KR102186451B1 - Primer set of Integrin beta 1 for detecting immunization of fish - Google Patents

Abstract

The present invention relates to an integrin beta 1 primer set for confirming immunization of fish, for confirming immunization of fish, and using the primer set to easily check the immunity status of immunized strength legs with an attenuated vaccine. It is now possible to manage and check the health of the legs more efficiently than before.

Description

Primer set of Integrin beta 1 for detecting immunization of fish {Primer set of Integrin beta 1 for detecting immunization of fish}

The present invention relates to an integrin beta 1 primer set for confirming immunization of fish for confirming immunization of fish.

The global veterinary vaccine market is growing by 2-3% every year, and it was reported to be worth 5.6 billion dollars in 2015. In the case of Korea, the total veterinary drug market is estimated to be around 600 billion won, of which fishery drugs are estimated at around 50 billion. However, in the case of fisheries, the use of existing livestock antibiotics is strongly regulated, or the role of fisheries disease managers is increased to induce management, but fundamental measures to reduce the use of antibiotics or antibiotics are prepared. It is not being done. Vaccines are known as a method of injecting antigens into the body, and various methods have been developed, but not much has been developed. Currently, the use of vaccines is known as the only way to reduce the misuse of antibiotics.

On the other hand, all existing vaccines for aquatic animals are injection vaccines, and it is a form that requires labor to inject one by one. However, in Korea, due to the absence of personnel during the on-site attendance and vaccination of fisheries disease managers, the amount of work is small compared to many hours, and thus the actual help of the fish family is not available. Therefore, there is an urgent need for a vaccine in an oral form that is simpler and much easier to use than injection.

It is not easy to expect an increase or decrease in efficacy of an oral vaccine, which has been studied until recently, instead of simple ease. In addition, compared to the advantages of administering with feed, the problem of whether or not it can be properly taken may arise because there are many heosils. It can be said that a technology capable of quantifying the dose by developing a technology for nanoengineering and fixing a vaccine strain in an oral formulation can be said to be very important.

It is possible to take advantage of the advantages of being able to make and manufacture various vaccines, such as intensive and easy calculation of effective concentration when an injectable vaccine is produced in the form of beads and attenuated microorganisms are mounted. In addition, after vaccination for each vaccine, it is necessary to develop a genetic marker for the effectiveness of the vaccine. To develop an oral vaccine, it is necessary to develop a genetic marker for diagnosing mucosal immunity and expression in the intestine.

The starry flounder/diamond back ( Platichthys stellatus ) is a saltwater fish of the plaice family, its body length is about 40cm and has a round rhombus. The eyes are usually on the left side of the body. There are several black bands on dorsal fin, posterior fin, and caudal fin. The color on the side with the eyes is dark brown, and the side without the eyes is light yellow. Unlike other flounder and fish, the position of the eye is concentrated in the same position as the flounder. It lives in the bottom of the coastal area with a depth of about 150m, and often appears in rivers. It eats small crustaceans, mollusks, and worms, lays eggs in estuaries in February and 3, and appears in the northern part of the East Sea of Korea. It is distributed in northern Japan, the Sea of Okhotsk, the Bering Sea, and southern California, and is used as sashimi, dried fish, steamed, and grilled.

Although the strength leg is known as a fish that is more resistant to disease than flounder, it is mainly raised through aquaculture, so various methods need to be applied in disease management. However, rather than abuse of antibiotics or chemicals, it is necessary to improve the immunity of the fish species of the strength leg, and the need to confirm the state in which such immunity is enhanced is also emerging.

Accordingly, the present inventors completed the present invention by providing a method of introducing an attenuated microorganism into a strain and confirming it through the expression of the Integrin beta 1 gene.

Korean Patent Registration No. 10-1789182 (Name of the invention: Primer set for diagnosing bacterial infection in fish and method for diagnosing bacterial infection in fish using the same, Applicant: Pusan National University Industry-Academic Cooperation Foundation, registration date: October 17, 2017) Republic of Korea Patent Laid-Open Patent No. 10-2018-0106570 (Name of the invention: Method for manufacturing and administering an inactivated vaccine for preventing bacterial diseases of the strength leg containing the protective serotype of the new Streptococcus parauberis strain, Applicant: Komi Pharm, Release date: October 1, 2018)

An object of the present invention is to provide a set of integrin beta 1 primers for confirming immunization of fish.

The present invention relates to a primer set for confirming immunization of fish, comprising the primers of SEQ ID NOs: 1 and 2.

The fish is characterized in that the strength legs.

The present invention provides a method for confirming immunization of fish using the primer set.

The method for confirming the immunization of the fish, preferably,

(First step) administering an immunogen to the strength leg; (Second step) taking the intestine of the strength leg to which the immunogen was administered and the strength leg to which the immunogen was not administered, extracting messenger ribonucleic acid (mRNA), and synthesizing complementary deoxyribonucleic acid (cDNA); (Third step) performing PCR (polymerase chain reaction) using the cDNA and the primer set of the present invention; And, (Step 4) comparing the gene expression levels of the strength leg to which the immunogen is administered and the strength leg to which the immunogen is not administered; characterized in that it is performed through.

Each primer sequence included in the primer set of the present invention is as follows.

SEQ ID NO: 1 (Integrin beta 1 primer F): GAAAGACTTCTCCCCTGA

SEQ ID NO: 2 (Primer R of Integrin beta 1):TGGAGCGATCACAGTTGAAG

In addition, Genebank No. of the gene amplified by each primer is as follows.

Integrin beta 1: XM_020108867.1

In the present invention, the sample of the strength leg can be used in any tissue of the strength leg, and tissues, cells, blood, etc. of fish can be used, and it is preferable to use intestinal tissue among the above tissues.

In the present invention, any immunogen that can be used for the immunization of the strength leg can be used as long as it can be used to enhance the immunity of the strength leg, preferably Streptococcus parauberis , Vibrio harveyi . The strain used as the immunogen is more preferably attenuated by treatment with formalin.

The PCR is characterized in that it is a real-time reverse transcript polymerase chain reaction (RT-PCR) or a reverse transcript polymerase chain reaction (RT-PCR).

When the PCR is a real-time RT-PCR, SYBR green may be added as a fluorescent labeling factor.

When synthesizing cDNA from RNA in the method of the present invention, reverse transcriptase, cNTPs, and rNTP (pre-mixed or separately supplied), and the like may be used.

To perform PCR in the method of the present invention, MgCl ₂ , Tag DNA polymerase, dNTPs, etc. may be used.

The present invention relates to an integrin beta 1 primer set for confirming immunization of fish, for confirming immunization of fish, and using the primer set to easily check the immunity status of immunized strength legs with an attenuated vaccine. It is now possible to manage and check the health of the legs more efficiently than before.

Hereinafter, a preferred embodiment of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided to sufficiently convey the spirit of the present invention to those skilled in the art so that the contents introduced herein are thorough and complete.

<Example 1. Immunization of fish>

In the strength leg used in the present invention, the injection vaccine was fed by forming round beads.

Alginic acid 0.5% (v/v) aqueous solution and physiological saline (0.9% [w/v] NaCl) solution of FKC ( Streptococcus parauberis , Vibrio harveyi ) (1×10 ⁸ cfu/ml) were mixed in a weight ratio of 1:1 Next, it was put into a metering pump (manufacturer Gilson, model: M312) through a hose. Then, it was added dropwise to a 0.5M solution of calcium chloride to form beads. After that, the first week (1 tablet) was administered to the strength leg at a water temperature of 18°C, and then fed three times every two months to induce immunization of fish.

Ten strength legs were used for each experimental group, and the level of immunization was compared with each gene expression level in tissue samples after intestinal tissue was collected by dissecting the strength legs fed with beads. The strain used in this experiment was Streptococcus parauberis , which was directly isolated from the flounder farm in Jeju, and Vibrio harveyi was directly isolated from the Gyeongbuk region D Fisheries, and the strain was identified by analyzing each morphology and genetic characteristics. FKC adjusted the concentration of each viable bacteria to 1×10 ⁸ cfu/ml, treated with 0.2% (w/v) formalin solution for 48 hours, and then redrawn it on solid nutrient medium to confirm that colony was not formed, and all died. After checking, it was used for beads. The strains up to the formalin treatment were treated in a cultured state in a liquid nutrient medium, and PBS (Phosphate Buffered Saline) was used as a solvent for the formalin solution.

<Example 2. Tissue extraction and RNA isolation and purification>

In order to confirm the expression of the intestinal immune marker of the strength leg, the tissue of the strength leg was dissected and the intestinal tissue was excised, and a third point of the rear part where it was judged that the immune part would be expressed a lot was cut and used. The contents of the intestinal tissue were removed immediately after extraction, and Ribosaver was placed in a 1.5 ml e-tube and stored without damaging the tissue.

RNA isolation was performed using a Hybrid-R RNA isolation kit of Gene ALL Co., Ltd.

To explain this in more detail, 700 µl of Ribo Ex was dispensed into a 1.5 ml e-tube, and the tissue was well ground using a ground pestle. Later, 200 µl of chloroform was added and vortexed sufficiently to remove the phenol component of the supernatant. After collecting the supernatant using a centrifuge (4℃ at 12000g, 15 minutes), add the RB1 aqueous solution as much as the supernatant, mix the supernatant and RB1 solution well, and then drop each drop into the spin columm to perform centrifugation. (20℃ for 10000g, 1 minute). Thereafter, washing was performed using an aqueous SW1 solution and an aqueous RNW solution, and 50µl of free-water was slowly added thereto to separate RNA through centrifugation (1000g, 20°C, 1 minute).

<Example 3. cDNA synthesis>

RtPCR for cDNA synthesis was performed using a CycleScript RT premix (bioneer). 18 µl of free-water was added to the premix, and 2 µl of RNA obtained in Example 2 was added each. After the vortexing process, cDNA was synthesized. The cDNA synthesis conditions are shown in Table 1 below.

cDNA synthesis conditions Step Temp.(℃) Time(sec) Cycle One 20℃ 30 seconds
12 2 45℃ 4 minutes 3 55℃ 30 seconds 4 95℃ 5 minutes One

The cDNA obtained by this method was measured using a spectrophotometer, and then the concentration was adjusted to 200 µg/ml and stored in a freezer at -20°C.

<Example 4. Primer synthesis>

The primer of Integrin beta 1 used in the present invention was synthesized as an oligo primer, and the primer sequence and conditions are shown in Table 2, and the Genebank No. of Integrin beta 1 is as follows.

Integrin beta 1: XM_020108867.1

Oligo NAME Scale Purifiction sequence(5' --> 3') Of amplification products
DNA size(bp) One Integrim brta 1 25 nmole BioRP F: GAAAGACTTCTCCCCTGA
R: TGGAGCGATCACAGTTGAAG 192 2 beta Actin 25 nmole BioRP F: CGTGCTGTCTTCCCATCCA
R: TCACCAACGTAGCTGTCTTTCTG 200

<Example 5. Polymerase chain reaction (PCR) and electrophoresis of genes>

The cDNA of the strength leg was PCR using each designed primer. As the PCR premix, the PyroHotstart Taq PCR premix of Bioneer Company was used. The total volume was 20 µl, and 1 µl (10 pmole/µl) of each Primer of DW 16µl and cDNA 2µl (200µg/µl) was used. The PCR conditions of Integrin beta 1 are shown in Table 3.

Integrin beta 1 PCR conditions Step Temp.(℃) Time(sec) Cycle Pre-denaturation 95 15:00 One Denaturation 95 00:30
35 Annealing 57 00:45 Extension 72 0:30 Final elongation 72 07:00 One

The amplified DNA was verified for success of DNA amplification using electrophoresis on a 2% agarose gel. The immune status of the fish intestine was expressed as a relative value by measuring the intensity of the band in the photo of the PCR result before and after the immunization of Integrin beta 1, and the fold value before expression was 1.0, and the expression level was confirmed to increase significantly. It can be seen that this is desirable for use as an immunization index.

Condition Gene expression level after immunization (fold) β-actin Integrin beta-1 Streptococcus beads administration group 1.0 3.7 Vibrio harveyi beads administration group 1.0 3.4

<Example 6. Confirmation of the amplified nucleotide sequence>

The product obtained by PCR amplification was requested for sequencing to Bioneer for reconfirmation. It was confirmed that each sequence was 100% identical to each gene through NCBI (National Center for Biotechnology Information) blast search results for the analyzed nucleotide sequence.

SEQ ID NO: 3: Integrin beta1-F

GTGCTCAGACTGGACGCCACTGCCGGAAGACAACGGCACCGATATCTGCAGCAACAATGGCGACTGCGTCTGCGGCACCTGCGAATGCAAGACGCGGGAAAATCCAGCGGAGGTTTACAGCGGGAAATACTGCGAGTGTGACAACTTCAACTGTGATCGCTCCAA

SEQ ID NO: 4: Integrin beta1-R

AGAAATCGCATTATTCGCTGTAACCTCCGCTGGATTTTCCCGCGTCTTGCATTCGCAGGTGCCGCAGACGCAGTCGCCATTGTTGCTGCAGATATCGGTGCCGTTGTCTTTCCGGCAGTTGGCGTCCAGGTCCTCTGTCCGCACTTCGTCTTTGCTGCACTCAC

<Example 7. Confirmation of immunization status of strength legs>

In Example 1, in order to confirm that the strength legs administered with FKC ( Streptococcus parauberis , Vibrio harveyi ) beads were in an immunized state, the disease state and mortality of the strength legs administered with FKC and the strength legs in the non-administration group were confirmed.

First, FKC ( Streptococcus parauberis , Vibrio harveyi ) beads were fed to the strength legs as in Example 1 to induce immunization.

Diseases of the immunization-inducing group and the non-bead-treated group were induced by feeding the infectious Streptococcus parauberis and Vibrio harveyi 0.1 ml (1×10 ⁸ cfu/ml) to the strength leg ( Streptococcus parauberis was attenuated FKC ( Streptococcus parauberis ) administered to the fed group).

Condition Non-administration group (%) Beads administration group (%) Disease inducing group against Streptococcus parauberis 80% 35% Disease induction group for Vibrio harveyi 70% 30%

Referring to Table 5, it can be seen that the mortality rate 1 month after disease induction was significantly reduced in the beads-administered group, and thus immunization was well performed.

Due to the administration of Streptococcus parauberis (FKC , Vibrio harveyi) , the mortality rate was significantly reduced, and through this, it can be suggested that the Integrin beta 1 gene identified in the present invention is a gene whose expression is increased through immunization.

On the other hand, this immunization procedure as that of Example 1, Example 7 Streptococcus parauberis used in, Vibrio harveyi besides the separation Alternatively Streptococcus parauberis, Vibrio harveyi or, when using a standard strain of Streptococcus parauberis, Vibrio harveyi deposited with the depository It appeared almost similar.

<110> JUNWON GBI Co., Ltd. <120> Primer set of Integrin beta 1 for detecting immunization of fish <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 1 gaaagacttc tcccctga 18 <210> 2 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 2 tggagcgatc acagttgaag 20 <210> 3 <211> 165 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 3 gtgctcagac tggacgccac tgccggaaga caacggcacc gatatctgca gcaacaatgg 60 cgactgcgtc tgcggcacct gcgaatgcaa gacgcgggaa aatccagcgg aggtttacag 120 cgggaaatac tgcgagtgtg acaacttcaa ctgtgatcgc tccaa 165 <210> 4 <211> 164 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 4 agaaatcgca ttattcgctg taacctccgc tggattttcc cgcgtcttgc attcgcaggt 60 gccgcagacg cagtcgccat tgttgctgca gatatcggtg ccgttgtctt tccggcagtt 120 ggcgtccagg tcctctgtcc gcacttcgtc tttgctgcac tcac 164

Claims (6)

delete delete Immunization confirmation method of the following strength legs ( Platichthys stellatus ) performed using the primer sets of SEQ ID NOs: 1 and 2.
Step of administering (a first step) of streptavidin attenuated state by treatment of formalin as an immunogen in the leg strength teuko kusu para Ube-less (Streptococcus parauberis) or Vibrio Har bay (Vibrio harveyi);
(Second step) extracting a messenger ribonucleic acid (mRNA) by collecting the intestines of the strength leg to which the immunogen was administered and the strength leg to which the immunogen was administered, and synthesizing cDNA (complementary deoxyribonucleic acid);
(Third step) performing PCR (polymerase chain reaction) using the cDNA and primer sets of SEQ ID NOs: 1 and 2; And,
(Step 4) Comparing the expression level of Integrin beta 1 (Genebank No. XM_020108867.1) for the strength leg to which the immunogen was administered and the strength leg to which the immunogen was not administered. delete The method of claim 3,
The PCR is a real-time reverse transcript polymerase chain reaction (RT-PCR) or RT-PCR (Reverse transcript polymerase chain reaction), characterized in that the strength leg ( Platichthys stellatus ) immunization confirmation method. delete