KR102258590B1 - Composition Comprising Extract of Saccharina japonica and Herb Medicines for Improvement of Respiratory Disease - Google Patents

Abstract

The present invention relates to a composition for alleviating respiratory diseases caused by fine dust stimulation, containing an extract extracted from Saccharina japonica and 9 kinds of Chinese medicinal herbs. The composition has no cytotoxicity, increases the amount of mucus secretion in the organs, and reduces the number of immune cells causing internal inflammation and the expression level of inflammatory cytokines in blood. Through food and pharmaceutical compositions containing the composition as an active component, it is expected that respiratory irritation caused by fine dust can be relieved, and respiratory diseases can be prevented or alleviated.

Description

Composition Comprising Extract of Saccharina japonica and Herb Medicines for Improvement of Respiratory Disease

The present invention relates to a composition for improving respiratory diseases caused by fine dust stimulation, comprising extracts extracted from kelp and 9 kinds of oriental medicinal herbs, specifically, a food composition for preventing or improving respiratory diseases, and respiratory diseases It relates to a pharmaceutical composition for preventing or treating.

With the development of industry and the increase in the use of fossil fuels, the frequency of occurrence of fine dust increases and the damage thereof is increasing. In general, particulate matter (PM) refers to particulate matter with a particle diameter of 10 μm or less, and can be classified into PM10, PM2.5 (extra-fine dust), and PM1 (ultra-fine dust) according to its size. have. If PM10 is about 1/5 to 1/7 smaller than the diameter of a human hair (50 to 70 μm), PM2.5 is so small that it is only about 1/20 to 1/30 of that of a human hair. Such fine dust is a mixture of very complex components such as sulfur oxides, nitrogen oxides, lead, ozone, and carbon monoxide.

The World Health Organization (WHO) has been providing air quality guidelines for PM10 and PM2.5 since 1987, and in 2013, the International Agency for Research on Cancer (IARC) under the World Health Organization (IARC) reduced fine dust. It was designated as a group 1 carcinogen (Group 1) that was confirmed to be carcinogenic to humans. Fine dust that is so small that it is invisible to the naked eye mixes in the air and penetrates the lungs through the respiratory tract, or moves in the body along blood vessels, which can adversely affect health. In particular, fine dust in the air is highly related to respiratory diseases, and in the short term causes worsening of pulmonary inflammatory response and respiratory symptoms, increased drug use, hospital admission and mortality, and in the long term, increased lower respiratory tract symptoms, decreased lung function, asthma and exacerbation and lung cancer in patients with chronic obstructive pulmonary disease (COPD).

Accordingly, as a result of the present inventors trying to develop a composition for soothing the respiratory tract stimulated by fine dust and preventing or improving respiratory diseases, kelp together with galgeun, bellflower, deodeok, maekmundong, bokryeong, baekchul, yeonjayuk, omija and dermis Extracts extracted from a mixture consisting of herbal medicines of , have no cytotoxicity, significantly increase the amount of mucus secretion in the organs, and significantly reduce the number of immune cells that cause inflammation in the blood and the expression of inflammatory cytokines. The present invention was completed by confirming that it is effective in improving respiratory diseases caused by dust.

delete

Republic of Korea Patent Publication No. 10-2019-0067101 (published on June 14, 2019) Republic of Korea Patent Publication No. 10-2019-0109278 (published on September 25, 2019)

An object of the present invention is to provide a composition for improving respiratory diseases comprising an extract extracted from kelp, galgeun, bellflower, deodeok, maekmundong, bokryeong, baekchul, yeonjayuk, omija and dermis as an active ingredient.

In addition, an object of the present invention is to provide a food composition for preventing or improving respiratory diseases comprising the composition as an active ingredient.

In addition, an object of the present invention is to provide a pharmaceutical composition for preventing or treating respiratory diseases comprising the composition as an active ingredient.

According to one embodiment, the present invention provides a composition for improving respiratory diseases comprising an extract extracted from kelp, galgeun, bellflower, deodeok, maekmundong, bokryeong, baekchul, yeonjayuk, omija and dermis as an active ingredient.

The kelp ( Saccharina japonica ) is known to contain abundant nutrients such as iodine, vitamin B2, and glutamic acid, and the alginic acid constituting the cell wall of the kelp has high viscosity and promotes intestinal peristalsis to stimulate defecation, and removes heavy metals from the body. It has been reported that adsorption and excretion work.

The Pueraria lobata Ohwi is the root of arrowroot, and contains isoflavonoids, triterpenoids, etc., and has been traditionally used for the treatment of cardiovascular diseases and diabetes, in addition to hepatoprotective action, anti- It is known to have hypercholesterolemia, anti-inflammatory and anticoagulant action.

The bellflower ( Platycodon grandiflorus ) is widely grown in the mountains and fields of Korea, contains saponins, and is used in oriental medicine for dentition, lung fever, tonsillitis, and diarrhea.

The deodeok ( Codonopsis lanceolata ) contains abundant saponins like bellflower, so it has a bitter taste and a very strong scent unique to ginseng, and has various effects such as cough, sputum, relief of bronchial diseases such as asthma, prevention of arteriosclerosis, blood sugar control, etc. Have.

The maekmundong ( Liriope muscari ) root is used as a medicine in oriental medicine, is known to be effective in healing bronchitis, and is used as an anti-inflammatory, tonic, antitussive, expectorant, and cardiac agent.

The bokryeong ( Wolfiporia extensa ) is a parasitic bacterium on the root of a pine tree, the bark is called bokryeongpi, the bacterium that grows with the pine root inside is called boksin ( 茯神 ), the white one is called baekbokryeong , and the red one is called jeokbokryeong . All are used as medicine. This bokryeong has a gentle diuretic effect, so it is effective when the digestive system is weak and there is edema all over the body, and because it has an expectorant effect, it is effective for chronic bronchitis and bronchiectasis, which are symptoms of difficulty in breathing and secreting a lot of sputum.

The baekchul ( Atractylodes macrocephala ) is a drug dried by removing the stem or rhizome of baekchul of the Asteraceae family, and has a slightly bitter and sweet taste, viscous and warm in nature, and pharmacologically inhibits intestinal motility, controls excitability, anti-ulcer, It has been reported to have liver function protection, immune function enhancement, vasodilation, and diuretic effects.

The yeonjayuk ( Nelumbo nucifera Gaertner ) is a medicinal herb by peeling and drying the seeds of water lilies and lotus flowers, and has been widely used for spleen weakness since ancient times, and pharmacologically it has been reported to inhibit nasal and throat cancers.

The omija ( Schisandra chinensis ) is a fruit that can taste sweet, sour, bitter, salty and spicy, and contains ingredients such as sijandrine, gomisin, citral, malic acid, and citric acid to strengthen the heart, lower blood pressure, and lower the immune system. It has the effect of increasing the blood pressure, strengthens lung function, and has antitussive expectorant action, which helps to treat cough and thirst.

The dermis ( Citrus reticulata Blanco ) is dried tangerine rind, has a hot taste and warm properties, and is known to strengthen the function of the spleen, relieve cough and phlegm, and have a diuretic effect. It has been reported to have gastrointestinal stimulation, digestion promotion, expectoration, anti-ulcer, anti-gastric juice secretion, cardiac arrhythmia, blood pressure increase, anti-allergy, biliary secretion promotion, uterine smooth muscle suppression, and antibacterial action.

Extracts extracted from such kelp and 9 types of oriental medicinal herbs contain useful physiologically active substances or active ingredients (active ingredients) separated from each material, and when a solvent is used for extraction, a solvent is used together with the active ingredient separated from each material. means to include In this case, the materials may be in a raw raw material, dry state, or a mixed state thereof, and may be in a finely pulverized state to efficiently extract the active ingredient. The extract includes an extract that has undergone a conventional purification process. As an example, separation using an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography (prepared for separation according to size, charge, hydrophobicity or affinity), etc. A fraction obtained through a purification method may also be included in the extract. In addition, the extract may be in a powder state by an additional process such as distillation under reduced pressure, freeze drying, spray drying, and the like.

The extract can be obtained using an extraction method known in the art without limitation. Examples of the extraction method include cold extraction, ultrasonic extraction, reflux cooling extraction, hot water extraction, pressure extraction, solvent extraction, supercritical extraction, ultrasonic extraction, and the like. When a solvent is used for extraction, an extraction solvent known in the art may be used without limitation. Examples of the extraction solvent include purified water, distilled water, C1-C4 alcohol, acetic acid, dichloromethane, dimethyl formamide, dimethyl sulfoxide (DMSO), acetone, acetonitrile, ethyl acetate, methyl acetate , pentane, hexane, chloroform, diethyl ether, carbon tetrachloride, tetrahydrofuran (THF), and the like. Examples of the C1-C4 alcohol include methanol, ethanol, propanol, n-butanol, and iso-butanol.

For example, the extract is boiled kelp, galgeun, bellflower, deodeok, maekmundong, bokryeong, baekchul, yeonjayuk, omija and dermis in 1 to 20 times water at 80 to 150° C. for 1 to 10 hours, filtered and concentrated. It may be obtained by freeze-drying.

At this time, the extract is based on the total weight, 10 to 30% by weight of kelp, 1 to 20% by weight of kelp, 1 to 20% by weight of bellflower, 1 to 20% by weight of deodeok, 1 to 20% by weight of maekmundong, 1 to 20% by weight of bokryeong Weight%, Baekchul 1 to 20% by weight, Yeonjayuk 1 to 20% by weight, Schisandra 1 to 20% by weight and dermis 1 to 20% by weight may be included.

The composition comprising the extract extracted from kelp and 9 kinds of oriental medicinal herbs according to the present invention may increase the amount of mucus secretion in the organs. In addition, it is possible to increase the number of immune cells such as leukocytes, neutrophils, lymphocytes, and monocytes that cause inflammation in the blood, and reduce the expression levels of the inflammatory cytokines IL-1β, IL-6, IL-8 and TNF-α. These compositions can alleviate respiratory diseases caused by fine dust stimulation, and can be used as food compositions, pharmaceutical compositions, etc. for preventing or improving respiratory diseases.

The food composition may be provided in any form suitable for food additives or functional foods, and may be, for example, a solution, an emulsion, a viscous mixture, a powder, granules, tablets, capsules, and the like. At this time, various bases and/or additives necessary and appropriate for formulation of the formulation may be included within a range that does not impair the main effect of the present invention, and fragrances, dyes, and fungicides within a range that does not impair the effect , antioxidants, preservatives, moisturizers, thickeners, inorganic salts, and may further include additives such as emulsifiers. The blending amount of these additives may be selected within a range that does not impair the purpose and effect of the present invention depending on the formulation or purpose of use. For example, based on the total weight of the food composition, the additive may be 0.01 to 5% by weight, more specifically 0.1 to 3% by weight.

The pharmaceutical composition may be provided in any dosage form suitable for pharmaceuticals, and may be, for example, oral or parenteral administration in solid, semi-solid or liquid form. Formulations for oral administration may be tablets, pills, granules, capsules, powders, fine granules, powders, emulsions, syrups, pellets, and the like. Formulations for parenteral administration may be injections, drops, ointments, lotions, sprays, suspensions, emulsions, suppositories, and the like. At this time, various bases and/or additives necessary and appropriate for formulation of the formulation may be included within the range that does not impair the main effect of the present invention, and carriers, surfactants, It may further include additives such as excipients, colorants, spices, preservatives, stabilizers, buffers, and suspending agents. Such pharmaceutical compositions may be administered orally, parenterally, rectally, topically, transdermally, intravenously, intramuscularly, intraperitoneally, subcutaneously, or the like. The active ingredient of the pharmaceutical composition may vary depending on the age, sex, weight, pathological condition and severity of the subject to be administered, the route of administration, or the judgment of the prescriber. For example, the daily dose may be 1 to 1,000 mg/kg/day, and more specifically, 10 to 600 mg/kg/day.

According to the present invention, a composition comprising an extract extracted from kelp and 9 kinds of oriental medicinal herbs has no cytotoxicity, increases the amount of mucus secretion in organs, the number of immune cells causing inflammation in the blood, and the expression level of inflammatory cytokines It is expected that it can reduce respiratory irritation caused by fine dust and prevent or improve respiratory diseases through food and pharmaceutical compositions containing these compositions as active ingredients.

1 is a result of confirming the cell viability of the extract in A549 cells. A549 cells were treated with extracts 50, 100, 200, and 400 μg/ml for 24 hours and then reacted with EZ-Cytox for 30 minutes to measure absorbance at 450 nm. Cell viability was calculated as a percentage compared to the control, and values obtained through independently repeated experiments were expressed as mean±SD.
Figure 2 is the result of confirming the mRNA expression by the extract in A549 cells. A549 cells were treated with LPS 10 μg/ml and extracts 50, 100, and 200 μg/ml for 12 hours, and then mRNA expression levels were measured by qRT-PCR. Independently, the values obtained through three repeated experiments were expressed as mean±SD. Significance compared to control ** ; p<0.01, *** ; p < 0.001.
Figure 3 is the result of confirming the expression of the biomarker by the extract in A549 cells. A549 cells were treated with LPS 10 μg/ml and extracts 50, 100, and 200 μg/ml for 12 hours, and then biomarker levels were measured with an ELISA kit. Independently, the values obtained through three repeated experiments were expressed as mean±SD. Significance compared to control * ; p<0.05, ** ; p<0.01, *** ; p < 0.001.
4 is a result of confirming the amount of phenol red secretion in the organ by the extract in the fine dust induction mouse model. Independently, the values obtained through three repeated experiments were expressed as mean±SD (n=6). Significance compared to control ** ; p < 0.01.
5 is a result of confirming the number of immune cells in the blood by the extract in the fine dust induced mouse model. Independently, the values obtained through three repeated experiments were expressed as mean±SD (n=6). Significance compared to control * ; p<0.05, ** ; p<0.01, *** ; p < 0.001.
6 is a result of confirming the level of cytokines in the serum by the extract in the fine dust induction mouse model. Independently, the values obtained through three repeated experiments were expressed as mean±SD (n=6). Significance compared to control * ; p<0.05, ** ; p<0.01, *** ; p < 0.001.
7 is a result of confirming the biomarker level in serum by the extract in the fine dust induced mouse model. Independently, the values obtained through three repeated experiments were expressed as mean±SD (n=6). Significance compared to control *** ; p < 0.001.

Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings. However, the following examples are described for the purpose of illustrating the present invention, and the scope of the present invention is not to be construed as being limited by the following examples.

1. Materials and Methods

1-1. material

(1) sample

The kelp and 9 kinds of medicinal herbs used in this experiment were purchased from Daejeon Oriental Pharmacy and used, and the contents and quantity of one pill are shown in Table 1 below.

ingredient Usage (g) Kelp 10 craving 5 Bellflower 5 deodeok 5 Maekmun-dong 5 Baek Bok-ryeong 5 Baekchul 5 soft meat 5 Schisandra 5 dermis 5 total 55

(2) reagent

As reagents, F-12K medium (ATCC, USA), LPS (lipopolysaccharide) (Sigma, USA), FBS (fetal bovine serum) (Gibco BRL, USA), P/S (penicillin-streptomycin) (Sigma, USA) ), trypan blue (Sigma, USA), trypsin-EDTA solution (1X) (Welgene, Korea), D-PBS (dulbecco's phosphate buffered saline) (Welgene, Korea), total RNA extraction kit (total RNA prep kit) (Intronbio, Korea), Accupower® Cyclescript™ RT premix kit (Bioneer, Korea), SYBR Green (Qiagen, Germany), DEPC-DW (Bioneer, Korea), human prostaglandin E2 (human) prostaglandin E2) ELISA kit (Mybiosource, USA), human interleukin 8 ELISA kit (Mybiosource, USA), human mucin-5AC ELISA kit (Mybiosource, USA), aluminum hydroxyl gel (aluminium hydroxygen gel) (Sigma Co., USA), PBS (phosphate buffered saline) (Welgene, Korea), ether (Sigma Co., USA), phenol red (Sigma Co., USA) , sodium hydroxide (Sigma Co., USA), coal fly ash (Sigma Co., USA), diesel particulate matter (Sigma Co., USA), DMSO (dimethyl sulfoxide) (Sigma Co., USA) was used.

(3) device

The instrument is a CO ₂ cell incubator (Sanyo, Japan), a clean bench (Vision scientific, Korea), an autoclave (Sanyo, Japan), a vortex mixer (Vision scientific, Korea) ), centrifuge (Hanil, Korea), deep-freezer (Sanyo, Japan), plate shaker (Lab-Line, USA), micro plate reader (Molecular) Devices, USA), nanodrop (Thermo Fisher, USA), alpha cycler 1 PCRmax (PCRmax, UK) real time PCR (Qiagen, Germany), luminex (Millipore, USA), optical An optical microscope (Carl ZEISS, Germany) was used.

1-2. Way

(1) sampling

1000 ml of distilled water was added to 1 cheap (55 g) of kelp and medicinal mixture, extracted at 100° C. for 3 hours, and the extract was filtered with a filter paper, then concentrated under reduced pressure through a rotary vacuum evaporator and freeze-dried Freeze-drying was performed using a (freeze dryer) to obtain 11.64 g (yield: 21.16%) of a powder, which was used while being stored at -20°C.

(2) cell culture

A549 cells were used in F-12K medium composed of 10% FBS and 1% P/S, and _{were cultured in a cell incubator maintained at 37° C. and 5% CO 2} conditions, and the experiment was performed by subculture at a cycle of 2-3 days. .

(3) Measurement of cell viability

A549 cells were seeded at 1Х10 ⁵ cells/well in a 48-well plate and cultured for 24 hours. After 24 hours, the extracts were treated at concentrations of 50, 100, 200, and 400 μg/ml and incubated for another 24 hours. 10 μl of EZ-Cytox per 100 μl of culture after incubation (DoGenBio, Korea) The solution was added and reacted for 30 minutes in a cell incubator. After the reaction, the change in absorbance at 450 nm was measured, and the cell viability relative to the control was expressed as a percentage.

(4) Measurement of gene expression level

- RNA extraction

A549 cells were seeded in a 6-well plate at 2Х10 ⁵ cells/well and cultured for 24 hours. After culturing, the extract was treated at concentrations of 100 and 200 μg/ml, and 30 minutes later, 10 μg/ml of LPS was added, respectively, and incubated for 24 hours. Then, 1 ml of easy blue™ total RNA extraction kit and 200 μl of chloroform were added to the cells obtained by centrifugation at 1,200 rpm for 5 minutes and vortexed, 13,000 rpm, 4°C for 10 minutes centrifuged. After 400 μl of the supernatant and 400 μl of binding buffer were reacted at room temperature for 1 minute, 700 μl of the reaction solution was injected into a column and centrifuged at 13,000 rpm for 30 seconds. 700 μl of washing buffer A was added to the column, centrifuged at 13,000 rpm for 30 seconds, and 700 μl of washing buffer B was added, followed by centrifugation in the same manner. After replacing the bottom of the column with a 1.5 ml tube, 30 μl of an extraction buffer was added to the column, reacted for 1 minute, and then centrifuged at 13,000 rpm for 1 minute to extract total RNA.

- cDNA synthesis

For the reverse transcription reaction, 1 μg of total RNA was added to the mixture (reaction buffer, dNTPs mixture, RNase inhibitor, stabilizer and oligo dT15 primer included) of the RT premix kit, and DEPC-DW was added so that the final volume was 20 μl. . After mixing this mixture well, react at 45°C for 60 minutes to synthesize first-strand cDNA, and leave at 95°C for 5 minutes to inactivate M-MLV RT. The synthesized cDNA is subjected to PCR (polymerase chain reaction). was used.

- Gene amplification

In order to amplify the synthesized cDNA, real-time PCR was performed, and 1 µl of cDNA, 2 µl of each primer, 10 µl of SYBR Green, and 5 µl of DEPC-DW were put in a real-time dedicated tube and put 2 at 95°C. After reacting for minutes, the gene was amplified by repeating 40 times for 5 seconds at 95°C and 30 seconds at 62.5°C. The gene expression level was calculated compared to the control group, and the sequences of the primers used are shown in Table 2 below.

Primer name Primer sequence (5'>3') Sequence number IL-8 F: TCTTGGCAGCCTTCCTGATT One R: TTTCTGTGTTGGCGCAGTGT 2 COX-2 F: GTTCCACCCGCAGTACAGAA 3 R: AGGGCTTCAGCATAAAGCGT 4 MCP-1 F: GCTCAGCCAGATGCAATCAA 5 R: CTTGGCCACAATGGTCTTGA 6 β-actin F: ATCGTGGGGCGCCCCAGGCACCA 7 R: GGGGTACTTCAGGGTGAGGA 8 F: forward primer, R: reverse primer

(5) Measurement of biomarker production amount

- PGE ₂ production measurement

A549 cells were seeded in a 6-well plate at 2Х10 ⁵ cells/well and cultured for 24 hours. After culturing, the extract was treated at concentrations of 100 and 200 μg/ml, and 30 minutes later, 10 μg/ml of LPS was added, respectively, and incubated for 24 hours. The supernatant and standard samples obtained by centrifuging the culture solution at 1,200 rpm for 5 minutes were put into a 96-well plate by 100 μl and reacted at 37° C. for 90 minutes. After the reaction, washing was performed twice using a washing buffer, 100 μl of biotin-labeled antibody (biotinylated antibody) was added, reacted at 37° C. for 1 hour, and washed 3 times. After washing, 100 μl of an enzyme-conjugate liquid was added and reacted at 37° C. for 30 minutes, followed by washing 5 times. Then, 100 μl of color reagent liquid was added, reacted at 37° C. for 20 minutes, 100 μl of color reagent C was added, and absorbance was measured at 450 nm through a microplate measuring instrument, and a standard curve ( It is expressed as an absolute value based on the standard curve).

- Measurement of IL-8 production

A549 cells were seeded in a 6-well plate at 2Х10 ⁵ cells/well and cultured for 24 hours. After culturing, the extract was treated at concentrations of 100 and 200 μg/ml, and 30 minutes later, 10 μg/ml of LPS was added, respectively, and incubated for 24 hours. The supernatant and the standard sample obtained by centrifuging the culture solution at 1,200 rpm for 5 minutes were put into a 96-well plate 50 μl each, 100 μl HRP-conjugate reagent was added, and reacted at 37° C. for 1 hour. After the reaction, washing was performed 4 times using a washing buffer, and 50 μl of chromogen solution A and 50 μl of chromogen solution B were added, followed by reaction at 37° C. for 15 minutes. Thereafter, 50 μl of a stop solution was added, and the absorbance was measured at 450 nm through a microplate meter, and it was expressed as an absolute value based on a standard curve.

- Measurement of MUC5AC production

A549 cells were seeded in a 6-well plate at 2Х10 ⁵ cells/well and cultured for 24 hours. After culturing, the extract was treated at concentrations of 100 and 200 μg/ml, and 30 minutes later, 10 μg/ml of LPS was added, respectively, and incubated for 24 hours. The supernatant and the standard sample obtained by centrifuging the culture solution at 1,200 rpm for 5 minutes were put into a 96-well plate by 100 μl and reacted at 37° C. for 2 hours. After the reaction, 100 μl biotin-labeled antibody was added, reacted again at 37° C. for 1 hour, and washed 3 times. After washing, 100 μl of HRP-avidin was added and reacted at 37° C. for 1 hour, followed by washing 5 times. Thereafter, 90 μl of TMB substrate was put and reacted at 37° C. for 20 minutes, 50 μl of stop solution was added, and absorbance was measured at 450 nm through a microplate measuring instrument, and the absolute value based on the standard curve. indicated as

(6) Production of experimental animals and models

Experimental animals, male 5-week-old ICR mice (20 ~ 22 g) were supplied from Raon Bio, and sufficient solid feed and water were supplied until the day of the experiment, temperature 22±2℃, humidity 55±15%, 12 hours/ After acclimatization for 2 weeks in a 12-hour light-dark cycle environment, it was used in the experiment. This experiment was approved by the Animal Experimentation Ethics Committee of Daejeon University (Animal Use Ethics Committee Approval No.-DJUARB2019-033), and the experiment was conducted according to the animal ethics rules.

To produce the fine dust stimulus induction model, first, each of coal fly ash and diesel fine dust was dissolved in DMSO at a concentration of 5 mg/ml, and the final concentration was 0.5 mg/ml for coal fly ash and 0.75 mg/ml for diesel fine dust. After dilution with PBS, aluminum hydroxide gel (Al(OH)3 gel) was added to 8% to prepare a fine dust mixture. For the administration of the fine dust mixture, the fine dust mixture is injected using the INT (Intra-Nasal-Trachea) method a total of 2 times after 3 days and 6 days after the start of sample administration. After anesthetizing the experimental animal with ether and securing the airway by fixing it with a rubber band, inject 50 μl of the fine dust mixture into the airway through the oral cavity, and at the same time inject 50 μl of the fine dust mixture into the nose to ensure that the mice breathe. In the process, the fine dust mixture was induced to be inhaled into the lungs through the bronchi. The experimental group was divided into four groups: a normal group untreated, a control group in which distilled water was orally administered to fine dust-induced mice, and an experimental group in which 200 and 400 mg/kg of extract was orally administered to fine dust-induced mice and administered orally for 14 days. proceeded.

(7) Separation of blood and tissue samples

After the oral administration was completed, the experimental animals were anesthetized using ethyl ether, and blood collected by cardiac puncture was divided and stored in EDTA tubes and microcentrifuge tubes. The blood in the EDTA tube was immediately analyzed for the number of immune cells, and the blood in the microcentrifuge tube was hardened at room temperature for 30 minutes and centrifuged (3,000 rpm, 15 minutes) to obtain serum. (Stored at -80 ° C. Trachea and lung tissue were incised with surgical scissors and fixed in 10% formalin or stored in a cryogenic freezer (-80 ° C).

(8) Measurement of mucus secretion

Thirty minutes before the end of the experiment, 200 μl of phenol red (10 mg/kg) was injected into the peritoneal cavity of the experimental animals. Then, under anesthesia with ethyl ether, blood was collected by cardiac puncture, and then the entire trachea was excised. The isolated organ was placed in 1 ml of physiological saline and the tissue was vortexed for 30 minutes, centrifuged at 10,000 rpm for 5 minutes, and 900 μl of the separated supernatant and 100 μl of 1M NaOH were added to develop color and absorbance at 546 nm. measured. The ratio of phenol red to the airway was obtained by dividing it by the weight of the extracted airway to determine the amount of mucus secretion in the airway.

(9) Immune cell measurement

In the blood stored in the EDTA tube, the number of white blood cells, lymphocytes, neutrophils, and monocytes was measured using the hematology system ADVIA® 2120i.

(10) Cytokine measurement

25 μl of the separated serum and standard sample was added to a 96-well plate, and 25 μl of each of assay buffer and antibody-immobilized beads were added, followed by reaction at room temperature for 2 hours. After the reaction, washing was performed twice using a washing buffer, and 25 μl of detection antibody was added and reacted at room temperature for 1 hour. After 1 hour, 25 μl of streptavidin-phycoerythrin was added and reacted at room temperature for 30 minutes. After washing twice again, 200 μl of sheath fluid was added thereto, and cytokine (IL-1β, IL-6, IL-8, TNF-α) levels were measured through Luminex.

(11) Immunoglobulin E (IgE) measurement

Into each well of the 96-well plate, 50 μl of the separated serum and standard sample was added, and 25 μl of IgE beads were added, followed by reaction at room temperature for 1 hour. After the reaction, washing was performed three times using a washing buffer, and 25 μl of anti-mouse light chain PE was added and reacted at room temperature for 15 minutes. After washing again 3 times, 200 μl of sheath fluid was added thereto to measure IgE levels through Luminex.

(12) histamine and PGE ₂ Measure

Into each well of a 96-well plate, 50 μl of the separated serum and standard sample was added, and 50 μl of biotin-labeled antibody was added to each well, followed by reaction at 37° C. for 45 minutes. After the reaction, washing was performed three times using a washing buffer, and 100 μl of HRP-streptavidin conjugate was added and reacted at 37° C. for 30 minutes. After washing 3 times again, 90 μl of TMB substrate was added and reacted at 37° C. for 10 minutes. After 10 minutes, 50 μl of the termination solution was added and absorbance was measured at 450 nm through a microplate meter to measure histamine and prostaglandin (PGE ₂ ) levels.

1-3. Statistical processing

Experimental results were expressed as mean±standard error of mean using SPSS 21.0, multiple comparisons using ANOVA, and significance at p<0.05, p<0.01 and p<0.001 levels through Tukey's HSD test. Tested.

2. Results

2-1. cell viability

As a result of measuring the cell viability, referring to Table 3 and FIG. 1, when the extract was treated at a concentration of 400 μg/ml or more, cell viability of 80% or less was shown.

Concentration (μg/ml) Survival rate of live cells (% compared to control) 0 (control) 100.0±1.7 50 100.0±1.4 100 99.9±5.9 200 100.1±6.6 400 80.0±4.2

2-2. Intracellular gene expression level

As a result of measuring intracellular IL-8, COX-2, MCP-1 gene expression levels, referring to Table 4 and FIG. 2, when the extract is treated at a concentration of 50 μg/ml or more, IL-8, COX-2, MCP -1 gene expression was significantly decreased (** ; p<0.01, *** ; p<0.001) compared to the control group.

Concentration (μg/ml) IL-8/β-actin COX-2/β-actin MCP-1/β-actin normal group 0.14±0.02 0.38±0.01 0.23±0.01 0 (control) 1.00±0.00 1.00±0.00 1.00±0.00 50 0.88±0.03 0.85±0.04 1.00±0.05 100 0.63±0.02 0.67±0.03 0.75±0.04 200 0.55±0.03 0.51±0.03 0.68±0.04

2-3. Amount of biomarker production in cells

As a result of measuring intracellular IL-8, PGE ₂ , and MUC5AC production, referring to Table 5 and FIG. 3 , when the extract was treated at a concentration of 50 μg/ml or more, the _{amount of PGE 2} and MUC5AC production was significantly higher than that of the control group (* ; p<0.05, ** ; p<0.01, *** ; p<0.001) decreased, and when treated at a concentration of 200 μg/ml or higher, IL-8 production was significantly (** ; p<0.01) decreased compared to the control group became

Concentration (μg/ml) IL-8 (pg/ml) PGE ₂ (pg/ml) MUC5AC (ng/ml) normal group 3.7±0.6 13.4±1.1 788.9±191.3 0 (control) 8.6±0.6 76.8±3.3 5794.9±241.5 50 8.6±0.4 69.0±2.1 4787.1±229.2 100 8.2±0.1 49.7±2.1 3744.7±198.5 200 5.0±0.1 36.5±2.9 3007.8±202.7

2-4. mucus secretion

As a result of measuring the amount of mucus secretion in the organs, referring to Table 6 and FIG. 4 , the amount of mucus secretion in the extract 400 mg/kg (high concentration) administration group was significantly increased (** ; p<0.01) compared to the control group.

Amount of phenol red secretion (ug/g) normal group 3.7±0.6 Control 8.6±0.6 low dose group 8.2±0.1 high-dose group 5.0±0.1

2-5. number of immune cells

As a result of measuring the number of immune cells in the blood, referring to Tables 7 and 5, the number of leukocytes, neutrophils, lymphocytes, and monocytes in the extract 200 (low concentration), 400 (high concentration) mg/kg administration group was significantly higher than that of the control group (* ; p<0.05, **; p<0.01, ***; p<0.001) decreased.

Immune cell count (Х10 ³ cells/μl) leukocyte neutrophils lymphocytes monocytes normal group 3.66±0.38 0.53±0.17 1.39±0.23 0.07±0.01 Control 8.92±0.68 1.77±0.26 6.66±0.59 0.28±0.02 low dose group 6.70±0.62 1.47±0.14 3.78±0.53 0.19±0.02 high-dose group 5.97±0.39 1.32±0.18 3.68±0.48 0.18±0.02

2-6. cytokine

As a result of measuring the cytokines in the serum, referring to Table 8 and Figure 6, the secretion of IL-1β, IL-6, IL-8, TNF-α in the extract 200 (low concentration), 400 (high concentration) mg/kg administration group Compared with the control group, it was significantly reduced (* ; p<0.05, ** ; p<0.01, *** ; p<0.001).

Cytokine levels (pg/ml) IL-1β IL-6 IL-8 TNF-α normal group 0.9±0.1 35.5±7.3 2.8±0.8 174.7±49.0 Control 12.4±0.8 175.1±14.1 7.6±0.6 477.0±49.3 low dose group 10.4±0.7 154.9±11.1 5.1±0.4 376.8±51.2 high-dose group 7.7±0.9 128.4±14.4 4.0±0.4 268.9±38.5

2-7. biomarker

As a result of measuring the biomarkers in the serum, referring to Table 9 and FIG. 7 , the secretion of IL-1β, IL-6, IL-8, TNF-α in the extract 200 (low concentration), 400 (high concentration) mg/kg administration group was It was significantly (*** ; p<0.001) decreased compared to the control group.

Cytokine levels (pg/ml) IgE histamine PGE ₂ normal group 51.8±7.8 36.9±2.1 121.0±27.0 Control 164.5±12.5 81.8±3.1 337.6±20.8 low dose group 106.5±8.0 65.1±3.7 270.1±23.4 high-dose group 79.4±6.1 46.2±4.5 234.6±14.0

So far, the present invention has been looked at around its preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the above description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> DAEJEON UNIVERSITY Industry-University Cooperation Foundation <120> Composition Comprising Extract of Saccharina japonica and Herb Medicines for Improvement of Respiratory Disease <130> PN190478 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-8 forward primer <400> 1 tcttggcagc cttcctgatt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-8 reverse primer <400> 2 tttctgtgtt ggcgcagtgt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COX-2 forward primer <400> 3 gttccacccg cagtacagaa 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COX-2 reverse primer <400> 4 agggcttcag cataaagcgt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MCP-1 forward primer <400> 5 gctcagccag atgcaatcaa 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MCP-1 reverse primer <400> 6 cttggccaca atggtcttga 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> b-actin forward primer <400> 7 atcgtggggc gccccaggca cca 23 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> b-actin reverse primer <400> 8 ggggtacttc agggtgagga 20

Claims (9)

Contains extracts extracted from kelp, galgeun, bellflower, deodeok, maekmundong, bokryeong, baekchul, yeonjayuk, omija and dermis as active ingredients,
The extract is based on the total weight, 10 to 30% by weight of kelp, 1 to 20% by weight of kelp, 1 to 20% by weight of bellflower, 1 to 20% by weight of deodeok, 1 to 20% by weight of maekmundong, 1 to 20% by weight of bokryeong , for improving respiratory diseases caused by fine dust stimulation, which is obtained by extraction from a mixture containing 1 to 20% by weight of baekchul, 1 to 20% by weight of lotus root, 1 to 20% by weight of Schisandra and 1 to 20% by weight of dermis composition.
The method according to claim 1,
The extract is a composition obtained by hot water extraction of a mixture consisting of kelp, galgeun, bellflower, deodeok, maekmundong, bokryeong, baekchul, yeonjayuk, omija and dermis at a temperature of 80 to 150 ℃.
delete The method according to claim 1,
The composition is a composition that increases the amount of mucus secretion in the organ.
The method according to claim 1,
The composition is a composition that reduces the number of immune cells in the blood.
The method according to claim 1,
The composition is a composition that reduces the expression level of the cytokines IL-1β, IL-6, IL-8 and TNF-α in the blood.
The method according to claim 1,
The respiratory disease is at least one selected from the group consisting of allergic rhinitis, pharyngitis, laryngitis, tonsillitis, pharyngitis, asthma, bronchitis, pneumonia and chronic obstructive pulmonary disease (COPD) caused by fine dust stimulation.
A food composition for preventing or improving respiratory diseases caused by fine dust stimulation comprising the composition of claim 1 as an active ingredient.
A pharmaceutical composition for preventing or treating respiratory diseases caused by fine dust stimulation comprising the composition of claim 1 as an active ingredient.

Images