KR102444282B1 - Composition for preventing, ameliorating, or treating disease associated with muscle loss, comprising extract of amomum tsaoko - Google Patents

Abstract

A pharmaceutical composition for the prevention and/or alleviation and/or treatment of muscle loss-related diseases containing herbal ingredients, specifically, a pharmaceutical composition for the prevention and/or treatment of muscle loss-related diseases, comprising an extract of Amomum Tsaoko; And there is provided a food composition for the prevention and / or improvement of muscle loss-related diseases.

Description

Composition for the prevention, improvement, or treatment of muscle loss-related diseases containing excess extract

The present invention relates to a use for the prevention and/or alleviation and/or treatment of muscle loss-related diseases containing a herbal ingredient, and specifically, for the prevention and/or treatment of muscle loss-related diseases comprising an extract of Amomum Tsaoko It provides a pharmaceutical composition, and a food composition for preventing and/or improving muscle loss-related diseases.

Skeletal muscle is the largest organ in the human body, accounting for 40-50% of the total body weight, and plays an important role in various metabolic functions in the body, including energy homeostasis and thermogenesis. Human muscle decreases by more than 1% every year after the age of 40. In particular, at the age of 80, it decreases to a level of 50% of the maximum muscle mass, and this decrease in muscle mass in old age is the most important factor that lowers the overall physical function. As aging progresses, body shape changes such as muscle and fat content and skeletal distortion. In the case of abnormal insulin secretion, the cells cannot supply energy properly, which can cause muscle development disorders. In addition, the decrease in muscle causes arthritis, back pain, and chronic pain to further increase, and can worsen urinary incontinence caused by abdominal obesity and increase the fracture rate. As such, sarcopenia, particularly sarcopenia in old age, is linked to various diseases and is a major cause of lowering the quality of life. Sarcopenia is known to be closely related to geriatric chronic diseases such as osteoporosis, insulin resistance and arthritis, and it is possible to suppress the decrease in physical activity due to aging through the prevention or improvement of sarcopenia.

Therefore, there is a need for the development of an effective therapeutic agent for sarcopenia, particularly sarcopenia in old age.

[Prior literature]

[Patent Literature]

Korean Patent Registration No. 10-1986229 (2019.05.30)

One example provides a pharmaceutical composition for the prevention and / or treatment of muscle loss-related diseases comprising an extract of excess ( Amomum Tsaoko ) as an active ingredient.

Another example provides a pharmaceutical composition for inhibiting muscle loss or increasing muscle containing an extract of Amomum Tsaoko as an active ingredient.

Another example provides a pharmaceutical composition for promoting muscle cell generation and / or differentiation comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a pharmaceutical composition for enhancing muscle athletic performance comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a pharmaceutical composition for treating muscle fatigue comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a medium composition for muscle cell proliferation and/or differentiation comprising an extract of Amomum Tsaoko .

Another example provides a food composition for the prevention and/or amelioration of muscle loss related diseases comprising an extract of Amomum Tsaoko .

Another example provides a food composition for inhibiting muscle loss or increasing muscle comprising an extract of Amomum Tsaoko .

Another example provides a food composition for promoting muscle cell differentiation (generation) comprising an extract of Amomum Tsaoko .

Another example provides a food composition for improving muscle athletic performance comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a food composition for improving muscle fatigue comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a food composition for enhancing mitochondrial function comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a method for preventing and/or treating a muscle loss-related disease, comprising administering to a subject in need thereof an effective amount of an extract of Amomum Tsaoko ).

Another example provides a method for inhibiting muscle loss or increasing muscle, comprising administering to a subject in need thereof an effective amount of an extract of Amomum Tsaoko .

Another example provides a method for promoting myocyte proliferation, generation and/or differentiation, comprising administering to a subject in need thereof an effective amount of an extract of Amomum Tsaoko ).

Another example provides a method for enhancing or improving muscle athletic performance, comprising administering to a subject in need thereof an effective amount of Amomum Tsaoko extract.

Another example provides a method for treating or improving muscle fatigue, comprising administering to a subject in need thereof an effective amount of Amomum Tsaoko extract.

Another example provides a food composition for enhancing mitochondrial function, comprising an effective amount of Amomum Tsaoko extract as an active ingredient for enhancing mitochondrial function.

Another example provides a method for differentiating, proliferating, and/or generating myoblasts, comprising culturing myoblasts with an Amomum Tsaoko extract.

Excessive ( Amomum Tsaoko ) extract in the present specification has excellent muscle cell proliferation, muscle cell generation and/or differentiation promotion, and phosphorylation effects of AKT and mTOR, enhancing muscle motility, enhancing myotube differentiation, strengthening mitochondrial function, and improving muscle fatigue It was confirmed that it has an effect.

Accordingly, in the present specification, the use of extracts of Amomum Tsaoko for inhibiting muscle loss, promoting muscle cell production and/or differentiation, and preventing/treating diseases related to muscle loss are provided.

Specifically, in one example, there is provided a pharmaceutical composition for the prevention and / or treatment of muscle loss-related diseases comprising an extract of Amomum Tsaoko as an active ingredient.

In another example, a pharmaceutical composition for inhibiting muscle loss or increasing muscle comprising an extract of Amomum Tsaoko as an active ingredient is provided.

In another example, there is provided a pharmaceutical composition for promoting muscle cell generation and/or differentiation comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a pharmaceutical composition for enhancing muscle athletic performance comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a pharmaceutical composition for treating muscle fatigue comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a medium composition for muscle cell proliferation and/or differentiation comprising an extract of Amomum Tsaoko .

In another example, there is provided a food composition for preventing and/or ameliorating a muscle loss related disease comprising an extract of Amomum Tsaoko .

In another example, there is provided a food composition for inhibiting muscle loss or increasing muscle, comprising an extract of Amomum Tsaoko as an active ingredient.

In another example, there is provided a food composition for promoting muscle cell production and/or differentiation comprising an extract of Amomum Tsaoko .

Another example provides a food composition for improving muscle athletic performance comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a food composition for improving muscle fatigue comprising an extract of Amomum Tsaoko as an active ingredient.

Another example provides a food composition for enhancing mitochondrial function comprising an extract of Amomum Tsaoko as an active ingredient.

In another example, there is provided a method for preventing and/or treating a muscle loss-related disease comprising administering to a subject in need thereof an effective amount of an extract of Amomum Tsaoko ).

In another example, there is provided a method of inhibiting muscle loss or increasing muscle, comprising administering to a subject in need thereof an effective amount of an extract of Amomum Tsaoko .

In another example, there is provided a method for promoting myocyte generation and/or differentiation comprising administering to a subject in need thereof an effective amount of an extract of Amomum Tsaoko ).

Another example provides a method for enhancing or improving muscle athletic performance, comprising administering to a subject in need thereof an effective amount of Amomum Tsaoko extract.

Another example provides a method for treating or improving muscle fatigue, comprising administering to a subject in need thereof an effective amount of Amomum Tsaoko extract.

Another example provides a food composition for enhancing mitochondrial function, comprising an effective amount of Amomum Tsaoko extract as an active ingredient for enhancing mitochondrial function.

Another example provides a method for differentiating, proliferating, and/or generating myoblasts, comprising culturing myoblasts with an Amomum Tsaoko extract. The myoblasts may be of a mammal.

In one example, when the mammal is a human, the myoblasts may be isolated from the human body. The culturing step may be performed by culturing myoblasts in a medium containing the extract ( Amomum Tsaoko ).

Hereinafter, the present invention will be described in more detail:

Excess ( Amomum Tsaoko ) extract included or used as an active ingredient in the pharmaceutical composition, food composition and / or method provided herein is extracted by extracting an extract or a part (eg, fruit, etc.) It may be the obtained extract. The excess whole plant or part (eg, fruit) may be used for extraction as a crude drug or in a dried and/or heated state. The extraction solvent may be water, a lower alcohol (a straight or branched chain alcohol having 1 to 4 carbon atoms, such as ethanol), or a mixture thereof, for example, 30 to 100% (v/v), 50 to 100% ( v/v), 60-100% (v/v), 62-100% (v/v), 64-100% (v/v), 65-100% (v/v), 66-100% ( v/v), 67-100% (v/v), 68-100% (v/v), 69-100% (v/v), or 70-100% (v/v) lower alcohol or lower It may be an aqueous alcohol solution (eg, ethanol or an aqueous ethanol solution). The amount of extractant used for the extraction is at least two times by volume (eg, more than (dry) starch and/or part by volume, based on the weight of the excess root and/or part, for example, the dry weight of the whole plant and/or part. It means 2L or more based on 1kg), 5 times by volume or more, 7 times by volume or more, or 10 times by volume or more, but is not limited thereto.

The extraction may be performed once, or may be performed two or more times (eg, 2 times, 3 times, 4 times, or 5 times) with the same or different extraction solvents and/or conditions.

The extraction time is not limited thereto, but for sufficient extraction of the active ingredient, 1 to 48 hours, 1 to 36 hours, 1 to 24 hours, 1 to 12 hours, 1 to 6 hours, 3 to 48 hours, 3 to 36 hours , 3 to 24 hours, 3 to 12 hours, or 3 to 6 hours. When the extraction is performed two or more times, the extraction time for each time may be within the above range, but is not limited thereto. The extraction temperature is not limited thereto, but for effective extraction of the active ingredient, from room temperature to the boiling point of the extraction solvent (eg, 15 to 100° C., 20 to 100° C., 25 to 100° C., 30 to 100° C., 35 to 100° C.) , 40 to 100 °C, 45 to 100 °C, 50 to 100 °C, 55 to 100 °C, 60 to 100 °C, 65 to 100 °C, 70 to 100 °C, 75 to 100 °C, 80 to 100 °C, 85 to 100 °C , 90 to 100 ℃, 95 to 100 ℃, 97 to 100 ℃, 15 to 97 ℃, 20 to 97 ℃, 25 to 97 ℃, 30 to 97 ℃, 35 to 97 ℃, 40 to 97 ℃, 45 to 97 ℃ , 50 to 97 °C, 55 to 97 °C, 60 to 97 °C, 65 to 97 °C, 70 to 97 °C, 75 to 97 °C, 80 to 97 °C, 15 to 95 °C, 20 to 95 °C, 25 to 95 °C , 30 to 95 °C, 35 to 95 °C, 40 to 95 °C, 45 to 95 °C, 50 to 95 °C, 55 to 95 °C, 60 to 95 °C, 65 to 95 °C, 70 to 95 °C, 75 to 95 °C , 80 to 95 ℃, 15 to 90 ℃, 20 to 90 ℃, 25 to 90 ℃, 30 to 90 ℃, 35 to 90 ℃, 40 to 90 ℃, 45 to 90 ℃, 50 to 90 ℃, 55 to 90 ℃ , 60 to 90 ° C, 65 to 90 ° C, 70 to 90 ° C, 75 to 90 ° C, 15 to 80 ° C, 20 to 80 ° C, 25 to 80 ° C, 30 to 80 ° C, 35 to 80 ° C, 40 to 80 ° C , 45 to 80 °C, 50 to 80 °C, 55 to 80 °C, 60 to 80 °C, 65 to 80 °C, 70 to 80 °C, 75 to 80 °C, 15 to 75 °C, 20 to 75 °C, 25 to 75 °C , 30 to 75 °C, 35 to 75 °C, 40 to 75 °C, 45 to 75 °C, 50 to 75 °C, 55 to 75 °C, 60 to 75 °C, 65 to 75 °C, or 7 0 to 75°C).

The extraction method for obtaining the extract may be prepared according to a known extraction method commonly used in the art to which the present invention pertains. Specifically, commonly used extraction methods such as reflux extraction, immersion extraction, heat extraction, cold extraction, hot water extraction, ultrasonic extraction, filtration, pressure extraction, supercritical extraction, and electrical extraction may be used.

In one embodiment, the excess extract is obtained by immersing the excess fruit in water or 50-100% (v/v) ethanol (or 70-100% (v/v) ethanol) (15-25° C.) or 70-95 It may be obtained by reflux extraction at a temperature of °C.

As used herein, the term 'muscle loss-related disease' may refer to a disease selected from among all symptoms related to muscle loss and all diseases caused thereby or a symptom of the disease. The muscle loss may be caused by aging, but is not limited thereto. In one example, the muscle loss-related disease may be one or more diseases selected from the group consisting of sarcopenia, muscular atrophy, muscular dystrophy, atonia, myasthenia gravis, and the like, for example, sarcopenia.

Sarcopenia (sarcopenia) refers to a symptom or disease caused by a gradual decrease in skeletal muscle mass according to certain factors, such as aging, and directly causes a decrease in muscle strength, and as a result, various body functions decrease and / or may mean a pathological condition that can cause a disability.

Amyotrophic lateral sclerosis (ALS) and/or progressive spinal cord progressive degeneration is caused by progressive degeneration of motor nerve fibers and cells in the spinal cord. It can cause spinal progressive muscular atrophy (SPMA). In one example, the muscular atrophy may be senescent muscular atrophy or obese muscular atrophy. The 'age-related muscular atrophy' is a chronic low-stage inflammation in which gradual loss of muscle mass and/or muscle strength and/or an increase in visceral fat and accompanying inflammation-inducing cytokines due to aging It may be caused by chronic low-grade inflammation. The 'obesity muscular atrophy' refers to a phenomenon in which obesity, such as obesity in old age, further aggravates muscle loss. Due to obesity, fat is deposited in the muscle to decrease muscle mass and increase mast cell-derived inflammatory factors, When the function of the mitochondria in the muscle is lowered, the muscle function is further weakened, and when an abnormality occurs in insulin secretion due to obesity, it cannot properly supply energy to the cells, so it may be caused by a muscle development disorder.

Muscular dystrophy, also called muscular dystrophy, is a disease in which progressive muscle atrophy and muscle weakness appear, and is one of degenerative myopathy characterized by pathological necrosis of muscle fibers.

Atony (atony), also called dystonia, may mean a state in which muscle tension is reduced or lost, or a pathological condition resulting therefrom. Muscle tension is regulated by reflexes in addition to control from the center, and when this control function is destroyed, it may be a disease caused by increase or loss of tension.

Myasthenia is a disease in which the contractility of muscles is reduced and the muscles are easily fatigued and weak. . Myasthenia gravis is a disease caused by a neurotransmission disorder at the neuromuscular junction, and may show pathological findings such as a change in the morphology of the neuromuscular junction post-synaptic membrane and a decrease in the number of nicotinic acetylcholine receptors.

As used herein, 'treatment' includes alleviation, alleviation or stabilization of disease state or symptoms, partial or complete recovery, prolongation of survival, reduction of disease range, delay or alleviation of disease progression, and other beneficial therapeutic results. used in meaning 'Prevention' is used to include all mechanisms and/or effects that act on a subject not having a specific disease to prevent the onset of the specific disease, delay the onset of the disease, or lower the frequency of onset.

As used herein, 'improving or improving muscle mobility' may refer to the recovery and/or improvement of lost or reduced muscle mobility, and/or enhancement of muscle mobility.

In the present specification, 'improving mitochondrial function' may mean enhancing the function of mitochondria of muscle cells, and the enhancement of mitochondrial function is due to increased mitochondrial biosynthesis, and/or mitochondrial antioxidant activity (reduction or removal of mitochondrial reactive oxygen species), etc. can

The content of the excess extract used as an active ingredient in the pharmaceutical composition can be appropriately adjusted depending on the form and purpose of use, the condition of the object of use, the type and severity of symptoms, etc. 0.001 to 99.9% by weight, 0.001 to 90% by weight, 0.001 to 75% by weight, 0.001 to 50% by weight, 0.01 to 99.9% by weight, 0.01 to 90% by weight, 0.01 to 75% by weight, 0.01 to 50% by weight, 0.1 to 99.9% by weight, 0.1 to 90% by weight, 0.1 to 75% by weight, 0.1 to 50% by weight, 1 to 99.9% by weight, 1 to 90% by weight, 1 to 75% by weight, 1 to 50% by weight, 5 to 99.9% by weight %, 5 to 90% by weight, 5 to 75% by weight, 5 to 50% by weight, 10 to 99.9% by weight, 10 to 90% by weight, 10 to 75% by weight, or 10 to 50% by weight, but limited thereto doesn't happen

The pharmaceutical composition or food composition includes mammals including humans, primates such as monkeys, mice, rats, and rodents such as rabbits, dogs, cats, cattle, pigs, sheep, horses, goats, etc., chickens, ducks, geese It can be administered to a target selected from vertebrates such as birds, snakes, lizards, turtles, and reptiles including crocodiles, amphibians, and fish, including the like, by various routes.

The administration method of the pharmaceutical composition may be any method commonly used, for example, oral administration, or intravenous administration, intramuscular administration, subcutaneous administration, intraperitoneal administration, lesion site (eg, muscle increase and / or muscle reduction inhibition) It can be administered by the route of topical administration or parenteral administration such as intraperitoneal injection. In one embodiment, the pharmaceutical composition may be for oral administration, but is not limited thereto.

The pharmaceutical composition may be administered in a pharmaceutically effective amount. The dosage of the pharmaceutical composition is variously prescribed according to factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration interval, administration route, excretion rate, and response sensitivity. can be The dosage may vary depending on the patient's age, weight, sex, dosage form, health condition, and disease level, and may be administered in divided doses once or several times a day at regular time intervals according to the judgment of a doctor or pharmacist. For example, one or daily dose of the pharmaceutical composition is 0.001 to 10000 mg/kg, specifically, 0.01 to 10000 mg/kg, 0.01 to 5000 mg/kg, 0.01 to 10000 mg/kg, based on the solid weight of the active ingredient (excess extract) 3000 mg/kg, 0.01 to 2500 mg/kg, 0.01 to 2000 mg/kg, 0.01 to 1800 mg/kg, 0.1 to 10000 mg/kg, 0.1 to 5000 mg/kg, 0.1 to 3000 mg/kg, 0.1 to 2500 mg/kg, 0.1 to 2000 mg/kg, 0.1 to 1800 mg/kg, 1 to 10000 mg/kg, 1 to 5000 mg/kg, 1 to 3000 mg/kg, 1 to 2500 mg/kg, 1 to 2000 mg /kg, 1 to 1800 mg/kg, 10 to 10000 mg/kg, 10 to 5000 mg/kg, 10 to 3000 mg/kg, 10 to 2500 mg/kg, 10 to 2000 mg/kg, 10 to 1800 mg/kg kg, 100 to 10000 mg/kg, 100 to 5000 mg/kg, 100 to 3000 mg/kg, 100 to 2500 mg/kg, 100 to 2000 mg/kg, or 100 to 1800 mg/kg it's not going to be The single or daily dose may be formulated as one formulation in a unit dose form, formulated in an appropriate amount, or prepared by internalizing in a multi-dose container. The above dosage is an example of an average case, and the dosage may be higher or lower depending on individual differences.

The pharmaceutical composition may be formulated into oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, or parenteral dosage forms in the form of sterile injection solutions, according to conventional methods. have.

In addition to the active ingredients described above, the pharmaceutical composition is generally selected from the group consisting of pharmaceutically and/or physiologically acceptable carriers, excipients, and diluents selected in consideration of administration methods and standard pharmaceutical practice. It may be administered in admixture with one or more adjuvants. For example, the pharmaceutically and/or physiologically acceptable carrier may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil, etc. may be one containing at least one selected from the group consisting of However, it is not limited thereto, and may be any carrier commonly used in the pharmaceutical field.

The pharmaceutically and/or physiologically acceptable diluents and/or excipients are selected from the group consisting of all fillers, bulking agents, binders, wetting agents, disintegrants, lubricants, surfactants, etc. commonly used in the proper formulation of pharmaceutical compositions. There may be more than one type.

For example, in the case of a solid preparation for oral administration such as tablets, pills, powders, granules, or capsules, the excipient is at least one or more materials for formulating the solid preparation, such as starch, calcium carbonate , sucrose (Sucrose), lactose (Lactose), may be at least one selected from the group consisting of gelatin. In addition, lubricants such as magnesium stearate talc and the like may also be used. In addition, in the case of formulation of liquid formulations for oral administration, such as suspensions, internal solutions, emulsions, and syrups, at least one selected from the group consisting of water, liquid paraffin, etc., which are commonly used simple diluents, may be used, and in addition , various commonly used excipients, for example, wetting agents, sweetening agents, fragrances, and/or preservatives may be included, but are not limited thereto.

For example, the pharmaceutical composition may be administered orally or orally in the form of a tablet containing starch or lactose, or in the form of a capsule containing an appropriate excipient, or in the form of an elixir or suspension containing a flavoring or coloring chemical. It may be administered intranasally or sublingually. Such liquid formulations may contain suspending agents (eg, methylcellulose, semisynthetic glycerides such as Witepsol or a mixture of Apricot kernel oil and PEG-6 esters or PEG-8 and caprylic/capric It may be formulated with a pharmaceutically acceptable excipient, such as a mixture of glycerides, such as a mixture of glycerides, but is not limited thereto.

In the food composition provided herein, the term "food" means an edible natural product or processed product containing one or more nutrients, and in a conventional sense, various general foods, health functional foods, beverages, food additives, and It may be used to mean one or more selected from the group consisting of beverage additives and the like. The term “food composition” may refer to a combination of ingredients for preparing the food.

The content of the herbal ingredient in the food composition may be appropriately adjusted depending on the type of food used, the purpose, etc., for example, 0.00001 to 99.9 wt%, 0.0001 to 99.9 wt%, 0.001 to 99.9 wt%, or 0.001 to 0.001 to 99.9 wt% based on the solids weight It may be 50% by weight, but is not limited thereto.

In the present specification, the 'subject' to which the herbal active ingredient is administered is a mammal including humans and primates such as monkeys, rodents such as mice, rats and rabbits, dogs, cats, cattle, pigs, sheep, horses, goats, etc. , an organism selected from vertebrates, such as birds, including chickens, ducks, geese, and reptiles, amphibians, and fish including snakes, lizards, turtles, and crocodiles, cells, tissues, or cell cultures isolated from the individual etc.

As used herein, 'muscle increase' may mean that the mass, volume, and/or density of skeletal muscle cells or skeletal muscle is increased compared to before administration of Amomum Tsaoko extract.

As used herein, the term 'muscle cell' is a generic term for cells constituting the muscles of mammals including humans, and may refer to myocytes, myotubes or myotubes, muscle fibers, or all of them. , 'myocyte differentiation' may refer to the generation of muscle cells (myocytes, myotubes, and/or myofibers) from myoblasts or a series of processes accompanying it.

The medium composition for muscle cell differentiation provided herein may be one in which an extract of Amomum Tsaoko is additionally added to a conventionally used medium for muscle cell differentiation. The amount of the excess (Amomum Tsaoko) extract added may be 0.1 to 90% by weight, 0.1 to 75% by weight, 0.1 to 50% by weight, or 0.1 to 25% by weight, based on the total weight of the medium, but is not limited thereto.

As described above, the pharmaceutical composition and food composition comprising the Amomum Tsaoko extract provided herein promote muscle differentiation and thus can be effectively applied to the prevention, treatment, and/or improvement of pathological conditions related to muscle loss. have.

1 is a photomicrograph showing the differentiation effect of C2C12 cells of an ethanol extract of excess fruit.
2 is a result showing the results of western blot tests for the degree of phosphorylation of AKT and mTOR according to the ethanol concentration (100%, 70%) in the treatment of excess fruit ethanol extract.
3 is a graph showing the relative value of the cell proliferation degree (100%) of the control group (untreated group) for the degree of proliferation of C2C12 cells when treated with extracts and hot water extracts by ethanol concentration (100%, 70%, 50%). .
Figure 4 is a graph showing the effect of the excess 70% ethanol extract and hot water extract on PGC-1α, GLUT-4, Creatine kinase, and ATP.
5 is a fluorescence image showing cells by immunostaining technique using MHC when treated with excess hot water extract.
6 is a graph showing differentiation/regeneration and fusion index by measuring the number and diameter of nuclei per myotube of cells treated with excess hot water extract.
7 is a graph showing the level of mitochondrial reactive oxygen species (ROS) in excess hot water extract treatment.
8 shows body weight (left), body weight change (middle), and anterior tibialis anterior (TA muscle weight (mg)/body weight) when excess hot water extract is administered (CTX+excess) to mice (CTX) induced muscle damage by cardiotoxin administration. (g) (TA/BW) (right) is a graph showing comparison of a group administered with water to a normal mouse (NC) and a group administered with water to a CTX mouse (CTX+ NC).
9 is a graph showing the creatine kinase (CK) activity present in the serum of muscle-injured mice administered with excess hot water extract compared to the water-administered group.
10 is a graph showing the energy supply/recovery-related gene expression level of muscle-injured mice administered with excess hot water extract compared to the water-administered group.
11 is a graph showing quantified results showing energy supply/recovery-related protein expression in muscle-injured mice administered with excess hot water extract.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1. Preparation of excess extract

1.1. Preparation of Excess Ethanol Extract

The fruit of Amomum Tsaoko is prepared as dried (purchased at Gyeongdong Market), and after grinding, 10 times the volume of alcohol (98% to 100% (v /v) ethanol; hereinafter referred to as “100% (v/v) ethanol”), 70% (v/v) ethanol, or 50% (v/v) ethanol is added and reflux extraction method is performed at 70 to 80° C. for 5 hours , to prepare 100% (v/v) ethanol extract, 70% (v/v) ethanol extract, and 50% (v/v) ethanol extract, which are ethanol extracts of excess fruit, respectively, and concentrated under reduced pressure and frozen A sample of the powder was prepared by forging (hereinafter referred to as “100% (v/v) ethanol extract”, “70% (v/v) ethanol extract”, and “50% (v/v) ethanol extract”, respectively. being).

1.2. Preparation of excess water extract (hot water extract)

The fruits of Amomum Tsaoko are prepared as dried (purchased at Gyeongdong Market), and then pulverized, using 10 times the volume of water based on the weight of the excess fruits to the crushed dried excess fruits at 90 to 100° C. Extracted by reflux extraction for 5 hours to prepare an excess hot water extract.

Example 2. Myocyte differentiation test

The effect on myocyte differentiation was tested using the excess ethanol extract (100% (v/v) ethanol extract) extracted by reflux extraction in Example 1.1.

Specifically, the C2C12 cell line was added to 200 ul of a culture medium prepared by adding the extract in an amount of 50 ug/ml to a differentiation medium (Differentiation media; DM; DMEM (Gibco), 1% Penicillin/streptomycin, 2% horse serum (HS)). (ATCC® CRL-1772 ^TM ) was inoculated in an amount of 1*10 ⁴ cells/96well, incubated for 24 to 72 hours at 37°C and 5% CO2 conditions, and the nucleus of the cells was observed under a microscope at 72 hours. Three or more overlapping parts were observed. For comparison, without the addition of the sample, growth media (Growth media; GM; DMEM (Gibco), 1% Penicillin/streptomycin, 10% FBS) or differentiation media (Differentiation media; DM; DMEM (Gibco), 1% Penicillin/ The same test was performed using only streptomycin, 2% HS).

The results observed under the microscope are shown in FIG. 1 . As shown in FIG. 1 , when an excess of 100% (v/v) ethanol extract was added to the DM medium, compared to the case where GM or DM was used alone, a significant increase in myocyte differentiation was exhibited.

Example 3. Myocyte increase-related AKT and mTOR activation (phosphorylation) test

In order to confirm the mechanism related to the myocyte-increasing effect, the excess ethanol extract (100% (v/v) ethanol extract and 70% (v/v) extract) extracted by reflux extraction in Example 1.1 was used in a serum-free medium (Serum free). media; SM) or differentiation media (DM) in an amount of 50 ug/ml, respectively, and AKT and mTOR activation (phosphorylation) effects were tested by western blot.

Specifically, serum free media (SM; DMEM (Gibco), 1% Penicillin/streptomycin) and differentiation media (Differentiation media; DM; DMEM (Gibco), 1% Penicillin/streptomycin, 2% HS) C2C12 cell line (ATCC® CRL-1772 ^TM ) in 10 ml of culture medium prepared by adding ethanol extract (100% (v/v) ethanol) in an amount of 50 ug/ml to 80% confluence in a 100 mm dish, and inoculated at 37 ° C. and 5% CO2 incubated for 24 hours, and Western blot was performed using an anti-p-AKT antibody and an anti-p-mTOR antibody (Cell signaling, USA) to measure p-AKT and p-mTOR, respectively. did.

For comparison, without the addition of the sample, serum free media (SM; DMEM (Gibco), 1% Penicillin/streptomycin) or Differentiation media (DM; DMEM (Gibco), 1% Penicillin/streptomycin, The same test was performed using 2% HS). The obtained Western blot results are shown in FIG. 2 and Table 1.

Samples
signal unit 100% 70% Serum-free medium (SM) Differentiation medium (DM) SM DM p-AKT (S473) + + ++ +++ p-mTOR (S2448) + + ++ ++

(The number of '+' indicates the depth (signal intensity) of the bands of p-AKT (S473) and p-mTOR (S2448) shown in FIG. 2)

As confirmed in the results of Figure 2 and Table 1, both the excess 100% (v/v) ethanol extract and 70% (v/v) ethanol extract were p-AKT and p- in both differentiation medium and serum-free medium. It was confirmed that the activation effect of mTOR was excellent.

Example 4. Myocyte proliferation test

Myocyte proliferation effect of excess ethanol extract (100% (v/v) ethanol extract, 70% (v/v) ethanol extract, 50% (v/v) ethanol extract) and hot water extract prepared in Examples 1.1 and 1.2 above was tested.

Serum free media (SM; DMEM (Gibco) 1% Penicillin/streptomycin) C2C12 cell line (ATCC® CRL-1772 ^TM ) in 200 ul of culture medium prepared by adding the extract in an amount of 50 ug/ml, respectively Inoculated in an amount of 1*10 ⁴ cells/96well, cultured at 37°C and 5% CO2 conditions for 24 hours, and MTT assay was performed at 24 hours to measure the degree of cell proliferation. For comparison, the same test was performed by culturing the C2C12 cell line in the same manner in the serum-free medium to which the sample was not treated (untreated group; denoted as SM).

As described above, the MTT assay was performed on the cell culture, and the results obtained by measuring the proliferation degree of C2C12 cells are shown in FIG. 3 . 3 is an excess ethanol extract, 100% (v/v) ethanol extract (100% EtOH), 70% (v/v) ethanol extract (70% EtOH), 50% (v/v) ethanol extract (50% EtOH) ), and to show the cell proliferation effect of the hot water extract (water), all of the above four types of excess extract showed a superior C2C12 cell proliferation effect compared to the control (SM), and in particular, in the 70% (v/v) ethanol extract The proliferative effect of C2C12 cells was confirmed by about 35%, and more than about 53% in the hot water extract.

Example 5. Test for improving muscle performance

To confirm the muscle motility improvement efficacy of the excess extract, PGC-1α, GLUT-4, Creatine kinase, The effect on ATP was measured by ELISA and Collormetric assay.

Specifically, hot water extract (DW) and excess ethanol extract (70% (v/v) ethanol; EtOH 70%) in differentiation media (Differentiation media; DM; DMEM (Gibco), 1% Penicillin/streptomycin, 2% HS) ) in an amount of 50ug/ml, inoculated the C2C12 cell line (ATCC® CRL-1772 ^TM ) to 80% confluence in a 100mm dish in 10 ml of a culture medium prepared by adding it, and cultured at 37°C and 5% CO2 conditions for 24 hours. , reacted at 37°C for 2 hours or 3 days and myotubes were lysed to PGC-1α (MyBioSource, USA), GLUT-4 (LS-Bio, USA), Creatine kinase (BioVision, USA), and ATP (BioVision, USA) was measured by ELISA and Collormetric assay.

The obtained results are shown in FIG. 4 . As shown in Figure 4, both the excess ethanol extract (EtOH 70%) and the hot water extract, compared to the control group (excess extract untreated group; using only medium), the levels of PGC-1α, GLUT-4, Creatine kinase, and ATP in myocytes was significantly increased, and in particular, the hot water extract showed a higher level of increase compared to the ethanol extract.

Example 6. Myotube differentiation enhancing effect test

To test the myotube differentiation enhancing effect of the excess extract, the C2C12 cell line treated with 5 ug/ml of the excess extract was subjected to immunostaining using an anti-MHC antibody.

Specifically, in order to investigate the myotube growth enhancing effect of the excess extract, 5 ug/ml of the excess hot water extract prepared in Example 1.2 was treated to induce differentiation of C2C12 myoblasts for 48 hours. The formed C2C12 myotubes were fixed with 4% (v/v) paraformaldehyde, then permeabilized with 0.5% (v/v) Triton X-100, and reacted with MHC antibody for 24 hours. Thereafter, it was fluorescently stained with GFP-conjugated antibody. In addition, nuclei were stained using DAPI (4',6-diamidino-2-phenylindole).

Fig. 5 shows a fluorescence image of the MHC-positive cells obtained as a result of the test observed with a fluorescence microscope, and Fig. 6 shows the distribution of MHC-positive cells according to the number of nuclei in the culture. As can be seen in FIGS. 5 and 6 , when the excess extract was treated, the number of MHC-positive cells increased compared to the control (DMSO treatment) ( FIG. 5 ), and the number of nuclei of 6 or more among MHC-positive cells was The ratio increased significantly ( FIG. 6 ). These results show that the excess extract has the effect of promoting myotube differentiation of C2C12 cells.

Example 7. Test for enhancing mitochondrial function

In order to confirm the mitochondrial function enhancing effect of the excess extract, mitochondrial reactive oxygen species (ROS) levels were measured.

Specifically, the level of mitochondrial active oxygen during the treatment of excess extract was measured by the Mito Tracker ^® red test method. After inducing differentiation of C2C12 myoblasts by treating the excess hot water extract prepared in Example 1.2 at an amount of 5ug/ml, 100nM MitoTracker Red (Invitrogen, USA) was reacted with C2C12 myotubes at 37°C for 30 minutes, and myotubes were lysed by fluorescence spectrometer was measured with

The measured levels of mitochondrial reactive oxygen species are shown in FIG. 7 . 7 shows the level of mitochondrial reactive oxygen species when treated with excess extract as a relative value to the control group (DMSO treated group). As shown in Figure 7, it can be confirmed that when the excess extract is treated, the mitochondrial active oxygen level is significantly reduced compared to the control. These results show that the excess extract has antioxidant activity against mitochondria and can contribute to functional enhancement.

Example 8. Excess extract in vivo effectiveness test

8.1. Preparation of Muscle Injury Mouse Model and Design of Excess Extract Dosing Trial

In order to confirm the muscle-increasing effect of the excess extract in vivo, the test was designed as follows.

First, a solution of 10uM cardiotoxin (CTX) in C57BL/6 mice is inserted into the Tibialis anterior muscle (TA muscle) at an angle of 10-20° to a depth of 2/3mm and 20ul is injected. The same amount of PBS was administered to the no-injury group.

The excess hot water extract prepared in Example 1.2 was administered with negative water for 21 days, and the water was changed once every two days. The excess hot water extract was diluted to a concentration of 2 ug/ml, and negatively administered at a dose of 1.6 to 2.8 mg/kg.

The following test was conducted by dividing the mice into three groups as follows:

a) No injury + Water (NC) (normal water administration group; 5 animals)

Normal mice (no CTX damage) were negatively administered for 21 days;

b) CTX injury + Water (CTX+NC) (muscle injury water administration group; 5 animals)

a group administered with CTX to mice that induced muscle damage for 21 days;

c) CTX injury + excess extract (CTX + excess) (extract muscle injury excess extract group; 5 mice)

A group in which 2ug/ml of excess hot water extract was negatively administered to mice inducing muscle damage by administration of CTX for 21 days.

8.2. Weight and muscle weighing

The body weight (day 0 and day 21) of the mice prepared in Example 8.1 was measured, and the change in body weight (body weight on day 21 - body weight on day 0) was calculated.

In addition, the weight of the anterior tibialis muscle of the mouse was measured with a scale on the 21st day after administration of water or excess extract, and TA muscle weight (mg)/body weight (g) (TA/BW) was calculated.

In addition, in order to measure the weight of the anterior tibialis anterior muscle (TA muscle) of the mouse on the 21st day after administration of water or excess extract, the skin of the mouse was cut and the muscle was exposed to remove the fascia and then only the TA muscle was removed. . Weight measurement of the removed anterior tibialis muscle was performed by calculating weight (mg)/weight (g) (TA/BW).

The obtained results are shown in FIG. 8 . As can be seen in FIG. 8 , the body weight of the muscle damage excess extract administration group increased compared to the normal water administration group, and unlike the muscle damage water administration group, the body weight change in the muscle damage excess extract administration group was not significant. In addition, the TA/BW value of the muscle-damaged extract-administered group was significantly increased compared to the normal water-administered group and the muscle-damaged water-administered group. These results show that the muscle gain per unit body weight in the muscle-damaged excess extract group is higher than that of the normal water-administered group and the muscle-damaged water-administered group, which supports the in vivo muscle-increasing effect of the excess extract.

8.3. Test on the improvement effect of excess extract on muscle fatigue

By measuring the activity of creatine kinase (CK) in the normal water administration group, the muscle damage water administration group, and the muscle damage excess extract administration group prepared in Example 8.1, the effect of improving muscle fatigue according to the excess extract administration was confirmed.

Specifically, (on the 21st day, in order to measure the CK activity (abcam, USA) present in the serum isolated from the blood of the mouse, the OD value was measured every minute by enzymatic assay, for a total of 15 minutes.

The obtained results are shown in FIG. 9 . As can be seen in FIG. 9 , the creatine kinase activity of the muscle-damaged extract-administered group was significantly lower than that of the normal water-administered group and the muscle-damaged water-administered group. Since creatine kinase activity is a representative marker that can confirm muscle fatigue, the above results demonstrate the effect of improving muscle fatigue of the excess extract.

8.4. Exercise performance improvement effect of excess extract

8.4.1. Measuring levels of energy supply/recovery related markers

The expression level at the gene level and the concentration at the protein level of the energy supply and recovery related markers in the mice prepared in Example 8.1 were measured.

qPCR analysis

Energy supply and recovery-related gene expression levels in the mice prepared in Example 8.1 were measured. PGC1α, GLUT4, and PPARγ were used as the energy supply and recovery-related genes, and gene expression levels were measured by qPCR analysis.

Specifically, the RNA of the TA miscle tissue obtained in Example 8.2 was extracted using the QIAzol Lysis reagent RNeasy Lipid Tissue Mini Kit (Qiagen, USA), and 1 μg RNA was prepared with oligo-dT (oligo-dT) and superscript Ⅱ reverse transcriptase. (Invitrogen, USA) for cDNA synthesis. The gene expression of the synthesized 1000ng cDNA was compared through quantitative real-time PCR amplification. Data were obtained using a comparative-cycle threshold method and expressed as a fold change, and beta-actin was used as a control in the comparative CT method. The primers used in the qPCR are summarized in Table 2 below.

primer sequence (5'->3') SEQ ID NO. PGC1alpha_F ACTGAGCTACCCTTGGGATG One PGC1alpha_R TAAGAATTTCGGTGGTGACA 2 GLUT4_F GTGACTGGAACACTGGTCCTA 3 GLUT4_R CCAGCCACGTTGCATTGTAG 4 PPARgamma_F GGGCTGAGGAGAAGTCACAC 5 PPARgamma_R TCAGTGGTTCACCGCTTCTT 6 beta-actin_F GGATCCCCGCCCTAGGCACCAGGGT 7 beta-actin_R GGAATTCGGCTGGGGTGTTGAAGGTCTCAAA 8

The expression levels (mRNA levels) of the obtained PGC1α (PGC1alpha), GLUT4, and PPARγ (PPARgamma) are shown in FIG. 10 as relative values to the normal water administration group. As can be seen in FIG. 10 , the expression levels of PGC1α, GLUT4, and PPARγ in the muscle damage excess extract administration group were significantly higher than in the normal water administration group and the muscle damage water administration group. These results show that the excess extract has the effect of increasing the in vivo mRNA levels of energy supply and recovery related genes.

Western blot analysis

Energy supply and recovery-related protein concentrations in mice prepared in Example 8.1 were measured. As the energy supply and recovery-related protein, PGC1α (Millipore, USA) was used, and the protein concentration was measured by Western blot.

Specifically, Tissue protein extraction, (Thermo, USA) was added to the TA miscle tissue obtained in Example 8.2, and the tissue was pulverized using a tissue lyser (Qiagen). After stabilization for 10 minutes and centrifugation at 14000 rpm for 10 minutes, the supernatant was obtained, western blotted using an anti-PGC1α antibody, and protein quantified.

The results obtained by quantifying the Western blot are shown in FIG. 11 . As can be seen in FIG. 11 , the protein concentration related to energy supply and recovery in the muscle damage excess extract administration group was significantly higher than in the normal water administration group and the muscle damage water administration group. These results show that the excess extract has the effect of increasing the in vivo concentration of energy supply and recovery related proteins.

<110> KOREAN DRUG CO., LTD. <120> COMPOSITION FOR PREVENTING, AMELIORATING, OR TREATING DISEASE ASSOCIATED WITH MUSCLE LOSS, COMPRISING EXTRACT OF AMOMUM TSAOKO <130> OPP20203096KR <150> 10-2019-0100471 <151> 2019-08-16 <160> 8 <170> enPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PGC1alpha_F <400> 1 actgagctac ccttgggatg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PGC1alpha_R <400> 2 taagaatttc ggtggtgaca 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GLUT4_F <400> 3 gtgactggaa cactggtcct a 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GLUT4_R <400> 4 ccagccacgt tgcattgtag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPARgamma_F <400> 5 gggctgagga gaagtcacac 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPARgamma_R <400> 6 tcagtggttc accgcttctt 20 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_F <400> 7 ggatccccgc cctaggcacc agggt 25 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_R <400> 8 ggaattcggc tggggtgttg aaggtctcaa a 31

Claims (13)

A pharmaceutical composition for the prevention or treatment of muscle loss-related diseases, comprising an extract of Amomum Tsaoko as an active ingredient. The pharmaceutical composition according to claim 1, wherein the excess extract is obtained by extracting the excess fruit with water, a straight or branched chain alcohol having 1 to 4 carbon atoms, or a mixture thereof. The pharmaceutical composition according to claim 2, wherein the excess extract is an extract of excess fruit with water or 50-100% (v/v) ethanol. The pharmaceutical composition according to any one of claims 1 to 3, wherein the muscle loss-related disease is at least one selected from the group consisting of sarcopenia, muscular atrophy, muscular dystrophy, atonia, and myasthenia gravis. Excess ( Amomum Tsaoko ) Food composition for the prevention or improvement of muscle loss-related diseases comprising an extract as an active ingredient. Excess ( Amomum Tsaoko ) A food composition for increasing muscle, comprising an extract as an active ingredient. Excess ( Amomum Tsaoko ) A food composition for improving muscle fatigue, comprising an extract as an active ingredient. Excess ( Amomum Tsaoko ) A food composition for improving muscle performance, comprising an extract as an active ingredient. The food composition according to any one of claims 5 to 8, wherein the excess extract is extracted from excess fruit with water, a straight or branched chain alcohol having 1 to 4 carbon atoms, or a mixture thereof. The food composition according to claim 9, wherein the excess extract is the excess fruit extracted with water or 50-100% (v/v) ethanol. According to claim 5, wherein the muscle loss-related disease is at least one selected from the group consisting of sarcopenia, muscular atrophy, muscular dystrophy, atonia, and myasthenia gravis, a food composition. A medium composition for muscle cell differentiation comprising extract from Amomum Tsaoko fruit. A method for differentiating myocytes, comprising culturing the isolated myoblasts with an extract of Amomum Tsaoko fruit.

Images