KR102287206B1 - A set of qRT-PCR markers for selection of seedless grape and uses thereof - Google Patents

Abstract

The present invention relates to a set of expression markers for selection of non-nucleated grapes and their use. The set of nine expression markers for selection of non-nucleated grapes according to the present invention can clearly distinguish between nucleated and non-nucleated grapes by determining whether or not the gene is expressed through qRT-PCR. A primer set capable of detecting 9 expressed genes was selected. A set of expression markers for selection of non-nucleated grapes capable of comparing the expression of nine genes can provide a pool of selection markers capable of discriminating between nucleated and non-nucleated varieties even by using only one gene expression marker among them.

Description

Expression marker set for selection of nuclear-free grapes and uses thereof {A set of qRT-PCR markers for selection of seedless grapes and uses thereof}

The present invention relates to a set of expression markers for selection of nuclear-free grapes and their use.

Grapes are an important crop grown worldwide for winemaking (71%) and for food (27%) or for dried fruit. Raw grapes can be broadly divided into seeded nucleated grapes and seedless non-nucleated grapes.

The mechanism of the formation of nucleolus in grapes can be divided into two major categories: the parthenocarpy, in which the fruit develops without pollination and fertilization, and the development of a nucleolus due to the degeneration of the pear in the embryonic development stage after pollination and fertilization. There is a stenospermocarpy. Since the above unit result is fertilized, unlike the unit result, degenerated seed traces remain.

Nucleated grapes can be divided into 1) the case where the seed exists only as a remnant, and 2) the case where the seed development is normal but hardening does not occur and the seed has soft seeds. In the case of a variety having seeds as a residue, granular hypertrophy cannot be expected because the growth hormone secreted from the seeds is insufficient. In order to achieve granular hypertrophy, it is necessary to use a method of artificially treating growth regulators, which requires a lot of labor and production costs. However, in the case of cultivars with soft seeds, the secretion of hormones for granular hypertrophy occurs normally, so large granules can be expected without any foreign body sensation.

In recent years, the sales of grape varieties without seeds and with large berry grains are rapidly increasing according to consumers' preference for high quality grapes for raw food. Nucleic-free grapes currently in circulation can be divided into three types according to the cultivation method or production method. ① Cultivation of pseudounitary (diploid) nuclear-free varieties using a genetically non-nucleated variety as a mating parent, ② Cultivating triploid-free varieties by crossing between a tetraploid variety and a diploid variety, ③ Nucleated grape varieties' buds It is to artificially produce nuclear-free varieties by treating growth regulators such as gibberellin. In all of the methods ①, ②, and ③ for the production of nuclear-free varieties, normal seeds are not produced, and growth hormone secreted from the seeds during embryonic development is insufficient.

The grapes with normal development but soft seeds do not have a foreign feeling of the seeds when the granules are chewed, and 'Perlon' cultivated in Argentina, and 'Perlon' cultivated in Argentina and 'Italy ( Italia)' and 'Perlon' are crossed and there is 'Hongju'.

France's GENOSCOPE provides genome-oriented data such as genome browser and gene information as a grape web database, and the grape standard genome 12X version was newly updated in 2012 (http://www.genoscope.cns.fr).

Molecular markers are markers that identify genetic variation in an organism at a molecular level. Several molecular markers have been developed since the early 1970s to identify between taxa, study population genetics using gene frequency, study biodiversity, and characterize genes in living organisms. The field of application is being expanded to the field to identify and function.

To date, in relation to the classification of grape and stock varieties, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), sequence characterized amplified region (SCAR), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter Although various DNA markers such as -simple sequence repeats (ISSR) have been reported, the development of molecular markers for screening nuclear-free grapes is insufficient.

Korean Patent No. 10-1976974 (registered on May 2, 2019)

An object of the present invention is to provide a biomarker composition for selection of nuclear-free grapes, a composition for selection of nuclear-free grapes comprising an agent capable of measuring the expression level of the biomarker as an active ingredient, a kit for selection of nuclear-free grapes comprising the composition, and the same To provide a method for selecting nuclear-free grapes used.

In order to achieve the above object, the present invention provides for selection of nuclear-free grapes comprising as an active ingredient any one or more proteins selected from the group consisting of VvNST3, VvPAL, VvC4H, Vv4CL, VvC3H, VvCCoAOMT, VvCCR, VvCOMT and VvCAD or a gene encoding the same. Provided is a biomarker composition for

In addition, the present invention is for selection of nuclear-free grapes comprising as an active ingredient an agent capable of measuring the expression level of any one or more genes selected from the group consisting of VvNST3, VvPAL, VvC4H, Vv4CL, VvC3H, VvCCoAOMT, VvCCR, VvCOMT and VvCAD. A composition is provided.

In addition, the present invention provides a kit for selection of nuclear-free grapes comprising the composition.

In addition, the present invention comprises the steps of (1) isolating RNA from grapes; (2) using the isolated RNA as a template, a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2, a primer set represented by SEQ ID NO: 3 and SEQ ID NO: 4, and a primer set represented by SEQ ID NO: 5 and SEQ ID NO: 6 , a primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8, a primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10, a primer set represented by SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14 a primer set, a primer set represented by SEQ ID NO: 15 and SEQ ID NO: 16; performing qRT-PCR amplification using any one or more primer sets selected from the group consisting of primer sets represented by SEQ ID NO: 17 and SEQ ID NO: 18; and (3) analyzing the qRT-PCR amplification product.

The present invention relates to a set of expression markers for selection of non-nucleated grapes and their use, and a quantitative PCR (qRT-PCR) marker set was developed to efficiently differentiate between nucleated grapes and soft seed grapes in grape varieties. Comparing the transcriptome of genes involved in grape seed formation and development, the expression of very low or almost no expression in seeds of non-nucleated grapes (remaining seeds or soft seeds), but high expression in hard seeds of nucleated grapes A set of quantitative PCR markers was developed to discover genes and effectively analyze the expression of these genes. By using this to select grape varieties with hardened seeds, it is also possible to develop non-nucleated grapes with high commercial value. In addition, according to the present invention, it is expected to secure the original technology for producing allele-free grapes with large granules without treatment with a growth regulator, and to be utilized as a major technology for developing high-quality grape varieties for reproduction.

1 shows the expression of cell wall sclerosis-related genes in 'Hongju'. A, lignin biosynthesis pathway in plants and transcription factors regulating the expression of lignin biosynthesis genes are shown. VND/NST/SND, NAC domain transcription factors; MYB, myeloblastosis family transcription factors; PAL, phenylalanine ammonia-lyase; C4H, cinnamate 4-hydroxylase; 4CL, 4-coumarate:CoA ligase; HCT, hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyl transferase; C3H, p-coumaroylshikimate 3-hydroxylase; CCoAOMT, caffeoyl-CoA 3-o-methyltransferase; CCR, cinnamoyl-CoA reductase; F5H, ferulate 5-hydroxylase; COMT, caffeic acid 3-o-methyltransferase; CAD, cinnamyl alcohol dehydrogenase; PER/LAC; peroxidase/laccase. B, a heat map based on the expression levels of cell wall-related differentially expressed genes selected in 'Italy' and 'Hongju' of each stage (7-42 DAF) is shown (normalized trimmed mean of M-values [TMM] mean of values) ).
2 shows qRT-PCR results of lignin pathway-related genes selected in 8 grape varieties. At 35 DAF, 4 nucleated varieties ('Autumn Black', 'Campbell Early', 'Italy', 'Muscat of Alexandria') and 4 non-nucleated varieties ('Crimson Seedless', 'Hongju', 'Perlon', 'Mr. Thompson') The expression profiles of qRT-PCR analysis of genes selected from 'Dillis') are shown. Error bars represent the standard error of three independent replicates per sample.

Nucleated grapes can be divided into 1) the case where the seed exists only as a remnant, and 2) the case where the seed development is normal but hardening does not occur and the seed has soft seeds. In the case of a variety having seeds as a residue, granular hypertrophy cannot be expected because the growth hormone secreted from the seeds is insufficient. However, in the case of cultivars with soft seeds, large granules can be expected because the secretion of hormones for granular hypertrophy occurs normally. Therefore, in the present invention, by confirming the expression of genes with very low or little expression in non-nucleated grape seeds and very high expression in hard seeds of nucleated grapes, a basis for selecting grapes without seed texture was established. Therefore, by using the present invention to identify and remove varieties having hardened seeds at an early stage, time and effort for selection of nuclear-free grapes can be saved, and grapes with soft seeds capable of granular hypertrophy can be selected.

Specifically, in the present invention, a molecular marker set capable of confirming the expression of nine genes related to seed development has been proposed. Differential expression genes were selected by performing RNA-seq experiments at each granulation period in the nucleated grape variety ‘Italy’ and the soft seed variety ‘Hongju’. A primer set for qRT-PCR was prepared for the selected genes, and qRT-PCR was performed on the seeds of 4 types of nucleated grapes and 4 types of non-nucleated grapes. Based on the results, 9 primer sets that can clearly distinguish nucleated and non-nucleated varieties were selected. The set of expression markers for selection of non-nucleated grapes of the present invention, which can compare the expression of nine genes, provides a pool of markers capable of determining whether the grapes are nuclear-free or nucleated even by using only one gene expression marker among them.

The present invention provides a biomarker composition for selection of nuclear-free grapes comprising as an active ingredient any one or more proteins selected from the group consisting of VvNST3, VvPAL, VvC4H, Vv4CL, VvC3H, VvCCoAOMT, VvCCR, VvCOMT and VvCAD or a gene encoding the same. .

Preferably, the seedless grapes may be 'Crimson Seedless', 'Hongju', 'Perlon' or 'Thompson Seedless', but are limited thereto it is not

In the present invention, "marker" refers to a nucleotide sequence used as a reference point when identifying genetically unspecified related loci. The term also applies to nucleic acid sequences complementary to marker sequences, such as nucleic acids used as primer sets capable of amplifying the marker sequence. The location on the genetic map of a molecular marker is referred to as a genetic locus.

In the present invention, "molecular marker" or "biomarker" can be usefully used because it can quickly distinguish varieties without being affected by the cultivation environment or growth period of crops. Molecular markers are a method of indicating polymorphism between individuals by targeting differences in the nucleotide sequence of DNA, which is the essence of genetic phenomena. The evaluation of genetic resources by external morphological characteristics is affected by crop growth status and various environmental factors, but the evaluation based on DNA markers is not affected by the environment, so it is highly useful to substitute and supplement phenotypic characteristics. . DNA marker is a useful technique for discriminating between the same cultivar (synonymous) and similar cultivars having the same cultivar name (dissimilar cultivar) or several different cultivar names despite being different cultivars. Therefore, it is possible to prevent cultivar mixing in the seedling distribution process because cultivar discrimination by DNA markers can easily and accurately distinguish cultivars using extracted DNA without investigation of morphological traits.

In addition, the present invention is for selection of nuclear-free grapes comprising as an active ingredient an agent capable of measuring the expression level of any one or more genes selected from the group consisting of VvNST3, VvPAL, VvC4H, Vv4CL, VvC3H, VvCCoAOMT, VvCCR, VvCOMT and VvCAD. A composition is provided.

Preferably, the seedless grapes may be 'Crimson Seedless', 'Hongju', 'Perlon' or 'Thompson Seedless', but are limited thereto it is not

Preferably, the agent capable of measuring the expression level of the gene is a primer that specifically binds to any one or more genes selected from the group consisting of VvNST3, VvPAL, VvC4H, Vv4CL, VvC3H, VvCCoAOMT, VvCCR, VvCOMT and VvCAD. Or it may be a probe, but is not limited thereto.

More preferably, the primers are a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2, a primer set represented by SEQ ID NO: 3 and SEQ ID NO: 4, a primer set represented by SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 And the primer set represented by SEQ ID NO: 8, the primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10, the primer set represented by SEQ ID NO: 11 and SEQ ID NO: 12, the primer set represented by SEQ ID NO: 13 and SEQ ID NO: 14, the sequence a primer set represented by number 15 and SEQ ID NO: 16; It may be any one or more primer sets selected from the group consisting of primer sets represented by SEQ ID NO: 17 and SEQ ID NO: 18, but is not limited thereto.

In the present invention, "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases as short as possible that can specifically bind to other than mRNA, and is labeled so that the presence or absence of a specific mRNA; You can check the expression level. The probe may be manufactured in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, or the like. Suitable probe selection and hybridization conditions can be appropriately selected according to techniques known in the art.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be amplified, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target. In the present invention, the oligonucleotide used as a primer may also contain a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid, or An intercalating agent may be included.

In addition, the present invention provides a kit for selection of nuclear-free grapes comprising the composition.

In addition to the primer set of the present invention, conventional components included in the qRT-PCR kit may be included. A typical composition included in the kit may be a cofactor (cofactor) and the like, such as reaction buffers, polymerase, dNTP (dATP, dCTP, dGTP and dTTP) and Mg ^{+ 2.} A variety of DNA polymerases can be used in the amplification step of the present invention, including Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species. Most of the polymerases can be isolated from the bacteria themselves or can be purchased commercially.

In addition, the present invention comprises the steps of (1) isolating RNA from grapes; (2) using the isolated RNA as a template, a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2, a primer set represented by SEQ ID NO: 3 and SEQ ID NO: 4, and a primer set represented by SEQ ID NO: 5 and SEQ ID NO: 6 , a primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8, a primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10, a primer set represented by SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14 a primer set, a primer set represented by SEQ ID NO: 15 and SEQ ID NO: 16; performing qRT-PCR amplification using any one or more primer sets selected from the group consisting of primer sets represented by SEQ ID NO: 17 and SEQ ID NO: 18; and (3) analyzing the qRT-PCR amplification product.

Preferably, the primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2 shows the expression level of VvNST3, the primer set represented by SEQ ID NO: 3 and SEQ ID NO: 4 shows the expression level of VvPAL, the SEQ ID NO: 5 and the sequence The primer set represented by No. 6 shows the expression level of VvC4H, the primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8 shows the expression level of Vv4CL, and the primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10 shows the expression level of VvC3H. The expression level, the primer set represented by SEQ ID NO: 11 and SEQ ID NO: 12, the expression level of VvCCoAOMT, the primer set represented by SEQ ID NO: 13 and SEQ ID NO: 14, the expression level of VvCCR, the SEQ ID NO: 15 and the sequence The primer set represented by No. 16 may be for checking the expression level of VvCOMT, and the primer set represented by SEQ ID NO: 17 and SEQ ID NO: 18 may be for checking the expression level of VvCAD.

Preferably, the seedless grapes may be 'Crimson Seedless', 'Hongju', 'Perlon' or 'Thompson Seedless', but are limited thereto it is not

The VvNST3 (VND/NST/SND; NAC domain transcription factors) used in the present invention is LOC100243701, and the CDS sequence is XM_010650755.2.

VvPAL (phenylalanine ammonia-lyase) used in the present invention is LOC100241377, and the CDS sequence is XM_002281763.4.

VvC4H (C4H; cinnamate 4-hydroxylase) used in the present invention is LOC100253493, and the CDS sequence is XM_002266202.3.

Vv4CL (4CL; 4-coumarate:CoA ligase) used in the present invention is LOC100254698, and the CDS sequence is XM_002272746.4.

VvC3H (C3H; p-coumaroylshikimate 3-hydroxylase) used in the present invention is LOC100263633, and the CDS sequence is XM_002283302.3.

VvCCoAOMT (CCoAOMT; caffeoyl-CoA 3-o-methyltransferase) used in the present invention is LOC100243978, and the CDS sequence is XM_002282831.4.

VvCCR (CCR; cinnamoyl-CoA reductase) used in the present invention is LOC100251623, and the CDS sequence is XM_002273418.3.

VvCOMT (COMT; caffeic acid 3-o-methyltransferase) used in the present invention is LOC100854172, and the CDS sequence is XM_003634113.2.

VvCAD (CAD, cinnamyl alcohol dehydrogenase) used in the present invention is LOC100257308, and the CDS sequence is XM_002285370.3.

A method for isolating RNA from grapes may use a method known in the art. Also, qRT-PCR is a method of amplifying a target nucleic acid from a primer set that specifically binds to the target nucleic acid using a polymerase. Such qRT-PCR methods are well known in the art, and commercially available kits may be used.

Hereinafter, the present invention will be described in detail according to non-limiting examples. Of course, the following examples of the present invention are not intended to limit or limit the scope of the present invention only to embody the present invention. Accordingly, what can be easily inferred by an expert in the technical field to which the present invention pertains from the detailed description and examples of the present invention is construed as belonging to the scope of the present invention.

< Experimental example >

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

1. Extraction of plant material and total RNA

The National Institute of Horticultural and Herbal Science in Wanju, Jeollabuk-do (35°50'02.5" N and .127°01'54.8" E) and the Daegyeong Grape Grafting Plant in Gyeongsan, Gyeongsangbuk-do (35°57'32.7"N and .128) °49'08.7"E), granules were collected on days 7, 14, 21, 28, 35, and 42 at intervals of 7 days after full bloom from the vines.

Total RNA was extracted using the CTAB method, and total RNA was quantified with a NanoDrop spectrophotometer (Thermo Fisher Scientific, MA, USA).

A list of grape varieties used in the present invention is shown in Table 1.

Cultivar name Classification of breeding seed Vitis vinifera cv. 'Autumn Black' overseas seeded V. labrusca cv. 'Campbell Early' overseas V. vinifera cv. 'Italia' overseas V. vinifera cv. 'Muscat of Alexandria' overseas V. vinifera cv. 'Crimson Seedless' overseas seedless V. vinifera cv. 'Hongju' domestic V. vinifera cv. 'Perlon' overseas V. vinifera cv. 'Thompson Seedless' overseas

2. Quantitative realtime - PCR ( qRT - PCR )

Using 500 ng of total RNA, cDNA was synthesized with the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, California, USA). For qRT-PCR, VvAP-47 (LOC100250494, VvAP47-F: 5'-TCCTGGACAAACTGAGCCAA-3' / VvAP47-R: 5'-TATAGCGCACCCACTCAACG-3') was used as an internal control, Power SYBR Green PCR master Mix (Applied Biosystems, Carlsbad, USA) was used. Real-time gene amplification was analyzed using the StepOne Plus Real-Time PCR system (Applied Biosystems, Warrington, UK). PCR was carried out at 95 °C for 15 seconds after repeating the process of 95 °C for 30 seconds, 60 °C or 58 °C for 30 seconds, and 72 °C for 30 seconds after denaturing at 95 °C for 10 minutes 40 times. Thereafter, the melting curve analysis was performed from 60°C to 95°C by increasing 0.3°C. Analysis of the relative expression level of the measurement results was ^{calculated using the 2-ΔΔCt} method (Livak and Schmittgen, 2001) based on 'Campbell Early'.

3. expression marker candidate marker's excavation

Total RNA of 'Italia' and 'Hongju' extracted by each stage of grape seed development was prepared using Tru Seq Stranded mRNA Library Preparation Kit (Illumina, San Diego, CA, USA) for transcript analysis. After extraction, each sample was biologically repeated 3 times to prepare an mRNA sequencing (RNA-Seq) library with an insert size of about 500 bp. The prepared library was subjected to sequencing using an Illumina Next-Seq device (Illumina, San Diego, CA, USA) so that an average of 30 million or more 75 bp × 2 paired end (PE) sequences were produced per sample. Among the RNA-seq reads mapped to the 'Pinot noir' standard genome (PN40024, assembly 12X, NCBI annotation release 102, Nov 2016), the sequence mapped to the gene region is for each gene based on the gene section information of the standard genome. Converted to read count and extracted. The read count value for each gene was normalized to a Trimmed Mean of M value (TMM) value. Based on the TMM value, genes differentially expressed in ‘Italy’ and ‘Hongju’ were selected. Differentially expressed genes (DEG) were selected using the EdgeR program of R Bioconductor (Robinson et al., 2010). Selection conditions were false discovery rate (FDR) less than 0.001 and fold-changes 4 or more.

4. Expression capable of confirming expression of genes related to grape seed formation and development marker Selection

Three pairs of primers for in silico PCR were arbitrarily designed using the Prime3 (version 2.3.6) algorithm in the PrimerPro Perl pipeline modified from the expression marker available region extracted by selecting differential expression genes related to the hardening of seeds. . At this time, the primer length was 18-25mer, the GC contents were 40-60%, and the PCR product size was 100-300bp.

The designed primer was confirmed by in silico PCR whether amplification was well using e-PCR (NCBI e-PCR package) in the PrimerPro Perl pipeline.

5. nuclear-free grape selection expression marker set of black

Four nucleated grapes ['Autumn Black', 'Campbell Early', 'Italy', 'Muscat of Alexandria') '] Extract RNA from seeds and 4 non-nucleated grapes ['Crimson Seedless', 'Hongju', 'Perlon', 'Thompson Seedless'] seeds and synthesize cDNA qRT-PCR was performed with the template.

< Example >

1. Differential expression gene selection and qRT - for PCR primer production and nuclear-free grape selection foot String marker set composition

Among the RNA-seq reads mapped to the standard genome, the sequence mapped to the gene region was converted into a read count for each gene based on the gene section information of the standard genome and extracted. The read count value for each gene was normalized to a Trimmed Mean of M value (TMM) value. Based on the TMM value, the differentially expressed genes were analyzed and selected in the nucleated variety ‘Italy’ and ‘Hongju’ with soft seeds (Fig. 1). 51 differentially expressed genes related to seed hardening were selected and 153 primer sets were prepared using Prime3 (version 2.3.6) algorithm. 4 nucleated varieties ('Autumn Black', 'Campbell Early', 'Italy', 'Muscat of Alexandria') and 4 non-nucleated varieties ('Crimson Seedless', 'Hongju', 'Perlon', 'Thompson Seedless') ), expression was assayed by performing qRT-PCR with the prepared primer set. Based on the results, 9 primer sets most suitable for constructing a set of expression markers for selection of nuclear-free grapes were confirmed (Table 2).

The selected 9 primer sets include the transcription factor gene NST3/SND1 that regulates the expression of one gene involved in lignin biosynthesis, and enzyme genes ( PAL, C4H, 4CL, C3H, CCoAOMT, CCR, COMT, CAD ). The results of qRT-PCR with 9 primer sets on 4 nucleated grapes and 4 nonnucleated grapes are shown in FIG. 2 . The results of qRT-PCR were the same as those of RNA-seq experiments (FIG. 1B), which showed higher expression in 'Italy', a nucleated grape, than in 'Hongju', a soft seed grape. The selected genes were expressed significantly higher in the 4 varieties of the nucleated grapes than in the non-nucleated grapes of the 4 varieties, indicating that the excavated 9 primer sets clearly differentiated the nucleated grape varieties and the non-nucleated grape varieties. By early identification and removal of varieties with hardened seeds using a set of 9 selected nuclear-free grape selection expression markers, time and effort for selection of nuclear-free grapes can be saved, and grapes with soft seeds capable of granular hypertrophy selection will also be possible.

Name NCBI Gene ID Sequence (5' to 3') Size (mer) GC% Product (bp) VvNST3 LOC100243701 -F AGAGAATGGACCTCCACAGG (SEQ ID NO: 1) 20 55.0 223
-R ATTATCTGCCTCTATCTCTTGC (SEQ ID NO: 2) 22 40.9 VvPAL LOC100241377 -F GAGAGCATGAACAAGGGTACT (SEQ ID NO: 3) 21 47.6 148
-R ATGAGTCTGTTCCGTTCCCA (SEQ ID NO: 4) 20 50.0 VvC4H LOC100253493 -F TGGCTCAGAGCTTCGAGTA (SEQ ID NO: 5) 19 52.6 200
-R AATATGATCAACGGCGCATTTC (SEQ ID NO: 6) 22 40.9 Vv4CL LOC100254698 -F AAGAGCCATTCGAGATCAAGTC (SEQ ID NO: 7) 22 45.5 204
-R TGTGCAGCCATCCTTCTT (SEQ ID NO: 8) 18 50.0 VvC3H LOC100263633 -F CACTACGTCAAGGTCCGAAAG (SEQ ID NO: 9) 21 52.4 213
-R CCCAAATGCCAGTCTTGTAATG (SEQ ID NO: 10) 22 45.5 VvCCoAOMT LOC100243978 -F AGAAAGCTGGTCTTGCACAC (SEQ ID NO: 11) 20 50.0 206
-R CCATAGGGTGTTGTCGTAGC (SEQ ID NO: 12) 20 55.0 VvCCR LOC100251623 -F TGAGAGTCTGAAAGAGGCCA (SEQ ID NO: 13) 20 50.0 131
-R CAGCCGCTGCTATTATCACA (SEQ ID NO: 14) 20 50.0 VvCOMT LOC100854172 -F AAGTGCTCTCTTCGCAACCT (SEQ ID NO: 15) 20 50.0 188
-R GGGATTCCACCATCAAGAACT (SEQ ID NO: 16) 21 47.6 VvCAD LOC100257308 -F CTCCTTCCCAGTTTGTCACC (SEQ ID NO: 17) 20 57.5 122 -R TGTTAGTCCATTCTCCTTGCAG (SEQ ID NO: 18) 22 58.1

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> A set of qRT-PCR markers for selection of seedless grape and uses it <130> ADP-2019-0579 <150> KR 10-2019-0150376 <151> 2019-11-21 <160> 18 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Vitis vinifera <400> 1 agagaatgga cctccacagg 20 <210> 2 <211> 22 <212> DNA <213> Vitis vinifera <400> 2 attatctgcc tctatctctt gc 22 <210> 3 <211> 21 <212> DNA <213> Vitis vinifera <400> 3 gagagcatga acaagggtac t 21 <210> 4 <211> 20 <212> DNA <213> Vitis vinifera <400> 4 atgagtctgt tccgttccca 20 <210> 5 <211> 19 <212> DNA <213> Vitis vinifera <400> 5 tggctcagag cttcgagta 19 <210> 6 <211> 22 <212> DNA <213> Vitis vinifera <400> 6 aatatgatca acggcgcatt tc 22 <210> 7 <211> 22 <212> DNA <213> Vitis vinifera <400> 7 aagagccatt cgagatcaag tc 22 <210> 8 <211> 18 <212> DNA <213> Vitis vinifera <400> 8 tgtgcagcca tccttctt 18 <210> 9 <211> 21 <212> DNA <213> Vitis vinifera <400> 9 cactacgtca aggtccgaaa g 21 <210> 10 <211> 22 <212> DNA <213> Vitis vinifera <400> 10 cccaaatgcc agtcttgtaa tg 22 <210> 11 <211> 20 <212> DNA <213> Vitis vinifera <400> 11 agaaagctgg tcttgcacac 20 <210> 12 <211> 20 <212> DNA <213> Vitis vinifera <400> 12 ccatagggtg ttgtcgtagc 20 <210> 13 <211> 20 <212> DNA <213> Vitis vinifera <400> 13 tgagagtctg aaagaggcca 20 <210> 14 <211> 20 <212> DNA <213> Vitis vinifera <400> 14 cagccgctgc tattatcaca 20 <210> 15 <211> 20 <212> DNA <213> Vitis vinifera <400> 15 aagtgctctc ttcgcaacct 20 <210> 16 <211> 21 <212> DNA <213> Vitis vinifera <400> 16 gggattccac catcaagaac t 21 <210> 17 <211> 20 <212> DNA <213> Vitis vinifera <400> 17 ctcctctcca gtttgtcacc 20 <210> 18 <211> 22 <212> DNA <213> Vitis vinifera <400> 18 tgttagtcca ttctccttgc ag 22

Claims (10)

delete delete VvNST3, VvPAL, VvC4H, Vv4CL, VvC3H, VvCCoAOMT, VvCCR, VvCOMT, and 'Crimson Seedless', 'Hongju' containing a formulation capable of measuring the expression level of VvCAD genes as an active ingredient ', 'Perlon (Perlon)' or 'Thompson Seedless' composition for seed-free grape selection. The method of claim 3, wherein the agent capable of measuring the expression level of the gene is a primer or probe that specifically binds to the VvNST3, VvPAL, VvC4H, Vv4CL, VvC3H, VvCCoAOMT, VvCCR, VvCOMT and VvCAD genes. A composition for selection of nuclear-free grapes. According to claim 4, wherein the primers are a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2, a primer set represented by SEQ ID NO: 3 and SEQ ID NO: 4, a primer set represented by SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: A primer set represented by 7 and SEQ ID NO: 8, a primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10, a primer set represented by SEQ ID NO: 11 and SEQ ID NO: 12, a primer set represented by SEQ ID NO: 13 and SEQ ID NO: 14; a primer set represented by SEQ ID NO: 15 and SEQ ID NO: 16; A composition for selection of nuclear-free grapes, characterized in that it is a primer set represented by SEQ ID NO: 17 and SEQ ID NO: 18. delete 'Crimson Seedless', 'Hongju', 'Perlon' or 'Thompson Seedless', comprising the composition of any one of claims 3 to 5 ' A kit for selection of nuclear-free grapes. (1) isolating RNA from grapes;
(2) using the isolated RNA as a template, a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2, a primer set represented by SEQ ID NO: 3 and SEQ ID NO: 4, and a primer set represented by SEQ ID NO: 5 and SEQ ID NO: 6 , a primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8, a primer set represented by SEQ ID NO: 9 and SEQ ID NO: 10, a primer set represented by SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14 a primer set, a primer set represented by SEQ ID NO: 15 and SEQ ID NO: 16; performing qRT-PCR amplification using the primer sets represented by SEQ ID NO: 17 and SEQ ID NO: 18; and
(3) 'Crimson Seedless', 'Hongju', 'Perlon' or 'Thompson Seedless', including the step of analyzing the qRT-PCR amplification product )' method for selection of nuclear-free grapes. The method of claim 8, wherein the primer set shown in SEQ ID NO: 1 and SEQ ID NO: 2 shows the expression level of VvNST3, the primer set shown in SEQ ID NO: 3 and SEQ ID NO: 4 shows the expression level of VvPAL, the SEQ ID NO: 5 And the primer set shown in SEQ ID NO: 6 shows the expression level of VvC4H, the primer set shown in SEQ ID NO: 7 and SEQ ID NO: 8 shows the expression level of Vv4CL, and the primer set shown in SEQ ID NO: 9 and SEQ ID NO: 10 is The expression level of VvC3H, the primer set represented by SEQ ID NO: 11 and SEQ ID NO: 12, the expression level of VvCCoAOMT, the primer set represented by SEQ ID NO: 13 and SEQ ID NO: 14, the expression level of VvCCR, the SEQ ID NO: 15 and the primer set represented by SEQ ID NO: 16 is for checking the expression level of VvCOMT, and the primer set represented by SEQ ID NO: 17 and SEQ ID NO: 18 is for checking the expression level of VvCAD. delete

Images