KR102186451B1 - Primer set of Integrin beta 1 for detecting immunization of fish - Google Patents
Primer set of Integrin beta 1 for detecting immunization of fish Download PDFInfo
- Publication number
- KR102186451B1 KR102186451B1 KR1020180167014A KR20180167014A KR102186451B1 KR 102186451 B1 KR102186451 B1 KR 102186451B1 KR 1020180167014 A KR1020180167014 A KR 1020180167014A KR 20180167014 A KR20180167014 A KR 20180167014A KR 102186451 B1 KR102186451 B1 KR 102186451B1
- Authority
- KR
- South Korea
- Prior art keywords
- strength
- immunization
- leg
- fish
- immunogen
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
본 발명은 어류의 면역화 확인용 어류의 면역화 확인용 인테그린 베타 1 프라이머 세트에 관한 것으로서, 상기 프라이머 세트를 이용하여 약독화된 백신으로 면역화된 강도다리의 면역 상태를 용이하게 확인함으로써 강도다리 양식장에서 강도다리의 건강 상태에 대한 관리 및 확인을 기존보다 효율적으로 수행할 수 있게 되었다. The present invention relates to an integrin beta 1 primer set for confirming immunization of fish, for confirming immunization of fish, and using the primer set to easily check the immunity status of immunized strength legs with an attenuated vaccine. It is now possible to manage and check the health of the legs more efficiently than before.
Description
본 발명은 어류의 면역화 확인용 어류의 면역화 확인용 인테그린 베타 1 프라이머 프라이머 세트에 관한 것이다. The present invention relates to an integrin beta 1 primer set for confirming immunization of fish for confirming immunization of fish.
전 세계 동물용 백신 시장이 매년 2~3%씩 성장하고 있으며, 2015년 56억달러 규모인 것으로 보고된 바 있다. 우리나라의 경우, 전체 동물용 의약품시장은 6,000억원 정도로 예측하며, 그 중 수산용 의약품은 500억정도로 추산된다. 그러나, 수산용의 경우 기존의 축산용의 항생제를 사용하지 않도록 강력하게 규제하거나, 수산질병관리사의 역할을 증대시켜 관리를 하도록 유도하고 있지만, 항생제의 대체제나 항생제의 사용을 저감 할 근본적인 대책이 마련되고 있지 않은 실정이다. 백신은 항원을 체내에 주입하는 방식으로 알려져 있으며, 다양한 방법이 개발되어져 왔으나 많이 개발되지 않은 상황이고 현재 백신사용이 항생제 오남용을 저감시키는 유일한 방법으로 알려져 있다.The global veterinary vaccine market is growing by 2-3% every year, and it was reported to be worth 5.6 billion dollars in 2015. In the case of Korea, the total veterinary drug market is estimated to be around 600 billion won, of which fishery drugs are estimated at around 50 billion. However, in the case of fisheries, the use of existing livestock antibiotics is strongly regulated, or the role of fisheries disease managers is increased to induce management, but fundamental measures to reduce the use of antibiotics or antibiotics are prepared. It is not being done. Vaccines are known as a method of injecting antigens into the body, and various methods have been developed, but not much has been developed. Currently, the use of vaccines is known as the only way to reduce the misuse of antibiotics.
한편, 기존의 수산동물들을 위한 백신은 모두 주사백신이며, 한 마리씩 주사하여야 하는 노동력을 감수해야 하는 형태이다. 그러나 국내에는 수산질병관리사의 현장 입회와 접종 시 인원의 부재로 많은 시간에 비해 작업량이 적어 어가의 실제적인 도움을 주지 못하고 있는 실정이다. 따라서, 주사보다는 간편하고 훨씬 사용하기 용이한 경구형태의 백신이 시급하다.On the other hand, all existing vaccines for aquatic animals are injection vaccines, and it is a form that requires labor to inject one by one. However, in Korea, due to the absence of personnel during the on-site attendance and vaccination of fisheries disease managers, the amount of work is small compared to many hours, and thus the actual help of the fish family is not available. Therefore, there is an urgent need for a vaccine in an oral form that is simpler and much easier to use than injection.
최근까지 연구되고 있는 경구형태의 백신은 간편한 용이성 대신 효능의 증감을 기대하기가 쉽지 않다. 또한, 사료와 함께 투여하는 장점에 비해 허실이 많아서 제대로 복용이 될 수 있느냐의 문제까지 대두될 수 있다. 이러한 문제를 해결할 수 있는 부분은 경구용 제제에 백신균주를 나노공학적으로 탑재하고, 고정하는 기술을 개발하여 투여량을 정량화할 수 있는 기술이 아주 중요하다고 할 수 있다.It is not easy to expect an increase or decrease in efficacy of an oral vaccine, which has been studied until recently, instead of simple ease. In addition, compared to the advantages of administering with feed, the problem of whether or not it can be properly taken may arise because there are many heosils. It can be said that a technology capable of quantifying the dose by developing a technology for nanoengineering and fixing a vaccine strain in an oral formulation can be said to be very important.
주사백신을 비즈의 형태로 제작하여 약독화된 미생물을 탑재할 경우에 집중적이고 유효농도의 산정을 용이하게 하는 등 다양한 백신을 이루어 제작할 수 있는 장점을 활용할 수 있다. 또한 각 백신에 대한 백신 접종 후 백신 효용에 대한 유전적 마커(genetic marker) 개발이 필요 경구백신을 개발하기 위해서는 점막면역과 장에서의 발현여부를 진단하는 유전적인 마커의 개발도 필요한 실정이다. It is possible to take advantage of the advantages of being able to make and manufacture various vaccines, such as intensive and easy calculation of effective concentration when an injectable vaccine is produced in the form of beads and attenuated microorganisms are mounted. In addition, after vaccination for each vaccine, it is necessary to develop a genetic marker for the effectiveness of the vaccine. To develop an oral vaccine, it is necessary to develop a genetic marker for diagnosing mucosal immunity and expression in the intestine.
강도다리(starry flounder/diamond back, Platichthys stellatus)는 가자미목 가자미과의 바닷물고기로서 몸길이는 40cm 정도이고 둥근 마름모꼴이다. 눈은 보통 몸의 왼쪽에 있다. 등지느러미, 뒷지느러미, 꼬리지느러미에 여러 개의 흑색 띠가 있다. 눈 있는 쪽 색깔은 짙은 갈색, 눈 없는 쪽은 연한 노란색을 띤다. 다른 가자밋과 어류와 다르게 눈의 위치는 넙치와 같은 위치에 몰려 있다. 수심 150m내외의 연안역 저층에 서식하며, 종종 하천에 출현하기도 한다. 소형 갑각류, 연체류, 갯지렁이류 등을 먹고 2-3월에 강어귀에 알을 낳으며 우리나라 동해 북부에 출현한다. 일본 북부, 오호츠크 해, 베링 해, 캘리포니아 남부 등지에 분포하며 회, 건어물, 찜, 구이 등으로 이용한다. The starry flounder/diamond back ( Platichthys stellatus ) is a saltwater fish of the plaice family, its body length is about 40cm and has a round rhombus. The eyes are usually on the left side of the body. There are several black bands on dorsal fin, posterior fin, and caudal fin. The color on the side with the eyes is dark brown, and the side without the eyes is light yellow. Unlike other flounder and fish, the position of the eye is concentrated in the same position as the flounder. It lives in the bottom of the coastal area with a depth of about 150m, and often appears in rivers. It eats small crustaceans, mollusks, and worms, lays eggs in estuaries in February and 3, and appears in the northern part of the East Sea of Korea. It is distributed in northern Japan, the Sea of Okhotsk, the Bering Sea, and southern California, and is used as sashimi, dried fish, steamed, and grilled.
강도다리는 넙치보다는 질병에 강한 어종으로 알려져 있기는 하지만 주로 양식을 통해 기르기 때문에 질병관리에 있어서 다양한 방법이 적용되어야 할 필요가 있다. 그러나 항생제나 화학약품 등의 남용보다는 강도다리 어종 자체의 면역력을 증진시키는 것이 필요하며, 이러한 면역력 증진이 된 상태를 확인해야 할 필요성 또한 대두되고 있다. Although the strength leg is known as a fish that is more resistant to disease than flounder, it is mainly raised through aquaculture, so various methods need to be applied in disease management. However, rather than abuse of antibiotics or chemicals, it is necessary to improve the immunity of the fish species of the strength leg, and the need to confirm the state in which such immunity is enhanced is also emerging.
이에 본 발명자들은 약독화된 미생물을 균주에 투입하고 이를 Integrin beta 1 유전자의 발현을 통해 확인하는 방법을 제공함으로써 본 발명을 완성하였다. Accordingly, the present inventors completed the present invention by providing a method of introducing an attenuated microorganism into a strain and confirming it through the expression of the Integrin beta 1 gene.
본 발명의 목적은 어류의 면역화 확인용 인테그린 베타 1 프라이머 세트를 제공하는 데에 있다. An object of the present invention is to provide a set of integrin beta 1 primers for confirming immunization of fish.
본 발명은 서열번호 1 및 2의 프라이머를 포함하는 것을 특징으로 하는 어류의 면역화 확인용 프라이머 세트에 관한 것이다.The present invention relates to a primer set for confirming immunization of fish, comprising the primers of SEQ ID NOs: 1 and 2.
상기 어류는 강도다리인 것을 특징으로 한다. The fish is characterized in that the strength legs.
본 발명은 상기 프라이머 세트를 이용한 어류의 면역화 확인 방법을 제공한다. The present invention provides a method for confirming immunization of fish using the primer set.
상기 어류의 면역화 확인 방법은, 바람직하게는, The method for confirming the immunization of the fish, preferably,
(제1단계) 강도다리에 면역원을 투여하는 단계; (제2단계) 면역원이 투여된 강도다리와 면역원이 비투여된 강도다리의 장을 각각 채취하여 mRNA(messenger Ribonucleic acid)를 추출하고 cDNA(complementary Deoxyribonucleic acid)를 합성하는 단계; (제3단계) 상기 cDNA와 본 발명의 프라이머 세트를 이용하여 PCR(Polymerase chain reaction)을 수행하는 단계; 및, (제4단계) 면역원이 투여된 강도다리와 면역원이 비투여된 강도다리의 유전자 발현량을 비교하는 단계;를 통해 수행되는 것을 특징으로 한다. (First step) administering an immunogen to the strength leg; (Second step) taking the intestine of the strength leg to which the immunogen was administered and the strength leg to which the immunogen was not administered, extracting messenger ribonucleic acid (mRNA), and synthesizing complementary deoxyribonucleic acid (cDNA); (Third step) performing PCR (polymerase chain reaction) using the cDNA and the primer set of the present invention; And, (Step 4) comparing the gene expression levels of the strength leg to which the immunogen is administered and the strength leg to which the immunogen is not administered; characterized in that it is performed through.
본 발명의 프라이머 세트에 포함되는 각각의 프라이머 서열은 하기와 같다. Each primer sequence included in the primer set of the present invention is as follows.
서열번호 1 (Integrin beta 1의 프라이머 F) :GAAAGACTTCTCCCCTGASEQ ID NO: 1 (Integrin beta 1 primer F): GAAAGACTTCTCCCCTGA
서열번호 2 (Integrin beta 1의 프라이머 R) :TGGAGCGATCACAGTTGAAGSEQ ID NO: 2 (Primer R of Integrin beta 1):TGGAGCGATCACAGTTGAAG
또한 각 프라이머가 증폭하는 유전자의 Genebank No.는 다음과 같다.In addition, Genebank No. of the gene amplified by each primer is as follows.
Integrin beta 1 : XM_020108867.1 Integrin beta 1: XM_020108867.1
본 발명에서 강도다리의 시료는 강도다리의 조직 어느 것이든지 사용가능하며, 어류의 조직, 세포, 혈액 등이 사용가능하며, 상기 조직 중에서 바람직하게는 장 조직을 사용하는 것이 좋다. In the present invention, the sample of the strength leg can be used in any tissue of the strength leg, and tissues, cells, blood, etc. of fish can be used, and it is preferable to use intestinal tissue among the above tissues.
본 발명에서 강도다리의 면역화에 사용될 수 있는 면역원으로는 강도다리의 면역 증진을 위해 사용될 수 있는 것이라면 어떤 것이라도 사용가능하나, 바람직하게는 Streptococcus parauberis, Vibrio harveyi 인 것이 좋다. 상기 면역원으로 사용된 균주는 더 바람직하게는 포르말린을 처리하여 약독화된 상태인 것이 더 좋다. In the present invention, any immunogen that can be used for the immunization of the strength leg can be used as long as it can be used to enhance the immunity of the strength leg, preferably Streptococcus parauberis , Vibrio harveyi . The strain used as the immunogen is more preferably attenuated by treatment with formalin.
상기 PCR은 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction) 또는 RT-PCR(Reverse transcript polymerase chain reaction)인 것을 특징으로 한다. The PCR is characterized in that it is a real-time reverse transcript polymerase chain reaction (RT-PCR) or a reverse transcript polymerase chain reaction (RT-PCR).
상기 PCR이 실시간 RT-PCR일 경우, 형광 표지 인자로서 SYBR green이 추가될 수 있다. When the PCR is a real-time RT-PCR, SYBR green may be added as a fluorescent labeling factor.
본 발명의 방법에서 RNA로부터 cDNA를 합성할 때, 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형) 등이 이용될 수 있다.When synthesizing cDNA from RNA in the method of the present invention, reverse transcriptase, cNTPs, and rNTP (pre-mixed or separately supplied), and the like may be used.
본 발명의 방법에서 PCR을 수행하기 위해, MgCl2, Tag DNA 폴리머라아제, dNTPs 등이 사용될 수 있다. To perform PCR in the method of the present invention, MgCl 2 , Tag DNA polymerase, dNTPs, etc. may be used.
본 발명은 어류의 면역화 확인용 어류의 면역화 확인용 인테그린 베타 1 프라이머 세트에 관한 것으로서, 상기 프라이머 세트를 이용하여 약독화된 백신으로 면역화된 강도다리의 면역 상태를 용이하게 확인함으로써 강도다리 양식장에서 강도다리의 건강 상태에 대한 관리 및 확인을 기존보다 효율적으로 수행할 수 있게 되었다. The present invention relates to an integrin beta 1 primer set for confirming immunization of fish, for confirming immunization of fish, and using the primer set to easily check the immunity status of immunized strength legs with an attenuated vaccine. It is now possible to manage and check the health of the legs more efficiently than before.
이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지도록, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다. Hereinafter, a preferred embodiment of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided to sufficiently convey the spirit of the present invention to those skilled in the art so that the contents introduced herein are thorough and complete.
<실시예 1. 어류의 면역화><Example 1. Immunization of fish>
본 발명에 사용한 강도다리는 주사백신을 둥근모양의 비즈를 형성하여 급이하였다. In the strength leg used in the present invention, the injection vaccine was fed by forming round beads.
알긴산 0.5%(v/v) 수용액과 FKC(Streptococcus parauberis, Vibrio harveyi)(1×108 cfu/㎖)의 생리식염수(0.9%[w/v] NaCl) 용액을 1:1의 중량비로 혼합한 다음, 호스를 통해 정량펌프 (제조사 Gilson, 모델 : M312)에 투입하였다. 그 다음, 염화칼슘 0.5M 용액에 적하하여 비즈를 구성하였다. 이후 수온 18℃에서 강도다리에 초기 일주일은 1회(1알) 투여, 이후 2달에 3회 먹여 어류의 면역화를 유도하였다. Alginic acid 0.5% (v/v) aqueous solution and physiological saline (0.9% [w/v] NaCl) solution of FKC ( Streptococcus parauberis , Vibrio harveyi ) (1×10 8 cfu/ml) were mixed in a weight ratio of 1:1 Next, it was put into a metering pump (manufacturer Gilson, model: M312) through a hose. Then, it was added dropwise to a 0.5M solution of calcium chloride to form beads. After that, the first week (1 tablet) was administered to the strength leg at a water temperature of 18°C, and then fed three times every two months to induce immunization of fish.
강도다리는 각 실험구마다 10마리씩 사용하였으며, 면역화 정도는 비즈를 먹인 강도다리를 해부하여 장 조직을 채취한 뒤 조직 샘플에서의 각 유전자 발현량을 비교하였다. 본 실험에 사용한 균주는 Streptococcus parauberis는 제주의 넙치양식장에서 Vibrio harveyi는 경북지역 D 수산에서 직접 분리한 균주였고 각 형태와 유전학적 특성을 분석하여 균주의 동정이 완료된 것을 사용하였다. FKC는 각각의 생균의 농도를 1×108 cfu/㎖로 맞춘 뒤 0.2%(w/v) formalin 용액을 48시간 처리한 후 고체 영양배지에 다시 그어 colony를 형성하지 않은 것을 확인하여 모두 사멸하였음을 확인하고 난 후 비즈에 사용하였다. 포르말린 처리까지의 균주는 액체 영양배지에 배양된 상태로 처리되었고, 포르말린 용액의 용매로는 PBS(Phosphate Buffered Saline)를 사용하였다. Ten strength legs were used for each experimental group, and the level of immunization was compared with each gene expression level in tissue samples after intestinal tissue was collected by dissecting the strength legs fed with beads. The strain used in this experiment was Streptococcus parauberis , which was directly isolated from the flounder farm in Jeju, and Vibrio harveyi was directly isolated from the Gyeongbuk region D Fisheries, and the strain was identified by analyzing each morphology and genetic characteristics. FKC adjusted the concentration of each viable bacteria to 1×10 8 cfu/ml, treated with 0.2% (w/v) formalin solution for 48 hours, and then redrawn it on solid nutrient medium to confirm that colony was not formed, and all died. After checking, it was used for beads. The strains up to the formalin treatment were treated in a cultured state in a liquid nutrient medium, and PBS (Phosphate Buffered Saline) was used as a solvent for the formalin solution.
<실시예 2. 조직 적출과 RNA 분리 및 정제><Example 2. Tissue extraction and RNA isolation and purification>
강도다리의 장 면역마커 발현여부를 확인하기 위해 강도다리의 조직을 해부 한 뒤 장 조직을 적출하여 면역 부분이 많이 발현될 것이라 판단되는 뒷부분의 1/3지점을 잘라 사용하였다. 장 조직은 적출 즉시 안에 내용물을 빼고 1.5㎖ e-tube에 Ribosaver를 넣고 조직이 손상되지 않게 보관하였다. In order to confirm the expression of the intestinal immune marker of the strength leg, the tissue of the strength leg was dissected and the intestinal tissue was excised, and a third point of the rear part where it was judged that the immune part would be expressed a lot was cut and used. The contents of the intestinal tissue were removed immediately after extraction, and Ribosaver was placed in a 1.5 ml e-tube and stored without damaging the tissue.
RNA 분리는 Gene ALL(주) 회사의 Hybrid-R RNA 분리 kit를 사용하여 진행하였다. RNA isolation was performed using a Hybrid-R RNA isolation kit of Gene ALL Co., Ltd.
이를 보다 자세히 설명하면, 1.5㎖ e-tube에 Ribo Ex 700㎕를 분주하고 마쇄 pestle를 이용하여 조직을 잘 갈아주었다. 후에 chloroform을 200㎕씩 넣고 상층액의 phenol 성분을 없애기 위해 충분히 vortexing 해 주었다. 원심분리기를 이용하여 (12000g에 4℃, 15분) 상층액을 딴 뒤 RB1 수용액을 상층액 만큼 넣어주고, 상층액과 RB1용액을 잘 섞어 준 뒤 Spin columm에 한방울씩 떨어트려 원심분리를 진행하였다(10000g에 20℃, 1분). 이후에 SW1 수용액과 RNW 수용액을 이용하여 워싱을 하고 free-water를 50㎕ 씩 천천히 넣어 원심분리(1000g, 20℃, 1분)를 통해 RNA를 분리하였다.To explain this in more detail, 700 µl of Ribo Ex was dispensed into a 1.5 ml e-tube, and the tissue was well ground using a ground pestle. Later, 200 µl of chloroform was added and vortexed sufficiently to remove the phenol component of the supernatant. After collecting the supernatant using a centrifuge (4℃ at 12000g, 15 minutes), add the RB1 aqueous solution as much as the supernatant, mix the supernatant and RB1 solution well, and then drop each drop into the spin columm to perform centrifugation. (20℃ for 10000g, 1 minute). Thereafter, washing was performed using an aqueous SW1 solution and an aqueous RNW solution, and 50µl of free-water was slowly added thereto to separate RNA through centrifugation (1000g, 20°C, 1 minute).
<실시예 3. cDNA 합성><Example 3. cDNA synthesis>
CycleScript RT premix(bioneer)를 사용하여 cDNA 합성을 하는 rtPCR을 진행하였다.premix에 free-water를 18㎕ 씩 넣고 실시예 2에서 얻은 RNA를 2㎕ 씩 넣는다. vortexing 과정을 거친 뒤 cDNA를 합성하였다. cDNA 합성 조건은 다음 표 1과 같다.RtPCR for cDNA synthesis was performed using a CycleScript RT premix (bioneer). 18 µl of free-water was added to the premix, and 2 µl of RNA obtained in Example 2 was added each. After the vortexing process, cDNA was synthesized. The cDNA synthesis conditions are shown in Table 1 below.
12
12
이와 같은 방법으로 얻은 cDNA를 스펙트로포토메타(spectrophotometer)를 사용하여 DNA 농도를 측정한 후 200㎍/㎖로 농도를 맞추고 -20℃ 냉동고에 보존하여 사용하였다. The cDNA obtained by this method was measured using a spectrophotometer, and then the concentration was adjusted to 200 µg/ml and stored in a freezer at -20°C.
<실시예 4. 프라이머 합성> <Example 4. Primer synthesis>
본 발명에 사용된 Integrin beta 1의 프라이머는 oligo primer로 합성하여 사용하였으며, primer 염기서열 및 조건은 표 2와 같고, Integrin beta 1의 Genebank No.는 다음과 같다. The primer of Integrin beta 1 used in the present invention was synthesized as an oligo primer, and the primer sequence and conditions are shown in Table 2, and the Genebank No. of Integrin beta 1 is as follows.
Integrin beta 1 : XM_020108867.1 Integrin beta 1: XM_020108867.1
DNA size(b.p.)Of amplification products
DNA size(bp)
R : TGGAGCGATCACAGTTGAAGF: GAAAGACTTCTCCCCTGA
R: TGGAGCGATCACAGTTGAAG
R : TCACCAACGTAGCTGTCTTTCTGF: CGTGCTGTCTTCCCATCCA
R: TCACCAACGTAGCTGTCTTTCTG
<실시예 5. 유전자의 중합효소연쇄반응(PCR) 및 전기영동> <Example 5. Polymerase chain reaction (PCR) and electrophoresis of genes>
강도다리의 cDNA를 각각 디자인한 프라이머를 이용하여 PCR 하였다. PCR premix는 바이오니아 회사의 PyroHotstart Taq PCR premix를 사용하였다. Total volume 은 20㎕로 D.W 16㎕, cDNA 2㎕(200㎍/㎕) 각각의 Primer를 1 ㎕(10 pmole/㎕) 씩 사용하였다. Integrin beta 1의 PCR 조건은 표 3과 같다.The cDNA of the strength leg was PCR using each designed primer. As the PCR premix, the PyroHotstart Taq PCR premix of Bioneer Company was used. The total volume was 20 µl, and 1 µl (10 pmole/µl) of each Primer of DW 16µl and cDNA 2µl (200µg/µl) was used. The PCR conditions of Integrin beta 1 are shown in Table 3.
35
35
증폭된 DNA 는 2% agarose gel 에서 전기영동을 이용해 DNA 증폭 성공여부를 검증하였다. 어류 장의 면역 상태는 Integrin beta 1의 면역화 전/후의 PCR 결과물 사진에서의 band의 intensity를 측정하여 발현 전의 fold 값을 1.0으로 하여 상대값으로 나타내었고, 발현량이 크게 증가하는 것으로 확인되어 Integrin beta-1이 면역화 지표로 이용하기에 바람직함을 알 수 있다. The amplified DNA was verified for success of DNA amplification using electrophoresis on a 2% agarose gel. The immune status of the fish intestine was expressed as a relative value by measuring the intensity of the band in the photo of the PCR result before and after the immunization of Integrin beta 1, and the fold value before expression was 1.0, and the expression level was confirmed to increase significantly. It can be seen that this is desirable for use as an immunization index.
<실시예 6. 증폭된 염기서열의 확인><Example 6. Confirmation of the amplified nucleotide sequence>
PCR 증폭을 해 얻은 산물을 재 확인차 바이오니아(주)에 염기서열분석 의뢰하였다. 분석된 염기서열을 대상으로 NCBI(National Center for Biotechnology Information) blast 검색결과를 통하여 각각의 서열이 각 유전자와 100% 일치함을 확인하였다. The product obtained by PCR amplification was requested for sequencing to Bioneer for reconfirmation. It was confirmed that each sequence was 100% identical to each gene through NCBI (National Center for Biotechnology Information) blast search results for the analyzed nucleotide sequence.
서열번호 3 : Integrin beta1-FSEQ ID NO: 3: Integrin beta1-F
GTGCTCAGACTGGACGCCACTGCCGGAAGACAACGGCACCGATATCTGCAGCAACAATGGCGACTGCGTCTGCGGCACCTGCGAATGCAAGACGCGGGAAAATCCAGCGGAGGTTTACAGCGGGAAATACTGCGAGTGTGACAACTTCAACTGTGATCGCTCCAAGTGCTCAGACTGGACGCCACTGCCGGAAGACAACGGCACCGATATCTGCAGCAACAATGGCGACTGCGTCTGCGGCACCTGCGAATGCAAGACGCGGGAAAATCCAGCGGAGGTTTACAGCGGGAAATACTGCGAGTGTGACAACTTCAACTGTGATCGCTCCAA
서열번호 4 : Integrin beta1-RSEQ ID NO: 4: Integrin beta1-R
AGAAATCGCATTATTCGCTGTAACCTCCGCTGGATTTTCCCGCGTCTTGCATTCGCAGGTGCCGCAGACGCAGTCGCCATTGTTGCTGCAGATATCGGTGCCGTTGTCTTTCCGGCAGTTGGCGTCCAGGTCCTCTGTCCGCACTTCGTCTTTGCTGCACTCACAGAAATCGCATTATTCGCTGTAACCTCCGCTGGATTTTCCCGCGTCTTGCATTCGCAGGTGCCGCAGACGCAGTCGCCATTGTTGCTGCAGATATCGGTGCCGTTGTCTTTCCGGCAGTTGGCGTCCAGGTCCTCTGTCCGCACTTCGTCTTTGCTGCACTCAC
<실시예 7. 강도다리의 면역화 상태 확인> <Example 7. Confirmation of immunization status of strength legs>
실시예 1에서 FKC(Streptococcus parauberis, Vibrio harveyi) 비즈가 투여된 강도다리가 면역화된 상태임을 확인하기 위해 FKC 투여 강도다리와 비투여군 강도다리의 질병 상태 및 폐사율을 확인하였다. In Example 1, in order to confirm that the strength legs administered with FKC ( Streptococcus parauberis , Vibrio harveyi ) beads were in an immunized state, the disease state and mortality of the strength legs administered with FKC and the strength legs in the non-administration group were confirmed.
먼저 FKC(Streptococcus parauberis, Vibrio harveyi) 비즈를 각각 실시예 1과 같이 강도다리에 먹여 면역화를 유도하였다. First, FKC ( Streptococcus parauberis , Vibrio harveyi ) beads were fed to the strength legs as in Example 1 to induce immunization.
면역화 유도군과 비즈 비투여군 강도다리의 질병은 전염력이 있는 Streptococcus parauberis, Vibrio harveyi를 0.1㎖(1×108 cfu/㎖)씩 강도다리에 먹여 유도하였다(Streptococcus parauberis 균은 약독화된 FKC(Streptococcus parauberis)를 먹인 군에 투여하는 방법을 실시함). Diseases of the immunization-inducing group and the non-bead-treated group were induced by feeding the infectious Streptococcus parauberis and Vibrio harveyi 0.1 ml (1×10 8 cfu/ml) to the strength leg ( Streptococcus parauberis was attenuated FKC ( Streptococcus parauberis ) administered to the fed group).
상기 표 5를 참고하면, 질병 유도 후 1개월 후의 폐사율이 비즈 투여군에서 현저하게 줄어들어 면역화가 잘 되었음을 확인할 수 있다. Referring to Table 5, it can be seen that the mortality rate 1 month after disease induction was significantly reduced in the beads-administered group, and thus immunization was well performed.
FKC(Streptococcus parauberis, Vibrio harveyi) 투여로 인해 폐사율이 현저하게 줄어들었고, 이를 통해 본 발명에서 확인되는 Integrin beta 1 유전자가 면역화를 통해 발현이 증가되는 유전자임을 제시할 수 있다. Due to the administration of Streptococcus parauberis (FKC , Vibrio harveyi) , the mortality rate was significantly reduced, and through this, it can be suggested that the Integrin beta 1 gene identified in the present invention is a gene whose expression is increased through immunization.
한편, 이와 같은 면역화 과정은 실시예 1과 실시예 7에서 사용한 Streptococcus parauberis, Vibrio harveyi 외에 다른 방법으로 분리된 Streptococcus parauberis, Vibrio harveyi 또는, 기탁기관에 기탁된 표준 균주인 Streptococcus parauberis, Vibrio harveyi를 사용할 때도 거의 유사하게 나타났다. On the other hand, this immunization procedure as that of Example 1, Example 7 Streptococcus parauberis used in, Vibrio harveyi besides the separation Alternatively Streptococcus parauberis, Vibrio harveyi or, when using a standard strain of Streptococcus parauberis, Vibrio harveyi deposited with the depository It appeared almost similar.
<110> JUNWON GBI Co., Ltd. <120> Primer set of Integrin beta 1 for detecting immunization of fish <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 1 gaaagacttc tcccctga 18 <210> 2 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 2 tggagcgatc acagttgaag 20 <210> 3 <211> 165 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 3 gtgctcagac tggacgccac tgccggaaga caacggcacc gatatctgca gcaacaatgg 60 cgactgcgtc tgcggcacct gcgaatgcaa gacgcgggaa aatccagcgg aggtttacag 120 cgggaaatac tgcgagtgtg acaacttcaa ctgtgatcgc tccaa 165 <210> 4 <211> 164 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 4 agaaatcgca ttattcgctg taacctccgc tggattttcc cgcgtcttgc attcgcaggt 60 gccgcagacg cagtcgccat tgttgctgca gatatcggtg ccgttgtctt tccggcagtt 120 ggcgtccagg tcctctgtcc gcacttcgtc tttgctgcac tcac 164 <110> JUNWON GBI Co., Ltd. <120> Primer set of Integrin beta 1 for detecting immunization of fish <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 1 gaaagacttc tcccctga 18 <210> 2 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 2 tggagcgatc acagttgaag 20 <210> 3 <211> 165 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 3 gtgctcagac tggacgccac tgccggaaga caacggcacc gatatctgca gcaacaatgg 60 cgactgcgtc tgcggcacct gcgaatgcaa gacgcgggaa aatccagcgg aggtttacag 120 cgggaaatac tgcgagtgtg acaacttcaa ctgtgatcgc tccaa 165 <210> 4 <211> 164 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 4 agaaatcgca ttattcgctg taacctccgc tggattttcc cgcgtcttgc attcgcaggt 60 gccgcagacg cagtcgccat tgttgctgca gatatcggtg ccgttgtctt tccggcagtt 120 ggcgtccagg tcctctgtcc gcacttcgtc tttgctgcac tcac 164
Claims (6)
(제1단계) 강도다리에 면역원으로서 포르말린을 처리하여 약독화된 상태인 스트렙트코쿠스 파라우베리스(Streptococcus parauberis) 또는 비브리오 하르베이(Vibrio harveyi)를 투여하는 단계;
(제2단계) 면역원이 투여된 강도다리와 면역원이 비여투된 강도다리의 장을 각각 채취하여 mRNA(messenger Ribonucleic acid)를 추출하고 cDNA(complementary Deoxyribonucleic acid)를 합성하는 단계;
(제3단계) 상기 cDNA와 서열번호 1 및 2의 프라이머 세트를 이용하여 PCR(Polymerase chain reaction)을 수행하는 단계; 및,
(제4단계) 면역원이 투여된 강도다리와 면역원이 비투여된 강도다리에 대해 인테그린 베타 1(Integrin beta 1 : Genebank No. XM_020108867.1)의 발현량을 비교하는 단계Immunization confirmation method of the following strength legs ( Platichthys stellatus ) performed using the primer sets of SEQ ID NOs: 1 and 2.
Step of administering (a first step) of streptavidin attenuated state by treatment of formalin as an immunogen in the leg strength teuko kusu para Ube-less (Streptococcus parauberis) or Vibrio Har bay (Vibrio harveyi);
(Second step) extracting a messenger ribonucleic acid (mRNA) by collecting the intestines of the strength leg to which the immunogen was administered and the strength leg to which the immunogen was administered, and synthesizing cDNA (complementary deoxyribonucleic acid);
(Third step) performing PCR (polymerase chain reaction) using the cDNA and primer sets of SEQ ID NOs: 1 and 2; And,
(Step 4) Comparing the expression level of Integrin beta 1 (Genebank No. XM_020108867.1) for the strength leg to which the immunogen was administered and the strength leg to which the immunogen was not administered.
상기 PCR은 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction) 또는 RT-PCR(Reverse transcript polymerase chain reaction)인 것을 특징으로 하는 강도다리(Platichthys stellatus)의 면역화 확인 방법.The method of claim 3,
The PCR is a real-time reverse transcript polymerase chain reaction (RT-PCR) or RT-PCR (Reverse transcript polymerase chain reaction), characterized in that the strength leg ( Platichthys stellatus ) immunization confirmation method.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020180167014A KR102186451B1 (en) | 2018-12-21 | 2018-12-21 | Primer set of Integrin beta 1 for detecting immunization of fish |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020180167014A KR102186451B1 (en) | 2018-12-21 | 2018-12-21 | Primer set of Integrin beta 1 for detecting immunization of fish |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20200077783A KR20200077783A (en) | 2020-07-01 |
KR102186451B1 true KR102186451B1 (en) | 2020-12-03 |
Family
ID=71601948
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020180167014A KR102186451B1 (en) | 2018-12-21 | 2018-12-21 | Primer set of Integrin beta 1 for detecting immunization of fish |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102186451B1 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101789182B1 (en) | 2016-06-30 | 2017-10-23 | 부산대학교 산학협력단 | Primer set for diagnosing infection of fish and method for diagnosing infection of fish using the same |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101953460B1 (en) | 2017-03-21 | 2019-02-28 | 주식회사 코미팜 | Method and apparatus for preparing inhibitable vaccine for prevention of stability bacterial disease including protected serum form of new streptococcus paraberis |
-
2018
- 2018-12-21 KR KR1020180167014A patent/KR102186451B1/en active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101789182B1 (en) | 2016-06-30 | 2017-10-23 | 부산대학교 산학협력단 | Primer set for diagnosing infection of fish and method for diagnosing infection of fish using the same |
Non-Patent Citations (6)
Title |
---|
Evans et al, J Cell Sci. 2009;122(Pt 2):215-225 |
Fenfang Wu et al., Fish & Shellfish Immunology, 2010, 29. pp.407-413.* |
GenBank accession No. XM_020108867.1 (2017.02.08.)* |
NCBI Reference Sequence: XM_020108867.1 |
Raghda S. M. et al, International Journal of Natural Sciences, 2014, 2(4), pp.33-43.* |
Wu et al, Fish Shellfish Immunol. 2010;29(3):407-413 |
Also Published As
Publication number | Publication date |
---|---|
KR20200077783A (en) | 2020-07-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Pietretti et al. | Ligand specificities of Toll-like receptors in fish: indications from infection studies | |
Ruangsri et al. | Differential expression and biological activity of two piscidin paralogues and a novel splice variant in Atlantic cod (Gadus morhua L.) | |
Thomas et al. | Studies on ulcerative disease caused by Aeromonas caviae-like bacterium in Indian catfish, Clarias batrachus (Linn) | |
JPH07504320A (en) | Gene transfer to birds by introducing DNA into muscles in ovo | |
Yu et al. | Polymeric immunoglobulin receptor in dojo loach (Misgurnus anguillicaudatus): molecular characterization and expression analysis in response to bacterial and parasitic challenge | |
JP2012036187A (en) | Dsrna induced specific and non-specific immunity in crustacean and other invertebrate and biodelivery vehicle for use therein | |
Das et al. | Expression analysis of heat shock protein genes during Aeromonas hydrophila infection in rohu, Labeo rohita, with special reference to molecular characterization of Grp78 | |
US10022433B2 (en) | Fish vaccine | |
Shahi et al. | Muscle growth in targeted knockout common carp (Cyprinus carpio) mstn gene with low off-target effects | |
Pennacchi et al. | Immune gene expression in the gills of Atlantic salmon (Salmo salar L.) following experimental reinfection with Neoparamoeba perurans | |
Bodó et al. | Identification of novel lumbricin homologues in Eisenia andrei earthworms | |
US9913888B2 (en) | Fish vaccine | |
US20170304416A1 (en) | Genetically modified babesia parasites expressing protective tick antigens and uses thereof | |
Chen et al. | Immunogenicity and efficacy of two DNA vaccines encoding antigenic PspA and TerD against Nocardia seriolae in hybrid snakehead | |
KR102186451B1 (en) | Primer set of Integrin beta 1 for detecting immunization of fish | |
Dixon et al. | Spring viraemia of carp | |
KR102130010B1 (en) | Primer set of transforming growth factors beta for detecting immunization of fish | |
CN101376675B (en) | Antimicrobial peptide | |
KR102271052B1 (en) | Primer set for Mucin 18, Mucin 2 like and IgM detecting immunization of fish | |
Elaswad | Genetic technologies for disease resistance research and enhancement in catfish | |
CN105121625A (en) | Immunogenic composition against aeromonas hydrophila | |
CN111484960B (en) | Novel Edwardsiella attenuated target and application thereof | |
JP2005112726A (en) | Dna vaccine against viral hemorrhagic sepsticemia of flatfish | |
Martinez-Lopez et al. | Increasing versatility of the DNA vaccines through modification of the subcellular location of plasmid-encoded antigen expression in the in vivo transfected cells | |
Komatsu et al. | Heavy metacercarial infection in the abdominal cavity of hatchery-reared Japanese dace Tribolodon hakonensis |