KR102130010B1 - Primer set of transforming growth factors beta for detecting immunization of fish - Google Patents

Abstract

The present invention relates to a TGF beta primer set for confirming immunization of fish. By using the primer set to easily confirm the immune status of Platichthys stellatus immunized with an attenuated vaccine, management and confirmation of the health status of Platichthys stellatus in a farm thereof can be performed more efficiently than before.

Description

TGF beta primer set for immunization of fish {Primer set of transforming growth factors beta for detecting immunization of fish}

The present invention relates to a TGF-β (transforming growth factors β) primer primer set for immunization verification of fish for immunization verification of fish.

The worldwide vaccine market for animals is growing 2-3% per year, and is reported to be $5.6 billion in 2015. In Korea, the total veterinary drug market is estimated at about 600 billion won, of which the fishery drug is estimated to be about 50 billion won. However, in the case of fisheries use, it is strongly regulated not to use the antibiotics for livestock production, or it is encouraging management by increasing the role of the fisheries disease manager, but fundamental measures to reduce the use of antibiotics or antibiotics are prepared. It is not being. Vaccines are known to inject antigens into the body, and various methods have been developed, but many have not been developed, and vaccine use is currently known as the only way to reduce antibiotic abuse.

On the other hand, all existing vaccines for aquatic animals are injection vaccines, and are in the form of taking the labor force to inject one by one. However, in Korea, due to the absence of personnel during on-site attendance and inoculation of fisheries disease managers, the amount of work is small compared to many hours, and thus, it is not possible to provide practical help for fishery. Therefore, there is an urgent need for an oral vaccine that is simpler and easier to use than injection.

Oral vaccines, which have been studied until recently, are not easy to expect to increase or decrease efficacy instead of ease. In addition, compared to the advantages of administering it with the feed, there are a lot of deficiencies, so the question of whether it can be taken properly can be raised. The part that can solve these problems is that it is very important to develop a technology for nano-engineering and immobilizing vaccine strains in oral preparations to quantify the dosage.

When the injection vaccine is manufactured in the form of beads and loaded with attenuated microorganisms, it is possible to utilize the advantages of producing various vaccines such as intensive and easy calculation of effective concentration. In addition, it is necessary to develop a genetic marker for vaccine efficacy after vaccination for each vaccine. To develop an oral vaccine, it is also necessary to develop a genetic marker for diagnosing mucosal immunity and intestinal expression.

The starry flounder/diamond back ( Platichthys stellatus ) is a saltwater fish of the flatfish flounder. It is about 40 cm long and has a round lozenge. The eyes are usually on the left side of the body. There are several black bands on the dorsal fin, back fin, and caudal fin. The eye side color is dark brown, and the eye side is light yellow. Unlike other gazami and fish, the eye position is concentrated in the same position as the flounder. Inhabits the lower layers of coastal areas around 150m in depth and often appears in rivers. It eats small crustaceans, mollusks, and worms, and lays eggs in estuaries in 2-3 months, appearing in the northern part of the East Sea of Korea. It is distributed in the northern part of Japan, the Sea of Okhotsk, the Bering Sea, and southern California.

Intensity legs are known to be more resistant to disease than flounder, but because they are mainly raised through farming, various methods of disease management need to be applied. However, rather than abuse of antibiotics or chemicals, it is necessary to improve the immunity of the vulture-legged fish species itself, and the need to confirm the state in which the immunity has been enhanced is also emerging.

Accordingly, the present inventors completed the present invention by providing a method for confirming the attenuated microorganisms into strains and expressing them through the expression of TGF-β (transforming growth factors β) gene.

Republic of Korea Registered Patent No. 10-1789182 (Invention name: Primer set for diagnosing bacterial infection of fish and method for diagnosing bacterial infection of fish using the same, Applicant: Pusan National University Industry-University Cooperation Foundation, Registration Date: October 17, 2017) Republic of Korea Patent Publication No. 10-2018-0106570 (Name of the invention: Method and method for preparing and administering an inactivated vaccine for the prevention of bacterial disease of high-intensity legs containing a protective serotype of a new Streptococcus p. aureus strain, Applicant: Comi Farm, Release date: October 01, 2018)

An object of the present invention is to provide a set of TGF-β (transforming growth factors β) primers for immunization of fish.

The present invention relates to a primer set for immunization of fish characterized in that it comprises the primers of SEQ ID NO: 1 and 2.

The fish is characterized in that the strength leg.

The present invention provides a method for confirming immunization of fish using the primer set.

The method for confirming the immunization of the fish, preferably,

(First step) administering an immunogen to the burglar leg; (2nd step) extracting mRNA (messenger ribonucleic acid) and synthesizing cDNA (complementary deoxyribonucleic acid) by extracting the intestine of the intensity leg to which the immunogen was administered and the intensity leg to which the immunogen was not administered; (Step 3) performing PCR (Polymerase chain reaction) using the cDNA and the primer set of the present invention; And, (4th step) comparing the gene expression level of the intensity leg to which the immunogen is administered and the intensity leg to which the immunogen is not administered is characterized by being performed through.

Each primer sequence included in the primer set of the present invention is as follows.

SEQ ID NO: 1 (primer F of TGF-β): TGGAAAGGAACTCGACCAAC

SEQ ID NO: 2 (primer R of TGF-β): AATGGGTCTCCTTCGATGTG

In addition, Genbank No. of the gene amplified by each primer is as follows.

TGF beta: XM_020097733.1

In the present invention, any sample of the strength leg may be used as any tissue of the strength leg, fish tissue, cells, blood, etc. may be used, and intestinal tissue is preferably used among the tissues.

In the present invention, any immunogen that can be used for immunization of the burglar leg can be used as long as it can be used to enhance the immunity of the burglar leg, preferably Streptococcus parauberis , Vibrio harveyi . The strain used as the immunogen is more preferably in an attenuated state by processing formalin.

The PCR is characterized in that it is a real-time real-time reverse transcript polymerase chain reaction (RT-PCR) or a reverse transcript polymerase chain reaction (RT-PCR).

When the PCR is a real-time RT-PCR, SYBR green may be added as a fluorescent labeling factor.

When synthesizing cDNA from RNA in the method of the present invention, reverse transcriptase, cNTPs and rNTP (pre-mixed or separate feed type) and the like can be used.

To perform PCR in the method of the present invention, MgCl ₂ , Tag DNA polymerase, dNTPs, and the like can be used.

The present invention relates to a set of TGF beta primers for immunization verification of fish for immunization verification of fish, and by using the primer set to easily check the immune status of the immunized leg immunized with the attenuated vaccine, the intensity leg in the intensity leg farm. It is now possible to efficiently manage and check the health status of a person.

Hereinafter, a preferred embodiment of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided to sufficiently convey the spirit of the present invention to those skilled in the art so that the contents introduced herein are thorough and complete.

<Example 1. Immunization of fish>

Intensity legs used in the present invention were injected with a vaccine to form round beads.

Alginic acid 0.5% (v/v) aqueous solution and FKC ( Streptococcus parauberis , Vibrio harveyi ) (1×10 ⁸ cfu/ml) physiological saline (0.9% [w/v] NaCl) solution in a weight ratio of 1:1 Next, it was put into a metering pump (manufacturer Gilson, model: M312) through a hose. Then, it was added dropwise to a 0.5 M solution of calcium chloride to construct beads. After that, the initial temperature was administered once a week (1 tablet) to the burglar legs at 18°C, and then fed 3 times every 2 months to induce immunization of fish.

Ten strength legs were used for each experimental group, and the degree of immunization was analyzed by dissecting the strength legs fed with beads, and then intestinal tissues were collected and the gene expression levels in the tissue samples were compared. The strain used in this experiment was Streptococcus parauberis in Jeju flounder farm, and Vibrio harveyi was a strain isolated directly from D fisheries in Gyeongbuk region. After adjusting the concentration of each live cell to 1×10 ⁸ cfu/ml, the FKC was treated with 0.2% (w/v) formalin solution for 48 hours, and then re-drawn in a solid nutrient medium to confirm that colony was not formed and all of them were killed. After confirming, it was used for beads. The strain until formalin treatment was treated in a cultured state in a liquid nutrient medium, and PBS (Phosphate Buffered Saline) was used as a solvent for the formalin solution.

<Example 2. Tissue extraction and RNA isolation and purification>

In order to confirm the expression of the intestinal immune marker of the burglar leg, the tissue of the burglar leg was dissected, and then the intestinal tissue was extracted to cut the 1/3 of the back of the part where it was determined that the immune part would be expressed. Immediately after extraction, the intestinal tissue was removed, and the Ribosaver was placed in a 1.5 ml e-tube, and the tissue was stored without damage.

RNA isolation was performed using a Hybrid-R RNA isolation kit from Gene ALL.

In more detail, 700 μl of Ribo Ex was dispensed into a 1.5 ml e-tube, and the tissue was well ground using a grinding pestle. Afterwards, 200 μl of chloroform was added and vortexing was performed to remove the phenol component of the supernatant. After centrifugation (12000g at 4℃, 15 minutes), the supernatant was added, and then the RB1 aqueous solution was added to the supernatant, the supernatant and the RB1 solution were mixed well, and then dropped dropwise onto the spin columm to perform centrifugation. (20°C at 10000 g, 1 minute). Thereafter, washing was performed using an aqueous solution of SW1 and an aqueous solution of RNW and RNA was isolated through centrifugation (1000 g, 20°C, 1 minute) by slowly adding 50 µl of free-water.

<Example 3. cDNA synthesis>

RtPCR was performed for cDNA synthesis using CycleScript RT premix (bioneer). Add 18 µl of RNAase free-water to the premix and add 2 µl of the RNA obtained in Example 2. After the vortexing process, cDNA was synthesized. cDNA synthesis conditions are shown in Table 1 below.

cDNA synthesis conditions Step Temp.(℃) Time Cycle One 20℃ 30 seconds 12 2 45℃ 4 minutes 3 55℃ 30 seconds 4 95℃ 5 minutes One

The cDNA obtained in this way was measured for DNA concentration using a spectrophotometer, adjusted to a concentration of 200 μg/ml, and stored in a freezer at -20°C.

<Example 4. Primer synthesis>

Primers of TGF beta used in the present invention were synthesized and used as oligo primers, primer sequences and conditions are shown in Table 2, and Genbank No. of TGF beta is as follows.

TGF beta: XM_020097733.1

Oligo NAME Scale Purifiction sequence(5' --> 3') Amplification products
DNA size(bp) One TGF beta 25 nmole BioRP F: TGGAAAGGAACTCGACCAAC
R: AATGGGTCTCCTTCGATGTG 158 2 beta Actin 25 nmole BioRP F: CGTGCTGTCTTCCCATCCA
R: TCACCAACGTAGCTGTCTTTCTG 200

<Example 5. Polymerase chain reaction (PCR) and electrophoresis of genes>

PCR was performed using primers designed for each of the cDNAs of the intensity leg. The PCR premix was a PyroHotstart Taq PCR premix from Bionica. The total volume was 20 µL, and 16 µL of DW and 2 µl (200 µg/µl) of cDNA were used for 1 µl (10 pmole/µl) of each primer. PCR conditions for TGF beta are shown in Table 3.

TGF beta PCR conditions Step Temp.(℃) Time Cycle Pre-denaturation 95 5 minutes One Denaturation 95 30 seconds 40 Annealing 60 30 seconds Extension 72 30 seconds Final elongation 72 5 minutes One

The amplified DNA was tested for success in DNA amplification using electrophoresis on a 2% agarose gel. The immune status of the fish intestine was measured as the intensity of the band in the PCR product picture before/after immunization of TGF beta, and the fold value before expression was expressed as a relative value. It can be seen that it is preferable to use as.

Condition Gene expression level after immunization (fold) β-actin TGF beta-1 Streptococcus beads administration group 1.0 3.5 Vibrio harveyi beads group 1.0 3.6

<Example 6. Confirmation of amplified base sequence>

The product obtained by PCR amplification was subjected to sequencing to Bionica Co., Ltd. for re-identification. Through the NCBI (National Center for Biotechnology Information) blast search results for the analyzed base sequence, it was confirmed that each sequence is 100% identical to each gene.

<Example 7. Confirmation of immunization status of robber legs>

In Example 1, the disease state and mortality of the FKC-administered burglar and non-administered burglar leg were checked to confirm that the burglar leg to which the FKC ( Streptococcus parauberis , Vibrio harveyi ) beads were administered was immunized.

First, FKC ( Streptococcus parauberis , Vibrio harveyi ) beads were fed to the intensity leg as in Example 1 to induce immunization.

In the immunization-inducing group and the non-bead- injected group, the disease of the burglar leg was induced by feeding the infectious Streptococcus parauberis and Vibrio harveyi in 0.1 ml (1×10 ⁸ cfu/ml) in each of the burglar legs ( Streptococcus parauberis bacteria were attenuated FKC ( Streptococcus parauberis ) was administered to the fed group).

Condition Beads non-administered (%) Bead administration group (%) Disease-inducing group for Streptococcus parauberis 80% 35% Disease-inducing group for Vibrio harveyi 70% 30%

Referring to Table 5, it can be confirmed that immunization was well achieved by significantly reducing the mortality rate after 1 month after disease induction in the beads administration group.

Mortality was significantly reduced due to FKC ( Streptococcus parauberis, Vibrio harveyi) administration, and it can be suggested that the TGF beta gene identified in the present invention is a gene whose expression is increased through immunization.

On the other hand, this immunization procedure as that of Example 1, Example 7 Streptococcus parauberis used in, Vibrio harveyi besides the separation Alternatively Streptococcus parauberis, Vibrio harveyi or, when using a standard strain of Streptococcus parauberis, Vibrio harveyi deposited with the depository It appeared almost similar.

<110> JUNWON GBI Co., Ltd. <120> Primer set of transforming growth factors beta for detecting immunization of fish} <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 1 tggaaaggaa ctcgaccaac 20 <210> 2 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 2 aatgggtctc cttcgatgtg 20

Claims (6)

delete delete Method for confirming immunization of the following intensity leg ( Platichthys stellatus ) performed using the primer set of SEQ ID NOs: 1 and 2.
Step of administering (a first step) of streptavidin attenuated state by treatment of formalin as an immunogen in the leg strength teuko kusu para Ube-less (Streptococcus parauberis) or Vibrio Har bay (Vibrio harveyi);
(Second step) extracting mRNA (messenger ribonucleic acid) and synthesizing cDNA (complementary deoxyribonucleic acid) by extracting the intestine of the intensity leg to which the immunogen was administered and the intensity leg to which the immunogen was not filtered;
(Step 3) performing PCR (Polymerase chain reaction) using the cDNA and the primer set of SEQ ID NOs: 1 and 2; And,
(Step 4) Comparing the expression level of TGF beta (TGF beta: XM_020097733.1) for the intensity leg administered with the immunogen and the intensity leg without administration of the immunogen delete According to claim 3,
The PCR is a real-time RT-PCR (Real-time reverse transcript polymerase chain reaction) or RT-PCR (Reverse transcript polymerase chain reaction) characterized in that the immunization method of fish. delete