KR102249795B1 - Composition for Improving Obesity or Exercise Performance comprising Extract from Inula japonica - Google Patents

Abstract

The present invention provides a composition for improving, preventing or treating obesity or muscle disease, comprising an extract of sunbokhwa as an active ingredient. The composition provides an effect of inhibiting adipocyte differentiation and fat accumulation, and increasing muscle mass and strengthening muscle strength.

Description

Composition for Improving Obesity or Exercise Performance comprising Extract from Inula japonica}

The present invention relates to a composition for improving obesity or exercise performance comprising a sunbokhwa extract.

In recent years, the intake of various animal foods in Korea is increasing as the national income improves along with economic growth and the dietary life becomes westernized. In 2008, plant foods accounted for 80.5% of the total amount of food intake per person per day and animal foods accounted for 19.5%, so the rate of consumption of animal foods was 6 times compared to the 3% surveyed in 1969 when the National Health and Nutrition Survey was first started. It was investigated that there was an increase in the above.

Accordingly, the obese population is rapidly increasing. The ratio of the obese (BMI>25) population in Korea was 11.7% in 1995, 30.7% in 2008, and the ratio of the highly obese (BMI>30) population was 2.3% in 1998 to 4.1% in 2008. (Ministry of Health and Welfare, 2009).

Obesity refers to a condition in which adipose tissue is abnormally increased due to excessive accumulation of energy in the body due to an imbalance between intake and consumption of energy, and the World Health Organization (WHO) has an Asian standard BMI (Body Mass Index) of 23. -25 is overweight, 25-30 is obese, and 30 or more is highly obese.

The causes of obesity include genetic factors, as well as environmental factors such as high fat and high calorie diet, lack of exercise due to busy social environment, and endocrine abnormalities, of which 50 to 70% of obesity is caused by environmental factors. It is known that the rest are due to genetic factors.

Fat stored in adipocytes is used as an important energy source in the body, but as obesity progresses, the number of adipocytes increases and adipocytes differentiate. The synthesis of triglycerides (triglycerides) increases according to the differentiation of adipocytes. Triglycerides accumulated and stored in adipocytes increase the size of adipocytes, and their diameter can increase by about 20 times as fat is stored, and as a result, cell volume is known to increase by several thousand times (Frayn KN, Karpe F. , Fielding BA, Macdonald IA, Coppack SW. Int J Obes Relat Metab Disord. 2003;27:875-888). The size of the adipocytes can be controlled through diet control, but the process of differentiation of new pro-adipocytes into adipocytes is not effective by diet control. It is important to control.

Currently, treatments for obesity can be divided into drugs that affect appetite by acting on the central nervous system and drugs that inhibit absorption by acting on the gastrointestinal tract. Drugs acting on the central nervous system include drugs such as fenfluramine and dexfenfluramine, which inhibit the serotonin (5HT) nervous system according to their respective mechanisms, drugs such as ephedrine and caffeine through the noradrenaline nervous system, and recently, serotonin and noradrenaline simultaneously in the nervous system. Drugs such as sibutramine, which act to inhibit obesity, are commercially available. In addition, drugs that inhibit obesity by acting on the gastrointestinal tract include Orlistat, which is recently approved as a treatment for obesity by inhibiting lipase produced in the pancreas to reduce the absorption of fat. However, among the existing drugs, fenfluramine, etc., caused side effects such as primary pulmonary hypertension or heart valve lesions, and has been banned recently.Other drugs also have problems such as blood pressure reduction or lactic acidosis, so patients with heart failure and kidney disease. There is a problem that cannot be used.

Therefore, it is necessary to develop an obesity treatment that is safe and has an excellent weight loss effect because there are few side effects derived from natural products.

Throughout this specification, a number of papers and patent documents are referenced and citations are indicated. The disclosure contents of the cited papers and patent documents are incorporated by reference in this specification as a whole, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly described.

The present inventors have tried to select an extract having an activity to improve obesity and exercise performance derived from natural products. As a result, it was confirmed that Seonbokhwa extract inhibits the differentiation of adipocytes, reduces fat accumulation, inhibits the expression of adipose differentiation-related mRNA, and increases muscle strength and muscle mass, thereby improving obesity and exercise performance. The composition has been completed.

Accordingly, an object of the present invention is to provide a pharmaceutical composition for improving, preventing or treating obesity.

Another object of the present invention is to provide a health functional food for reducing body fat.

Another object of the present invention is to provide a composition for inhibiting differentiation of adipocytes.

Another object of the present invention is to provide a method for inhibiting differentiation of adipocytes.

Another object of the present invention is to provide a pharmaceutical composition for improving, preventing or treating muscle diseases.

Another object of the present invention is to provide a health functional food for increasing muscle mass.

Another object of the present invention is to provide a health functional food for improving exercise performance.

Other objects and advantages of the present invention will become more apparent by the following detailed description, claims and drawings.

According to one aspect of the present invention, the present invention provides a pharmaceutical composition for improving, preventing or treating obesity, comprising a sunbokhwa extract as an active ingredient.

The present inventors have tried to select an extract having an activity to improve obesity and exercise performance derived from natural products. As a result, it was confirmed that the extract of Seonbokhwa inhibited the differentiation of adipocytes, reduced fat accumulation, suppressed the expression of adipose differentiation-related mRNA, and increased muscle strength and muscle mass.

When the sunbokhwa extract used in the composition of the present invention is obtained by treating the sunbokhwa with an extraction solvent, various extraction solvents may be used. Specifically, a polar solvent or a non-polar solvent can be used. Suitable as polar solvents are (i) water, (ii) alcohols (preferably methanol, ethanol, propanol, butanol, normal-propanol, iso-propanol, normal-butanol, 1-pentanol, 2-butoxyethanol. Or ethylene glycol), (iii) acetic acid, (iv) dimethyl-formamide (DMFO), and (v) dimethyl sulfoxide (DMSO). Suitable non-polar solvents include acetone, acetonitrile, ethyl acetate, methyl acetate, fluoroalkane, pentane, hexane, 2,2,4-trimethylpentane, decane, cyclohexane, cyclopentane, diisobutylene, 1- Pentene, 1-chlorobutane, 1-chloropentane, o-xylene, diisopropyl ether, 2-chloropropane, toluene, 1-chloropropane, chlorobenzene, benzene, diethyl ether, diethyl sulfide, chloroform, dichloro Methane, 1,2-dichloroethane, aniline, diethylamine, ether, carbon tetrachloride and THF.

More specifically, the extraction solvent used in the present invention is (a) water, (b) anhydrous or hydrated lower alcohol having 1-4 carbon atoms (methanol, ethanol, propanol, butanol, etc.), and (c) the lower alcohol and water Mixed solvent with, (d) acetone, (e) ethyl acetate, (f) chloroform, (g) butyl acetate, (h) 1,3-butylene glycol, (i) hexane and (j) diethyl ether. Includes.

More specifically, the sunbokhwa extract of the present invention was obtained by treating sunbokhwa with water and an anhydrous or hydrated lower alcohol having 1-4 carbon atoms.

In the case of using a mixture of water and alcohol as a solvent used in the preparation of crude extract of sunbokhwa, 10% or more to less than 100% (v/v), 20% or more to less than 100% (v/v), 30% More than 100% (v/v), 40% or more and less than 100% (v/v), 50% or more and less than 100% (v/v), 60% or more and less than 100% (v/v), 70% or more and less than 100% (v/v), 10% or more and less than 90% (v/v), 20% or more and less than 90% (v/v), 30% or more and less than 90% (v/v) Less than, 40% or more and less than 90% (v/v), 50% or more and less than 90% (v/v), 60% or more and less than 90% (v/v), or 60% or more and less than 80% (v/v) v) a C 1 to C 4 linear or branched alcohol aqueous solution, for example, 70% (v/v) C 1 to C 4 linear or branched alcohol aqueous solution.

In addition, the aqueous alcohol solution may be at least one selected from the group consisting of an aqueous methanol solution, an aqueous ethanol solution, an aqueous propanol solution, and an aqueous butanol solution, and may be, for example, an aqueous ethanol solution, but is not limited thereto.

The sunbokhwa extract according to the present invention may be a solvent fraction obtained by fractionating the crude solvent extract with an additional solvent.For example, at least one solvent selected from the group consisting of ethyl ether, ethyl acetate, and butanol is added to the crude solvent extract. It may be a solvent fraction used.

For example, the crude solvent extract obtained by extracting the sunbath with one or more solvents selected from the group consisting of water and a straight chain or branched alcohol having 1 to 4 carbon atoms is one selected from the group consisting of ethyl ether, ethyl acetate, and butanol. It may be a solvent fraction using the above solvent.

The sunbokhwa extract includes a crude solvent extract and a solvent fraction of sunbokhwa, as described above.

The Seonbokhwa extract is obtained by extracting at least one selected from the group consisting of flowers, leaves, stems and roots of Seonbokhwa with at least one solvent selected from the group consisting of water and a straight chain or branched alcohol having 1 to 4 carbon atoms. It may be a crude extract. According to an embodiment of the present invention, the sunbokhwa extract is a flower extract of sunbokhwa.

The solvent is 10% or more and less than 100% (v/v), 20% or more and less than 100% (v/v), 30% or more and less than 100% (v/v), 40% or more and less than 100% (v /v) less than, 50% or more to less than 100% (v/v), 60% or more to 100% (v/v), 70% or more to less than 100% (v/v), 10% or more to 90% Less than (v/v), from more than 20% to less than 90% (v/v), from more than 30% to less than 90% (v/v), from more than 40% to less than 90% (v/v), from more than 50% Less than 90% (v/v), more than 60% to less than 90% (v/v), or more than 60% to 80% (v/v) straight chain or branched alcohol aqueous solution having 1 to 4 carbon atoms, for example, It may be an aqueous solution of 70% (v/v) straight-chain or branched alcohol having 1 to 4 carbon atoms.

The manufacturing process of the sunbokhwa extract according to the present invention will be described in more detail as follows: After cutting the sunbokhwa and washing with water to remove constrictions, an extraction solvent of about 10 to 20 times the weight of the sunbokhwa Extracted under reflux. After extraction, it is filtered to collect the filtrate. The extraction temperature is not particularly limited, but is preferably 15 to 110, preferably 20 to 90.

The extraction process may be repeated once or several times, and in one preferred example of the present invention, a method of re-extraction after the first extraction may be employed. This is to prevent this because the water content is high, so that loss occurs, and the extraction efficiency is lowered only by the first extraction. In addition, as a result of verifying the extraction efficiency of each step, it was found that about 80 to 90% of the total extraction amount was extracted by the secondary extraction.

In an example of the present invention, when the extraction process is repeated twice, the obtained residue is subjected to reflux extraction with an extraction solvent, about 5 to 15 times by volume, preferably 8 to 12 times by volume. After extraction, it is filtered, combined with the filtrate obtained previously, and concentrated under reduced pressure to prepare Seonbokhwa extract. As described above, extraction efficiency may be increased by mixing the second extraction and the filtrate obtained after each extraction, but the extract of the present invention is not limited to the number of extractions.

If the amount of the solvent used in the preparation of the sunbokhwa extract is too small, stirring becomes difficult and the solubility of the extract decreases, resulting in lower extraction efficiency, and if too large, the amount of solvent used in the next purification step increases, which is not economical. This may cause problems in handling, so the amount of the solvent is preferably within the above range.

The filtered extract thus obtained is about 10 to 30 times by weight, preferably 15 to 25 times by weight, more preferably about 10 to 30 times by weight of the total amount of the concentrate in order to adjust the content of the lower alcohol remaining suitable for use as a pharmaceutical ingredient. Azeotropically concentrated 1 to 5 times, preferably 2 to 3 times with 20 weight times of water, and homogeneously suspended by adding the same amount of water again, and then freeze-dried to prepare a powdery sunbokhwa extract.

The extraction method used in the present invention may be any method commonly used, for example, cold sedimentation, hot water extraction, ultrasonic extraction, or reflux cooling extraction method, but is not limited thereto.

As used herein, the term'extract' includes a crude solvent extract, a specific solvent-soluble extract (solvent fraction), and a solvent fraction of a crude solvent extract, and the sunbokhwa extract includes all of a solution, a concentrate, or a powder.

In the present specification, the term "including as an active ingredient" means including an amount sufficient to achieve the efficacy or activity of the following sunbokhwa extract. The present invention is a composition extracted from a natural plant material, Seonbokhwa, and there is no side effect on the human body even if an excessive dose is administered. Therefore, the upper limit of the quantity contained in the composition of the present invention can be carried out by those skilled in the art by selecting within an appropriate range.

The present invention provides a pharmaceutical composition for improving, preventing or treating obesity comprising a sunbokhwa extract as an active ingredient.

In this specification, the term "obesity" refers to a state in which adipose tissue is abnormally increased due to excessive accumulation of energy in the body due to an imbalance between intake and consumption of energy, and the World Health Organization (WHO) refers to an Asian standard BMI (Body Mass Index). : Body mass index) 23-25 is overweight, 25-30 is obese, and 30 or more is reported as high obesity.

According to one embodiment of the present invention, the sunbokhwa extract is an anhydrous or hydrated lower alcohol extract having 1-4 carbon atoms.

The sunbokhwa extract inhibits fat accumulation in adipocytes. As demonstrated in the following examples, as a result of treatment with 100 ug/ml of Seonbokhwa extract on adipocytes, the accumulation of fat in adipocytes was suppressed.

The composition of the present invention can be prepared as a pharmaceutical composition.

According to a preferred embodiment of the present invention, the composition of the present invention comprises (a) a pharmaceutically effective amount of the above-described sunbokhwa extract of the present invention; And (b) a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically effective amount" refers to an amount sufficient to achieve the efficacy or activity of the above-described sunbokhwa extract.

When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used at the time of formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. It does not become. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally.

A suitable dosage of the pharmaceutical composition of the present invention is formulated in various ways depending on factors such as the formulation method, the mode of administration, the patient's age, weight, sex, pathological condition, food, administration time, route of administration, excretion rate and response sensitivity. Can be. A typical dosage of the pharmaceutical composition of the present invention is in the range of 0.001-100 mg/kg on an adult basis.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person having ordinary knowledge in the art. Or it can be prepared by incorporating it into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension, syrup, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, powder, granule, tablet or capsule, and may additionally include a dispersant or a stabilizer.

According to another aspect of the present invention, the present invention provides a health functional food for reducing body fat comprising an extract of sunbokhwa as an active ingredient.

The present invention can be provided as a food product. When prepared as a food composition for body fat reduction comprising the extract of Seonbokhwa of the present invention as an active ingredient, as well as the Seonbokhwa extract as an active ingredient, it includes ingredients commonly added during food production, for example, proteins, carbohydrates , Fats, nutrients, seasonings and flavoring agents. Examples of the aforementioned carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, oligosaccharides, and the like; And polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents [taumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.]) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is prepared as a drink, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, cephalothorax extract, jujube extract, licorice extract, etc. may be additionally included in addition to the sunbokhwa extract of the present invention. I can.

When the present invention is manufactured as a health functional food, it includes ingredients that are commonly added during food production, and includes, for example, proteins, carbohydrates, fats, nutrients and seasonings. For example, when prepared as a drink, a flavoring agent or natural carbohydrate may be included as an additional component in addition to the sunbokhwa extract as an active ingredient. For example, natural carbohydrates include monosaccharides (eg, glucose, fructose, etc.); Disaccharides (eg, maltose, sucrose, etc.); oligosaccharide; Polysaccharides (eg, dextrin, cyclodextrin, etc.); And sugar alcohols (eg, xylitol, sorbitol, erythritol, etc.). As the flavoring agent, natural flavoring agents (eg, taumarin, stevia extract, etc.) and synthetic flavoring agents (eg, saccharin, aspartame, etc.) can be used.

Since the health functional food for reducing body fat of the present invention contains the same active ingredient as the pharmaceutical composition for improving, preventing or treating obesity, the contents in common between the two are described in order to avoid excessive complexity of the present specification. Omit it.

According to another aspect of the present invention, the present invention provides a health functional food for inhibiting differentiation from adipocytes to adipocytes comprising a sunbokhwa extract.

According to another aspect of the present invention, the present invention provides a method for inhibiting differentiation into adipocytes, comprising the step of treating an extract of Seonbokhwa on adipocytes.

According to one embodiment of the present invention, the sunbokhwa extract is an anhydrous or hydrated lower alcohol extract having 1-4 carbon atoms.

As demonstrated in the Examples below, the extract of Seonbokhwa inhibits the expression of adipocyte differentiation-related mRNA (eg, PPARγ, C/EBPa and aP2) in adipocytes.

The health functional food for inhibiting differentiation from adipocytes to adipocytes of the present invention and the method for inhibiting differentiation into adipocytes comprising the step of treating the adipocytes are common contents related to the aforementioned sunbokhwa extract and health functional foods. In order to avoid excessive complexity of the present specification, description thereof is omitted.

According to another aspect of the present invention, the present invention provides a pharmaceutical composition for improving, preventing or treating muscle diseases, comprising an extract of sunbokhwa as an active ingredient.

As used herein, the term "muscular disease" refers to external factors such as contusion, laceration, crush, internal factors such as sudden or severe falls or muscle strain during sports activities, which may occur during treatment. It is meant to include muscle damage, muscle wasting, and/or loss of muscle function resulting from an interruption in possible blood supply, and the cause may be due to genetic and/or environmental factors.

According to one embodiment of the present invention, the muscle disease is sarcopenia, muscular atrophy, muscle dystrophy, cardiac atrophy, atony, muscular dystrophy, muscle degeneration, and It is one or more muscle diseases selected from the group consisting of myasthenia gravis. Specifically, the muscle disease is muscular atrophy, sarcopenia, muscle dystrophy, cardiac atrophy, or hypotonia.

According to another embodiment of the present invention, the muscle disease is sarcopenia.

As used herein, the term "myosopenia" refers to a gradual decrease in skeletal muscle mass, which directly causes a decrease in muscle strength, and as a result, refers to a condition in which various bodily functions can be reduced and disorders.

According to one embodiment of the present invention, the sunbokhwa extract is an anhydrous or hydrated lower alcohol extract having 1-4 carbon atoms.

According to another aspect of the present invention, the present invention provides a health functional food for increasing muscle mass comprising an extract of sunbokhwa as an active ingredient.

According to one embodiment of the present invention, the sunbokhwa extract is an anhydrous or hydrated lower alcohol extract having 1-4 carbon atoms.

The health functional food for increasing muscle mass has the effect of increasing the muscle mass of the gastrocnemius (gastroc.), quadriceps, tricep, and soleus.

As demonstrated in the following examples, the health functional food for increasing muscle mass has an effect of increasing muscle strength and endurance.

According to another aspect of the present invention, the present invention provides a health functional food for improving exercise performance, comprising an extract of sunbokhwa as an active ingredient.

In the present specification, the term "exercise performance ability" refers to the ability to quickly, strongly, long, and competently perform physical movements performed in daily life or sports. The exercise performance ability can be largely divided into 1) muscle fatigue recovery, 2) endurance, 3) activation of the muscular nervous system, and the like, and the health functional food for improving exercise performance of the present invention has an effect of improving endurance.

The endurance is defined as'resistance to fatigue'. This refers to the resistance to fatigue that occurs during exercise that lasts under maximum (before maximum force) or during intense exercise.

As demonstrated in the following examples, the health functional food for improving exercise performance has an effect of increasing muscle strength and endurance.

In the health functional food for increasing muscle mass and the health functional food for improving exercise performance of the present invention, descriptions of the common contents related to the aforementioned sunbokhwa extract and health functional food will be omitted in order to avoid excessive complexity of the present specification.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a composition for improving, preventing or treating obesity and muscle diseases, comprising a sunbokhwa extract as an active ingredient.

(b) The composition of the present invention provides an effect of inhibiting adipocyte differentiation and inhibiting fat accumulation.

(c) The composition of the present invention provides an effect of increasing muscle mass and strengthening muscle strength.

(d) The composition of the present invention provides economical cost and convenience in manufacturing by using natural substances as a material.

1A to 1I show the effect of inhibiting differentiation of 3T3-L1 adipocytes by treatment with Seonbokhwa water extract, Seonbokhwa 50% ethanol extract, and Seonbokhwa 70% ethanol extract through Oil Red O staining. 1A to 1C show the results of oil red O staining by treating 3T3-L1 adipocytes with water extract of sunbokhwa at 0, 10, 25, 50 and 100 ug/ml. 1D to 1F show the results of oil red O staining by treating 3T3-L1 adipocytes with 50% ethanol extracts 0, 10, 25, 50 and 100 ug/ml. Figures 1g to 1i show the results of oil red O staining by treating 3T3-L1 adipocytes with 70% ethanol extracts 0, 10, 25, 50 and 100 ug/ml. 1a, 1d and 1g are 6-well plate images of oil red O stained 3T3-L1 adipocytes, and FIGS. 1b, 1e and 1h show microscopic images of oil red O stained 3T3-L1 adipocytes. Figures 1c, 1f and 1i show the quantification of the oil red O absorbance intensity of 3T3-L1 adipocytes stained with oil red O. 'CS' is untreated 3T3-L1 adipocytes,'MDI' is 3T3-L1 adipocytes treated with only MDI medium, and'IJ10','IJ25','IJ50'and'IJ100' are extracts from Seonbokhwa, respectively. It means treatment groups of 10, 25, 50 and 100 ug/ml.
Figures 2a to 2e show the cell viability of 3T3-L1 adipocytes and the degree of expression of lipodifferentiation-related mRNAs and proteins by treatment with 70% ethanol extract of sunbokhwa. Figure 2a is a result of confirming the cell viability when treated with 70% ethanol extract of sunbokhwa 0, 10, 25, 50, 100 and 200 ug / ml. 2b to 2d are PPARγ (Peroxisome proliferator-activated receptor gamma), C/EBPα (CCAAT/enhancer-binding protein alpha) of 3T3-L1 adipocytes by treatment with 0, 50 and 100 ug/ml of 70% ethanol extract. ) And aP2 (adipocyteP2) mRNA expression levels, respectively. 2e is a result showing the protein expression level through Western blot.
3A to 3E show changes in weight gain, body fat, and muscle mass of obese model mice fed with 70% ethanol extract of sunbokhwa. Figure 3a shows the weight gain (g) of the high-fat diet mice to which the sunbokhwa 70% ethanol extract 0.25% (IL) or 0.5% (IH) was added. FIG. 3B shows a DEXA image of a high-fat diet mouse to which 0.25% (IL) or 0.5% (IH) of sunbokhwa 70% ethanol extract was added. Figure 3c is a total body mass (total body mass), lean body mass (lean body mass) and fat body mass (fat body mass) of a high-fat diet mouse to which the ethanol extract of sunbokhwa 70% 0.25% (IL) or 0.5% (IH) was added. ). 3D shows adipose tissue (EP (epididymal fat pad, epididymal fat)), SC (subcutaneous fat, subcutaneous fat), and BAT of a high-fat diet mouse to which a sunbokhwa 70% ethanol extract 0.25% (IL) or 0.5% (IH) was added. (brown adipose tissue, brown fat)). Figure 3e shows the gastrocnemius (gastroc.), quadriceps, tricep, soleus of a high-fat diet mouse to which a 70% ethanol extract of sunbokhwa is added 0.25% (IL) or 0.5% (IH). Represents the weight of (g/BW (Body weight)).
Figures 4a to 4b show the results of analysis of lipid-related mRNA expression in tissues of obese model mice fed with sunbokhwa extract. Figure 4a shows SCD1 (Stearoyl-CoA desaturase-1), SREBP1c (Sterol regulatory element-binding protein 1c) and Indicates the level of CD36 mRNA expression. Figure 4b shows the expression levels of PPAR-γ, C/EBPa, and aP2 mRNA in epididymal fat (EP) of high-fat diet mice to which the sunbokhwa 70% ethanol extract 0.25% (IL) or 0.5% (IH) was added.
Figures 5a to 5c show the results of the grip strength test, the lower trabecular test and the expression analysis of the muscle-related mRNA of the obese model mice fed with the sunbokhwa extract. 5A shows the results of a grip strength test of a high-fat diet mouse to which 0.25% (IL) or 0.5% (IH) of sunbokhwa 70% ethanol extract was added. Figure 5b shows the results of exercise load test of high-fat diet mice to which the sunbokhwa 70% ethanol extract 0.25% (IL) or 0.5% (IH) was added. 5C is a UCP2 (Mitochondrial uncoupling protein 2), PGC-1α (Peroxisome proliferator-activated receptor) of the gastrointestinal muscle (Gastro.) of a high-fat diet mouse to which a 70% ethanol extract 0.25% (IL) or 0.5% (IH) was added. gamma coactivator 1-alpha), MHCIa (Major Histocompatibility Complex Ia), MHCIIa and MHCIIb mRNA expression analysis results are shown.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Throughout this specification, "%" used to indicate the concentration of a specific substance is (weight/weight)% for solids/solids, (weight/volume)% for solids/liquids, and Liquid/liquid is (vol/vol) %.

Example

Experimental materials and test methods

Preparation of sunbokhwa extract

Seonbokhwa extract was prepared by adding 500 ml equivalent to 10 times to 50 g of the sunbok flower crushed using water, 50% ethanol, and 70% ethanol as a solvent, and hot water extraction at 80℃ for 2 hours. I did. After hot water extraction, ethanol was removed from the ethanol solvent using a vacuum concentrator, and all samples were lyophilized to calculate the yield and used in the experiment.

3T3-L1 cell differentiation

3T3-L1 cells ^{were seeded into 6-well plates at 4*10 5} cells/well and incubated for 3 days. After 3 days, MDI medium was treated to induce differentiation. The MDI medium contains dexamethasone, IBMX (3-isobutyl-1-methylxanthin) and insulin. The dexamethasone was prepared at a concentration of 10 mM, diluted with PBS to a concentration of 1 mM, filtered and treated with 1:1000 dilution, and the IBMX was prepared at a concentration of 11.5 mg/ml (in 0.5 N KOH) and diluted 1:100 The insulin was prepared at a concentration of 1 mg/ml (in 0.02 M HCl) and diluted 1:1000. After 2 days of induction with MDI medium, it was exchanged for insulin medium (prepared by mixing insulin at a concentration of 1 mg/ml (in 0.02 M HCl) in 10% FBS high glucose DMEM at a ratio of 1:1000). After 2 days, 10% FBS (with 1% PSG (penicillin-streptomycin-L-glutamine) high glucose DMEM medium was exchanged, and 2 days later, 10% FBS (with 1% PSG (penicillin-streptomycin-L-glutamine)) was replaced with 10% FBS (penicillin-streptomycin-L-glutamine). ) After replacing with high glucose DMEM medium, it was terminated after 2 days.

The treatment of Seonbokhwa water extract, Seonbokhwa 50% ethanol extract and Seonbokhwa 70% ethanol extract was replaced with MDI medium at concentrations of 0, 10, 25, 50 and 100 μg/ml, and treated after 30 minutes to use insulin medium. It was cultured until replacement (2 days), and after that, when the cell differentiation was completed, the ability to inhibit lipolysis was measured compared to the group not treated with the sample.

Oil Red O Dyeing

The medium of the cell culture plate was removed and washed with 1 ml of 10% formalin (in PBS). After treatment with 1 ml of 10% formalin (in PBS) and allowed to stand for 1 hour, the formalin was removed and washed with 1 ml of 60% isopropanol. 60% isopropanol was removed in the hood, filtered oil red O was mixed with distilled water and 3:2, 1 ml was added and reacted for 10 minutes. After removing Oil Red O, it was washed with distilled water, and then slightly filled with distilled water and observed under a microscope. After microscopic observation, distilled water was removed from the hood, and the plate was photographed. Thereafter, 1 ml of 100% isopropanol was treated, stirred for 10 minutes, and transferred to a 96 well plate to measure absorbance at 500 nm.

MTT analysis

3T3-L1 cells were seeded in a 96 well plate at 1*10 ⁴ cells/well, and after 24 hours, 70% ethanol extract dissolved in DMSO was treated at a concentration of 0, 25, 50, 100, 200 μg/ml. . After incubating for 24 hours, MTT solution was added, reacted in an incubator for 2 hours, and then the medium was removed, and 200 μl of DMSO was added and shaken for 5 minutes, and the absorbance was measured at 540 nm. The wells that were not treated with anything were held at 100% (control, control), and cell viability for the remaining conditions was confirmed.

mRNA expression analysis

RNA was extracted under each condition according to the method of the RNeasy mini kit (Qiagen) to investigate the effect of the 70% extract of sunbokhwa on the mRNA expression in cells or in vivo. For cDNA synthesis, ReverTra Ace qPCR RT Mater Mix (ToYoBo, Osaka, Japan) was used, and the cycle condition was maintained at 37°C for 15 minutes, 50°C for 5 minutes, 98°C for 5 minutes, and then 4°C. For quantitative real-time PCR, AB ViiA 7 Real time PCR was used, and PCR was amplified at 50°C for 2 minutes and 95°C for 10 minutes and 40 cycles. The mRNA expression was normalized with 18S for muscle tissue and actin for other tissues and cells, and then the mRNA expression level of the control group (CS or normal diet group (normal or nor)) was set to '1'. The degree of expression was shown. A list of primers used in the real time PCR is shown in Table 1.

gene Sequence (5'->3') Sequence list C/EBPa F CAAGAACAGCAACGAGTACCG First sequence R GTCACTGGTCAACTCCAGCAC Second sequence PPARr F TCGCTGATGCACTGCCTATG 3rd sequence R GAGAGGTCCACAGAGCTGATT Sequence 4 FAS F GGAGGTGGTGATAGCCGGTAT Sequence 5 R TGGGTAATCCATAGAGCCCAG Sequence 6 Ap2 F CCGCAGACGACAGGA Sequence 7 R CTCATGCCCTTTCATAAACT Sequence 8 CD36 F ATGGGCTGTGATCGGAACTG Sequence 9 R GTCTTCCCAATAAGCATGTCTCC Sequence 10 SCD-1 F TTCTTGCGATACACTCTGGTGC Sequence 11 R CGGGATTGAATGTTCTTGTCGT Sequence 12 SREBP1c F TGGATTGCACATTTGAAGACAT Sequence 13 R GCCAGAGAAGCAGAAGAG SEQ ID NO: 14 PGC1a F TGGAGTGACATAGAGTGTGCTGC Sequence 15 R CTCAAATATGTTCGCAGGCTCA Sequence 16 UCP2 F ATGGTTGGTTTCAAGGCCACA SEQ ID NO: 17 R TTGGCGGTATCCAGAGGGAA Sequence 18 MHC1a F CTCAAGCTGCTCAGCAATCTATTT SEQ ID NO: 19 R GGAGCGCAAGTTTGTCATAAGT Sequence 20 MHC2a F AAGCGAAGAGTAAGGCTGTC SEQ ID NO:21 R GTGATTGCTTGCAAAGGAAC SEQ ID NO:22 MHC2b F CACCTGGACGATGCTCTCAGA SEQ ID NO:23 R GCTCTTGCTCGGCCACTCT SEQ ID NO: 24 18S F CTCAACACGGGAAACCTCAC SEQ ID NO: 25 R CGCTCCACCAACTAAGAACG Sequence 26 β-actin F GCAGGAGTACGATGAGTCCG Sequence 27 R ACGCAGCTCAGTAACAGTCC Sequence 28

Animal experiment design

Experimental animals received C57BL/6J Jms SIc 4-week-old male rats and conducted the experiment. A total of 34 animals were fed with a normal diet (n=7), a high fat diet (n=9), and 0.25% (IL, n=9) and 0.5% (IH, n=9) of Seonbokhwa extract were added to the high fat diet, respectively. The experiment was conducted by dividing one diet into groups fed. The diet was made free, and the intake was calculated by measuring the amount of feeding and the remaining amount each time.

Grip strength test

After measuring repeatedly 5 times using the grip test Model GT3 (Bioseb), the average was measured excluding the maximum and minimum values.

Treadmill test

After acclimating the experimental animal to the treadmill for 2 days before measurement (Day 1: slope 10°5 m/min 10 minutes, 10 m/min 10 minutes Day 2: slope 10°5 m/min 5 minutes , 10 m/min, 15 minutes) The end point is when the initial speed of the experiment is 10 m/min and the incline is 10° for 20 minutes, and then the speed is increased by 2 m/min every 2 minutes, and the end point is to stay for 10 seconds without running. It was measured by converting the time to the distance run.

Western blot

Cells or tissues were lysed, and then the protein was quantified using the Bratford assay and then sampled to contain the same amount of protein. Proteins were separated by molecular weight through SDS-PAGE (Sodium dodecyl sulfate-Polyacrylamide gel electrophoresis) using an acrylamide gel, and then transferred to the membrane using semidry. After blocking with 5% skim milk for 1 hour, reacting with the primary antibody overnight, reacting with the secondary antibody for 1 hour, and treating with an electrochemiluminescence (ECL) solution for detection.

result

Inhibition of differentiation of 3T3-L1

Seonbokhwa water extract, Seonbokhwa 50% ethanol extract, and Seonbokhwa 70% ethanol extract were diluted with MDI in 3T3-L1 adipocytes and treated at concentrations of 0 (MDI only), 10, 25, 50 and 100 μg/ml. As a result of staining with Oil Red O, it was confirmed that, when treated with 50% ethanol extract of sunbokhwa and 100 μg/ml of 70% ethanol extract of sunbokhwa, fat accumulation in the cells was significantly reduced (FIGS. 1A to 1I ).

MTT analysis

As a result of treatment with 70% ethanol extract of Seonbokhwa at 25, 50, 100 and 200 μg/ml concentrations on 3T3-L1 adipocytes, there was no significant difference in the viability of cells when treated with 25, 50 and 100 μg/ml. It was confirmed that the cell viability decreased when 200 μg/ml was treated (FIG. 2A).

Inhibition of adipogenic differentiation-related mRNA and protein expression

After treatment with 70% ethanol extract, a concentration-dependent inhibitory effect was confirmed as a result of confirming the level of mRNA expression of PPAR-γ, C/EBPa, and aP2, adipose differentiation-related mRNAs. When the ethanol extract was treated, a remarkable inhibitory effect was confirmed (FIGS. 2b to 2d ).

In addition, as a result of examining the protein expression level through Western blot, it was confirmed that the expression of PPAR-γ, C/EBPα, FAS and AP2 proteins was reduced when 100 ug/ml of sunbokhwa 70% ethanol extract was treated (Fig. 2e). ).

Changes in body weight, fat, and muscle phenotype in mice

When obesity was induced by a high fat diet, when fed with 70% ethanol extract of sunbokhwa, the weight gain was significantly reduced, and the body composition was analyzed using DEXA (Dual-energy X-ray absorptiometry). As a result, it was confirmed that the amount of fat in the body decreased (FIGS. 3A to 3C ). In addition, as a result of measuring organ and muscle weight, the weight of adipose tissue (EP (epididymal fat pad, epididymal fat)), SC (subcutaneous fat, subcutaneous fat) and BAT (brown adipose tissue, brown fat) was significantly compared to the control group. It was confirmed that the weight of the gastrocnemius, gastroc., quadriceps, tricep, soleus, and each of the weights increased significantly to reduce the weight of adipose tissue and the effect of muscle development. It was confirmed (Figs. 3D and 3E).

Inhibition of mRNA expression related to adipogenesis and lipogenesis in tissues

As a result of analyzing lipid production-related mRNAs (SCD1, SREBP1c and CD36) in the liver of high-fat diet mice fed with 70% ethanol extract of sunbokhwa, the experimental group fed 70% ethanol extract of sunbokhwa significantly compared with the control group. It could be confirmed that it decreased (FIG. 4A). In addition, as a result of examining the expression level of adipogenesis-related mRNA (C/EBPα, PPARγ, and aP2) in epididymal fat pad (EP), it was also confirmed that the experimental group significantly decreased compared to the control group (Fig. 4b). .

Analysis of endurance-related behavioral experiments

As a result of conducting the grip test and exercise load test, which are behavioral experiments related to improvement of exercise capacity, it was confirmed that muscle strength and endurance were significantly increased in the experimental group fed with 70% ethanol extract of sunbokhwa (Figs. 5a and 5b).

Muscle-related mRNA expression regulation effect

As a result of examining the expression of muscle-related mRNA, the amount of mRNA expression of Type 1a MHC (Myosin heavy chain) belonging to the local root was increased in the group fed with 70% ethanol extract of Seonbokhwa. In other words, it is estimated that it can induce an increase in endurance. In addition, it was confirmed that the amount of mRNA expression of UCP2, which is important for fatty acid consumption, was significantly increased in the experimental group fed with a high concentration of sunbokhwa 70% ethanol extract (FIG. 5C).

As described above, specific parts of the present invention have been described in detail, and it is obvious that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereto for those of ordinary skill in the art. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> KOREA FOOD RESEARCH INSTITUTE <120> Composition for Improving Obesity or Exercise Performance comprising Extract from Inula japonica <130> PN160482 <160> 28 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> C/EBPa Forward primer <400> 1 caagaacagc aacgagtacc g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> C/EBPa Reverse primer <400> 2 gtcactggtc aactccagca c 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPARr Forward primer <400> 3 tcgctgatgc actgcctatg 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PPARr Reverse primer <400> 4 gagaggtcca cagagctgat t 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FAS Forward primer <400> 5 ggaggtggtg atagccggta t 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FAS Reverse primer <400> 6 tgggtaatcc atagagccca g 21 <210> 7 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Ap2 Forward primer <400> 7 ccgcagacga cagga 15 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ap2 Reverse primer <400> 8 ctcatgccct ttcataaact 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD36 Forward primer <400> 9 atgggctgtg atcggaactg 20 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CD36 Reverse primer <400> 10 gtcttcccaa taagcatgtc tcc 23 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SCD-1 Forward primer <400> 11 ttcttgcgat acactctggt gc 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SCD-1 Reverse primer <400> 12 cgggattgaa tgttcttgtc gt 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SREBP1c Forward primer <400> 13 tggattgcac atttgaagac at 22 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SREBP1c Reverse primer <400> 14 gccagagaag cagaagag 18 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PGC1a Forward primer <400> 15 tggagtgaca tagagtgtgc tgc 23 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PGC1a Reverse primer <400> 16 ctcaaatatg ttcgcaggct ca 22 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> UCP2 Forward primer <400> 17 atggttggtt tcaaggccac a 21 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> UCP2 Reverse primer <400> 18 ttggcggtat ccagagggaa 20 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MHC1a Forward primer <400> 19 ctcaagctgc tcagcaatct attt 24 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MHC1a Reverse primer <400> 20 ggagcgcaag tttgtcataa gt 22 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MHC2a Forward primer <400> 21 aagcgaagag taaggctgtc 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MHC2a Reverse primer <400> 22 gtgattgctt gcaaaggaac 20 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MHC2b Forward primer <400> 23 cacctggacg atgctctcag a 21 <210> 24 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MHC2b Reverse primer <400> 24 gctcttgctc ggccactct 19 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18S Forward primer <400> 25 ctcaacacgg gaaacctcac 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18S Reverse primer <400> 26 cgctccacca actaagaacg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> b-actin Forward primer <400> 27 gcaggagtac gatgagtccg 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> b-actin Reverse primer <400> 28 acgcagctca gtaacagtcc 20

Claims (15)

delete delete delete delete delete delete delete delete delete More than 60% to less than 100% (v/v) , including Seonbokhwa extract (Inula japonica ), which is a water-containing lower alcohol extract having 1 to 4 carbon atoms as an active ingredient, as an active ingredient, Sacopenia, muscular atrophy, and hypotonia (atony), muscle dystrophy (muscular dystrophy), muscle degeneration and at least one pharmaceutical composition for improvement, prevention or treatment selected from the group consisting of myasthenia.
delete More than 60% to less than 100% (v/v) A health functional food for increasing muscle mass, comprising as an active ingredient the sunbokhwa extract (Inula japonica), which is a water-containing lower alcohol extract having 1 to 4 carbon atoms.
delete More than 60% to less than 100% (v/v) A health functional food for improving exercise performance, comprising as an active ingredient Sunbokhwa extract (Inula japonica), which is a water-containing lower alcohol extract having 1 to 4 carbon atoms. delete

Images