative example 1~36] Preparation of flower extract

The dried flower raw material of Reference Example 1 was mixed with water at a temperature of about 30° C. at a ratio of 1:6 by weight (= flower raw material: water), and then left for about 6 hours while maintaining the temperature, the flower raw material extracts were obtained. Then, the extract was removed by centrifugation at 8,000 rpm or 5,000 x g using a centrifugal dehydrator to obtain an extract and concentrated to 1/10 to 3/10 of the volume of the extract to obtain a concentrate. Then, ethanol 4 to 5 times the volume of the concentrate was slowly added to the concentrate to proceed with an ethanol precipitation reaction, and when the precipitation reaction was completed, the ethanol was removed, washed and dried at a temperature of about 50° C. to obtain a flower extract. (Yield: about 5% by weight)

The obtained flower extracts are shown in Table 7 below as Comparative Examples 1 to 36.

sample flower extract sample flower extract Comparative Example 1 brown algae extract Comparative Example 19 Wheatfruit extract Comparative Example 2 Citrus Flower Extract Comparative Example 20 Ringworm Extract Comparative Example 3 kandong flower extract Comparative Example 21 Prickly pear extract Comparative Example 4 Gwangnae Flower Extract Comparative Example 22 Balsam extract Comparative Example 5 gold and silver extract Comparative Example 23 Hydrangea Extract Comparative Example 6 Chrysanthemum Extract Comparative Example 24 pomegranate extract Comparative Example 7 Laurel Flower Extract Comparative Example 25 Sunflower extract Comparative Example 8 Gohwa Extract Comparative Example 26 Narcissus Extract Comparative Example 9 Green Tea Flower Extract Comparative Example 27 water lily extract Comparative Example 10 Evening Primrose Extract Comparative Example 28 lotus extract Comparative Example 11 Camellia Extract Comparative Example 29 rape flower extract Comparative Example 12 daisy extract Comparative Example 30 Ginseng Flower Extract Comparative Example 13 dohwa extract Comparative Example 31 Jasmine Extract Comparative Example 14 lavender extract Comparative Example 32 rose extract Comparative Example 15 Marigold Extract Comparative Example 33 Geranium Extract Comparative Example 16 Plum Extract Comparative Example 34 Calendula Extract Comparative Example 17 peony extract Comparative Example 35 Pansy Extract Comparative Example 18 Mugunghwa Extract Comparative Example 36 Safflower Extract

[ comparative example 37~72] from flower extracts derived hydrolyzate Produce

The dried flower raw material of Reference Example 1 was mixed with water at a temperature of 45 to 60° C. in a ratio of 1:6 by weight (= flower raw material: water), and then left for about 3 hours while maintaining the temperature to leave the flower An extract of the raw material was obtained. Then, a mixed hydrolase of pectinase, cellulase and glucosidase (weight ratio of pectinase: cellulase: glucosidase = 1:1:1) was added to the extract in about 5% by weight based on the total weight of the extract The mixture prepared by adding inactivated. Then, after 7 days of low-temperature aging at a low temperature of 4-8°C, filtration with a 0.45 μm filter, concentration and freeze-drying were performed to obtain a hydrolyzate derived from the flower extract (yield: about 2-3% by weight) ).

The hydrolyzate derived from the obtained flower extract is shown in Table 8 below as Comparative Examples 37 to 72.

sample from flower extracts derived hydrolyzate sample from flower extracts derived hydrolyzate Comparative Example 37 Hydrolyzate derived from brown algae extract Comparative Example 55 Hydrolyzate derived from wheatgrass extract Comparative Example 38 Hydrolyzate derived from citrus flower extract Comparative Example 56 Hydrolyzate derived from ringworm extract Comparative Example 39 Hydrolyzate derived from kandonghwa extract Comparative Example 57 Hydrolyzate Derived from Prickly pear extract Comparative Example 40 Hydrolyzate derived from Kwangnae flower extract Comparative Example 58 Hydrolyzate derived from balsam extract Comparative Example 41 Hydrolyzate derived from gold extract Comparative Example 59 Hydrolyzate derived from hydrangea extract Comparative Example 42 Hydrolyzate derived from chrysanthemum extract Comparative Example 60 Hydrolyzate derived from pomegranate extract Comparative Example 43 Hydrolyzate derived from Laurel extract Comparative Example 61 Hydrolyzate derived from bald eagle extract Comparative Example 44 Hydrolyzate derived from Gohwal extract Comparative Example 62 Hydrolyzate derived from narcissus extract Comparative Example 45 Hydrolyzate derived from green tea flower extract Comparative Example 63 Hydrolyzate derived from water lily extract Comparative Example 46 Hydrolyzate derived from Evening Primrose Extract Comparative Example 64 Hydrolyzate derived from lotus flower extract Comparative Example 47 Hydrolyzate derived from camellia extract Comparative Example 65 Hydrolyzate derived from rape flower extract Comparative Example 48 Hydrolyzate derived from daisy extract Comparative Example 66 Hydrolyzate derived from ginseng flower extract Comparative Example 49 Hydrolyzate derived from Dohwa Extract Comparative Example 67 Hydrolyzate derived from jasmine extract Comparative Example 50 Hydrolyzate derived from lavender extract Comparative Example 68 Hydrolyzate derived from rose extract Comparative Example 51 Hydrolyzate derived from marigold extract Comparative Example 69 Hydrolyzate derived from geranium extract Comparative Example 52 Hydrolyzate derived from plum extract Comparative Example 70 Hydrolyzate derived from calendula extract Comparative Example 53 Hydrolyzate derived from peony extract Comparative Example 71 Hydrolyzate derived from pansy extract Comparative Example 54 Hydrolyzate derived from Mugunghwa extract Comparative Example 72 Hydrolyzate derived from safflower extract

[ comparative example 73~90] Preparation of a mixture consisting of different flower extracts

A mixture of two types of flower extracts according to Comparative Examples 1 to 36 in a weight ratio of 1:1 is shown in Table 9 below as Comparative Examples 73 to 90.

sample A mixture of different flower extracts (a mixture of components 1 and 2) Ingredient 1 Ingredient 2 Comparative Example 73 Rose Extract (Comparative Example 32) Chrysanthemum extract (Comparative Example 6) Comparative Example 74 Rose Extract (Comparative Example 32) Camellia flower extract (Comparative Example 11) Comparative Example 75 Rose Extract (Comparative Example 32) Plum extract (Comparative Example 16) Comparative Example 76 Rose Extract (Comparative Example 32) Peony extract (Comparative Example 17) Comparative Example 77 Rose Extract (Comparative Example 32) Lotus extract (Comparative Example 28) Comparative Example 78 Rose Extract (Comparative Example 32) Narcissus extract (Comparative Example 26) Comparative Example 79 Chrysanthemum extract (Comparative Example 6) Camellia flower extract (Comparative Example 11) Comparative Example 80 Chrysanthemum extract (Comparative Example 6) Plum extract (Comparative Example 16) Comparative Example 81 Chrysanthemum extract (Comparative Example 6) Peony extract (Comparative Example 17) Comparative Example 82 Chrysanthemum extract (Comparative Example 6) Lotus extract (Comparative Example 28) Comparative Example 83 Chrysanthemum extract (Comparative Example 6) Narcissus extract (Comparative Example 26) Comparative Example 84 Camellia flower extract (Comparative Example 11) Plum extract (Comparative Example 16) Comparative Example 85 Camellia flower extract (Comparative Example 11) Peony extract (Comparative Example 17) Comparative Example 86 Camellia flower extract (Comparative Example 11) Lotus extract (Comparative Example 28) Comparative Example 87 Camellia flower extract (Comparative Example 11) Narcissus extract (Comparative Example 26) Comparative Example 88 Plum extract (Comparative Example 16) Peony extract (Comparative Example 17) Comparative Example 89 Plum extract (Comparative Example 16) Lotus extract (Comparative Example 28) Comparative Example 90 Plum extract (Comparative Example 16) Narcissus extract (Comparative Example 26)

[ comparative example 91~108] from different flower extracts derived hydrolyzate mixture preparation

A mixture obtained by mixing hydrolyzates derived from two kinds of flower extracts according to Comparative Examples 37 to 72 in a weight ratio of 1:1 is shown in Table 10 below as Comparative Examples 91 to 108.

sample from different flower extracts derived hydrolyzate Mixture (mixture of component 1 and component 2) Ingredient 1 Ingredient 2 Comparative Example 91 Hydrolyzate derived from rose extract (Comparative Example 68) Hydrolyzate derived from chrysanthemum extract (Comparative Example 42) Comparative Example 92 Hydrolyzate derived from rose extract (Comparative Example 68) Hydrolyzate derived from camellia extract (Comparative Example 47) Comparative Example 93 Hydrolyzate derived from rose extract (Comparative Example 68) Hydrolyzate derived from plum extract (Comparative Example 52) Comparative Example 94 Hydrolyzate derived from rose extract (Comparative Example 68) Hydrolyzate derived from peony extract (Comparative Example 53) Comparative Example 95 Hydrolyzate derived from rose extract (Comparative Example 68) Hydrolyzate derived from lotus flower extract (Comparative Example 64) Comparative Example 96 Hydrolyzate derived from rose extract (Comparative Example 68) Hydrolyzate derived from narcissus extract (Comparative Example 62) Comparative Example 97 Hydrolyzate derived from chrysanthemum extract (Comparative Example 42) Hydrolyzate derived from camellia extract (Comparative Example 47) Comparative Example 98 Hydrolyzate derived from chrysanthemum extract (Comparative Example 42) Hydrolyzate derived from plum extract (Comparative Example 52) Comparative Example 99 Hydrolyzate derived from chrysanthemum extract (Comparative Example 42) Hydrolyzate derived from peony extract (Comparative Example 53) Comparative Example 100 Hydrolyzate derived from chrysanthemum extract (Comparative Example 42) Hydrolyzate derived from lotus flower extract (Comparative Example 64) Comparative Example 101 Hydrolyzate derived from chrysanthemum extract (Comparative Example 42) Hydrolyzate derived from narcissus extract (Comparative Example 62) Comparative Example 102 Hydrolyzate derived from camellia extract (Comparative Example 47) Hydrolyzate derived from plum extract (Comparative Example 52) Comparative Example 103 Hydrolyzate derived from camellia extract (Comparative Example 47) Hydrolyzate derived from peony extract (Comparative Example 53) Comparative Example 104 Hydrolyzate derived from camellia extract (Comparative Example 47) Hydrolyzate derived from lotus flower extract (Comparative Example 64) Comparative Example 105 Hydrolyzate derived from camellia extract (Comparative Example 47) Hydrolyzate derived from narcissus extract (Comparative Example 62) Comparative Example 106 Hydrolyzate derived from plum extract (Comparative Example 52) Hydrolyzate derived from peony extract (Comparative Example 53) Comparative Example 107 Hydrolyzate derived from plum extract (Comparative Example 52) Hydrolyzate derived from lotus flower extract (Comparative Example 64) Comparative Example 108 Hydrolyzate derived from plum extract (Comparative Example 52) Hydrolyzate derived from narcissus extract (Comparative Example 62)

[ test example 1] Glycoprotein from flower extract fraction , and glycoproteins of flower extracts fraction from derived hydrolyzate Determination of glycoprotein content

The glycoprotein fraction of the flower extract according to Examples 1 to 36 and Examples 37 to 72, the hydrolyzate derived from the glycoprotein fraction of the flower extract according to Examples 73 to 108, the flower extract according to Comparative Examples 1 to 36 and comparison In order to measure the total glycoprotein content of the hydrolyzate derived from the flower extract according to Examples 37 to 72, a BCA Assay (Bicinchoninic Acid Assay, BCA Assay) method was performed.

BCA assay

Protein is a measurement method using the property which can be reduced to Cu ^{1 +} copper ions from the Cu ^{2 +,} copper ions reduced by the glycoproteins there is to form a compound of violet to react with BCA sugar solutions under alkaline conditions , The amount of glycoprotein is measured using the increase in absorbance at 562 nm as more purple compounds are produced as the amount of glycoprotein increases. The specific experimental method is as follows.

First, using the micro BCT glycoprotein assay reagent kit (micro BCA protein assay reagent kit, cat. No. 23227, Pierce), 150 μl each of the standard solution and diluted samples (Examples 1-36 in each 96-well microplate) And the glycoprotein fraction of the flower extract according to Examples 37-72, the hydrolyzate derived from the glycoprotein fraction of the flower extract according to Examples 73-108, the flower extract according to Comparative Examples 1-36, or Comparative Examples 37-72 (hydrolyzate derived from a flower extract according to ) was added, and then BCA Kit WR (BCA Kit Working Reagent), a glycoprotein quantification reagent, was added and vortexed for 30 seconds. After reacting at a temperature of about 37° C. for 2 hours, absorbance was measured at 540 nm using a microplate reader (UVT-06685, Thermo max, USA) to prepare a calibration curve and quantify glycoproteins.

Tables 11 and 12 below show glycoprotein fractions of flower extracts according to Examples 1 to 36 and Examples 37 to 72, hydrolyzates derived from glycoprotein fractions of flower extracts according to Examples 73 to 108, and Comparative Examples 1 to It shows the total content (wt%) of glycoproteins contained in the hydrolyzate derived from the flower extract according to 36 and the flower extract according to Comparative Examples 37 to 72 (the raw materials in Tables 11 to 12 are Comparative Examples 1 to 72 and Examples Examples 1 to 108 show the sources used for manufacturing).

Raw material comparative example 1-18:
glycoprotein
content comparative example 37-54:
glycoprotein
content Example 1-18:
glycoprotein
content Example 37-54:
glycoprotein
content Example 73-90:
glycoprotein
content brown flower 8.7 9.9 10.1 11.5 13.2 citrus flower 13.2 13.8 14.1 14.6 15.4 Kandonghwa 15.4 15.7 16.2 16.6 17.5 Gwangnam Flower 22.1 22.5 22.7 23.0 23.2 gold coin 29.8 30.1 30.6 31.1 32.1 Chrysanthemum 12.3 13.2 13.8 14.4 15.0 laureate 9.7 10.1 10.2 10.7 11.2 gossip 11.6 12.1 12.3 12.9 13.5 green tea flower 14.3 15.0 16.2 17.1 18.9 evening primrose 28.7 29.4 30.1 31.3 32.4 camellia 21.6 21.7 22.1 22.5 22.8 daisy 18.5 18.6 19.1 20.5 21.9 drawing 8.7 9.0 9.7 10.0 10.8 lavender 6.4 6.6 7.2 7.9 8.5 marigold 3.3 3.6 3.8 4.6 5.3 plum blossom 9.8 10.1 11.2 13.2 15.5 peony 1.6 1.7 1.9 2.6 3.2 Rose of Sharon 8.7 9.1 9.5 10.0 10.9

Raw material comparative example 19-36:
glycoprotein
content comparative example 55-72:
glycoprotein
content Example 19-36:
glycoprotein
content Example 55-72:
glycoprotein
content Example 91-108:
glycoprotein
content honeysuckle 21.8 23.3 24.1 26.4 30.8 ringworm 6.8 7.1 7.2 9.5 10.9 chrysanthemum 15.4 17.3 18.1 18.6 19.2 balsam 9.6 10.3 11.1 11.5 12.9 hydrangea 2.6 3.8 5.2 7.7 12.3 pomegranate 2.7 3.1 7.9 10.7 18.5 dress shoes 12.8 14.2 15.1 15.5 17.6 daffodil 20.4 21.6 22.9 25.7 28.6 training 15.1 15.6 16.4 17.3 19.2 Lotus 12.1 13.9 14.8 16.7 19.7 rape flower 10.8 11.6 12.1 12.4 13.8 ginseng flower 6.7 7.6 8.2 9.3 10.4 Jasmine 5.2 7.1 15.8 16.1 26.5 rose 30.9 31.1 31.9 33.5 35.9 geranium 1.8 2.1 3.0 4.7 7.6 calendula 2.2 4.3 5.1 9.5 12.3 pansy 6.4 6.5 6.8 7.6 8.5 safflower 1.8 2.1 2.5 3.7 5.4

As a result, as shown in Tables 11 and 12, the content range of glycoproteins contained in each of the glycoprotein fractions of the flower extracts according to Examples 1 to 36 derived from various flowers is based on the total weight of the glycoprotein fraction. It was 1.9 to 31.9% by weight, and the content range of glycoproteins contained in each of the glycoprotein fractions of the flower extract according to Examples 37 to 72 was 2.6 to 33.5% by weight based on the total weight of the glycoprotein fraction, and Examples 73 to The content range of glycoproteins contained in each hydrolyzate derived from the glycoprotein fraction of the flower extract according to 108 was 3.2 to 35.9% by weight based on the total weight of the hydrolyzate, and in each of the flower extracts according to Comparative Examples 1 to 36 The content range of glycoproteins contained was 1.6 to 30.9% by weight based on the total weight of the flower extract, and the content range of glycoproteins contained in each hydrolyzate derived from the flower extract according to Comparative Examples 37 to 72 was that of the flower extract. It was confirmed that it was 1.7 to 31.1 wt% based on the total weight.

[ test example 2] Glycoprotein of flower extract fraction , and glycoproteins of flower extracts from fractions derived hydrolyzate Sugar content measurement and sugar type analysis

1) Determination of total sugar content

The glycoprotein fraction of the flower extract according to Examples 1 to 36 and Examples 37 to 72, the hydrolyzate derived from the glycoprotein fraction of the flower extract according to Examples 73 to 108, the flower extract according to Comparative Examples 1 to 36, and comparison Hydrolysates derived from flower extracts according to examples 37-72 In order to measure the total sugar content, a phenol-sulfate method was performed.

In the phenol-sulfate method, when reducing sugar is treated with concentrated sulfuric acid, it is dehydrated to form furfural or a derivative thereof. The absorbance of this derivative is measured and quantified at 490 nm. The experimental method is as follows.

First, a sample (a glycoprotein fraction of a flower extract according to Examples 1 to 36 and Examples 37 to 72, a hydrolyzate derived from a glycoprotein fraction of a flower extract according to Examples 73 to 108, and a hydrolyzate according to Comparative Examples 1 to 36 5% (w/v) phenol was added to 0.5 ml of a solution obtained by diluting a flower extract or a hydrolyzate derived from a flower extract according to Comparative Examples 37 to 72) in distilled water to a concentration of 1% (w/v). After adding ml, 2.5 ml of sulfuric acid was strongly added. Then, using a vortex mixer (vortex mixer) after vortexing (vortexing) for 30 seconds and left for about 20 minutes at a temperature of about 25 ℃ using a microplate reader (microplate reader, UVT-06685, Thermo max, USA) Then, absorbance was measured at 490 nm, a calibration curve was prepared, and total sugar was quantified.

Tables 13 and 14 below show glycoprotein fractions of flower extracts according to Examples 1 to 36 and Examples 37 to 72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73 to 108, and Comparative Examples 1 to It shows the total content (wt%) of sugars contained in the hydrolyzate derived from the flower extract according to 36 and the flower extract according to Comparative Examples 37 to 72 (the raw materials in Tables 13 to 14 are Comparative Examples 1 to 72 and Example 1) ~108 represents the source used for manufacturing).

Raw material comparative example 1-18:
sugar content comparative example 37-54:
sugar content Example 1-18:
sugar content Example 37-54:
sugar content Example 73-90:
sugar content brown flower 29.1 29.4 29.9 30.1 30.3 citrus flower 17.1 18.1 18.5 18.8 19.2 Kandonghwa 16.8 18.2 20.3 20.1 20.7 Gwangnam Flower 27.4 29.1 30.2 30.4 30.9 gold coin 24.3 26.7 27.1 27.9 28.8 Chrysanthemum 12.1 13.5 14.1 14.7 15.4 laureate 11.6 12.1 12.6 12.8 13.3 gossip 13.8 15.4 16.1 16.2 16.9 green tea flower 16.2 17.8 19.3 20.1 20.8 evening primrose 14.7 16.4 17.1 17.8 18.9 camellia 21.3 23.8 24.1 24.6 25.4 daisy 13.2 14.9 15.1 15.3 15.5 drawing 16.4 17.2 18.5 18.6 18.9 lavender 27.7 29.3 30.0 30.1 30.8 marigold 28.1 28.6 28.6 28.7 28.7 plum blossom 11.3 13.2 14.3 15.1 19.4 peony 15.3 15.9 16.3 18.1 18.6 Rose of Sharon 11.8 12.1 12.6 12.8 13.2

Raw material comparative example 19-36:
sugar content comparative example 55-72:
sugar content Example 19-36:
sugar content Example 55-72:
sugar content Example 91-108:
sugar content honeysuckle 28.1 29.2 29.8 30.1 30.8 ringworm 8.1 9.4 9.7 10.1 10.9 chrysanthemum 14.3 16.1 16.5 16.8 17.2 balsam 8.7 9.4 10.2 10.4 10.9 hydrangea 9.8 11.2 11.9 12.1 12.3 pomegranate 13.2 13.8 16.4 17.9 18.5 dress shoes 12.6 14.5 15.6 16.8 17.6 daffodil 5.3 6.2 6.7 7.6 8.6 training 17.8 18.6 18.8 18.9 19.2 Lotus 5.3 5.7 6.1 6.3 6.7 rape flower 4.8 6.4 7.5 9.0 9.8 ginseng flower 3.1 4.4 5.1 5.1 5.4 Jasmine 21.3 23.9 25.8 26.1 26.5 rose 31.8 33.4 34.5 35.0 35.9 geranium 4.5 5.6 6.4 7.1 7.6 calendula 10.2 11.1 11.6 11.8 12.3 pansy 5.3 6.2 7.7 8.0 8.5 safflower 3.1 4.4 4.7 5.1 5.4

As a result, as shown in Tables 13 and 14, the sugar content range in each of the glycoprotein fractions of the flower extracts according to Examples 1 to 36 derived from various flowers was 4.7 to 4.7 to the total weight of the glycoprotein fraction. It was 34.5% by weight, and the sugar content range in each of the glycoprotein fractions of the flower extract according to Examples 37 to 72 was 5.1 to 35.0% by weight based on the total weight of the glycoprotein fraction, and the flowers according to Examples 73 to 108 The sugar content range in each hydrolyzate derived from the glycoprotein fraction of the extract was 5.4 to 35.9 wt% based on the total weight of the hydrolyzate, and the sugar content range in each of the flower extracts according to Comparative Examples 1 to 36 was It was 3.1 to 31.8 wt% based on the total weight of the flower extract, and the sugar content range in each hydrolyzate derived from the flower extract according to Comparative Examples 37 to 72 was 4.4 to 33.4 wt% based on the total weight of the flower extract. was confirmed to be.

2) Determination of constituent sugars and their content

2.5 mg of the sample (hydrolyzate derived from the glycoprotein fraction of the flower extract according to Examples 73 to 108) was dissolved in 1 ml of tertiary distilled water, and then hydrolyzed using TFA (trifluoroacetic acid). Then, using a CarboPac ^TM PA1 column and Bio LC (HPAEC-PAD system, Dionex, USA), it was analyzed with an 18mM NaOH monosolvent gradient, and the flow rate was 1ml/min with a standard mixture of 1mM (Fucose, Rhamnose, Arabinose, Galactose, Glucose, Mannose, Xylose, Fructose) was used to prepare a calibration curve, and the per component of the sample and its content (% by weight) were confirmed.

As a result, as shown in Tables 15 and 16 below, the constituent sugars and their content of each hydrolyzate derived from the glycoprotein fractions of the flower extracts according to Examples 73 to 108 derived from various flowers depend on the type of flower. It was confirmed that they are different (the raw materials in Tables 15 to 16 show the sources used in the preparation of Examples 73 to 108).

Raw material Glucose
(weight%) Galactose
( weight% ) Mannose
(weight%) Xylose
(weight%) Rhamnose
(weight%) Arabinose
( weight% ) Fucose
(weight%) Fructose
(weight%) brown flower 37.1 58.1 10.0 3.9 9.1 16.3 1.8 N/D citrus flower 11.2 26.5 1.2 5.6 5.5 10.9 3.9 N/D Kandonghwa 36.5 12.3 0.7 8.2 5.3 8.5 5.6 0.2 Gwangnam Flower 32.8 11.8 3.8 10.9 3.9 28.9 10.2 N/D gold coin 50.1 4.8 7.4 16.7 2.0 10.9 8.2 N/D Chrysanthemum 13.7 3.9 8.3 2.1 3.8 20.8 5.4 0.1 laureate 12.2 4.5 8.1 0.0 3.8 11.9 1.2 N/D gossip 20.1 16.7 4.9 0.3 4.9 10.2 1.6 N/D green tea flower 15.0 28.9 5.2 0.0 16.8 10.3 11.8 N/D evening primrose 18.3 10.9 10.9 0.0 16.7 5.9 4.8 0.8 camellia 11.0 20.8 14.5 2.3 28.9 1.8 3.9 0.1 daisy 13.2 27.5 5.6 1.9 10.9 2.1 4.5 N/D drawing 23.4 16.9 4.8 3.9 2.4 2.4 7.1 N/D lavender 50.8 27.5 6.3 3.8 3.6 1.6 8.1 N/D marigold 30.8 50.2 15.8 2.4 2.5 5.4 5.6 N/D plum blossom 24.3 16.7 3.1 2.2 3.4 6.7 2.2 1.6 peony 52.4 11.2 2.0 0.0 3.9 3.9 3.9 N/D Rose of Sharon 43.2 15.4 0.0 0.0 5.4 4.8 1.8 0.2

Raw material Glucose
(weight%) Galactose
( weight% ) Mannose
(weight%) Xylose
(weight%) Rhamnose
(weight%) Arabinose
( weight% ) Fucose
(weight%) Fructose
(weight%) honeysuckle 163.9 20.3 3.8 0.0 1.9 3.9 2.8 N/D ringworm 16.7 2.9 11.8 1.9 3.1 4.5 1.9 N/D chrysanthemum 10.9 6.9 3.9 4.5 4.8 28.9 2.1 N/D balsam 20.8 7.5 3.7 1.7 5.5 0.0 2.9 N/D hydrangea 27.5 12.9 5.4 1.6 0.0 1.8 1.7 1.2 pomegranate 16.9 19.8 1.2 8.2 18.5 11.0 1.6 N/D dress shoes 27.5 11.2 3.5 1.7 12.3 13.2 8.2 N/D daffodil 11.9 5.4 2.8 0.0 8.1 23.4 8.3 N/D training 10.2 30.2 2.7 0.5 4.9 18.5 10.5 0.4 Lotus 28.9 3.4 5.2 3.9 8.3 16.7 3.3 N/D rape flower 10.3 3.6 12.9 0.0 3.8 11.3 1.1 N/D ginseng flower 5.9 8.9 1.1 0.0 4.9 12.6 1.8 0.9 Jasmine 45.6 9.7 1.3 2.1 2.9 15.7 2.1 0.8 rose 90.6 27.0 15.2 2.5 6.7 49.8 3.4 N/D geranium 8.7 13.2 0.0 0.0 6.9 8.5 1.6 N/D calendula 19.8 19.8 11.2 0.0 4.8 5.6 5.4 1.6 pansy 15.2 4.9 5.9 3.9 3.9 8.9 3.9 N/D safflower 10.2 5.5 3.6 0.0 4.5 1.2 7.8 N/D

[ test example 3] Glycoprotein of flower extract fraction , and glycoproteins of flower extracts from fractions derived hydrolyzate Molecular weight measurement

In order to measure the molecular weight of the glycoprotein fraction of the flower extract according to Examples 37 to 72 and the hydrolyzate derived from the glycoprotein fraction of the flower extract according to Examples 73 to 108, the GPC-RI system (Gel permeation Chromatography-Refractive Index system) ) (Agilent 1260 Series System, Agilent, USA) and column (Agilent PL aqagel Mixed-M, OH-30, Agilent, USA) were used to analyze molecular weight. A sample (a glycoprotein fraction of a flower extract according to Examples 37 to 72, or a hydrolyzate derived from a glycoprotein fraction of a flower extract according to Examples 73 to 108) was prepared at a concentration of 1 mg/ml and filtered through a 0.45 μm filter After that, distilled water was analyzed as a mobile phase at a flow rate of 1 ml/min at a temperature of 35° C.

In addition, in order to convert the average molecular weight of each hydrolyzate derived from the glycoprotein fraction of the flower extract according to Examples 37 to 72 and the glycoprotein fraction of the flower extract according to Examples 73 to 108, which is the sample, into Daltons (Da), As a standard material, a calibration curve of molecular weight according to the delay time in the column of the sample was prepared and confirmed using polysaccharides for each molecular weight as a standard material, and as a result, glycoprotein fractions of the flower extracts according to Examples 37 to 72 regardless of the flower type The molecular weight range of was about 1,000 to 700,000a, and it was confirmed that the molecular weight range of the hydrolyzate derived from the glycoprotein fraction of the flower extract according to Examples 73 to 108 was about 250 to 1,000 Da (data not shown).

[ test example 4] Glycoprotein in flower extract fraction , and glycoproteins of flower extracts from fractions derived hydrolyzate Collagen degrading enzyme in skin cells ( MMP -1) expression deterrent evaluation

Glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples 127-144 A mixture consisting of glycoprotein fractions of different flower extracts according to MMP-1 ( The ability to inhibit matrix metalloproteinase-1) expression was confirmed.

^{First, human fibroblasts (Human Dermal Fibroblast, HDF) were cultured in a 6-well plate 1x10 5} using DMEM (Dulbecco Modified Eagle Medium, Gibco) supplemented with penicillin/streptomycin and 10% FBS (Fetal Bovine Serum, Gibco). After seeding with cells/well (cells/well), it was cultured in an incubator at _{37° C./5% CO 2 for about 24 hours.} Thereafter, the medium used for HDF culture was removed, HBSS (Hanks' Balanced Salt Solution, Welgene, Korea) was added, and the remaining HDFs except for the non-UVB-irradiated group were irradiated with UVB ^{of 220 mJ/cm 2 and the sample (Example 1~} 36 and the glycoprotein fraction of the flower extract according to Examples 37-72, the hydrolyzate derived from the glycoprotein fraction of the flower extract according to Examples 73-108, and different types according to Examples 109-126 and 127-144 A mixture consisting of a glycoprotein fraction of a flower extract, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162, a flower extract according to Comparative Examples 1 to 36, and a flower extract according to Comparative Examples 37 to 72 A hydrolyzate derived from a flower extract, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, or a mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108) is diluted with DMEM to obtain a final throughput After treatment so as to be 0.001% by weight ([No treat]: UVB non-irradiated group; [(-) Control]: UVB irradiated group), the cells were further cultured for about 72 hours. Then, the expression level of MMP-1 contained in the medium of HDF was measured using an ELISA kit (Human Total MMP-1 DuoSet ELISA KIT, R&D Systems) capable of measuring the expression level of MMP-1 (each sample). Measured in triplicate samples and averaged).

As a result, as shown in FIGS. 1 and 2 below, the glycoprotein fractions of the flower extracts according to Examples 1 to 36 and Examples 37 to 72 derived from various flowers and the sugars of the flower extracts according to Examples 73 to 108 It was confirmed that the hydrolyzate derived from the protein fraction had a higher ability to inhibit MMP-1 expression than the hydrolyzate derived from the flower extract according to Comparative Examples 1 to 36 and the flower extract according to Comparative Examples 37 to 72 (graphs of FIGS. 1 and 2 ) The X-axis represents raw materials (sources) used in the preparation of Comparative Examples 1 to 72 and Examples 1 to 108).

In addition, as shown in FIG. 3 below, a mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, and glycoproteins of different flower extracts according to Examples 145 to 162 The mixture of the hydrolyzate derived from the fraction had a higher MMP-1 expression inhibition ability than the mixture of the different flower extracts according to Comparative Examples 73 to 90 and the hydrolyzate derived from the different flower extracts according to Comparative Examples 91 to 108. (The X-axis of the graph of FIG. 3 shows the raw materials (sources) used in the preparation of Comparative Examples 73 to 108 and Examples 109 to 162).

[ test example 5] Glycoprotein in flower extract fraction , and glycoproteins of flower extracts from fractions Evaluation of moisturizing ability in skin cells of derived hydrolyzate

Glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples 127-144 A mixture consisting of glycoprotein fractions of different flower extracts according to Confirm the moisturizing effect of the hydrolyzate derived from the flower extract according to ~72, the mixture consisting of different flower extracts according to Comparative Examples 73 to 90, and the mixture of the hydrolyzate derived from the different flower extracts according to Comparative Examples 91 to 108 In order to do this, the expression pattern of the aquaporin-3 gene, which is known to be involved in moisturizing action, was investigated.

Aquaporin-3

Aquaporin is present in the cell membrane as a transporter that actively moves water molecules from the cell membrane into the cell ( J Biol). Chem , 274:21631-21636, 1999; Curr . Opin . Struct . Biol . , 15:176-183, 2005). Thirteen types of aquaporin proteins are known in mammals so far, and among them, aquaporin-3 (AQP3) protein is a type of aquaglyceroporin protein that selectively passes water molecules and glycerol. It is known to be important for hydration and wound healing ( J Invest Dermatol , 118:678-685, 2002; J. Mol . Med. , 96:523-529, 2008).

First, human keratinocytes (HaCaT) were seeded in a 6-well plate at 1x10 ⁵ cells/well (cells/well) using DMEM supplemented with penicillin/streptomycin and 10% FBS for about 24 hours. incubated during Subsequent samples (a glycoprotein fraction of a flower extract according to Examples 1 to 36 and Examples 37 to 72, a hydrolyzate derived from a glycoprotein fraction of a flower extract according to Examples 73 to 108, Examples 109 to 126 and Examples A mixture consisting of glycoprotein fractions of different flower extracts according to 127 to 144, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162, a flower extract according to Comparative Examples 1 to 36, A hydrolyzate derived from the flower extracts according to Comparative Examples 37 to 72, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, or a mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108) was diluted with DMEM and treated so that the final treatment amount was 0.001% by weight ([Control]: untreated group; [Rosiglitazone]: 5 μM rosiglitazone (Sigma, USA) treated group as a positive control), after culturing for about 72 hours more HaCaT was washed with PBS (phosphate buffer saline) (Welgene, Korea), recovered, and HaCaT mRNA was extracted using PureLink RNA Mini Kit (Thermo Fisher Scientific, USA). The extracted mRNA was synthesized into cDNA using the High Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific, USA), and then amplified by Real Time PCR (RT-PCR) to measure the expression level of the aquaporin-3 gene (each The average value was obtained by measuring triplicate samples per sample.

< RT-PCR analysis method >

RNA extraction kit (PureLink RNA Mini Kit, Thermo Fisher Scientific, USA) required for RT-PCR analysis, PCR Premix Kit (SYBR GREEN PCR MASTER Mix, 4368702, Thermo Fisher Scientific, USA), cDNA synthesis kit (High Capacity RNA- to-cDNA Kit, Thermo Fisher Scientific, USA) was prepared.

First, a sample (a glycoprotein fraction of a flower extract according to Examples 1-36 and Examples 37-72, a hydrolyzate derived from a glycoprotein fraction of a flower extract according to Examples 73-108, A mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162, Comparative Example 1 from a flower extract according to ~36, a hydrolyzate derived from a flower extract according to Comparative Examples 37 to 72, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, or from different flower extracts according to Comparative Examples 91 to 108 A mixture of the derived hydrolyzate) was isolated from the treated HaCaT cells, and cDNA was synthesized (RT, Reverse Transcription) from the isolated RNA using a cDNA synthesis kit. After adding the synthesized cDNA and aquaporin-3 specific primer (see Table 17 below) to the PCR Premix Tube (Taq Polymerase is included in the test drug), PCR is performed under the following reaction conditions to express the expression pattern of the aquaporin-3 gene. was confirmed.

RT-PCR reaction conditions

(1) RT: cDNA was synthesized using the cDNA synthesis kit and RNA of the sample-treated keratinocytes.

(2) PCR: using the synthesized cDNA, [95 ° C.: 5 min], [(95 ° C: 45 sec; 50 ° C: 45 sec; 68 ° C: 60 sec) x 40 cycles], and [68 ° C.: 5 min] for PCR reaction.

After the RT-PCR reaction product was electrophoresed on a 1% (W/V) gel, the molecular weight of the amplified nucleic acid of the reaction product was confirmed to determine the expression level of the aquaporin-3 gene.

Table 17 shows primer pairs for aquaporin-3 gene amplification.

primer direction Primer sequence (5' to 3') SEQ ID NO: Aquaporin-3-F forward ACCTTTGCCATGTGCTTCCT One Aquaporin-3-R reverse GCGTCTGTGCCAGGGTGTA 2

As a result, as shown in FIGS. 4 and 5 below, the glycoprotein fractions of the flower extracts according to Examples 1-36 and Examples 37-72 derived from various flowers and the sugars of the flower extracts according to Examples 73-108 The hydrolyzate derived from the protein fraction had a higher expression level of aquaporin-3 than the hydrolyzate derived from the flower extracts according to Comparative Examples 1 to 36 and the flower extracts according to Comparative Examples 37 to 72, and it was confirmed that the skin moisturizing ability was excellent (Fig. The X-axis of the graphs of 4 to 5 shows the raw materials (sources) used in the production of Comparative Examples 1 to 72 and Examples 1 to 108). In addition, as shown in FIG. 6 below, Examples 109 to 126 and Examples A mixture of glycoprotein fractions of different flower extracts according to 127 to 144 and a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162 were different from each other according to Comparative Examples 73 to 90. It was confirmed that the expression level of aquaporin-3 was higher than that of a mixture consisting of a flower extract and a mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108, and thus the skin moisturizing ability was excellent (the X-axis of the graph of FIG. Examples 73 to 108 and Examples 109 to 162 show raw materials (sources) used for production).

[ test example 6] Glycoprotein in flower extract fraction , and glycoproteins of flower extracts from fractions derived hydrolyzate Evaluation of skin barrier function strengthening efficacy by promoting lipid synthesis in skin cells

Glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples 127-144 A mixture consisting of glycoprotein fractions of different flower extracts according to The lipid synthesis performance of the hydrolyzate derived from the flower extract according to ~72, the mixture consisting of different flower extracts according to Comparative Examples 73 to 90, and the mixture of the hydrolyzate derived from the different flower extracts according to Comparative Examples 91 to 108 Confirmed.

^{First, human keratinocytes (HaCaT) were seeded at 1x10 5} cells/well (cells/well) using DMEM supplemented with penicillin/streptomycin and 10% FBS in a 6-well plate and cultured for about 24 hours. Next, samples (a glycoprotein fraction of a flower extract according to Examples 1 to 36 and Examples 37 to 72, a hydrolyzate derived from a glycoprotein fraction of a flower extract according to Examples 73 to 108, Examples 109 to 126 and Examples A mixture consisting of glycoprotein fractions of different flower extracts according to Examples 127 to 144, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162, and a flower extract according to Comparative Examples 1 to 36 , a hydrolyzate derived from a flower extract according to Comparative Examples 37 to 72, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, or a mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108 ) was diluted with DMEM so that the final treatment amount was 0.001% by weight, or a positive control group, Rosiglitazone, Sigma, USA, was treated to have a final concentration of 5 μM ([Control]: untreated group). After that, the medium was changed every 3 days and cultured for 2 more weeks. Lipid staining was performed by treating HaCaT with Oil Red O dye (Sigma, USA) at an appropriate concentration, then photographing the HaCaT stained with a microscope, and then dissolving using isopropanol (Isopropanol, Sigma, USA) to measure absorbance at 500 nm (Three triplicate samples were measured to obtain an average value) to determine the degree of differentiation from keratinocytes into keratinocytes and the amount of lipid synthesis.

As a result, as shown in FIGS. 7 and 8 below, the glycoprotein fractions of the flower extracts according to Examples 1 to 36 and Examples 37 to 72 derived from various flowers and the sugars of the flower extracts according to Examples 73 to 108 The hydrolyzate derived from the protein fraction has a higher lipid synthesis ability, which is a skin barrier component, than the hydrolyzate derived from the flower extract according to Comparative Examples 1 to 36 and the flower extract according to Comparative Examples 37 to 72, so that the skin barrier function strengthening effect is excellent. was confirmed (the X-axis in the graphs of FIGS. 7 to 8 shows the raw materials (sources) used in the preparations of Comparative Examples 1 to 72 and Examples 1 to 108).

In addition, as shown in FIG. 9 below, a mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, and glycoproteins of different flower extracts according to Examples 145 to 162 The mixture of hydrolysates derived from the fractions is more lipid synthesis as a skin barrier component than the mixture of different flower extracts according to Comparative Examples 73 to 90 and the mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108. It was confirmed that the skin barrier function strengthening effect was high due to the high performance (the X-axis of the graph of FIG. 9 shows the raw materials (sources) used in the preparation of Comparative Examples 73 to 108 and Examples 109 to 162).

[ test example 7] Glycoprotein in flower extract fraction , and glycoproteins of flower extracts from fractions Evaluation of the tyrosinase activity inhibition ability of the derived hydrolyzate

Glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples 127-144 A mixture consisting of glycoprotein fractions of different flower extracts according to Measurement of the whitening effect of a hydrolyzate derived from a flower extract according to ~72, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, and a mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108 In order to do this, the activity inhibitory ability of tyrosinase was confirmed.

First, samples (a glycoprotein fraction of a flower extract according to Examples 1 to 36 and Examples 37 to 72, a hydrolyzate derived from a glycoprotein fraction of a flower extract according to Examples 73 to 108, Examples 109 to 126 and Examples A mixture consisting of glycoprotein fractions of different flower extracts according to Examples 127 to 144, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162, and a flower extract according to Comparative Examples 1 to 36 , a hydrolyzate derived from a flower extract according to Comparative Examples 37 to 72, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, or a mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108 ; Positive control: 10ppm arbutin) was diluted with phosphate buffer to 0.001% by weight 0.9ml, 0.1M phosphate buffer (pH 6.8) 1.0ml, and 1.5ml L-tyrosine solution 1.0ml , and incubated at about 37°C for about 10 minutes. Then, 0.1 ml of mushroom tyrosinase (1,500 units/ml) was added to the mixed solution and reacted at about 37° C. for about 10 minutes, and then at 475 nm using a UV-Vis spectrophotometer (Smarspec Plus, Biorad, USA). By measuring the absorbance, the activity inhibitory ability for tyrosinase was evaluated by calculating _{IC 50 .}

As a result, as shown in Tables 18 and 19 below, the glycoprotein fractions of the flower extracts according to Examples 1 to 36 and Examples 37 to 72 derived from various flowers and the sugars of the flower extracts according to Examples 73 to 108 _{The hydrolyzate derived from the protein fraction has a lower IC 50} value than the hydrolyzate derived from the flower extract according to Comparative Examples 1 to 36 and the flower extract according to Comparative Examples 37 to 72, and thus has a high tyrosinase activity inhibitory ability, resulting in skin whitening. It was confirmed that the efficacy was excellent (positive control group (arbutin): IC ₅₀ = 0.014 mg/ml) (The raw materials in Tables 18 to 19 show the sources used in the preparation of Comparative Examples 1 to 72 and Examples 1 to 108).

In addition, as shown in Table 20 below, a mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, and glycoproteins of different flower extracts according to Examples 145 to 162 _{The mixture of hydrolysates derived from the fractions has an IC 50} value lower than that of a mixture of different flower extracts according to Comparative Examples 73 to 90 and a mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108. It was confirmed that the skin whitening effect was excellent due to the high tyrosinase activity inhibitory ability) (The raw materials in Table 20 show the sources used in the preparation of Comparative Examples 73 to 108 and Examples 109 to 162).

Inhibition of tyrosinase activity:
IC ₅₀ (mg/ml) Raw material comparative example 1 to 18 comparative example 37-54 Example 1 to 18 Example 37-54 Example 73-90 brown flower 0.058 0.057 0.055 0.053 0.051 citrus flower 0.055 0.053 0.052 0.050 0.048 Kandonghwa 0.075 0.073 0.071 0.070 0.058 Gwangnam Flower 0.071 0.059 0.050 0.048 0.042 gold coin 0.055 0.051 0.046 0.041 0.036 Chrysanthemum 0.053 0.052 0.051 0.046 0.045 laureate 0.061 0.060 0.059 0.053 0.051 gossip 0.041 0.040 0.039 0.038 0.036 green tea flower 0.055 0.051 0.048 0.043 0.041 evening primrose 0.062 0.058 0.047 0.046 0.044 camellia 0.048 0.047 0.046 0.045 0.042 daisy 0.063 0.062 0.061 0.058 0.056 drawing 0.055 0.051 0.044 0.043 0.041 lavender 0.081 0.066 0.043 0.041 0.037 marigold 0.061 0.058 0.051 0.045 0.042 plum blossom 0.051 0.049 0.045 0.043 0.039 peony 0.064 0.061 0.053 0.051 0.049 Rose of Sharon 0.051 0.050 0.049 0.047 0.046

Inhibition of tyrosinase activity:
IC ₅₀ (mg/ml) Raw material comparative example 19-36 comparative example 55-72 Example 19-36 Example 55-72 Example 91~108 honeysuckle 0.053 0.052 0.051 0.048 0.047 ringworm 0.048 0.047 0.046 0.045 0.042 chrysanthemum 0.058 0.041 0.038 0.035 0.032 balsam 0.077 0.055 0.047 0.046 0.041 hydrangea 0.066 0.059 0.043 0.039 0.037 pomegranate 0.065 0.051 0.047 0.041 0.034 dress shoes 0.050 0.048 0.043 0.041 0.033 daffodil 0.079 0.066 0.053 0.047 0.042 training 0.060 0.053 0.044 0.042 0.038 Lotus 0.059 0.055 0.053 0.051 0.049 rape flower 0.051 0.050 0.048 0.043 0.040 ginseng flower 0.051 0.049 0.047 0.038 0.035 Jasmine 0.045 0.044 0.043 0.041 0.039 rose 0.042 0.039 0.035 0.031 0.028 geranium 0.059 0.041 0.038 0.034 0.031 calendula 0.061 0.053 0.043 0.041 0.038 pansy 0.066 0.058 0.044 0.042 0.041 safflower 0.045 0.044 0.041 0.038 0.035

Inhibition of tyrosinase activity:
IC ₅₀ (mg/ml) Raw material comparative example 73-90 comparative example 91~108 Example 109~126 Example 127-144 Example 145~162 rose + chrysanthemum 0.039 0.035 0.032 0.030 0.026 rose + camellia 0.038 0.036 0.031 0.029 0.027 rose + plum 0.040 0.036 0.032 0.030 0.027 rose + peony 0.041 0.037 0.033 0.030 0.027 rose + lotus 0.037 0.034 0.032 0.030 0.027 rose + daffodil 0.040 0.038 0.033 0.030 0.025 Chrysanthemum + Camellia 0.047 0.045 0.045 0.044 0.041 Chrysanthemum + plum 0.050 0.048 0.044 0.042 0.038 Chrysanthemum + Peony 0.052 0.050 0.048 0.045 0.041 Chrysanthemum + lotus 0.051 0.048 0.046 0.043 0.039 Chrysanthemum + Narcissus 0.052 0.050 0.048 0.045 0.041 Camellia + Plum Blossom 0.046 0.043 0.041 0.039 0.036 Camellia + Peony 0.047 0.045 0.043 0.041 0.037 Camellia + lotus 0.046 0.044 0.042 0.040 0.038 Camellia + Narcissus 0.047 0.046 0.045 0.041 0.035 plum + peony 0.047 0.044 0.041 0.039 0.038 plum + lotus 0.050 0.048 0.044 0.041 0.038 plum + daffodil 0.046 0.044 0.041 0.039 0.036

[ test example 8] Glycoprotein in flower extract fraction , and glycoproteins of flower extracts from fractions derived hydrolyzate Inflammatory cytokine expression caused by UV irradiation deterrent evaluation

Glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples 127-144 A mixture consisting of glycoprotein fractions of different flower extracts according to Hydrolyzate derived from flower extracts according to ~72, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, and a mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108 due to ultraviolet irradiation of The inhibitory activity of inflammatory cytokine expression was confirmed.

^{First, human keratinocytes (HaCaT) were seeded at 5x10 4} cells/well (cells/well) using DMEM supplemented with penicillin/streptomycin and 10% FBS in a 24-well test plate and cultured for 24 hours. attached. Human keratinocytes attached to each well were washed once with PBS, and 500 μl of PBS was added thereto. Then, after irradiating the human keratinocytes with UVB of 10mJ/cm ² , PBS was removed and 350 μl of DMEM was added. Herein, samples (a glycoprotein fraction of a flower extract according to Examples 1 to 36 and Examples 37 to 72, a hydrolyzate derived from a glycoprotein fraction of a flower extract according to Examples 73 to 108, Examples 109 to 126 and Examples) A mixture consisting of glycoprotein fractions of different flower extracts according to Examples 127 to 144, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162, and a flower extract according to Comparative Examples 1 to 36 , a hydrolyzate derived from a flower extract according to Comparative Examples 37 to 72, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, or a mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108 ) was diluted with DMEM so that the final treatment amount was 0.1% by weight, and then cultured for about 5 hours. The degree of inhibition of inflammatory cytokine expression was confirmed by taking 150 μl of the culture supernatant and quantifying IL-1α.

As a result, as shown in Tables 21 and 22 below, the glycoprotein fractions of the flower extracts according to Examples 1-36 and Examples 37-72 derived from various flowers and the sugars of the flower extracts according to Examples 73-108 The hydrolyzate derived from the protein fraction had a higher ability to inhibit the expression of inflammatory cytokines than the hydrolyzate derived from the flower extract according to Comparative Examples 1 to 36 and the flower extract according to Comparative Examples 37 to 72, so it was confirmed that the skin inflammatory effect was excellent (Table The raw materials of 21-22 represent the sources used in the preparation of Comparative Examples 1-72 and Examples 1-108).

In addition, as shown in Table 23 below, a mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, and glycoproteins of different flower extracts according to Examples 145 to 162 The mixture of the hydrolyzate derived from the fraction has a higher ability to inhibit inflammatory cytokine expression than the mixture consisting of different flower extracts according to Comparative Examples 73 to 90 and the mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108. It was confirmed that the skin anti-inflammatory effect was excellent (the raw materials in Table 23 show the sources used in the preparation of Comparative Examples 73 to 108 and Examples 109 to 162).

Inhibition rate of inflammatory cytokine expression (%) Raw material Comparative Examples 1 to 18 Comparative Examples 37-54 Examples 1-18 Examples 37-54 Examples 73-90 brown flower 21.0 21.1 22.0 24.0 25.0 citrus flower 22.0 22.1 23.0 25.0 28.0 Kandonghwa 22.0 23.0 24.0 25.0 27.0 Gwangnam Flower 19.0 20.0 21.0 23.0 28.0 gold coin 21.0 21.1 22.0 24.0 26.0 Chrysanthemum 17.0 19.0 23.0 25.0 29.0 laureate 16.0 16.1 18.0 21.0 23.0 gossip 22.0 22.1 23.0 25.0 26.0 green tea flower 15.0 15.1 16.0 20.0 21.0 evening primrose 14.0 14.5 15.0 16.0 18.0 camellia 15.0 15.1 15.5 16.0 17.0 daisy 20.0 20.1 20.5 21.0 22.0 drawing 20.0 20.5 21.0 22.0 24.0 lavender 19.0 20.0 22.0 23.0 24.0 marigold 24.0 24.1 24.5 25.0 26.0 plum blossom 22.5 23.0 23.5 25.0 26.0 peony 27.0 28.0 28.5 29.0 30.0 Rose of Sharon 20.0 22.0 23.0 26.0 29.0

Inhibition rate of inflammatory cytokine expression (%) Raw material Comparative Examples 19-36 Comparative Examples 55-72 Examples 19-36 Examples 55-72 Example 91~108 honeysuckle 21.0 22.0 23.0 24.0 27.0 ringworm 22.0 22.1 23.0 24.0 25.0 chrysanthemum 17.0 21.0 23.0 25.0 29.0 balsam 20.0 23.0 24.0 27.0 28.0 hydrangea 24.0 25.0 29.0 31.0 32.0 pomegranate 19.0 21.0 23.0 25.0 28.0 dress shoes 22.0 22.1 23.0 26.0 29.0 daffodil 13.0 13.5 14.0 15.0 16.0 training 22.0 22.1 23.0 25.0 26.0 Lotus 16.0 16.1 17.0 18.0 19.0 rape flower 20.0 22.0 23.0 25.0 28.0 ginseng flower 15.0 16.0 17.0 18.5 21.0 Jasmine 24.0 24.1 24.5 25.0 26.0 rose 26.0 27.0 30.0 32.0 33.0 geranium 22.0 22.1 22.5 25.0 26.0 calendula 21.0 21.5 22.5 23.0 24.0 pansy 17.0 18.0 19.0 21.0 22.0 safflower 19.0 19.5 20.0 20.5 21.0

Inhibition rate of inflammatory cytokine expression (%) Raw material Comparative Examples 73 to 90 comparative example 91~108 Example 109~126 Example 127-144 Example 145~162 rose + chrysanthemum 28.0 29.0 31.0 33.0 37.0 rose + camellia 29.0 30.0 32.0 33.0 36.0 rose + plum 30.0 30.1 31.0 33.0 36.0 rose + peony 27.1 28.1 33.0 34.0 35.0 rose + lotus 29.0 31.0 33.0 35.0 37.0 rose + daffodil 28.0 30.0 32.0 34.0 35.0 Chrysanthemum + Camellia 30.0 31.0 33.0 35.0 36.0 Chrysanthemum + plum 28.0 30.0 31.0 33.0 35.0 Chrysanthemum + Peony 29.0 31.0 32.0 34.0 35.0 Chrysanthemum + lotus 28.0 29.0 31.0 32.0 34.0 Chrysanthemum + Narcissus 27.0 29.0 31.0 32.5 34.0 Camellia + Plum Blossom 29.0 31.0 32.0 33.0 35.0 Camellia + Peony 27.1 30.0 32.0 34.0 36.0 Camellia + lotus 28.0 29.0 31.0 33.0 35.0 Camellia + Narcissus 27.0 28.0 31.0 32.0 34.0 plum + peony 30.0 31.0 33.0 34.0 35.0 plum + lotus 28.0 30.0 32.0 33.0 34.0 plum + daffodil 29.0 31.0 33.0 35.0 36.0

[ test example 9] Glycoprotein in flower extract fraction , and glycoproteins of flower extracts from fractions derived hydrolyzate Evaluation of hair strength enhancement effect

Glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples 127-144 A mixture consisting of glycoprotein fractions of different flower extracts according to The effect of hydrolysates derived from flower extracts according to ~72, mixtures of different flower extracts according to Comparative Examples 73 to 90 and hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108 on hair strength To evaluate the effect, it was measured using a hair tensile strength meter (TA-XT-Plus, Stable Micro System LTD., England).

Samples (glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Example 127 A mixture consisting of glycoprotein fractions of different flower extracts according to -144, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145-162, a flower extract according to Comparative Examples 1-36, comparison Hydrolysates derived from flower extracts according to Examples 37 to 72, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, or a mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108) It was diluted in distilled water at 1% w/v and evenly applied to normal hair tresses by 1 g, and then dried for 24 hours under 40% relative humidity and a temperature of 25°C. A single strand of arbitrarily uniform hair (diameter: 65-75㎛) was selected from the dried hair tress, mounted on a tensile strength meter, and the magnitude of the force when the hair broke was measured while pulling it at a speed of 20 mm/min. After repeating the same method more than 10 times, the average value was taken to indicate the strength of the hair. As a negative control group, hair tresses treated with purified water were used.

As a result, as shown in Tables 24 and 25 below, glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72 and glycoprotein fractions of flower extracts according to Examples 73-108 from various flowers It was confirmed that the hydrolyzate derived from the hydrolyzate had a higher hair strength enhancing effect than the hydrolyzate derived from the flower extract according to Comparative Examples 1 to 36 and the flower extract according to Comparative Examples 37 to 72 (Table 24 to The raw materials of 25 represent the sources used in the preparation of Comparative Examples 1 to 72 and Examples 1 to 108).

In addition, as shown in Table 26 below, a mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, and glycoproteins of different flower extracts according to Examples 145 to 162 The mixture of the hydrolyzate derived from the fraction has higher hair tensile strength than the mixture of the different flower extracts according to Comparative Examples 73 to 90 and the mixture of the hydrolyzate derived from the different flower extracts according to Comparative Examples 91 to 108. It was confirmed that the strength enhancing effect was excellent (the raw materials in Table 26 show the sources used in the preparation of Comparative Examples 73 to 108 and Examples 109 to 162).

Raw material Hair Tensile strength (g) comparative example 1 to 18 comparative example 37-54 Examples 1-18 Examples 37-54 Example 73-90 brown flower 103.1 104.5 106.2 107.3 108.4 citrus flower 114.3 115.3 116.3 119.6 121.2 Kandonghwa 110.2 110.8 111.4 112.1 115.7 Gwangnam Flower 105.3 105.9 106.8 107.4 109.1 gold coin 104.7 105.3 107.4 108.1 110.3 Chrysanthemum 109.2 110.2 110.4 112.1 113.6 laureate 114.3 115.3 116.3 116.6 117.8 gossip 119.5 120.1 120.2 121.6 123.5 green tea flower 118.7 119.3 120.3 121.1 123.7 evening primrose 106.6 107.9 110.2 111.5 115.9 camellia 102.3 102.6 103.5 105.1 107.3 daisy 106.4 107.1 107.3 107.5 112.2 drawing 100.9 101.3 103.1 106.5 109.3 lavender 104.6 106.5 107.8 111.1 113.7 marigold 115.6 116.2 117.8 119.9 121.5 plum blossom 115.3 115.9 116.3 118.1 120.1 peony 107.8 108.3 109.2 114.3 117.2 Rose of Sharon 118.5 119.2 120.8 122.2 123.2

Raw material Hair Tensile strength (g) comparative example 19-36 comparative example 55-72 Example 19-36 Examples 55-72 Example 91~108 honeysuckle 104.1 106.3 108.1 109.3 113.3 ringworm 106.5 107.1 108.8 109.1 111.5 chrysanthemum 102.4 106.5 109.4 111.2 115.2 balsam 100.1 103.2 104.3 105.4 107.2 hydrangea 102.2 103.4 105.2 106.8 109.1 pomegranate 116.6 117.3 118.1 118.4 121.5 dress shoes 113.3 114.4 115.8 116.9 118.2 daffodil 101.6 105.4 106.3 114.8 117.2 training 114.4 116.2 118.5 121.1 123.6 Lotus 105.7 106.3 108.1 108.4 112.9 rape flower 115.7 116.5 118.4 122.9 125.4 ginseng flower 105.8 109.3 111.5 118.3 121.5 Jasmine 110.8 112.3 113.1 113.2 117.4 rose 116.2 120.3 121.6 128.2 131.4 geranium 109.1 110.6 111.6 114.3 115.7 calendula 108.4 109.3 113.9 118.3 119.2 pansy 107.2 110.1 113.8 114.3 116.5 safflower 101.1 102.3 103.2 105.6 108.2

Raw material Hair Tensile strength (g) comparative example 73-90 comparative example 91~108 Example 109~126 Example 127-144 Example 145~162 rose + chrysanthemum 116.5 120.5 122.3 130.1 132.8 rose + camellia 116.5 121.3 126.4 129.3 131.9 rose + plum 116.8 126.3 127.3 130.4 131.7 rose + peony 117.1 121.5 126.3 130.6 132.4 rose + lotus 118.3 122.7 126.9 130.4 133.2 rose + daffodil 116.5 122.2 127.5 129.8 131.4 Chrysanthemum + Camellia 117.4 126.4 129.3 130.3 132.4 Chrysanthemum + plum 117.2 120.7 126.4 129.4 133.2 Chrysanthemum + Peony 116.8 121.2 126.3 129.9 130.2 Chrysanthemum + lotus 119.2 122.7 128.3 129.7 131.4 Chrysanthemum + Narcissus 118.1 123.4 127.9 130.3 132.3 Camellia + Plum Blossom 118.6 121.7 127.4 129.8 133.1 Camellia + Peony 117.4 121.3 125.3 128.2 131.9 Camellia + lotus 116.8 125.4 127.5 128.6 132.1 Camellia + Narcissus 117.3 124.2 126.8 128.8 131.7 plum + peony 118.2 123.4 125.7 129.4 132.4 plum + lotus 117.6 125.4 128.4 130.2 133.3 plum + daffodil 116.9 126.2 129.1 131.2 133.7

[ test example 10] Glycoprotein in flower extract fraction , and glycoproteins of flower extracts from fractions derived hydrolyzate Evaluation of hair gloss improvement effect

Glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples 127-144 A mixture consisting of glycoprotein fractions of different flower extracts according to Effects of hydrolysates derived from flower extracts according to ~72, mixtures of different flower extracts according to Comparative Examples 73 to 90, and hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108 on hair gloss In order to evaluate the effect, it was measured using a goniophotometer (Goniophotometer, Murakami Color Research Laboratory) indicating the degree of hair gloss.

Normal hair tresses obtained from volunteers were prepared and used after the hair tresses were damaged by treatment with hydrogen peroxide. A sample (a glycoprotein fraction of a flower extract according to Examples 1-36 and Examples 37-72, a hydrolyzate derived from a glycoprotein fraction of a flower extract according to Examples 73-108, Examples 109-126) was added to each hair tress. And a mixture consisting of glycoprotein fractions of different flower extracts according to Examples 127 to 144, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162, according to Comparative Examples 1 to 36 A flower extract, a hydrolyzate derived from a flower extract according to Comparative Examples 37 to 72, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, or a hydrolyzate derived from different flower extracts according to Comparative Examples 91 to 108 of the mixture) was diluted in distilled water at 1% w/v and evenly applied 1gl at a time, followed by washing with water 10 times ([Control]: untreated group). The washed hair tress was dried for 24 hours under a relative humidity of 40% and a temperature of 25°C. A single strand of uniform hair (diameter: 65-75 μm) was randomly selected from the dried hair tress, and the hair gloss was measured (three triplicate samples were measured to obtain the average value) after mounting on the measuring device. As a negative control group, hair tresses treated with purified water were used.

As a result, as shown in FIGS. 10 and 11 below, the glycoprotein fractions of the flower extracts according to Examples 1 to 36 and Examples 37 to 72 derived from various flowers and the sugars of the flower extracts according to Examples 73 to 108 It was confirmed that the hydrolyzate derived from the protein fraction was superior to the hydrolyzate derived from the flower extract according to Comparative Examples 1 to 36 and the flower extract according to Comparative Examples 37 to 72 in reducing hair roughness and improving hair gloss (Fig. The X-axis of the graphs of 10 to 11 shows the raw materials (sources) used in the preparation of Comparative Examples 1 to 72 and Examples 1 to 108).

In addition, as shown in FIG. 12 below, a mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, and glycoproteins of different flower extracts according to Examples 145 to 162 The mixture of hydrolysates derived from the fractions has the effect of reducing hair roughness and hair compared to the mixtures of different flower extracts according to Comparative Examples 73 to 90 and the mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108. It was confirmed that the gloss improvement effect was excellent (the X-axis of the graph of FIG. 12 shows the raw materials (sources) used in the preparation of Comparative Examples 73 to 108 and Examples 109 to 162).

In addition, as shown in FIGS. 13 and 14, when the hydrolyzate derived from the glycoprotein fraction of the rose extract according to Example 104 is treated with a commercially available bleaching agent, hair tress increased due to the bleaching treatment. It was confirmed through sensory examination and field emission scanning electron microscopy (FE-SEM, Field Emission Scanning Electron Microscopes, JEOL, Japan) that the roughness of the hair was reduced and the gloss of the hair tress reduced due to the bleaching treatment was significantly improved. .

[ test example 11] Glycoprotein in flower extract fraction , and glycoproteins of flower extracts from fractions Antioxidant activity evaluation by derived hydrolyzate

Glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples 127-144 A mixture consisting of glycoprotein fractions of different flower extracts according to Measurement of antioxidant activity of hydrolysates derived from flower extracts according to ~72, mixtures comprising different flower extracts according to Comparative Examples 73 to 90, and mixtures of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108 In order to do this, the DPPH method was performed.

In order to evaluate the DPPH radical scavenging ability, samples (a glycoprotein fraction of a flower extract according to Examples 1-36 and Examples 37-72, a hydrolyzate derived from a glycoprotein fraction of a flower extract according to Examples 73-108, Examples A mixture consisting of glycoprotein fractions of different flower extracts according to 109 to 126 and Examples 127 to 144, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162, Comparative Examples 1 to Derived from a flower extract according to 36, a hydrolyzate derived from a flower extract according to Comparative Examples 37 to 72, a mixture consisting of different flower extracts according to Comparative Examples 73 to 90, or from different flower extracts according to Comparative Examples 91 to 108 (mixture of hydrolyzate) was diluted with phosphate buffer, and 0.1 ml of 0.2 mM 2,2-diphenyl-1-picrylhydrazyl (Sigma, USA) solution was dispensed to 0.1 ml of a solution prepared to be 50 ppm, left for about 30 minutes, and then 520 nm absorbance was measured using an ELISA reader (ELISA reader, Eon, Biotek, USA) in did. As a positive control, 50 ppm of L-ascorbic acid (Sigma, USA) was used.

As a result, as shown in FIGS. 15 and 16 below, the glycoprotein fractions of the flower extracts according to Examples 1 to 36 and Examples 37 to 72 derived from various flowers and the sugars of the flower extracts according to Examples 73 to 108 The hydrolyzate derived from the protein fraction had a higher DPPH radical scavenging effect than the hydrolyzate derived from the flower extract according to Comparative Examples 1 to 36 and the flower extract according to Comparative Examples 37 to 72, and thus it was confirmed that the antioxidant effect was very excellent (Fig. 15). The X-axis of the graph of ~16 shows the raw materials (sources) used in the preparation of Comparative Examples 1-72 and Examples 1-108).

In addition, as shown in FIG. 17 below, a mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, and glycoproteins of different flower extracts according to Examples 145 to 162 The mixture of the hydrolyzate derived from the fraction has a higher DPPH radical scavenging effect than the mixture consisting of different flower extracts according to Comparative Examples 73 to 90 and the mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108. It was confirmed that the efficacy was very good (the X-axis of the graph of FIG. 17 shows the raw materials (sources) used in the preparation of Comparative Examples 73 to 108 and Examples 109 to 162).

[ test example 12] Glycoprotein in flower extract fraction , and glycoproteins of flower extracts from fractions derived hydrolyzate reactive oxygen species (reactive oxygen species, ROS ) extinction ability evaluation

(1) ROS scavenging ability due to UV

Glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples 127-144 A mixture consisting of glycoprotein fractions of different flower extracts according to The ROS removal ability of the hydrolyzate derived from the flower extract according to ~72, the mixture consisting of different flower extracts according to Comparative Examples 73 to 90, and the hydrolyzate derived from the different flower extracts according to Comparative Examples 91 to 108 was measured For this purpose, a method of measuring fluorescence using DCF-DA (2', 7'-dichlorofluorescein diacetate, Sigma, USA) was used.

^{Human keratinocytes (HaCaT) were seeded at 1x10 4} cells/well (cells/well) in 96-well black microplate for fluorescence measurement using DMEM supplemented with penicillin/streptomycin and 10% FBS, and 37°C/5 % CO ₂ Incubated in an incubator for about 24 hours. Thereafter, each diluted in serum-free DMEM and samples (a hydrolyzate derived from the glycoprotein fraction of the flower extract according to Examples 1-36 and Examples 37-72, and the glycoprotein fraction of the flower extract according to Examples 73-108; A mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162, Comparative Example A flower extract according to 1-36, a hydrolyzate derived from a flower extract according to Comparative Examples 37-72, a mixture consisting of different flower extracts according to Comparative Examples 73-90, or different flower extracts according to Comparative Examples 91-108 (a mixture of hydrolysates derived from ) was added and further cultured for about 24 hours ([No treat]: non-UVB irradiation group; [(-) Control]: UVB irradiation group). When the incubation time was 24 hours, the medium used for HaCaT culture was removed and HaCaT was washed with HBSS, 100 μM DCFH-DA (diluting solvent: HBSS) was added, and 100 μl was added and 37° C./5% _{CO 2 Incubator} After incubation for about 1 hour, it was washed with HBSS. Then, after irradiating UVB of 50mJ/cm ² , treated with DCFH-DA, and fluorescence generated from HaCaT irradiated with UV with a fluorescence plate reader (Tecan plate reader, Switzerland) Excitation/Emission = Fluorescence intensity at 485nm/530nm was measured (3 for each sample (triplicate samples) were measured to obtain an average value).

As a result, as shown in FIGS. 18 and 19 below, the glycoprotein fractions of the flower extracts according to Examples 1-36 and Examples 37-72 derived from various flowers and the sugars of the flower extracts according to Examples 73-108 The hydrolyzate derived from the protein fraction has a higher scavenging effect on ROS due to UV irradiation than the hydrolyzate derived from the flower extract according to Comparative Examples 1 to 36 and the flower extract according to Comparative Examples 37 to 72, indicating that the antioxidant effect is excellent. (FIG. 21: When the hydrolyzate derived from the glycoprotein fraction of the rose extract according to Example 104 was treated to keratinocytes (HaCaT), the scavenging effect on ROS due to UV irradiation was significantly improved under a fluorescence microscope (EvosAutoFL , Thermofisher, 4X)) (The X-axis of the graphs of FIGS. 18 to 19 shows the raw materials (sources) used in the preparation of Comparative Examples 1 to 72 and Examples 1 to 108).

In addition, as shown in FIG. 20 below, a mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, and glycoproteins of different flower extracts according to Examples 145 to 162 The mixture of hydrolysates derived from the fractions was higher than the mixture of the different flower extracts according to Comparative Examples 73 to 90 and the mixture of hydrolysates derived from the different flower extracts according to Comparative Examples 91 to 108 for ROS due to UV irradiation. It was confirmed that the scavenging effect was high and the antioxidant effect was excellent (the X-axis of the graph of FIG. 20 shows the raw materials (sources) used in the preparation of Comparative Examples 73 to 108 and Examples 109 to 162).

(2) Scavenging ability of ROS due to oxidative stress

Glycoprotein fractions of flower extracts according to Examples 1-36 and Examples 37-72, hydrolysates derived from glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples 127-144 A mixture consisting of glycoprotein fractions of different flower extracts according to The ROS removal ability of the hydrolyzate derived from the flower extract according to ~72, the mixture consisting of different flower extracts according to Comparative Examples 73 to 90, and the hydrolyzate derived from the different flower extracts according to Comparative Examples 91 to 108 was measured In order to do this, a method for measuring fluorescence using DCF-DA was used. ^{Human keratinocytes (HaCaT) were seeded at 1x10 4} cells/well (cells/well) in 96-well black microplate for fluorescence measurement using DMEM supplemented with penicillin/streptomycin and 10% FBS, and 37°C/5 % CO ₂ Incubated in an incubator for about 24 hours. Thereafter, each diluted in serum-free DMEM and samples (a hydrolyzate derived from the glycoprotein fraction of the flower extract according to Examples 1-36 and Examples 37-72, and the glycoprotein fraction of the flower extract according to Examples 73-108; A mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162, Comparative Example A flower extract according to 1-36, a hydrolyzate derived from a flower extract according to Comparative Examples 37-72, a mixture consisting of different flower extracts according to Comparative Examples 73-90, or different flower extracts according to Comparative Examples 91-108 A mixture of hydrolysates derived from) was added and further cultured for about 24 hours. When the incubation time was 24 hours, the medium used for HaCaT culture was removed and HaCaT was washed with HBSS, 100 μM DCFH-DA (diluting solvent: HBSS) was added, and 100 μl was added and 37° C./5% _{CO 2 Incubator} After incubation for about 1 hour, it was washed with HBSS. Then, after treatment with 100 μM H ₂ O ₂ (diluting solvent: HBSS) ([No treat]: H ₂ O ₂ untreated group; [(-) Control]: H ₂ O ₂ treated group), DCFH-DA and The _{fluorescence intensity generated from HaCaT treated with H 2} O ₂ was measured at Excitation/Emission = 485 nm/530 nm with a fluorescence plate reader (Tecan plate reader, Switzerland). to find).

As a result, as shown in FIGS. 22 and 23 below, the glycoprotein fractions of the flower extracts according to Examples 1 to 36 and Examples 37 to 72 derived from various flowers and the sugars of the flower extracts according to Examples 73 to 108 The hydrolyzate derived from the protein fraction has a higher scavenging effect on ROS due to oxidative stress than the hydrolyzate derived from the flower extract according to Comparative Examples 1 to 36 and the flower extract according to Comparative Examples 37 to 72, so that the antioxidant effect is very excellent. (FIG. 25: When the hydrolyzate derived from the glycoprotein fraction of the rose extract according to Example 104 was treated with keratinocytes (HaCaT), the scavenging effect on ROS caused by oxidative stress was significantly improved. Confirmed under a microscope (EvosAutoFL, Thermofisher, 10X)) (X-axis of the graphs of FIGS. 22-23 shows raw materials (sources) used in the preparation of Comparative Examples 1-72 and Examples 1-108).

In addition, as shown in FIG. 24 below, a mixture consisting of glycoprotein fractions of different flower extracts according to Examples 109 to 126 and Examples 127 to 144, and glycoproteins of different flower extracts according to Examples 145 to 162 The mixture of hydrolysates derived from the fractions was more resistant to ROS due to oxidative stress than the mixtures of different flower extracts according to Comparative Examples 73 to 90 and the mixture of hydrolysates derived from different flower extracts according to Comparative Examples 91 to 108. It was confirmed that the antioxidative effect was very good due to the high scavenging effect on the skin.

Glycoprotein fractions of flower extracts according to Examples 1-36 and 37-72 of the present invention, hydrolysates derived from the glycoprotein fractions of flower extracts according to Examples 73-108, Examples 109-126 and Examples of the present invention Pharmaceutical compositions and cosmetics comprising, as an active ingredient, a mixture consisting of glycoprotein fractions of different flower extracts according to 127 to 144, or a mixture of hydrolysates derived from glycoprotein fractions of different flower extracts according to Examples 145 to 162 The composition may be commercialized (pharmaceuticals, cosmetics) in various formulations of Formulation Examples 1 to 4, but is not limited thereto, and an appropriate amount of glycoprotein of flower extract in consideration of the functionality, cost and other conditions of the product to be implemented. derived from the fraction or the glycoprotein fraction of the flower extract It can be applied to various formulations and formulations containing hydrolysates.

[Formulation Example 1] Preparation of ointment

By mixing the ingredients in Table 27 including the oil phase component and the water phase component, the glycoprotein fraction of the flower extract according to the present invention or the glycoprotein fraction of the flower extract An ointment containing the hydrolyzate was prepared.

Ingredients content (wt%) Purified water remaining amount derived from a glycoprotein fraction of one or more flower extracts, or a glycoprotein fraction of one or more flower extracts. hydrolyzate 10.0 Caprin/Caprylic Triglyceride 10.0 liquid paraffin 10.0 Sorbitan Sesquioleate 6.0 Octyldodeces-25 9.0 Cetylethylhexanoate 10.0 squalane 1.0 salicylic acid 1.0 glycerin 15.0 sorbitol 10.0

[ Formulation example 2] Manufacture of nutrient lotion

By mixing the ingredients in Table 28 including the oil phase component and the water phase component, the glycoprotein fraction of the flower extract according to the present invention or the glycoprotein fraction of the flower extract Nutrient lotion containing hydrolyzate was prepared.

Ingredients content (wt%) Purified water remaining amount derived from a glycoprotein fraction of one or more flower extracts, or a glycoprotein fraction of one or more flower extracts. hydrolyzate 0.1 beeswax 4.0 Polysorbate 60 1.5 Sorbitan sesquioleate 1.5 liquid paraffin 0.5 Montana 202 (Manufacturer: Seppic) 5.0 glycerin 3.0 butylene glycol 3.0 propylene glycol 3.0 Carboxyvinyl Polymer 0.1 triethanolamine 0.2 Preservatives, Colors, Flavors appropriate amount

[ Formulation example 3] Manufacture of massage cream

A glycoprotein fraction of the flower extract according to the present invention or the glycoprotein fraction of the flower extract according to the present invention by mixing the ingredients in Table 29 including the oil phase component and the water phase component. A massage cream containing hydrolyzate was prepared.

Ingredients content (wt%) Purified water remaining amount derived from a glycoprotein fraction of one or more flower extracts, or a glycoprotein fraction of one or more flower extracts. hydrolyzate 0.1 beeswax 10.0 Polysorbate 60 1.5 sebum 60 hydrogenated castor oil 2.0 Sorbitan sesquioleate 0.8 liquid paraffin 40.0 squalane 5.0 Montana 202 (Manufacturer: Seppic) 4.0 glycerin 5.0 butylene glycol 3.0 propylene glycol 3.0 triethanolamine 0.2 Preservatives, Colors, Flavors appropriate amount

[ Formulation example 4] Manufacture of the pack

By mixing the ingredients in Table 30 including the oil phase component and the aqueous phase component, the glycoprotein fraction of the flower extract according to the present invention or the glycoprotein fraction of the flower extract A pack containing the hydrolyzate was prepared.

Ingredients content (wt%) Purified water remaining amount derived from a glycoprotein fraction of one or more flower extracts, or a glycoprotein fraction of one or more flower extracts. hydrolyzate 0.1 polyvinyl alcohol 13.0 Sodium Carboxymethyl Cellulose 0.2 glycerin 5.0 allantoin 0.1 ethanol 6.0 PEG-12 Nonylphenyl Ether 0.3 Polysorbate 60 0.3 Preservatives, Colors, Flavors appropriate amount

Statistical processing

For statistical analysis, the t-test test method was used to test the significance between the two groups, and compared with the control group, * P <0.05, ** P <0.01, *** P <0.001 was considered a valid difference.

As the specific parts of the present invention have been described in detail above, for those of ordinary skill in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

<110> Morechem Co., Ltd. <120> Composition Comprising Glycoprotein Fraction of the Flower Extract or Hydrolysate Derived from the Glycoprotein Fraction, and Method of Producing Glycoprotein Fraction of the Flower Extract and Hydrolysate Derived from the Glycoprotein Fraction <130> YPD201803-0014 <160> 2 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Aquaporin-3-F <400> 1 acctttgcca tgtgcttcct 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Aquaporin-3-R <400> 2 gcgtctgtgc cagggtgta 19

Claims (15)

A composition for improving skin elasticity and improving skin wrinkles comprising, as an active ingredient, a glycoprotein fraction of a flower extract having an isoelectric point (pI) value of 3.5 to 6.5, or a hydrolyzate derived from a glycoprotein fraction of the flower extract,
The above flowers are brown flower, tangerine flower, kandong flower, gwangnam flower, gold and silver flower, chrysanthemum, laurel flower, gooseberry, green tea flower, evening primrose, camellia flower, daisy, drawing flower, lavender, marigold, plum flower, peony, mugunghwa, honeysuckle flower, white sagebrush, chrysanthemum, It is at least one selected from the group consisting of balsam, hydrangea, pomegranate, safflower, daffodil, water lily, lotus, rapeseed, ginseng, jasmine, rose, geranium, calendula, pansy, and safflower;
The glycoprotein fraction is a flower residue formed from the raw material mixture by centrifuging the raw material mixture mixed so that the weight ratio of the flower and water is 1:2∼1:10 at a temperature of 20∼60°C for 2∼10 hours. The extraction solvent was added to the glycoprotein precipitate obtained by removing the precipitate containing It is obtained by drying the stock solution containing the glycoprotein in the lower layer formed by centrifugation after adding it so that the weight ratio of the glycoprotein precipitate and the extraction solvent is 1:2 to 1:10 at a temperature of 40 to 60 ° C,
The hydrolyzate is prepared by adding water to the glycoprotein fraction to prepare a lysate so that the weight ratio of the glycoprotein fraction and water is 1:10 to 1:20, and then adding a hydrolase to the lysate to obtain the lysate and After preparing the hydrolysis reaction product so that the weight ratio of the hydrolase is 1:0.1~1:10, the reaction product hydrolyzed at 30~60℃ for 2~8 hours is centrifuged and the supernatant of the reaction product formed is 0.1~ It is obtained by filtration to a size of 10.0 μm,
The extraction solvent is an alcohol having 1 to 4 carbon atoms,
The hydrolases are protease, pectinase, α,β-glucosidase, amyloglucosidase, beta-glucanase. ), cellulase, naringinase, α-amylase, hemicellulase, arabinase, xylanase and tannase A composition for improving skin elasticity and improving skin wrinkles, characterized in that at least four types selected from the group consisting of. A composition for improving skin moisturizing and skin dryness comprising, as an active ingredient, a glycoprotein fraction of a flower extract having an isoelectric point value of 3.5 to 6.5 or a hydrolyzate derived from a glycoprotein fraction of the flower extract,
The above flowers are brown flower, tangerine flower, kandong flower, gwangnam flower, gold and silver flower, chrysanthemum, laurel flower, gooseberry, green tea flower, evening primrose, camellia flower, daisy, drawing flower, lavender, marigold, plum flower, peony, mugunghwa, honeysuckle flower, white sagebrush, chrysanthemum, It is at least one selected from the group consisting of balsam, hydrangea, pomegranate, safflower, daffodil, water lily, lotus, rapeseed, ginseng, jasmine, rose, geranium, calendula, pansy, and safflower;
The glycoprotein fraction is a flower residue formed from the raw material mixture by centrifuging the raw material mixture mixed so that the weight ratio of the flower and water is 1:2∼1:10 at a temperature of 20∼60°C for 2∼10 hours. The extraction solvent was added to the glycoprotein precipitate obtained by removing the precipitate containing It is obtained by drying the stock solution containing the glycoprotein in the lower layer formed by centrifugation after adding it so that the weight ratio of the glycoprotein precipitate and the extraction solvent is 1:2 to 1:10 at a temperature of 40 to 60 ° C,
The hydrolyzate is prepared by adding water to the glycoprotein fraction to prepare a lysate so that the weight ratio of the glycoprotein fraction and water is 1:10 to 1:20, and then adding a hydrolase to the lysate to obtain the lysate and After preparing the hydrolysis reaction product so that the weight ratio of the hydrolase is 1:0.1~1:10, the reaction product hydrolyzed at 30~60℃ for 2~8 hours is centrifuged and the supernatant of the reaction product formed is 0.1~ It is obtained by filtration to a size of 10.0 μm,
The extraction solvent is an alcohol having 1 to 4 carbon atoms,
The hydrolases are protease, pectinase, α,β-glucosidase, amyloglucosidase, beta-glucanase. ), cellulase, naringinase, α-amylase, hemicellulase, arabinase, xylanase and tannase A composition for improving skin moisturizing and skin dryness, characterized in that at least four types selected from the group consisting of. A composition for promoting lipid synthesis in skin cells for strengthening skin barrier function, comprising as an active ingredient a glycoprotein fraction of a flower extract having an isoelectric point value of 3.5 to 6.5 or a hydrolyzate derived from the glycoprotein fraction of the flower extract,
The above flowers are brown flower, tangerine flower, kandong flower, gwangnam flower, gold and silver flower, chrysanthemum, laurel flower, gooseberry, green tea flower, evening primrose, camellia flower, daisy, drawing flower, lavender, marigold, plum flower, peony, mugunghwa, honeysuckle flower, white sagebrush, chrysanthemum, It is at least one selected from the group consisting of balsam, hydrangea, pomegranate, safflower, daffodil, water lily, lotus, rapeseed, ginseng, jasmine, rose, geranium, calendula, pansy, and safflower;
The glycoprotein fraction is a flower residue formed from the raw material mixture by centrifuging the raw material mixture mixed so that the weight ratio of the flower and water is 1:2∼1:10 at a temperature of 20∼60°C for 2∼10 hours. The extraction solvent was added to the glycoprotein precipitate obtained by removing the precipitate containing It is obtained by drying the stock solution containing the glycoprotein in the lower layer formed by centrifugation after adding it so that the weight ratio of the glycoprotein precipitate and the extraction solvent is 1:2 to 1:10 at a temperature of 40 to 60 ° C,
The hydrolyzate is prepared by adding water to the glycoprotein fraction to prepare a lysate so that the weight ratio of the glycoprotein fraction and water is 1:10 to 1:20, and then adding a hydrolase to the lysate to obtain the lysate and After preparing the hydrolysis reaction product so that the weight ratio of the hydrolase is 1:0.1~1:10, the reaction product hydrolyzed at 30~60℃ for 2~8 hours is centrifuged and the supernatant of the reaction product formed is 0.1~ It is obtained by filtration to a size of 10.0 μm,
The extraction solvent is an alcohol having 1 to 4 carbon atoms,
The hydrolases are protease, pectinase, α,β-glucosidase, amyloglucosidase, beta-glucanase. ), cellulase, naringinase, α-amylase, hemicellulase, arabinase, xylanase and tannase A composition for promoting lipid synthesis in skin cells for strengthening the skin barrier function, characterized in that at least four types selected from the group consisting of. A composition for skin whitening comprising, as an active ingredient, a glycoprotein fraction of a flower extract having an isoelectric point value of 3.5 to 6.5 or a hydrolyzate derived from the glycoprotein fraction of the flower extract,
The above flowers are brown flower, tangerine flower, kandong flower, gwangnam flower, gold and silver flower, chrysanthemum, laurel flower, gooseberry, green tea flower, evening primrose, camellia flower, daisy, drawing flower, lavender, marigold, plum flower, peony, mugunghwa, honeysuckle flower, white sagebrush, chrysanthemum, It is at least one selected from the group consisting of balsam, hydrangea, pomegranate, safflower, daffodil, water lily, lotus, rapeseed, ginseng, jasmine, rose, geranium, calendula, pansy, and safflower;
The glycoprotein fraction is a flower residue formed from the raw material mixture by centrifuging the raw material mixture mixed so that the weight ratio of the flower and water is 1:2∼1:10 at a temperature of 20∼60°C for 2∼10 hours. The extraction solvent was added to the glycoprotein precipitate obtained by removing the precipitate containing It is obtained by drying the stock solution containing the glycoprotein in the lower layer formed by centrifugation after adding it so that the weight ratio of the glycoprotein precipitate and the extraction solvent is 1:2 to 1:10 at a temperature of 40 to 60 ° C,
The hydrolyzate is prepared by adding water to the glycoprotein fraction to prepare a lysate so that the weight ratio of the glycoprotein fraction and water is 1:10 to 1:20, and then adding a hydrolase to the lysate to obtain the lysate and After preparing the hydrolysis reaction product so that the weight ratio of the hydrolase is 1:0.1~1:10, the reaction product hydrolyzed at 30~60℃ for 2~8 hours is centrifuged and the supernatant of the reaction product formed is 0.1~ It is obtained by filtration to a size of 10.0 μm,
The extraction solvent is an alcohol having 1 to 4 carbon atoms,
The hydrolases are protease, pectinase, α,β-glucosidase, amyloglucosidase, beta-glucanase. ), cellulase, naringinase, α-amylase, hemicellulase, arabinase, xylanase and tannase A composition for skin whitening, characterized in that at least four selected from the group consisting of. A composition for alleviating skin inflammation comprising, as an active ingredient, a glycoprotein fraction of a flower extract having an isoelectric point value of 3.5 to 6.5 or a hydrolyzate derived from the glycoprotein fraction of the flower extract,
The above flowers are brown flower, tangerine flower, kandong flower, gwangnam flower, gold and silver flower, chrysanthemum, laurel flower, gooseberry, green tea flower, evening primrose, camellia flower, daisy, drawing flower, lavender, marigold, plum flower, peony, mugunghwa, honeysuckle flower, white sagebrush, chrysanthemum, It is at least one selected from the group consisting of balsam, hydrangea, pomegranate, safflower, daffodil, water lily, lotus, rapeseed, ginseng, jasmine, rose, geranium, calendula, pansy, and safflower;
The glycoprotein fraction is a flower residue formed from the raw material mixture by centrifuging the raw material mixture mixed so that the weight ratio of the flower and water is 1:2∼1:10 at a temperature of 20∼60°C for 2∼10 hours. The extraction solvent was added to the glycoprotein precipitate obtained by removing the precipitate containing It is obtained by drying the stock solution containing the glycoprotein in the lower layer formed by centrifugation after adding it so that the weight ratio of the glycoprotein precipitate and the extraction solvent is 1:2 to 1:10 at a temperature of 40 to 60 ° C,
The hydrolyzate is prepared by adding water to the glycoprotein fraction to prepare a lysate so that the weight ratio of the glycoprotein fraction and water is 1:10 to 1:20, and then adding a hydrolase to the lysate to obtain the lysate and After preparing the hydrolysis reaction product so that the weight ratio of the hydrolase is 1:0.1~1:10, the reaction product hydrolyzed at 30~60℃ for 2~8 hours is centrifuged and the supernatant of the reaction product formed is 0.1~ It is obtained by filtration to a size of 10.0 μm,
The extraction solvent is an alcohol having 1 to 4 carbon atoms,
The hydrolases are protease, pectinase, α,β-glucosidase, amyloglucosidase, beta-glucanase. ), cellulase, naringinase, α-amylase, hemicellulase, arabinase, xylanase and tannase A composition for alleviating skin inflammation, characterized in that at least 4 selected from the group consisting of. A composition for enhancing tensile strength of hair comprising as an active ingredient a glycoprotein fraction of a flower extract having an isoelectric point value of 3.5 to 6.5 or a hydrolyzate derived from the glycoprotein fraction of the flower extract,
The above flowers are brown flower, tangerine flower, kandong flower, gwangnam flower, gold and silver flower, chrysanthemum, laurel flower, gooseberry, green tea flower, evening primrose, camellia flower, daisy, drawing flower, lavender, marigold, plum flower, peony, mugunghwa, honeysuckle flower, white sagebrush, chrysanthemum, It is at least one selected from the group consisting of balsam, hydrangea, pomegranate, safflower, daffodil, water lily, lotus, rapeseed, ginseng, jasmine, rose, geranium, calendula, pansy, and safflower;
The glycoprotein fraction is a flower residue formed from the raw material mixture by centrifuging the raw material mixture mixed so that the weight ratio of the flower and water is 1:2∼1:10 at a temperature of 20∼60°C for 2∼10 hours. The extraction solvent was added to the glycoprotein precipitate obtained by removing the precipitate containing It is obtained by drying the stock solution containing the glycoprotein in the lower layer formed by centrifugation after adding it so that the weight ratio of the glycoprotein precipitate and the extraction solvent is 1:2 to 1:10 at a temperature of 40 to 60 ° C,
The hydrolyzate is prepared by adding water to the glycoprotein fraction to prepare a lysate so that the weight ratio of the glycoprotein fraction and water is 1:10 to 1:20, and then adding a hydrolase to the lysate to obtain the lysate and After preparing the hydrolysis reaction product so that the weight ratio of the hydrolase is 1:0.1~1:10, the reaction product hydrolyzed at 30~60℃ for 2~8 hours is centrifuged and the supernatant of the reaction product formed is 0.1~ It is obtained by filtration to a size of 10.0 μm,
The extraction solvent is an alcohol having 1 to 4 carbon atoms,
The hydrolases are protease, pectinase, α,β-glucosidase, amyloglucosidase, beta-glucanase. ), cellulase, naringinase, α-amylase, hemicellulase, arabinase, xylanase and tannase A composition for enhancing the tensile strength of hair, characterized in that at least four selected from the group consisting of. A composition for improving hair gloss comprising, as an active ingredient, a glycoprotein fraction of a flower extract having an isoelectric point value of 3.5 to 6.5 or a hydrolyzate derived from the glycoprotein fraction of the flower extract, as an active ingredient,
The above flowers are brown flower, tangerine flower, kandong flower, gwangnam flower, gold and silver flower, chrysanthemum, laurel flower, gooseberry, green tea flower, evening primrose, camellia flower, daisy, drawing flower, lavender, marigold, plum flower, peony, mugunghwa, honeysuckle flower, white sagebrush, chrysanthemum, It is at least one selected from the group consisting of balsam, hydrangea, pomegranate, safflower, daffodil, water lily, lotus, rapeseed, ginseng, jasmine, rose, geranium, calendula, pansy, and safflower;
The glycoprotein fraction is a flower residue formed from the raw material mixture by centrifuging the raw material mixture mixed so that the weight ratio of the flower and water is 1:2∼1:10 at a temperature of 20∼60°C for 2∼10 hours. The extraction solvent was added to the glycoprotein precipitate obtained by removing the precipitate containing It is obtained by drying the stock solution containing the glycoprotein in the lower layer formed by centrifugation after adding it so that the weight ratio of the glycoprotein precipitate and the extraction solvent is 1:2 to 1:10 at a temperature of 40 to 60 ° C,
The hydrolyzate is prepared by adding water to the glycoprotein fraction to prepare a lysate so that the weight ratio of the glycoprotein fraction and water is 1:10 to 1:20, and then adding a hydrolase to the lysate to obtain the lysate and After preparing the hydrolysis reaction product so that the weight ratio of the hydrolase is 1:0.1~1:10, the reaction product hydrolyzed at 30~60℃ for 2~8 hours is centrifuged and the supernatant of the reaction product formed is 0.1~ It is obtained by filtration to a size of 10.0 μm,
The extraction solvent is an alcohol having 1 to 4 carbon atoms,
The hydrolases are protease, pectinase, α,β-glucosidase, amyloglucosidase, beta-glucanase. ), cellulase, naringinase, α-amylase, hemicellulase, arabinase, xylanase and tannase A composition for improving the gloss of hair, characterized in that at least four types selected from the group consisting of. 8. The method according to any one of claims 1 to 7,
The hydrolase is a protease, pectinase, α,β- glucosidase and cellulase, characterized in that the complex hydrolase consisting of, the composition. 8. The method according to any one of claims 1 to 7,
The molecular weight range of the glycoprotein fraction is 1,000-700,000Da, the composition characterized in that the molecular weight range of the hydrolyzate is 250-1,000Da. 8. The method according to any one of claims 1 to 7,
The composition, characterized in that the content of the glycoprotein fraction or the hydrolyzate is 0.01 to 10.0% by weight based on the total weight of the composition. 8. The method according to any one of claims 1 to 7,
The flower is a mixture of rose and chrysanthemum, a mixture of rose and camellia, a mixture of rose and plum, a mixture of rose and peony, a mixture of rose and lotus, a mixture of rose and daffodil, a mixture of chrysanthemum and camellia, a mixture of chrysanthemum and plum , a mixture of chrysanthemum and peony, a mixture of chrysanthemum and lotus, a mixture of chrysanthemum and daffodil, a mixture of chrysanthemum and plum, a mixture of camellia and peony, a mixture of camellia and peony, a mixture of camellia and lotus, a mixture of camellia and daffodil, a mixture of plum and peony, A composition, characterized in that one selected from the group consisting of a mixture of plum blossoms and lotus flowers, and a mixture of plum blossoms and daffodils. The composition according to any one of claims 1 to 7, wherein the composition is a cosmetic composition. A method for producing a glycoprotein fraction of a flower extract, and a hydrolyzate derived therefrom, comprising:
(a) The raw material mixture mixed so that the weight ratio of flowers and water is 1:2∼1:10 is left at a temperature of 20∼60°C for 2∼10 hours and then centrifuged to contain the flower residue formed from the raw material mixture removing the precipitate and obtaining a flower extract containing the glycoprotein of the upper layer formed from the raw material mixture;
(b) adjusting the pH of the flower extract to precipitate a glycoprotein having an isoelectric point of pH 3.5 to 6.5 to obtain a glycoprotein precipitate;
(c) adding an extraction solvent to the glycoprotein precipitate to prepare a mixture so that the weight ratio of the glycoprotein precipitate and the extraction solvent is 1:2 to 1:10, and then centrifuging the mixture to form an upper layer formed from the mixture removing the solution, and obtaining a stock solution containing the glycoprotein of the lower layer formed from the mixture;
(d) drying the stock solution containing the glycoprotein at a temperature of 40 to 60° C. to obtain a glycoprotein fraction;
(e) adding water to the glycoprotein fraction to prepare a lysate so that the weight ratio of the glycoprotein fraction and water is 1:10 to 1:20 preparing a hydrolysis reaction product so that the weight ratio of the degrading enzyme is 1:0.1 to 1:10, and then obtaining a reaction product hydrolyzed at a temperature of 30 to 60° C. for 2 to 8 hours; and
(f) filtering the supernatant of the reaction product formed by centrifuging the reaction product to a size of 0.1 to 10.0 μm to obtain a hydrolyzate;
The extraction solvent is an alcohol having 1 to 4 carbon atoms,
The hydrolases are protease, pectinase, α,β-glucosidase, amyloglucosidase, beta-glucanase. ), cellulase, naringinase, α-amylase, hemicellulase, arabinase, xylanase and tannase 4 or more selected from the group consisting of,
The above flowers are brown flower, tangerine flower, kandong flower, gwangnam flower, gold and silver flower, chrysanthemum, laurel flower, gooseberry, green tea flower, evening primrose, camellia flower, daisy, drawing flower, lavender, marigold, plum flower, peony, mugunghwa, honeysuckle flower, white sagebrush, chrysanthemum, Glycoprotein of a flower extract, characterized in that it is at least one selected from the group consisting of balsam, hydrangea, pomegranate, saffron, daffodil, water lily, lotus, rapeseed, ginseng, jasmine, rose, geranium, calendula, pansy and safflower. A method for preparing fractions and hydrolysates derived therefrom. 14. The method of claim 13,
The hydrolase is a protease, pectinase, α, β- glucosidase, characterized in that the complex hydrolase consisting of a cellulase, the production method. 14. The method of claim 13,
The molecular weight range of the glycoprotein fraction is 1,000 to 700,000 Da, and the molecular weight range of the hydrolyzate is 250 to 1,000 Da, the production method.

Images