KR102271052B1 - Primer set for Mucin 18, Mucin 2 like and IgM detecting immunization of fish - Google Patents

Abstract

The present invention relates to a mucin 18, mucin 2 like, and IgM primer set for confirming the immunization of a fish for confirming the immunization of a fish, and by using the primer set to easily check the immune status of a robber leg immunized with an attenuated vaccine by using the primer set. It has become possible to more efficiently manage and check the health status of robber legs at the robber bridge farm.

Description

{Primer set for Mucin 18, Mucin 2 like and IgM detecting immunization of fish}

The present invention relates to mucin 18, mucin 2 like and IgM primer sets for confirming immunization of fish.

Starry flounder/diamond back, Platichthys stellatus ) is a saltwater fish of the family Flounder, with a body length of about 40cm and a round diamond shape. The eyes are usually on the left side of the body. There are several black bands on the dorsal, anal, and caudal fins. The side with eyes is dark brown, and the side without eyes is light yellow. Unlike other halibut and fish, the eyes are concentrated in the same position as the halibut. It inhabits the lower layers of coastal areas at a depth of about 150m, and often appears in rivers. It feeds on small crustaceans, molluscs, and midges. Lays eggs in estuaries in February-March. It appears in the northern part of the East Sea of Korea. It is distributed in northern Japan, the Sea of Okhotsk, the Bering Sea, and southern California. It is used for sashimi, dried fish, steamed, grilled, etc.

Although it is known as a fish that is more resistant to disease than flounder, it is necessary to apply various methods for disease management because it is mainly raised through aquaculture. However, rather than the abuse of antibiotics or chemicals, it is necessary to enhance the immunity of the robin species itself, and the need to check the state of such immunity enhancement is also emerging.

Accordingly, the present inventors have completed the present invention by providing a method for introducing an attenuated microorganism into a strain and confirming it through Mucin 18, mucin-2-like, and IgM gene expression.

Republic of Korea Patent No. 10-1789182 (Title of the invention: Primer set for diagnosing bacterial infection in fish and method for diagnosing bacterial infection in fish using the same, Applicant: Pusan National University Industry-Academic Cooperation Foundation, Registration Date: October 17, 2017) Korean Patent Laid-Open Patent No. 10-2018-0106570 (Title of the invention: Preparation and administration method of an inactivated vaccine for preventing bacterial disease of the leg strength, including the protective serotype of a novel Streptococcus parauberis strain, Applicant: Komipharm Co., Ltd., Release date: October 01, 2018)

It is an object of the present invention to provide a set of mucin 18, mucin 2 like and IgM primers for immunization confirmation of fish.

The present invention provides a first primer set comprising the primers of SEQ ID NOs: 1 and 2;

a second primer set comprising primers of SEQ ID NOs: 3 and 4; and;

a third primer set comprising primers of SEQ ID NOs: 5 and 6;

It relates to a primer set for confirming the immunization of fish, characterized in that it comprises one or more primer sets selected from the group consisting of.

The fish is characterized in that the strength legs.

The present invention provides a method for confirming immunization of fish using the primer set.

The method for confirming the immunization of the fish is preferably,

(Step 1) administering an immunogen to the strength leg; (Second step) extracting mRNA (messenger ribonucleic acid) and synthesizing cDNA (complementary deoxyribonucleic acid) by collecting the intestines of the robber leg to which the immunogen was administered and the robber leg to which the immunogen was not administered; (Step 3) performing PCR (Polymerase chain reaction) using the cDNA and the primer set of the present invention; and, (4th step) comparing the gene expression levels of the strength legs to which the immunogen was administered and the strength legs to which the immunogen was not administered;

Each primer sequence included in the primer set of the present invention is as follows.

SEQ ID NO: 1 (Primer F of Mucin 18): CTACTCTTTCCCTCTACCAC

SEQ ID NO: 2 (Primer R of Mucin 18): GAGGTCTTGTTTTCCTGATC

SEQ ID NO: 3 (Mucin-2-like primer F): CTACTGTACCTGCAAGAG

SEQ ID NO: 4 (Primer R of Mucin-2-like): GGATCCTGATAGTTTTGGAG

SEQ ID NO: 5 (IgM primer F): CTACTCTTTCCTCTACCAC

SEQ ID NO: 6 (primer R of IgM): GTAGGCAATGGATCTGAC

In addition, the Genebank No. of the gene amplified by each primer is as follows.

Mucin 18: XM_020088244.1

Mucin 2 like : XM_023422491.1

IgM: AF228579.1

In the present invention, as the sample of the strength leg, any tissue of the strength leg can be used, and the tissue, cell, blood, etc. of fish can be used, and it is preferable to use intestinal tissue among the tissues.

In the present invention, any immunogen that can be used for immunization of the strength leg can be used as long as it can be used to enhance immunity of the strength leg, but preferably Streptococcus parauberis , Vibrio harveyi. The strain used as the immunogen is more preferably in an attenuated state by treatment with formalin.

The PCR is characterized in that it is real-time reverse transcript polymerase chain reaction (RT-PCR) or reverse transcript polymerase chain reaction (RT-PCR).

When the PCR is real-time RT-PCR, SYBR green may be added as a fluorescent labeling factor.

When synthesizing cDNA from RNA in the method of the present invention, reverse transcriptase, cNTPs and rNTPs (pre-mixed or separately supplied) may be used.

In order to perform PCR in the method of the present invention, MgCl ₂ , Tag DNA polymerase, dNTPs, etc. may be used.

The present invention relates to a mucin 18, mucin 2 like, and IgM primer set for confirming the immunization of a fish for confirming the immunization of a fish, and by using the primer set to easily check the immune status of a robber leg immunized with an attenuated vaccine by using the primer set. It has become possible to more efficiently manage and check the health status of robber legs at the robber bridge farm.

Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided so that this disclosure will be thorough and complete, and will fully convey the spirit of the invention to those skilled in the art.

<Example 1. Immunization of fish>

The strength leg used in the present invention was fed by forming round-shaped beads with the injection vaccine.

Alginic acid 0.5% (v/v) aqueous solution and FKC ( Streptococcus parauberis , Vibrio harveyi ) (1×10 ⁸ cfu/ml) physiological saline (0.9% [w/v] NaCl) solution were mixed in a weight ratio of 1:1. Then, it was put into a metering pump (manufacturer Gilson, model: M312) through a hose. Then, it was added dropwise to a 0.5M solution of calcium chloride to form beads. After that, the immunization of fish was induced by administering once (1 tablet) to the robber's legs at a water temperature of 18°C for the first week, and then feeding them 3 times in 2 months.

Ten robber legs were used in each experimental group, and the level of immunization was compared with each gene expression level in tissue samples after intestinal tissue was collected by dissecting robber legs fed with beads. The strains used in this experiment were Streptococcus parauberis and Vibrio harveyi directly isolated from a halibut farm in Jeju, Gyeongsangbuk-do. The strains were identified by analyzing their morphology and genetic characteristics. After adjusting the concentration of each live cell to 1×10 ⁸ cfu/ml, the FKC was treated with 0.2% (w/v) formalin solution for 48 hours and then re-drawn on a solid nutrient medium to confirm that no colonies were formed and all were killed. After confirming, it was used for beads. The strain until formalin treatment was treated in a cultured state in a liquid nutrient medium, and PBS (Phosphate Buffered Saline) was used as a solvent for the formalin solution.

<Example 2. Tissue extraction and RNA isolation and purification>

In order to check the expression of intestinal immune markers in the robber's leg, the tissue of the robber's leg was dissected, and the intestinal tissue was extracted. The intestinal tissue was removed immediately after extraction, and Ribosaver was put in a 1.5 ml e-tube and stored without damaging the tissue.

RNA isolation was performed using a Hybrid-R RNA isolation kit manufactured by Gene ALL Co., Ltd.

To explain this in more detail, 700 μl of Ribo Ex was dispensed into a 1.5 ml e-tube and the tissue was well ground using a grinding pestle. After that, 200 μl of chloroform was added and vortexed sufficiently to remove the phenol component of the supernatant. After removing the supernatant using a centrifuge (12000g, 4℃, 15 minutes), the RB1 aqueous solution was added as much as the supernatant, and the supernatant and RB1 solution were mixed well, and then centrifuged by dropping dropwise into the spin column. (20°C at 10000 g, 1 min). Thereafter, washing was performed using an aqueous solution of SW1 and an aqueous solution of RNW, and 50 μl of free-water was slowly added thereto, and RNA was isolated through centrifugation (1000 g, 20° C., 1 min).

<Example 3. cDNA synthesis>

rtPCR for cDNA synthesis was performed using CycleScript RT premix (bioneer). 18 μl of free-water was added to the premix, and 2 μl of the RNA obtained in Example 2 was added each. After vortexing, cDNA was synthesized. cDNA synthesis conditions are shown in Table 1 below.

cDNA synthesis conditions Step Temp.(℃) Time(sec) Cycle One 20℃ 30 seconds
12 2 45℃ 4 minutes 3 55℃ 30 seconds 4 95℃ 5 minutes One

After measuring the DNA concentration of the cDNA obtained in this way using a spectrophotometer, the concentration was adjusted to 200 μg/ml and stored in a -20°C freezer for use.

<Example 4. Primer Synthesis>

Mucin 18, Mucin-2-like, and IgM primers used in the present invention were synthesized using oligo primers, and the primer sequences and conditions for each gene are shown in Table 2, and the Genebank No. of each gene is as follows. same.

IgM: AF228579.1

Mucin 18: XM_020088244.1

Mucin 2 like : XM_023422491.1

Oligo NAME Scale Purification sequence(5' --> 3') of amplification products
DNA size (bp) One Mucin 18 25 nmole BioRP F: CTACTCTTTCCTCTACCAC
R: GAGGTCTTGTTTTCCTGATC 182 2 Mucin-2-like 25 nmole BioRP F: CTACTGTACCTGCAAGAG
R: GGATCCTGATAGTTTTGGAG 248 3 IgM 25 nmole BioRP F: CTACTCTTTCCTCTACCAC
R: GTAGGCAATGGATCTGAC 232 4 beta-actin 25 nmole BioRP F: CGTGCTGTCTTCCCATCCA
R :TCACCAACGTAGCTGTCTTTCTG 200

<Example 5. Polymerase Chain Reaction (PCR) and Electrophoresis of Genes>

The cDNA of the strength leg was subjected to PCR using each designed primer. As the PCR premix, Bioneer's PyroHotstart Taq PCR premix was used. Total volume was 20 μl, 16 μl of DW, 2 μl of cDNA (200 μg/μl), and 1 μl (10 pmole/μl) of each primer was used.

PCR conditions for IgM and Mucin 18 primers are shown in Table 3, and PCR conditions for Mucin 2 like primers are shown in Table 4.

PCR conditions for IgM and Mucin 18 Step Temp.(℃) Time(min:sec) Cycle Pre-denaturation 95 15:00 One Denaturation 95 00:30 35 Annealing 55 00:45 Extension 72 0:30 final elongation 72 07:00 One

PCR conditions for Mucin 2 like Step Temp.(℃) Time(min:sec) Cycle Pre-denaturation 95 15:00 One Denaturation 95 00:30 35 Annealing 52 00:45 Extension 72 0:30 final elongation 72 07:00 One

The amplified DNA was tested for success in DNA amplification by electrophoresis on 2% agarose gel. The immune status of the fish intestine was expressed as a relative value by measuring the band intensity in the PCR result picture before and after immunization of each gene and setting the fold value before expression to 1.0.

Condition Gene expression level value after immunization (fold) β-actin IgM Mucin 18 Mucin 2 like Streptococcus beads administration group 1.0 3.5 3.3 2.7 Vibrio harveyi beads administration group 1.0 3.5 3.2 2.5

<Example 6. Identification of the amplified nucleotide sequence>

To reconfirm the product obtained by PCR amplification, sequencing was requested to Bioneer Co., Ltd. Based on the analyzed base sequence, it was confirmed that each sequence was 100% identical to each gene through the NCBI (National Center for Biotechnology Information) blast search result.

SEQ ID NO: 7: Mucin 18 F

TGGAGGCTGTTTATCCAGAAAGCCAGCAGGGGGCAATGGTGTGATCATTGCAGTCCTCATTATCTGCCTCCTGCTGCTCGCCATCTTGGGGGCTGTGCTCTACTTCCTCTACAAAAAGGGCAAAATCTGTGGCCGATCAGGAAAACAAGACCTC

SEQ ID NO: 8: Mucin 18 R

CACAAGGGTTGCCTTTTTGTAGAGGAGTAGAGCACAGCCCCCAAGATGGCGAGCAGCAGGAGGCAGATAATGAGGACTGCAATGATCACACCATTGCCCCCTGCTGGCTTTTTCTGGATATCTGTTGCTCCTTTAACTGTGGTAGAGGAAAGAGTAGA

SEQ ID NO: 9: Mucin 2 like F

CCTTCAGCAGACACAATGTCCAGGAACTTGTATCATCTACGGGAGTGGTCACTACTCTACATTTGATGAGCAAACATATGCCTTTCAAGGAGATTGTTGCCTACATTGCTGTCAAGAACAAGTGTGGCAATAAAACTGTAGAGCACAACTTTGGAATTATCACCCAGAGAATGTACCGTGCGGATCTACAGGCACCACCTGCTC

SEQ ID NO: 10: Mucin 2 like R

GGATTCGAAATCGCACGGTACATTCTCTGTGATAATTCCAAAGTTGTGCTCTACAGTTTTATTGCCACACTTGTTCTTGACAGCAATGTAGGCACAATCTCCTTGAAAGGCATATGTTTGCTCATCAAATGTAGAGTAGTGACCACTCCCGTAGATGATACAAGTTCCTGGACATTTTTTGTCTGTGCATTCCCAGGTAGTAGA

SEQ ID NO: 11: IgM F

GGGCATTCTGCTTGTTGATGATGATTGACAACAGACGATTTCAATACCACAAACCCAATTAAAAACCATGAATCCTACTCGGCTTATGGCCAGTTATCAATCAGCCTCGACCAGTGGAAAGAAGCTGGCTCGGTGTACAGCTGCGTGGTTTACCACCAATCTGTCTGGATTCCAATACAAGAGCCATTGTCAGATCCAT

SEQ ID NO: 12: IgM-R

GGGCTGATGTATCAGAGATTGGTGGTAACCACGCAGCTGTACACCGAGCCAGCTTCTTTCCACTGGTCGAGGCTGATTGATAACTGGCCATAAGCCGAGTAGGATTCATGGTTTTTAATTGGGTTTGTGGTATTGAAATCGTCTGTTGTCAATTCATCATCAACAAGCCAAGAAACGAAAACCTCTTTCAGGGGAGAAGTC

<Example 7. Confirmation of immunization status of strength legs>

In Example 1, FKC ( Streptococcus parauberis , Vibrio harveyi ) to confirm that the strength leg to which the beads were administered was in an immunized state, the disease state and mortality of the FKC-administered strength leg and the non-administration group strength leg were checked.

First, immunization was induced by feeding FKC ( Streptococcus parauberis , Vibrio harveyi ) beads to the strength leg as in Example 1, respectively.

The disease in the immunization-induced group and the non-beads group was induced by feeding the robber's legs with the infectious Streptococcus parauberis and Vibrio harveyi at an amount of 0.1 ml (1×10 ⁸ cfu/ml) ( Streptococcus parauberis is an attenuated FKC ( Streptococcus). parauberis ) to the fed group).

Condition Beads non-administration group (%) Bead administration group (%) Streptococcus parauberis on
Korean disease induction group 80% 35% Vibrio harveyi in
Korean disease induction group 70% 30%

Referring to Table 7, it can be confirmed that the mortality rate 1 month after induction of the disease was significantly reduced in the bead administration group, so that the immunization was good.

The mortality rate was significantly reduced due to the administration of FKC ( Streptococcus parauberis, Vibrio harveyi) , and through this, it can be confirmed that the Mucin 18, Mucin 2 like, IgM genes identified in the present invention are genes whose expression is increased through immunization.

On the other hand, this immunization procedure as that of Example 1, Example 7 Streptococcus parauberis used in, Vibrio harveyi besides the separation Alternatively Streptococcus parauberis, Vibrio harveyi or, when using a standard strain of Streptococcus parauberis, Vibrio harveyi deposited with the depository appeared almost identical.

<110> JUNWON GBI Co., Ltd. <120> Primer set Mucin 18, Mucin 2 like and IgM for detecting immunization of fish <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 1 ctactctttc ctctaccac 19 <210> 2 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 2 gaggtcttgt tttcctgatc 20 <210> 3 <211> 18 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 3 ctactgtacc tgcaagag 18 <210> 4 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 4 ggatcctgat agttttggag 20 <210> 5 <211> 19 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 5 ctactctttc ctctaccac 19 <210> 6 <211> 18 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 6 gtaggcaatg gatctgac 18 <210> 7 <211> 154 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 7 tggaggctgt ttatccagaa agccagcagg gggcaatggt gtgatcattg cagtcctcat 60 tatctgcctc ctgctgctcg ccatcttggg ggctgtgctc tacttcctct acaaaaaggg 120 caaaatctgt ggccgatcag gaaaacaaga cctc 154 <210> 8 <211> 158 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 8 cacaagggtt gcctttttgt agaggagtag agcacagccc ccaagatggc gagcagcagg 60 aggcagataa tgaggactgc aatgatcaca ccattgcccc ctgctggctt tttctggata 120 tctgttgctc ctttaactgt ggtagaggaa agagtaga 158 <210> 9 <211> 219 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 9 ccttcagcag acacaatgtc caggaacttg tatcatctac gggagtggtc actactctac 60 atttgatgag caaacatatg cctttcaagg agattgtgcc tacattgctg tcaagaacaa 120 gtgtggcaat aaaactgtag agcacaactt tggaattatc acagagaatg taccgtgcgg 180 atctacaggc accacctgct ccaaaatatc aggatccca 219 <210> 10 <211> 221 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 10 ggattcgaaa tcgcacggta cattctctgt gataattcca aagttgtgct ctacagtttt 60 attgccacac ttgttcttga cagcaatgta ggcacaatct ccttgaaagg catatgtttg 120 ctcatcaaat gtagagtagt gaccactccc gtagatgata caagttcctg gacatttttt 180 gtctgtgcat tcccactttc cactcttgca ggtacagtag a 221 <210> 11 <211> 204 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 11 gggcattctg cttgttgatg atgattgaca acagacgatt tcaataccac aaacccaatt 60 aaaaaccatg aatcctactc ggcttatggc cagttatcaa tcagcctcga ccagtggaaa 120 gaagctggct cggtgtacag ctgcgtggtt taccaccaat ctctggattc caatacaaga 180 gccattgtca gatccattgc ctac 204 <210> 12 <211> 206 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 12 gggctgatgt atcagagatt ggtggtaacc acgcagctgt acaccgagcc agcttctttc 60 cactggtcga ggctgattga taactggcca taagccgagt aggattcatg gtttttaatt 120 gggtttgtgg tattgaaatc gtctgttgtc aattcatcat caacaagcca agaaacgaaa 180 acctcttcag gggagaagtc tttcca 206

Claims (6)

a first primer set comprising the primers of SEQ ID NOs: 1 and 2;
a second primer set comprising primers of SEQ ID NOs: 3 and 4; and
a third primer set comprising primers of SEQ ID NOs: 5 and 6;
A primer set for confirming immunization of fish, comprising all of. According to claim 1,
The fish is a primer set for immunization confirmation of fish, characterized in that the strength leg. A method for confirming immunization of fish using the primer set of claim 1. 4. The method of claim 3,
The method of confirming the immunization of the fish includes: (1st step) administering an immunogen to the strength leg;
(Second step) extracting mRNA (messenger ribonucleic acid) and synthesizing cDNA (complementary deoxyribonucleic acid) by collecting the intestines of the robber leg to which the immunogen was administered and the robber leg to which the immunogen was not administered;
(Step 3) performing PCR (Polymerase chain reaction) using the cDNA and the primer set of claim 1; and;
(Step 4) comparing the gene expression levels of the strength legs to which the immunogen was administered and the strength legs to which the immunogen was not administered;
A method of confirming the immunization of fish, characterized in that it is carried out through. 5. The method of claim 4,
The PCR is a real-time RT-PCR (Real-time reverse transcript polymerase chain reaction) or RT-PCR (Reverse transcript polymerase chain reaction) immunization confirmation method of fish, characterized in that. A kit for confirming immunization of fish comprising the primer set of claim 1.