KR20200072834A - Primer set for Mucin 18, Mucin 2 like and IgM detecting immunization of fish - Google Patents
Primer set for Mucin 18, Mucin 2 like and IgM detecting immunization of fish Download PDFInfo
- Publication number
- KR20200072834A KR20200072834A KR1020180160868A KR20180160868A KR20200072834A KR 20200072834 A KR20200072834 A KR 20200072834A KR 1020180160868 A KR1020180160868 A KR 1020180160868A KR 20180160868 A KR20180160868 A KR 20180160868A KR 20200072834 A KR20200072834 A KR 20200072834A
- Authority
- KR
- South Korea
- Prior art keywords
- fish
- mucin
- primer set
- immunization
- leg
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
본 발명은 어류의 면역화 확인용 뮤신 18, 뮤신 2 라이크 및 IgM 프라이머 세트에 관한 것이다. The present invention relates to mucin 18, mucin 2 like and IgM primer sets for immunization of fish.
강도다리(starry flounder/diamond back, Platichthys stellatus)는 가자미목 가자미과의 바닷물고기로서 몸길이는 40cm 정도이고 둥근 마름모꼴이다. 눈은 보통 몸의 왼쪽에 있다. 등지느러미, 뒷지느러미, 꼬리지느러미에 여러 개의 흑색 띠가 있다. 눈 있는 쪽 색깔은 짙은 갈색, 눈 없는 쪽은 연한 노란색을 띤다. 다른 가자밋과 어류와 다르게 눈의 위치는 넙치와 같은 위치에 몰려 있다. 수심 150m 내외의 연안역 저층에 서식하며, 종종 하천에 출현하기도 한다. 소형 갑각류, 연체류, 갯지렁이류 등을 먹는다. 2-3월에 강어귀에 알을 낳는다. 우리나라 동해 북부에 출현한다. 일본 북부, 오호츠크 해, 베링 해, 캘리포니아 남부 등지에 분포한다. 회, 건어물, 찜, 구이 등으로 이용한다. The starry flounder/diamond back ( Platichthys stellatus ) is a saltwater fish of the flatfish flounder. It is about 40 cm long and has a round lozenge. The eyes are usually on the left side of the body. There are several black bands on the dorsal fin, back fin, and caudal fin. The eye side color is dark brown, and the eye side is light yellow. Unlike other gazami and fish, the eye position is concentrated in the same position as the flounder. Inhabits the lower layers of coastal areas around 150m deep and often appears in rivers. Eat small crustaceans, mollusks, and worms. Lay eggs in estuaries in 2-3 months. It appears in the northern part of the East Sea of Korea. It is distributed in northern Japan, the Sea of Okhotsk, the Bering Sea, and southern California. It is used as sashimi, dried fish, steamed and grilled.
강도다리는 넙치보다는 질병에 강한 어종으로 알려져 있기는 하지만 주로 양식을 통해 기르기 때문에 질병관리에 있어서 다양한 방법이 적용되어야 할 필요가 있다. 그러나 항생제나 화학약품 등의 남용보다는 강도다리 어종 자체의 면역력을 증진시키는 것이 필요하며, 이러한 면역력 증진이 된 상태를 확인해야 할 필요성 또한 대두되고 있다. Intensity legs are known to be more resistant to disease than flounder, but because they are mainly raised through farming, various methods of disease management need to be applied. However, rather than abuse of antibiotics or chemicals, it is necessary to improve the immunity of the vulture-legged fish species itself, and the need to confirm the state in which the immunity has been enhanced is also emerging.
이에 본 발명자들은 약독화된 미생물을 균주에 투입하고 이를 Mucin 18, mucin-2-like, IgM 유전자 발현을 통해 확인하는 방법을 제공함으로써 본 발명을 완성하였다. Accordingly, the present inventors completed the present invention by providing a method for confirming the attenuated microorganisms into strains and expressing them through Mucin 18, mucin-2-like, and IgM gene expression.
본 발명의 목적은 어류의 면역화 확인용 뮤신 18, 뮤신 2 라이크 및 IgM 프라이머 세트를 제공하는 데에 있다. An object of the present invention is to provide a mucin 18, mucin 2 like and IgM primer set for immunization of fish.
본 발명은 서열번호 1 및 2의 프라이머를 포함하는 제1 프라이머 세트;The present invention is a first primer set comprising the primers of SEQ ID NO: 1 and 2;
서열번호 3 및 4의 프라이머를 포함하는 제2 프라이머 세트; 및,A second primer set comprising primers of SEQ ID NOs: 3 and 4; And,
서열번호 5 및 6의 프라이머를 포함하는 제3 프라이머 세트; A third primer set comprising primers of SEQ ID NOs: 5 and 6;
로 이루어진 군 중에서 선택되는 1종 이상의 프라이머 세트를 포함하는 것을 특징으로 하는 어류의 면역화 확인용 프라이머 세트에 관한 것이다.It relates to a primer set for immunization of fish characterized in that it comprises at least one primer set selected from the group consisting of.
상기 어류는 강도다리인 것을 특징으로 한다. The fish is characterized in that the strength leg.
본 발명은 상기 프라이머 세트를 이용한 어류의 면역화 확인 방법을 제공한다. The present invention provides a method for confirming immunization of fish using the primer set.
상기 어류의 면역화 확인 방법은, 바람직하게는, The method for confirming the immunization of the fish, preferably,
(제1단계) 강도다리에 면역원을 투여하는 단계; (제2단계) 면역원이 투여된 강도다리와 면역원이 비투여된 강도다리의 장을 각각 채취하여 mRNA(messenger Ribonucleic acid)를 추출하고 cDNA(complementary Deoxyribonucleic acid)를 합성하는 단계; (제3단계) 상기 cDNA와 본 발명의 프라이머 세트를 이용하여 PCR(Polymerase chain reaction)을 수행하는 단계; 및, (제4단계) 면역원이 투여된 강도다리와 면역원이 비투여된 강도다리의 유전자 발현량을 비교하는 단계;;를 통해 수행되는 것을 특징으로 한다. (First step) administering an immunogen to the burglar leg; (2nd step) extracting mRNA (messenger ribonucleic acid) and synthesizing cDNA (complementary deoxyribonucleic acid) by extracting the intestine of the intensity leg to which the immunogen was administered and the intensity leg to which the immunogen was not administered; (Step 3) performing PCR (Polymerase chain reaction) using the cDNA and the primer set of the present invention; And, (4th step) comparing the gene expression level of the intensity leg to which the immunogen has been administered and the intensity leg to which the immunogen has not been administered; is characterized in that it is performed through.
본 발명의 프라이머 세트에 포함되는 각각의 프라이머 서열은 하기와 같다. Each primer sequence included in the primer set of the present invention is as follows.
서열번호 1 (Mucin 18의 프라이머 F) : CTACTCTTTCCTCTACCACSEQ ID NO: 1 (primer F of Mucin 18): CTACTCTTTCCTCTACCAC
서열번호 2 (Mucin 18의 프라이머 R) : GAGGTCTTGTTTTCCTGATCSEQ ID NO: 2 (primer R of Mucin 18): GAGGTCTTGTTTTCCTGATC
서열번호 3 (Mucin-2-like의 프라이머 F) : CTACTGTACCTGCAAGAGSEQ ID NO: 3 (Mucin-2-like primer F): CTACTGTACCTGCAAGAG
서열번호 4 (Mucin-2-like의 프라이머 R) : GGATCCTGATAGTTTTGGAGSEQ ID NO: 4 (Mucin-2-like primer R): GGATCCTGATAGTTTTGGAG
서열번호 5 (IgM의 프라이머 F) : CTACTCTTTCCTCTACCACSEQ ID NO: 5 (IgM primer F): CTACTCTTTCCTCTACCAC
서열번호 6 (IgM의 프라이머 R) : GTAGGCAATGGATCTGACSEQ ID NO: 6 (IgM primer R): GTAGGCAATGGATCTGAC
또한 각 프라이머가 증폭하는 유전자의 Genebank No.는 다음과 같다.In addition, Genebank No. of the gene amplified by each primer is as follows.
Mucin 18 : XM_020088244.1Mucin 18: XM_020088244.1
Mucin 2 like : XM_023422491.1Mucin 2 like: XM_023422491.1
IgM : AF228579.1IgM: AF228579.1
본 발명에서 강도다리의 시료는 강도다리의 조직 어느 것이든지 사용가능하며, 어류의 조직, 세포, 혈액 등이 사용가능하며, 상기 조직 중에서 바람직하게는 장 조직을 사용하는 것이 좋다. In the present invention, any sample of the strength leg may be used as any tissue of the strength leg, fish tissue, cells, blood, etc. may be used, and intestinal tissue is preferably used among the tissues.
본 발명에서 강도다리의 면역화에 사용될 수 있는 면역원으로는 강도다리의 면역 증진을 위해 사용될 수 있는 것이라면 어떤 것이라도 사용가능하나, 바람직하게는 Streptococcus parauberis, Vibrio harveyi 인 것이 좋다. 상기 면역원으로 사용된 균주는 더 바람직하게는 포르말린을 처리하여 약독화된 상태인 것이 더 좋다. In the present invention, any immunogen that can be used for immunization of the burglar leg can be used as long as it can be used to enhance immunity of the burglar leg, preferably Streptococcus parauberis , Vibrio harveyi . The strain used as the immunogen is more preferably in an attenuated state by processing formalin.
상기 PCR은 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction) 또는 RT-PCR(Reverse transcript polymerase chain reaction)인 것을 특징으로 한다. The PCR is characterized in that it is a real-time reverse transcript polymerase chain reaction (RT-PCR) or a reverse transcript polymerase chain reaction (RT-PCR).
상기 PCR이 실시간 RT-PCR일 경우, 형광 표지 인자로서 SYBR green이 추가될 수 있다. When the PCR is a real-time RT-PCR, SYBR green may be added as a fluorescent labeling factor.
본 발명의 방법에서 RNA로부터 cDNA를 합성할 때, 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형) 등이 이용될 수 있다.When synthesizing cDNA from RNA in the method of the present invention, reverse transcriptase, cNTPs and rNTP (pre-mixed or separate feed type) and the like can be used.
본 발명의 방법에서 PCR을 수행하기 위해, MgCl2, Tag DNA 폴리머라아제, dNTPs 등이 사용될 수 있다. To perform PCR in the method of the present invention, MgCl 2 , Tag DNA polymerase, dNTPs, and the like can be used.
본 발명은 어류의 면역화 확인용 어류의 면역화 확인용 뮤신 18, 뮤신 2 라이크, IgM 프라이머 세트에 관한 것으로서, 상기 프라이머 세트를 이용하여 약독화된 백신으로 면역화된 강도다리의 면역 상태를 용이하게 확인함으로써 강도다리 양식장에서 강도다리의 건강 상태에 대한 관리 및 확인을 기존보다 효율적으로 수행할 수 있게 되었다. The present invention relates to a mucin 18, mucin 2 like, IgM primer set for confirming the immunization of fish for immunization of fish, by easily confirming the immunity status of the burglar legs immunized with the attenuated vaccine using the primer set It is now possible to manage and check the health status of robbery legs more efficiently than in the existing robbery farms.
이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지도록, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다. Hereinafter, a preferred embodiment of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided to sufficiently convey the spirit of the present invention to those skilled in the art so that the contents introduced herein are thorough and complete.
<실시예 1. 어류의 면역화><Example 1. Immunization of fish>
본 발명에 사용한 강도다리는 주사백신을 둥근모양의 비즈를 형성하여 급이하였다. Intensity legs used in the present invention were injected with a vaccine to form round beads.
알긴산 0.5%(v/v) 수용액과 FKC(Streptococcus parauberis, Vibrio harveyi)(1×108 cfu/ml)의 생리식염수(0.9%[w/v] NaCl) 용액을 1:1의 중량비로 혼합한 다음, 호스를 통해 정량펌프 (제조사 Gilson, 모델 : M312)에 투입하였다. 그 다음, 염화칼슘 0.5M 용액에 적하하여 비즈를 구성하였다. 이후 수온 18℃에서 강도다리에 초기 일주일은 1회(1알) 투여, 이후 2달에 3회 먹여 어류의 면역화를 유도하였다. Alginic acid 0.5% (v/v) aqueous solution and FKC ( Streptococcus parauberis , Vibrio harveyi ) (1×10 8 cfu/ml) physiological saline solution (0.9% [w/v] NaCl) solution in a weight ratio of 1:1 Next, it was put into a metering pump (manufacturer Gilson, model: M312) through a hose. Then, it was added dropwise to a 0.5 M solution of calcium chloride to construct beads. After that, the initial temperature was administered once a week (1 tablet) to the burglar legs at 18°C, and then fed 3 times every 2 months to induce immunization of fish.
강도다리는 각 실험구마다 10마리씩 사용하였으며, 면역화 정도는 비즈를 먹인 강도다리를 해부하여 장 조직을 채취한 뒤 조직 샘플에서의 각 유전자 발현량을 비교하였다. 본 실험에 사용한 균주는 Streptococcus parauberis는 제주의 넙치양식장에서 Vibrio harveyi는 경북지역 D 수산에서 직접 분리한 균주였고 각 형태와 유전학적 특성을 분석하여 균주의 동정이 완료된 것을 사용하였다. FKC는 각각의 생균의 농도를 1×108 cfu/ml로 맞춘 뒤 0.2%(w/v) formalin 용액을 48시간 처리한 후 고체 영양배지에 다시 그어 colony를 형성하지 않은 것을 확인하여 모두 사멸하였음을 확인하고 난 후 비즈에 사용하였다. 포르말린 처리까지의 균주는 액체 영양배지에 배양된 상태로 처리되었고, 포르말린 용액의 용매로는 PBS(Phosphate Buffered Saline)를 사용하였다. Ten strength legs were used for each experimental group, and the degree of immunization was analyzed by dissecting the strength legs fed with beads, and then intestinal tissues were collected and the gene expression levels in the tissue samples were compared. The strain used in this experiment was Streptococcus parauberis in Jeju flounder farm, Vibrio harveyi was a strain isolated directly from D fisheries in Gyeongbuk area, and the analysis of each morphology and genetic characteristics was used to identify the strain. FKC adjusted the concentration of each live bacteria to 1×10 8 cfu/ml, treated with a 0.2% (w/v) formalin solution for 48 hours, and re-drawn in a solid nutrient medium to confirm that colony was not formed, and all of them were killed. After confirming, it was used for beads. The strain until formalin treatment was treated in a cultured state in a liquid nutrient medium, and PBS (Phosphate Buffered Saline) was used as a solvent for the formalin solution.
<실시예 2. 조직 적출과 RNA 분리 및 정제><Example 2. Tissue extraction and RNA isolation and purification>
강도다리의 장 면역마커 발현여부를 확인하기 위해 강도다리의 조직을 해부 한 뒤 장 조직을 적출하여 면역 부분이 많이 발현될 것이라 판단되는 뒷부분의 1/3지점을 잘라 사용하였다. 장 조직은 적출 즉시 안에 내용물을 빼고 1.5㎖ e-tube에 Ribosaver를 넣고 조직이 손상되지 않게 보관하였다. In order to confirm the expression of the intestinal immune marker of the burglar leg, the tissue of the burglar leg was dissected, and then the intestinal tissue was extracted to cut the 1/3 of the back of the part where it was determined that the immune part would be expressed. Immediately after extraction, the intestinal tissue was removed, and the Ribosaver was placed in a 1.5 ml e-tube, and the tissue was stored without damage.
RNA 분리는 Gene ALL(주) 회사의 Hybrid-R RNA 분리 kit를 사용하여 진행하였다. RNA isolation was performed using a Hybrid-R RNA isolation kit from Gene ALL.
이를 보다 자세히 설명하면, 1.5㎖ e-tube에 Ribo Ex 700㎕를 분주하고 마쇄 pestle를 이용하여 조직을 잘 갈아주었다. 후에 chloroform을 200㎕씩 넣고 상층액의 phenol 성분을 없애기 위해 충분히 vortexing 해 주었다. 원심분리기를 이용하여 (12000g에 4℃, 15분) 상층액을 딴 뒤 RB1 수용액을 상층액 만큼 넣어주고, 상층액과 RB1용액을 잘 섞어 준 뒤 Spin columm에 한방울씩 떨어트려 원심분리를 진행하였다(10000g에 20℃, 1분). 이후에 SW1 수용액과 RNW 수용액을 이용하여 워싱을 하고 free-water를 50㎕ 씩 천천히 넣어 원심분리(1000g, 20℃, 1분)를 통해 RNA를 분리하였다.In more detail, 700 μl of Ribo Ex was dispensed into a 1.5 ml e-tube, and the tissue was well ground using a grinding pestle. Afterwards, 200 μl of chloroform was added and vortexing was performed to remove the phenol component of the supernatant. After centrifugation (12000g at 4℃, 15 minutes), the supernatant was added, and then the RB1 aqueous solution was added to the supernatant, the supernatant and the RB1 solution were mixed well, and then dropped dropwise onto the spin columm to perform centrifugation. (20°C at 10000 g, 1 minute). Thereafter, washing was performed using an aqueous solution of SW1 and an aqueous solution of RNW and RNA was isolated through centrifugation (1000 g, 20°C, 1 minute) by slowly adding 50 µl of free-water.
<실시예 3. cDNA 합성><Example 3. cDNA synthesis>
CycleScript RT premix(bioneer)를 사용하여 cDNA 합성을 하는 rtPCR을 진행하였다.premix에 free-water를 18㎕ 씩 넣고 실시예 2에서 얻은 RNA를 2㎕ 씩 넣는다. vortexing 과정을 거친 뒤 cDNA를 합성하였다. cDNA 합성 조건은 다음 표 1과 같다.RtPCR for cDNA synthesis was performed using CycleScript RT premix (bioneer). 18 μl of free-water was added to the premix, and 2 μl of RNA obtained in Example 2 was added. After the vortexing process, cDNA was synthesized. cDNA synthesis conditions are shown in Table 1 below.
12
12
이와 같은 방법으로 얻은 cDNA를 스펙트로포토메타(spectrophotometer)를 사용하여 DNA 농도를 측정한 후 200㎍/㎖로 농도를 맞추고 -20℃ 냉동고에 보존하여 사용하였다. The cDNA obtained in this way was measured for DNA concentration using a spectrophotometer, adjusted to a concentration of 200 μg/ml, and stored in a freezer at -20°C.
<실시예 4. 프라이머 합성> <Example 4. Primer synthesis>
본 발명에 사용된 Mucin 18, Mucin-2-like, IgM의 프라이머는 oligo primer로 합성하여 사용하였으며, 각각의 유전자 별 primer 염기서열 및 조건은 표 2와 같고, 각 유전자의 Genebank No.는 다음과 같다. Primers of Mucin 18, Mucin-2-like, and IgM used in the present invention were synthesized and used as oligo primers. The primer sequence and conditions for each gene are shown in Table 2, and the Genebank No. of each gene is as follows. same.
IgM : AF228579.1IgM: AF228579.1
Mucin 18 : XM_020088244.1Mucin 18: XM_020088244.1
Mucin 2 like : XM_023422491.1Mucin 2 like: XM_023422491.1
DNA size(b.p.)Amplification products
DNA size(bp)
R : GAGGTCTTGTTTTCCTGATCF: CTACTCTTTCCTCTACCAC
R: GAGGTCTTGTTTTCCTGATC
R : GGATCCTGATAGTTTTGGAGF: CTACTGTACCTGCAAGAG
R: GGATCCTGATAGTTTTGGAG
R : GTAGGCAATGGATCTGACF: CTACTCTTTCCTCTACCAC
R: GTAGGCAATGGATCTGAC
R :TCACCAACGTAGCTGTCTTTCTGF: CGTGCTGTCTTCCCATCCA
R :TCACCAACGTAGCTGTCTTTCTG
<실시예 5. 유전자의 중합효소연쇄반응(PCR) 및 전기영동> <Example 5. Polymerase chain reaction (PCR) and electrophoresis of genes>
강도다리의 cDNA를 각각 디자인한 프라이머를 이용하여 PCR 하였다. PCR premix는 바이오니아 회사의 PyroHotstart Taq PCR premix를 사용하였다. Total volume 은 20㎕로 D.W 16㎕, cDNA 2㎕(200㎍/㎕) 각각의 Primer를 1 ㎕(10 pmole/㎕) 씩 사용하였다. PCR was performed using primers designed for each of the cDNAs of the intensity leg. The PCR premix was a PyroHotstart Taq PCR premix from Bionica. The total volume was 20 µL, and 16 µL of DW and 2 µl (200 µg/µl) of cDNA were used for 1 µl (10 pmole/µl) of each primer.
IgM, Mucin 18 primer의 PCR 조건은 표 3과 같고, Mucin 2 like primer의 PCR 조건은 표 4와 같다.PCR conditions for IgM and Mucin 18 primers are shown in Table 3, and PCR conditions for Mucin 2 like primers are shown in Table 4.
증폭된 DNA 는 2% agarose gel 에서 전기영동을 이용해 DNA 증폭 성공여부를 검증하였다. 어류 장의 면역 상태는 각 유전자의 면역화 전/후의 PCR 결과물 사진에서의 band의 intensity를 측정하여 발현 전의 fold 값을 1.0으로 하여 상대값으로 나타내었다. The amplified DNA was tested for success in DNA amplification using electrophoresis on a 2% agarose gel. The immune status of the fish intestine was expressed as a relative value by setting the fold value before expression to 1.0 by measuring the intensity of the band in the PCR product picture before/after immunization of each gene.
<실시예 6. 증폭된 염기서열의 확인><Example 6. Confirmation of amplified base sequence>
PCR 증폭을 해 얻은 산물을 재 확인차 바이오니아(주)에 염기서열분석 의뢰하였다. 분석된 염기서열을 대상으로 NCBI(National Center for Biotechnology Information) blast 검색결과를 통하여 각각의 서열이 각 유전자와 100% 일치함을 확인하였다. The product obtained by PCR amplification was subjected to sequencing to Bionica Co., Ltd. for re-identification. Through the NCBI (National Center for Biotechnology Information) blast search results for the analyzed base sequence, it was confirmed that each sequence is 100% identical to each gene.
서열번호 7 : Mucin 18 FSEQ ID NO: 7: Mucin 18 F
TGGAGGCTGTTTATCCAGAAAGCCAGCAGGGGGCAATGGTGTGATCATTGCAGTCCTCATTATCTGCCTCCTGCTGCTCGCCATCTTGGGGGCTGTGCTCTACTTCCTCTACAAAAAGGGCAAAATCTGTGGCCGATCAGGAAAACAAGACCTCTGGAGGCTGTTTATCCAGAAAGCCAGCAGGGGGCAATGGTGTGATCATTGCAGTCCTCATTATCTGCCTCCTGCTGCTCGCCATCTTGGGGGCTGTGCTCTACTTCCTCTACAAAAAGGGCAAAATCTGTGGCCGATCAGGAAAACAAGACCTC
서열번호 8 : Mucin 18 RSEQ ID NO: 8: Mucin 18 R
CACAAGGGTTGCCTTTTTGTAGAGGAGTAGAGCACAGCCCCCAAGATGGCGAGCAGCAGGAGGCAGATAATGAGGACTGCAATGATCACACCATTGCCCCCTGCTGGCTTTTTCTGGATATCTGTTGCTCCTTTAACTGTGGTAGAGGAAAGAGTAGACACAAGGGTTGCCTTTTTGTAGAGGAGTAGAGCACAGCCCCCAAGATGGCGAGCAGCAGGAGGCAGATAATGAGGACTGCAATGATCACACCATTGCCCCCTGCTGGCTTTTTCTGGATATCTGTTGCTCCTTTAACTGTGGTAGAGGAAAGAGTAGA
서열번호 9 : Mucin 2 like FSEQ ID NO: 9: Mucin 2 like F
CCTTCAGCAGACACAATGTCCAGGAACTTGTATCATCTACGGGAGTGGTCACTACTCTACATTTGATGAGCAAACATATGCCTTTCAAGGAGATTGTGCCTACATTGCTGTCAAGAACAAGTGTGGCAATAAAACTGTAGAGCACAACTTTGGAATTATCACAGAGAATGTACCGTGCGGATCTACAGGCACCACCTGCTCCAAAATATCAGGATCCCACCTTCAGCAGACACAATGTCCAGGAACTTGTATCATCTACGGGAGTGGTCACTACTCTACATTTGATGAGCAAACATATGCCTTTCAAGGAGATTGTGCCTACATTGCTGTCAAGAACAAGTGTGGCAATAAAACTGTAGAGCACAACTTTGGAATTATCACAGAGAATGCA
서열번호 10 : Mucin 2 like RSEQ ID NO: 10: Mucin 2 like R
GGATTCGAAATCGCACGGTACATTCTCTGTGATAATTCCAAAGTTGTGCTCTACAGTTTTATTGCCACACTTGTTCTTGACAGCAATGTAGGCACAATCTCCTTGAAAGGCATATGTTTGCTCATCAAATGTAGAGTAGTGACCACTCCCGTAGATGATACAAGTTCCTGGACATTTTTTGTCTGTGCATTCCCACTTTCCACTCTTGCAGGTACAGTAGAGGATTCGAAATCGCACGGTACATTCTCTGTGATAATTCCAAAGTTGTGCTCTACAGTTTTATTGCCACACTTGTTCTTGACAGCAATGTAGGCACAATCTCCTTGAAAGGCATATGTTTGCTCATCAAATGTAGAGTAGTGACCACTCCCGTAGATGATACAAGTTCCTGGACATTTTTTGTCTGTA
서열번호 11 : IgM FSEQ ID NO: 11: IgM F
GGGCATTCTGCTTGTTGATGATGATTGACAACAGACGATTTCAATACCACAAACCCAATTAAAAACCATGAATCCTACTCGGCTTATGGCCAGTTATCAATCAGCCTCGACCAGTGGAAAGAAGCTGGCTCGGTGTACAGCTGCGTGGTTTACCACCAATCTCTGGATTCCAATACAAGAGCCATTGTCAGATCCATTGCCTACGGGCATTCTGCTTGTTGATGATGATTGACAACAGACGATTTCAATACCACAAACCCAATTAAAAACCATGAATCCTACTCGGCTTATGGCCAGTTATCAATCAGCCTCGACCAGTGGAAAGAAGCTGGCTCGGTGTACAGCTGCGTGGTTTACCACCAATCTCTGGATTCCAGATAGAG
서열번호 12 : IgM-RSEQ ID NO: 12: IgM-R
GGGCTGATGTATCAGAGATTGGTGGTAACCACGCAGCTGTACACCGAGCCAGCTTCTTTCCACTGGTCGAGGCTGATTGATAACTGGCCATAAGCCGAGTAGGATTCATGGTTTTTAATTGGGTTTGTGGTATTGAAATCGTCTGTTGTCAATTCATCATCAACAAGCCAAGAAACGAAAACCTCTTCAGGGGAGAAGTCTTTCCAGGGCTGATGTATCAGAGATTGGTGGTAACCACGCAGCTGTACACCGAGCCAGCTTCTTTCCACTGGTCGAGGCTGATTGATAACTGGCCATAAGCCGAGTAGGATTCATGGTTTTTAATTGGGTTTGTGGTATTGAAATCGTCTGTTGTCAATTCATCATCAACAAGCTAAGAAACGAAAACCTTCAGAGGA
<실시예 7. 강도다리의 면역화 상태 확인> <Example 7. Confirmation of immunization status of robber legs>
실시예 1에서 FKC(Streptococcus parauberis, Vibrio harveyi) 비즈가 투여된 강도다리가 면역화된 상태임을 확인하기 위해 FKC 투여 강도다리와 비투여군 강도다리의 질병 상태 및 폐사율을 확인하였다. In Example 1, the disease state and mortality of the FKC-administered burglar and non-administered burglar leg were checked to confirm that the burglar leg to which the FKC ( Streptococcus parauberis , Vibrio harveyi ) beads were administered was immunized.
먼저 FKC(Streptococcus parauberis, Vibrio harveyi) 비즈를 각각 실시예 1과 같이 강도다리에 먹여 면역화를 유도하였다. First, FKC ( Streptococcus parauberis , Vibrio harveyi ) beads were fed to the intensity leg as in Example 1 to induce immunization.
면역화 유도군과 비즈 비투여군 강도다리의 질병은 전염력이 있는 Streptococcus parauberis, Vibrio harveyi를 0.1㎖(1×108 cfu/㎖)씩 강도다리에 먹여 유도하였다(Streptococcus parauberis균은 약독화된 FKC(Streptococcus parauberis)를 먹인 군에 투여하는 방법을 실시함). In the immunization-inducing group and the non-bead- injected group, the disease of the burglar leg was induced by feeding the infectious Streptococcus parauberis and Vibrio harveyi in 0.1 ml (1×10 8 cfu/ml) in each of the burglar legs ( Streptococcus parauberis bacteria were attenuated FKC ( Streptococcus parauberis ) was administered to the fed group).
대한 질병 유도군 Streptococcus parauberis on
Korean disease-inducing group
대한 질병 유도군 Vibrio harveyi in
Korean disease-inducing group
상기 표 7을 참고하면, 질병 유도 후 1개월 후의 폐사율이 비즈 투여군에서 현저하게 줄어들어 면역화가 잘 되었음을 확인할 수 있다. Referring to Table 7, the mortality rate after 1 month after disease induction was significantly reduced in the beads-administered group, and it was confirmed that immunization was well performed.
FKC(Streptococcus parauberis, Vibrio harveyi) 투여로 인해 폐사율이 현저하게 줄어들었고, 이를 통해 본 발명에서 확인되는 Mucin 18, Mucin 2 like, IgM 유전자가 면역화를 통해 발현이 증가되는 유전자임을 확인할 수 있다. Mortality was significantly reduced due to FKC ( Streptococcus parauberis, Vibrio harveyi) administration, and it can be confirmed that Mucin 18, Mucin 2 like, and IgM genes identified in the present invention are genes whose expression is increased through immunization.
한편, 이와 같은 면역화 과정은 실시예 1과 실시예 7에서 사용한 Streptococcus parauberis, Vibrio harveyi 외에 다른 방법으로 분리된 Streptococcus parauberis, Vibrio harveyi 또는, 기탁기관에 기탁된 표준 균주인 Streptococcus parauberis, Vibrio harveyi를 사용할 때도 거의 유사하게 나타났다. On the other hand, this immunization procedure as that of Example 1, Example 7 Streptococcus parauberis used in, Vibrio harveyi besides the separation Alternatively Streptococcus parauberis, Vibrio harveyi or, when using a standard strain of Streptococcus parauberis, Vibrio harveyi deposited with the depository It appeared almost similar.
<110> JUNWON GBI Co., Ltd. <120> Primer set Mucin 18, Mucin 2 like and IgM for detecting immunization of fish <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 1 ctactctttc ctctaccac 19 <210> 2 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 2 gaggtcttgt tttcctgatc 20 <210> 3 <211> 18 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 3 ctactgtacc tgcaagag 18 <210> 4 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 4 ggatcctgat agttttggag 20 <210> 5 <211> 19 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 5 ctactctttc ctctaccac 19 <210> 6 <211> 18 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 6 gtaggcaatg gatctgac 18 <210> 7 <211> 154 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 7 tggaggctgt ttatccagaa agccagcagg gggcaatggt gtgatcattg cagtcctcat 60 tatctgcctc ctgctgctcg ccatcttggg ggctgtgctc tacttcctct acaaaaaggg 120 caaaatctgt ggccgatcag gaaaacaaga cctc 154 <210> 8 <211> 158 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 8 cacaagggtt gcctttttgt agaggagtag agcacagccc ccaagatggc gagcagcagg 60 aggcagataa tgaggactgc aatgatcaca ccattgcccc ctgctggctt tttctggata 120 tctgttgctc ctttaactgt ggtagaggaa agagtaga 158 <210> 9 <211> 219 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 9 ccttcagcag acacaatgtc caggaacttg tatcatctac gggagtggtc actactctac 60 atttgatgag caaacatatg cctttcaagg agattgtgcc tacattgctg tcaagaacaa 120 gtgtggcaat aaaactgtag agcacaactt tggaattatc acagagaatg taccgtgcgg 180 atctacaggc accacctgct ccaaaatatc aggatccca 219 <210> 10 <211> 221 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 10 ggattcgaaa tcgcacggta cattctctgt gataattcca aagttgtgct ctacagtttt 60 attgccacac ttgttcttga cagcaatgta ggcacaatct ccttgaaagg catatgtttg 120 ctcatcaaat gtagagtagt gaccactccc gtagatgata caagttcctg gacatttttt 180 gtctgtgcat tcccactttc cactcttgca ggtacagtag a 221 <210> 11 <211> 204 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 11 gggcattctg cttgttgatg atgattgaca acagacgatt tcaataccac aaacccaatt 60 aaaaaccatg aatcctactc ggcttatggc cagttatcaa tcagcctcga ccagtggaaa 120 gaagctggct cggtgtacag ctgcgtggtt taccaccaat ctctggattc caatacaaga 180 gccattgtca gatccattgc ctac 204 <210> 12 <211> 206 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 12 gggctgatgt atcagagatt ggtggtaacc acgcagctgt acaccgagcc agcttctttc 60 cactggtcga ggctgattga taactggcca taagccgagt aggattcatg gtttttaatt 120 gggtttgtgg tattgaaatc gtctgttgtc aattcatcat caacaagcca agaaacgaaa 180 acctcttcag gggagaagtc tttcca 206 <110> JUNWON GBI Co., Ltd. <120> Primer set Mucin 18, Mucin 2 like and IgM for detecting immunization of fish <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 1 ctactctttc ctctaccac 19 <210> 2 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 2 gaggtcttgt tttcctgatc 20 <210> 3 <211> 18 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 3 ctactgtacc tgcaagag 18 <210> 4 <211> 20 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 4 ggatcctgat agttttggag 20 <210> 5 <211> 19 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 5 ctactctttc ctctaccac 19 <210> 6 <211> 18 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 6 gtaggcaatg gatctgac 18 <210> 7 <211> 154 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 7 tggaggctgt ttatccagaa agccagcagg gggcaatggt gtgatcattg cagtcctcat 60 tatctgcctc ctgctgctcg ccatcttggg ggctgtgctc tacttcctct acaaaaaggg 120 caaaatctgt ggccgatcag gaaaacaaga cctc 154 <210> 8 <211> 158 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 8 cacaagggtt gcctttttgt agaggagtag agcacagccc ccaagatggc gagcagcagg 60 aggcagataa tgaggactgc aatgatcaca ccattgcccc ctgctggctt tttctggata 120 tctgttgctc ctttaactgt ggtagaggaa agagtaga 158 <210> 9 <211> 219 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 9 ccttcagcag acacaatgtc caggaacttg tatcatctac gggagtggtc actactctac 60 atttgatgag caaacatatg cctttcaagg agattgtgcc tacattgctg tcaagaacaa 120 gtgtggcaat aaaactgtag agcacaactt tggaattatc acagagaatg taccgtgcgg 180 atctacaggc accacctgct ccaaaatatc aggatccca 219 <210> 10 <211> 221 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 10 ggattcgaaa tcgcacggta cattctctgt gataattcca aagttgtgct ctacagtttt 60 attgccacac ttgttcttga cagcaatgta ggcacaatct ccttgaaagg catatgtttg 120 ctcatcaaat gtagagtagt gaccactccc gtagatgata caagttcctg gacatttttt 180 gtctgtgcat tcccactttc cactcttgca ggtacagtag a 221 <210> 11 <211> 204 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 11 gggcattctg cttgttgatg atgattgaca acagacgatt tcaataccac aaacccaatt 60 aaaaaccatg aatcctactc ggcttatggc cagttatcaa tcagcctcga ccagtggaaa 120 gaagctggct cggtgtacag ctgcgtggtt taccaccaat ctctggattc caatacaaga 180 gccattgtca gatccattgc ctac 204 <210> 12 <211> 206 <212> DNA <213> Unknown <220> <223> Platichthys stellatus <400> 12 gggctgatgt atcagagatt ggtggtaacc acgcagctgt acaccgagcc agcttctttc 60 cactggtcga ggctgattga taactggcca taagccgagt aggattcatg gtttttaatt 120 gggtttgtgg tattgaaatc gtctgttgtc aattcatcat caacaagcca agaaacgaaa 180 acctcttcag gggagaagtc tttcca 206
Claims (6)
서열번호 3 및 4의 프라이머를 포함하는 제2 프라이머 세트; 및
서열번호 5 및 6의 프라이머를 포함하는 제3 프라이머 세트;
로 이루어진 군 중에서 선택되는 1종 이상의 프라이머 세트를 포함하는 것을 특징으로 하는 어류의 면역화 확인용 프라이머 세트. A first primer set comprising primers of SEQ ID NOs: 1 and 2;
A second primer set comprising primers of SEQ ID NOs: 3 and 4; And
A third primer set comprising primers of SEQ ID NOs: 5 and 6;
Primer set for immunization of fish characterized in that it comprises at least one primer set selected from the group consisting of.
상기 어류는 강도다리인 것을 특징으로 하는 어류의 면역화 확인용 프라이머 세트. According to claim 1,
The fish is a primer set for immunization of fish, characterized in that the strength leg.
상기 어류의 면역화 확인 방법은, (제1단계) 강도다리에 면역원을 투여하는 단계;
(제2단계) 면역원이 투여된 강도다리와 면역원이 비여투된 강도다리의 장을 각각 채취하여 mRNA(messenger Ribonucleic acid)를 추출하고 cDNA(complementary Deoxyribonucleic acid)를 합성하는 단계;
(제3단계) 상기 cDNA와 제1항의 프라이머 세트를 이용하여 PCR(Polymerase chain reaction)을 수행하는 단계; 및,
(제4단계) 면역원이 투여된 강도다리와 면역원이 비투여된 강도다리의 유전자 발현량을 비교하는 단계;
를 통해 수행되는 것을 특징으로 하는 어류의 면역화 확인 방법.According to claim 3,
The method for confirming immunization of fish includes (first step) administering an immunogen to a burglar leg;
(Second step) extracting mRNA (messenger ribonucleic acid) and synthesizing cDNA (complementary deoxyribonucleic acid) by extracting the intestine of the intensity leg to which the immunogen was administered and the intensity leg to which the immunogen was not filtered;
(Step 3) performing PCR (Polymerase chain reaction) using the cDNA and the primer set of claim 1; And,
(Step 4) Comparing the gene expression level of the intensity leg to which the immunogen was administered and the intensity leg to which the immunogen was not administered;
Method for immunization of fish characterized in that is carried out through.
상기 PCR은 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction) 또는 RT-PCR(Reverse transcript polymerase chain reaction)인 것을 특징으로 하는 어류의 면역화 확인 방법.According to claim 4,
The PCR is a real-time RT-PCR (Real-time reverse transcript polymerase chain reaction) or RT-PCR (Reverse transcript polymerase chain reaction) characterized in that the immunization method of fish.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020180160868A KR102271052B1 (en) | 2018-12-13 | 2018-12-13 | Primer set for Mucin 18, Mucin 2 like and IgM detecting immunization of fish |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020180160868A KR102271052B1 (en) | 2018-12-13 | 2018-12-13 | Primer set for Mucin 18, Mucin 2 like and IgM detecting immunization of fish |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20200072834A true KR20200072834A (en) | 2020-06-23 |
| KR102271052B1 KR102271052B1 (en) | 2021-06-30 |
Family
ID=71137752
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020180160868A KR102271052B1 (en) | 2018-12-13 | 2018-12-13 | Primer set for Mucin 18, Mucin 2 like and IgM detecting immunization of fish |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR102271052B1 (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012505193A (en) * | 2008-10-10 | 2012-03-01 | プロベルテ ファーマ，エス．エー． | Orally administered immunostimulant for aquaculture |
| KR20160118506A (en) * | 2015-04-02 | 2016-10-12 | 구을리주식회사 | Pharmaceutical Composition Comprising an Extract of Celosia for Preventing and Treating Fish Disease Caused by Virues |
| KR101789182B1 (en) | 2016-06-30 | 2017-10-23 | 부산대학교 산학협력단 | Primer set for diagnosing infection of fish and method for diagnosing infection of fish using the same |
| KR20180106570A (en) | 2017-03-21 | 2018-10-01 | 주식회사 코미팜 | Method and apparatus for preparing inhibitable vaccine for prevention of stability bacterial disease including protected serum form of new streptococcus paraberis |
-
2018
- 2018-12-13 KR KR1020180160868A patent/KR102271052B1/en active IP Right Grant
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012505193A (en) * | 2008-10-10 | 2012-03-01 | プロベルテ ファーマ，エス．エー． | Orally administered immunostimulant for aquaculture |
| KR20160118506A (en) * | 2015-04-02 | 2016-10-12 | 구을리주식회사 | Pharmaceutical Composition Comprising an Extract of Celosia for Preventing and Treating Fish Disease Caused by Virues |
| KR101789182B1 (en) | 2016-06-30 | 2017-10-23 | 부산대학교 산학협력단 | Primer set for diagnosing infection of fish and method for diagnosing infection of fish using the same |
| KR20180106570A (en) | 2017-03-21 | 2018-10-01 | 주식회사 코미팜 | Method and apparatus for preparing inhibitable vaccine for prevention of stability bacterial disease including protected serum form of new streptococcus paraberis |
Non-Patent Citations (1)
| Title |
|---|
| PLoS ONE, Volume 8, Issue 6, e65457* * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102271052B1 (en) | 2021-06-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nguyen et al. | A formalin-inactivated vaccine provides good protection against Vibrio harveyi infection in orange-spotted grouper (Epinephelus coioides) | |
| Ming et al. | Molecular cloning and expression of two HSP70 genes in the Wuchang bream (Megalobrama amblycephala Yih) | |
| Distel et al. | Phylogenetic characterization and in situ localization of the bacterial symbiont of shipworms (Teredinidae: Bivalvia) by using 16S rRNA sequence analysis and oligodeoxynucleotide probe hybridization | |
| Sayers et al. | Gastrointestinal nematode infection in sheep–a review of the alternatives to anthelmintics in parasite control | |
| Jensen et al. | Phylogenetic analysis of bacterial communities associated with larvae of the Atlantic halibut propose succession from a uniform normal flora | |
| Campoverde et al. | Ontogeny and modulation after PAMPs stimulation of β-defensin, hepcidin, and piscidin antimicrobial peptides in meagre (Argyrosomus regius) | |
| Schmitt et al. | Expression, tissue localization and synergy of antimicrobial peptides and proteins in the immune response of the oyster Crassostrea gigas | |
| Bathige et al. | Interferon regulatory factors 4 and 8 in rock bream, Oplegnathus fasciatus: structural and expressional evidence for their antimicrobial role in teleosts | |
| Das et al. | Expression analysis of heat shock protein genes during Aeromonas hydrophila infection in rohu, Labeo rohita, with special reference to molecular characterization of Grp78 | |
| CN109576275B (en) | Cynoglossus semilaevis antibacterial disease related gene and application method thereof | |
| Li et al. | Expression of allograft inflammatory factor-1 (AIF-1) in response to bacterial challenge and tissue injury in the pearl oyster, Pinctada martensii | |
| Lowenberger et al. | Aedes aegypti: Induced Antibacterial Proteins Reduce the Establishment and Development ofBrugia malayi | |
| Cao et al. | Identification and characterization of the related immune-enhancing proteins in crab Scylla paramamosain stimulated with rhubarb polysaccharides | |
| Bodó et al. | Identification of novel lumbricin homologues in Eisenia andrei earthworms | |
| Oidtmann et al. | Crayfish plague epizootics in Germany--classification of two German isolates of the crayfish plague fungus Aphanomyces astaci by random amplification of polymorphic DNA | |
| WO2015040574A1 (en) | Biological control of insects | |
| CN117448349B (en) | Kiwi fruit bacterial canker disease gene AcMIF2-1 and application thereof | |
| Yu et al. | MH-DAB gene polymorphism and disease resistance to Flavobacterium columnare in grass carp (Ctenopharyngodon idellus) | |
| KR20210052718A (en) | Feed additive comprising fermented mealworm and feed composition using the same | |
| Wang et al. | Characterization of the antimicrobial peptide attacin loci from Glossina morsitans | |
| KR102271052B1 (en) | Primer set for Mucin 18, Mucin 2 like and IgM detecting immunization of fish | |
| Ponprateep et al. | Recombinant anti-lipopolysaccharide factor isoform 3 and the prevention of vibriosis in the black tiger shrimp, Penaeus monodon | |
| Xie et al. | Transcriptome analysis reveals potential key immune genes of Hong Kong oyster (Crassostrea hongkongensis) against Vibrio parahaemolyticus infection | |
| KR102130010B1 (en) | Primer set of transforming growth factors beta for detecting immunization of fish | |
| Huang et al. | Major histocompatibility complex class IIA and IIB genes of loach (Misgurnus anguillicaudatus): Molecular cloning and expression analysis in response to bacterial and parasitic challenge |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant |