KR102228397B1 - Primer set for diagnosing zika virus and method of diagnosing zika virus using the same - Google Patents

Abstract

The present invention relates to a Zika virus diagnostic primer and probe set, and a Zika virus diagnostic method using the same.

Description

Primer set for Zika virus diagnosis and diagnostic method of Zika virus using the same {PRIMER SET FOR DIAGNOSING ZIKA VIRUS AND METHOD OF DIAGNOSING ZIKA VIRUS USING THE SAME}

The present invention relates to a Zika virus diagnostic primer and probe set prepared in consideration of the evolutionary aspect of Zika virus, and a method for diagnosing Zika virus using the same.

Zika virus (ZIKV) is a single-stranded RNA virus belonging to Flaviviridae , and is known to be the cause of mosquito-borne viral infectious diseases transmitted by Aedes mosquitoes. Egyptian forest mosquito ( Aedes aegypti ) is known to be the main vector, but it is believed that it can also be transmitted by white line forest mosquito (Aedes albopictus). Human-to-human transmission has not yet been accurately identified, but many cases showing the possibility of transmission through blood transfusion or sexual contact have been reported. During Zika virus infection, clinical symptoms such as joint pain, conjunctivitis, and muscle pain occur along with fever, but it is known that about 80% of them are non-expressive infections and the symptoms are mild.

Zika virus was first isolated from a rhesus monkey living in the Zika forest in Uganda in 1947. In 2007, the epidemic was sporadic on the island of Yap, an island of the Federation of Micronesia, and cases were reported in the Polynesia region of France from 2013 to 2014. In addition, after the first human infection case was reported in Brazil in May 2015, the epidemic spread in Latin America, and infections continued to occur. Accordingly, the World Health Organization (WHO) declared a Zika virus emergency on February 1, 2016 based on the abnormal spread of Zika virus.

In particular, despite minor clinical symptoms, the association between the birth of mycrocephaly neonates and the occurrence of Guillain-Bare syndrome due to Zika virus infection has emerged, and it is known as a virus that has become a major public health problem. .

Currently, there are no cases of human infection caused by the Zika virus indigenous to Korea. However, due to the increase in frequent international exchanges, the outbreak of Zika virus infection by foreign inflow can occur at any time. In particular, the fact that the Zika virus outbreak occurred in Southeast Asian countries in 2015 and the fact that white line forest mosquitoes that can mediate the Zika virus live in Korea mean that thorough countermeasures must be prepared in preparation for the Zika virus outbreak.

However, no Zika virus treatment or vaccine has been developed yet, and in particular, it is very necessary to secure diagnostic technology essential for early detection of Zika virus. In such a situation where there is no antiviral treatment or vaccine, rapid and accurate diagnosis can diagnose Zika virus infection and provide important information to quickly cope with it.

Waggoner jj et al. developed a primer and probe set targeting the Zika virus NS2B gene in 2016 and announced the possibility of using it for Zika virus diagnosis (Non-Specific Document 1), and Victor et al. reported various Zika viruses previously reported in 2016. Based on a set of diagnostic primers and probes, a method for overcoming the sensitivity limitation technically was published (Non-Patent Document 2). In addition, the Korean Centers for Disease Control and Prevention (KCDC) developed a primer set capable of diagnosing Zika virus and Japanese encephalitis virus in 2016 (Patent Document 1).

Although several research results have been published as described above, the development of primers and probe sets capable of diagnosing various Zika viruses that are popular in recent years is still required due to higher sensitivity and specificity, no error, and evolutionary advantage There is a situation.

Korean Patent Registration No. 10-1692436

Waggoner JJ et, al., Zika Virus: Diagnostics for an Emerging Pandemic Threat. 2016 Journal clinical microbiology, 54(4):860-7 Corman Victor M et al., Assay optimization for molecular detection of Zika virus. 2016 Bull World Health Organ. 1;94(2):880-892

It is an object of the present invention to provide a set of primers and probes capable of accurately and quickly diagnosing the Zika virus, which is currently prevalent, which is not prevalent and disappeared in the past.

More specifically, sensitivity to Zika viruses with different epidemic years (MR766_1947, IBH30656_1968, PRVABC59_2015, PANAMA_2016, MEX2-81_2016) based on genome big data-based various (NCBI listed 372 nucleotide sequences) Zika virus sequencing analysis. It is to provide a set of primers and probes having and specificity.

Another object of the present invention is to provide a method for diagnosing Zika virus using the primer and probe set.

However, the problem to be solved by the present invention is not limited to the problems mentioned above, and other problems that are not mentioned will be clearly understood by those of ordinary skill in the art from the following description.

According to an embodiment of the present invention, there is provided a composition for diagnosing Zika virus, comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a probe consisting of the nucleotide sequence of SEQ ID NO: 3 do.

According to another embodiment of the present invention, a composition for diagnosing Zika virus comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, and a probe consisting of the nucleotide sequence of SEQ ID NO: 6 Is provided.

According to one side, the probe may have a reporter and a quencher attached thereto.

According to one side, the reporter may be a FAM attached to the 5'end of the probe.

According to one side, the quencher may be BHQ1 attached to the 3'end of the probe.

According to another embodiment of the present invention, a Zika virus diagnostic kit comprising an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, and a probe consisting of a nucleotide sequence of SEQ ID NO: 3 Is provided.

According to another embodiment of the present invention, a Zika virus diagnostic kit comprising an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 4, an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 5, and a probe consisting of a nucleotide sequence of SEQ ID NO: 6 Is provided.

According to one side, the diagnosis may be based on real-time reverse transcription polymerase chain reaction (RT-PCR).

According to another embodiment of the present invention, real-time qRT-PCR is performed using an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a probe consisting of the nucleotide sequence of SEQ ID NO: 3 A method of providing information necessary for diagnosis of Zika virus is provided, including the step of performing.

According to another embodiment of the present invention, real-time qRT-PCR is performed using an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, and a probe consisting of the nucleotide sequence of SEQ ID NO: 6 A method of providing information necessary for diagnosis of Zika virus is provided, including the step of performing.

According to one side, the real-time qRT-PCR may be a TaqMan probe type real-time qRT-PCR.

The primer and probe set of the present invention is produced based on the Zika virus, which is currently infecting and infecting the human body in consideration of the evolution of the Zika virus, so when applied to the actual field, Zika virus genes can be detected with very high sensitivity and specificity. have.

In addition, all Zika virus genes reported from 1947 to 2017 can be detected equally, and it can exhibit superior detection sensitivity and specificity compared to existing diagnostic kits developed without considering the evolution of Zika virus.

The effects of the present invention are not limited to the above effects, and should be understood to include all effects that can be deduced from the configuration of the invention described in the detailed description or claims of the present invention.

1A shows that 372 Zika virus cDNA nucleotide sequences were extracted from Genbank and then sorted to select primers and probes.
1B is a result of the evolution of Zika virus derived through a molecular tree (phylogenetic tree).
2A is a diagram showing the detection limit values of genetic diagnosis for five different Zika viruses using the primer and probe set of the present invention through one-step RT-PCR.
Figure 2b shows the detection limit values of genetic diagnosis for five different Zika viruses through one-step RT-PCR using a set of primers and probes selected as a positive control group.
FIG. 3 is a one-step RT-PCR showing genetic diagnostic detection limits for five different Zika viruses using the primer and probe set of the present invention and the positive control primer and probe set.
Figure 4 is a comparison of the Zika virus detection specificity through the results of real-time one-step qRT-PCR using the primer and probe set of the present invention and the positive control primer and probe set.

Hereinafter, embodiments will be described in detail with reference to the accompanying drawings. The same reference numerals shown in each drawing indicate the same members.

Various changes may be made to the embodiments described below. The embodiments described below are not intended to be limited to the embodiments, and should be understood to include all changes, equivalents, and substitutes thereto.

The terms used in the examples are used only to describe specific embodiments, and are not intended to limit the embodiments. Singular expressions include plural expressions unless the context clearly indicates otherwise. In the present specification, terms such as "comprise" or "have" are intended to designate the presence of features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, but one or more other features. It is to be understood that the presence or addition of elements, numbers, steps, actions, components, parts, or combinations thereof, does not preclude in advance the possibility of the presence or addition.

Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which the embodiment belongs. Terms as defined in a commonly used dictionary should be interpreted as having a meaning consistent with the meaning in the context of the related technology, and should not be interpreted as an ideal or excessively formal meaning unless explicitly defined in the present application. Does not.

In addition, in the description with reference to the accompanying drawings, the same reference numerals are assigned to the same components regardless of the reference numerals, and redundant descriptions thereof will be omitted. In describing the embodiments, when it is determined that a detailed description of related known technologies may unnecessarily obscure the subject matter of the embodiments, the detailed description thereof will be omitted.

The present inventors extracted all 372 Zika virus cDNA sequences listed in Genebank, a public database, and aligned through the Lasergene 7.0 (DNAstar) program, and then envelop (Env) genes showing the least nucleotide sequence mutations. And nonstructural 1 (NS1) genes were selected as target genes, and by analyzing well-preserved nucleotide sequence positions without mutations in each gene, primers and probes capable of specifically detecting only the Zika virus gene were produced. Example 1).

Accordingly, according to an embodiment of the present invention, a composition for diagnosing Zika virus comprising an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, and a probe consisting of a nucleotide sequence of SEQ ID NO: 3 Is provided.

In addition, according to another embodiment of the present invention, for diagnosis of Zika virus, including an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, and a probe consisting of the nucleotide sequence of SEQ ID NO: 6 A composition is provided.

The composition for diagnosing Zika virus of the present invention may detect Zika virus using a real-time reverse transcription polymerase chain reaction or a general reverse transcription polymerase chain reaction. In the real-time reverse transcription polymerase chain reaction, the reaction result is monitored in real time by using an oligonucleotide probe in which a primer and a fluorescent substance are chemically bound. In the process of polymerase chain reaction, the probe binds to the complementary sequence in the sample's nucleic acid, just like the two primers, and the position is a little away from the primer.

The probe may have a structure in which a reporter and a fluorescent substance called a quencher are attached at both ends, and in this case, if the reporter and the quencher are present in close proximity, the fluorescence of the reporter is canceled and the fluorescence of the reporter is not detected, but amplification As this progresses, when the reporter is separated from the quencher, the reporter's fluorescence is detected. Therefore, the intensity of fluorescence gradually increases as the amplification cycle increases. The reporter may be FAM attached to the 5'end of the probe, and the quencher may be BHQ1 attached to the 3'end of the probe.

According to another embodiment of the present invention, a Zika virus diagnostic kit comprising an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, and a probe consisting of a nucleotide sequence of SEQ ID NO: 3 Is provided.

According to another embodiment of the present invention, a Zika virus diagnostic kit comprising an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 4, an oligonucleotide consisting of a nucleotide sequence of SEQ ID NO: 5, and a probe consisting of a nucleotide sequence of SEQ ID NO: 6 Is provided.

The kit may additionally include an amplification buffer solution, dNTP, control, detection reagent, etc. in addition to the primer and probe set of the present invention, and may be provided in a liquid or dry type, and only when there is no effect on the reaction for the purpose. Additional ingredients may be included accordingly. On the other hand, the kit provided in a dry state can be used for a long period of time due to improved storage stability, and has a significant result with the cultivation method, so that accurate results can be obtained within a faster time.

According to another embodiment of the present invention, real-time qRT-PCR is performed using an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a probe consisting of the nucleotide sequence of SEQ ID NO: 3 A method of providing information necessary for diagnosis of Zika virus is provided, including the step of performing.

According to another embodiment of the present invention, real-time qRT-PCR is performed using an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, and a probe consisting of the nucleotide sequence of SEQ ID NO: 6 A method of providing information necessary for diagnosis of Zika virus is provided, including the step of performing.

The real-time qRT-PCR may be a TaqMan probe type real-time qRT-PCR. When the probe consisting of the nucleotide sequence of SEQ ID NO: 3 and the probe consisting of the nucleotide sequence of SEQ ID NO: 6 are used as a TaqMan probe, a reporter and a quencher at the 5'end and the 3'end, respectively, as described above. It is possible to use a fluorescent substance attached thereto. Specifically, the reporter may be FAM attached to the 5'end of the probe, and the quencher may be BHQ1 attached to the 3'end of the probe.

Hereinafter, the experimental materials and methods used in the examples of the present invention will be described in detail. However, the following examples are merely illustrative of the content of the present invention, and the scope of the invention is not limited by the examples.

Example One: Zika virus For diagnosis primer And Probe making

After extracting all the 372 Zika virus cDNA sequences listed in Genbank, a public database, and aligning them through the Largergene v7.0 (DNAstar, USA) program, the envelop (Env) showing the least nucleotide sequence variation. The gene and the nonstructural 1 (NS1) gene were selected as target genes.

Finally, the nucleotide sequence positions of 372 Zika virus Env genes and NS1 genes according to the separation year (1947 to 2017) were analyzed. As a primer for RT-PCR that can specifically detect Zika virus, nt2293 to nt2405 were selected among the Zika virus envelope gene regions, and nt2467 to nt2609 regions were selected for the NS1 gene. The sizes of the final products of RT-PCR using these primers were 112 bp and 138 bp, respectively, and the sequences of specific primers and probe sets are shown in Table 1 below.

Sequence number name Base sequence (5'-3) location Usage One ZIKV-Env_2293F TTTGGAGCRGCYTTCAAATCA 2293-2313 Forward primer 2 ZIKV-Env_2381R AGGGARATRGATCCATTCTTTGTGT 2405-2381 Reverse primer 3 ZIKV-Env_2316 probe TGTTTGGAGGAATGTCCTGGTTCTCACA 2316-2343 Probe 4 ZIKV-NS1_2467F GGGTGYTCRGTGGACTTCTC 2467-2486 Forward primer 5 ZIKV-NS1_2609R CARGCYTGCTTGACTGCTGCTGC 2609-2587 Reverse primer 6 ZIKV-NS1_2552 probe GGTACAAGTACCATCCTGACTCCCC 2552-2576 Probe

* In the base sequence, R means A or G.

* In the base sequence, Y means C or T/U.

Example 2: Zika virus Analysis of evolutionary patterns

Five different Zika viruses were selected to perform diagnostic performance evaluation for Zika virus using the primer set and probe prepared in Example 1 above. Virus selection is carried out by analyzing the number of molecular lines that can confirm the genetic evolution pattern using the Bayesian Evolution Analysis Sampling Tree (BEAST) program (Fig. 1b), and then the Zika finally selected in consideration of the year of virus isolation, host, and region of isolation. Viruses are as shown in Table 2 below.

Example 3: Positive control to be used in performance evaluation primer And Probe making

In order to prepare primers and probes that can be used as positive controls, information on primers and probes was prepared by referring to Non-Patent Document 1 (Waggoner JJ et, al.) and Patent Document 1 (Korean Patent Registration No. 10-1692436). , The specific nucleotide sequence is shown in Table 3.

On the other hand, the positive control primer is a primer for RT-PCR, targeting nt9527 to nt9691 of the NS5 gene site of Zika virus and nt4533 to nt4624 of the NS2B gene site. The gene sizes of the final products by each of these RT-PCRs were 164 bp and 91 bp.

Sequence number name Base sequence (5'-3) location Usage 7 ZIKV-NS5_PC1_9527F ATGGARGCTGAGGARGT 9527-9543 Forward primer 8 ZIKV-NS5_PC1_9691R RGCRTGTGCAAACCTATCA 9691-9673 Reverse primer 9 ZIKV-NS5_PC1_9680 probe ACCTATCATCAATTGGCTTCACAACGC 9680-9654 Probe 10 ZIKV_NS2b_PC2_4533F CTGTGGCATGAACCCAATAG 4533-4553 Forward primer 11 ZIKV_NS2b_PC2_4624R ATCCCATAGAGCACCACTCC 4624-4604 Reverse primer 12 ZIKV_NS2b_PC2_4578 probe CCACGCTCCAGCTGCAAAGG 2552-2576 Probe

*FAM is attached to the 5'end of the probe and BHQ1 is attached to the 3'end.

* In the base sequence, R means A or G.

Example 4: One-step RT- PCR Used for diagnosis Of the primer Detection limit measurement

Using the primer prepared in Example 1, one-step RT-PCR was performed in the following manner.

For One-step RT-PCR, 5x Hipi RT-PCR master premix 4 ul (Lpis Biotech, EBT-1101), forward primer 1ul (10pmol/ul), reverse primer 1ul (10pmol/ul), nuclease in a PCR reaction tube After adding 9ul of free water and 5ul of RNA extracted from each Zika virus and mixing well ^{, a PCR reaction tube was put into a gene amplifier (Proflex TM} 3, Applied Biosystems, USA) and the reaction was carried out. ^{Preparation of each RNA sample was diluted to 5x10 5} PFU/ml using a cell culture solution of 5 kinds of Zika virus (MR766, PRVABC59, IBH30656, MEX2-81, PANAMA) to measure the lowest detection limit, and then 10 times each. After step dilution, 200ul was taken (1x10 ⁵ ~ 0.1PFU/ml), and 50ul of RNA was extracted using a Qiagen viral RNA mini kit (QIAGEN, USA). The sample prepared with the above composition was placed in a gene amplifier and placed in a PCR reaction tube and left to stand at 50° C. for 30 minutes. In this process, after inducing a reverse transcription reaction in which cDNA is synthesized using RNA as a template, it is allowed to stand at 95°C for 15 minutes to activate the polymerase (pfu polymerase).

After that, the reaction was carried out under conditions of 95°C for 15 seconds, 58°C for 45 seconds, and 72°C for 45 seconds, and PCR was repeated 45 times. After that, it is allowed to stand for 5 minutes at 72°C. The sample for which RT-PCR was completed in this way was subjected to electrophoresis in 2% agarose gel at 20 ul to determine the result. As a result, as shown in Figs. 2a and 2b, as a whole, one-step RT-PCR detection limit values for 5 types of Zika virus were variously confirmed.

First, looking at the results of Figure 2a, in the case of a primer set consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 (hereinafter,'primer set 1'), MR766 virus is 10 PFU/ml, PRVABC59 ^{virus is 10 2 PFU/ml, IBH30656} It was confirmed that the virus can detect up to 10 ^{PFU/ml, the MEX2-81 virus up to 10 2} PFU/ml, and the PANAMA virus up to 10 ² PFU/ml.

Even in the case of a primer set consisting of the nucleotide sequences of SEQ ID NO: 4 and SEQ ID NO: 5 (hereinafter,'primer set 2'), PANMA virus ^{can detect up to 10 3} PFU/ml of the remaining 4 Zika viruses. It was found that 10 ² PFU/ml can be detected.

On the other hand, as a result of performing one-step RT-PCR with a primer set consisting of the nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8 (hereinafter,'primer set 3') as positive controls, PRVABC59, IBH30656, among 5 Zika viruses, It was confirmed that the MEX2-81 virus can detect up to 10 PFU/ml. In contrast, it was confirmed that the primer set (hereinafter,'primer set 4') consisting of the nucleotide sequence of SEQ ID NO: 10 and SEQ ID NO: 11 can detect up to ^{10 3 PFU/ml of all four Zika viruses except for MR766.} (Fig. 2b).

Example 5: real-time one-step qRT - PCR Lawful Zika virus detection

Real-time one-step qRT-PCR was performed as follows using the primers and probes prepared in Example 1. Using primer set 1 and a probe of SEQ ID NO: 3 (Invention Example 1) and a probe of primer set 2 and SEQ ID NO: 6 (Invention Example 2) so that 5 types of Zika virus genes with different epidemic years can be detected in real time. A real-time one-step qRT-PCR method of the Taqman probe method was performed.

Here, as the one-step qRT-PCR kit, TaqmanTM RNA-to-CTTM one-step kit (Applied biosystemsTM, USA) was used, NFW was used as the negative control group, and the primer set prepared in Example 3 was the positive control group. Using the probe of 3 and SEQ ID NO: 9 (Comparative Example 1) and primer set 4 and the probe of SEQ ID NO: 12 (Comparative Example 2), it was analyzed whether Zika virus gene detection was possible.

For real-time one-step qRT-PCR, 2X master mix 10ul, forward primer 1ul (10pmol/ul), reverse primer 1ul (10pmol/ul), probe 0.5ul (10pmol/ul), 40xRT enzyme 0.5ul ^{, Dilute to 10 4} PFU/ml using 5 different virus cell culture solutions as in Example 3 in 2 ul of NFW, and then add 5 ul of the extracted RNA and mix well. The prepared sample was placed in a gene amplifier (ABI quantstudio 3, applied Biosystems) and allowed to stand at 48° C. for 15 minutes so that a reverse transcription reaction occurred.

In this process, cDNA is synthesized using RNA extracted from virus as a template. After inducing a reverse transcription reaction, it is allowed to stand at 95° C. for 10 minutes to activate the polymerase. Thereafter, standing at 95° C. for 15 seconds and at 59° C. for 1 minute was repeatedly performed 40 times, and whether or not gene amplification was performed in this section was measured as a fluorescence value.

As a result, as shown in Table 4, it was confirmed that the Zika virus gene could not be detected in Comparative Example 1 used as a positive control under the conditions of real-time one-step qRT-PCR.

Ct value Viral RNA
(10 ⁴ PFU) Invention Example 1 Invention Example 2 Comparative Example 1 Comparative Example 2 MR766 25.5 24.0 - 27.6 PRVABC59 24.6 24.2 - 21.8 IBH30656 20.6 21.3 - - MEX2-81 24.8 23.9 - 21.7 PANMA 23.8 24.2 - 21.2

Next, 2X Qrt-PCR master mix 12.5ul, forward primer 1.5ul (10pmol/ul), reverse primer 1.5ul (10pmol/ul) using the method described in Patent Document 1 (Korean Patent Registration No. 10-1692436) , 0.4ul (10pmol/ul) of the probe, 0.4ul of 40xRT enzyme, and 3.1ul of NFW were put in a PCR reaction tube, and retested in the gene amplifier specified above. Specifically, cDNA synthesis was allowed to stand at 45° C. for 10 minutes and then at 95° C. for 10 minutes to activate the polymerase (Taq polymerase). Then, the test conditions were repeated 45 times at 95°C for 15 seconds and 53°C for 45 seconds, and real-time one-step qRT-PCR was performed.

As a result, as in the results shown in Table 4, the primer and probe set of Comparative Example 1 used as a positive control group did not detect the Zika virus gene at all.

Ct value Viral RNA
(10 ⁴ PFU) Invention Example 1 Invention Example 2 Comparative Example 1 Comparative Example 2 MR766 26.5 23.0 - 27.6 PRVABC59 25.6 23.2 - 22.2 IBH30656 20.8 22.3 - - MEX2-81 25.8 22.9 - 21.9 PANMA 24.1 24.3 - 22.2

Therefore, hereinafter, the positive control for measuring the detection limit value of real-time one-step qRT-PCR was subjected to comparative analysis using the primer and probe set of Comparative Example 2.

Example 6: real-time one-step qRT - PCR Used Zika virus Detection limit measurement

A real-time one-step qRT-PCR was performed by the method described in Example 5 to perform comparative analysis on the detection limit of the Zika virus gene.

For real-time one-step qRT-PCR, 2X master mix 10ul, forward primer 1ul (10pmol/ul), reverse primer 1ul (10pmol/ul), probe 0.5ul (10pmol/ul), 40xRT enzyme 0.5 in a PCR reaction tube ul, NFW 2ul and 5 different virus cell cultures were ^{diluted 10 times in steps from 10 5} PFU/ml to 0.1 PFU/ml, and then 5ul of extracted RNA was added and mixed well.

The prepared sample was placed in a gene amplifier (ABI quantstudio 3, applied Biosystems) and allowed to stand at 48° C. for 15 minutes so that a reverse transcription reaction occurred. In this process, cDNA was synthesized using RNA extracted from virus as a template. After inducing a reverse transcription reaction, it was allowed to stand at 95° C. for 10 minutes to activate the polymerase, followed by standing at 95° C. for 15 seconds and at 59° C. for 1 minute, followed by 40 times. In this section, whether or not the gene was amplified was measured by fluorescence value. The results are shown in Table 6, and the standard curve of FIG. 3 was derived based on the result values.

Looking at the results of Table 6, it was confirmed that the primers and probe sets of Inventive Example 1 and Inventive Example 2 can detect up to 10 PFU/ml of Zika virus Env gene site and NS1 gene site through real-time one-step qRT-PCR. Became. On the other hand, in the case of Comparative Example 2, which is a positive control, three different Zika virus genes showed similar detection limit values as in Experimental Examples 1 and 2, but the IBH30656 Zika virus gene isolated in 1968 was not detected. On the other hand, when evaluating the overall coefficient of variation (CV) value, it was found to be less than 5%, confirming that the result was significant.

Example 7: real-time one-step qRT - PCR Use Zika virus Detection specificity analysis

Next, RNA was extracted from the dengue virus serotype 1,2,3,4 of the flavivirus identical to the Zika virus, and the chikungunya virus (S27 strain) of the alpha virus genus for the analysis of the Zika virus detection specificity, and Example 5 Real-time one-step qRT-PCR was performed under the same test conditions as specified in. RNA of all viruses was extracted after dilution with a ^{titer of 10 4 PFU/ml.}

As a result, as shown in Fig. 4 and Table 7, when the primers and probe sets of Inventive Examples 1 and 2 were used, only genes of five different Zikavirus species were detected. In contrast, the primer and probe set of Comparative Example 2 was confirmed to have a detection (Ct) value of 36 or more for other flaviviruses, and it was confirmed that the specificity was lower than that of the primers and probe sets of Inventive Examples 1 and 2.

That is, by using the primer and probe set of the present invention, it is possible to detect the genes of various Zika virus that are currently popular through real-time one-step qRT-PCR, and has superior detection sensitivity and specificity compared to the previously reported gene diagnosis technology. Since it has a degree, it is possible to effectively diagnose various types of Zika virus that are currently prevalent.

As described above, although the embodiments have been described by the limited embodiments and drawings, various modifications and variations are possible from the above description to those of ordinary skill in the art. For example, even if the described techniques are performed in a different order from the described method, and/or the described components are combined or combined in a form different from the described method, or are replaced or substituted by other components or equivalents. Appropriate results can be achieved.

Therefore, other implementations, other embodiments, and those equivalent to the claims also fall within the scope of the claims to be described later.

<110> KOREA UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> PRIMER SET FOR DIAGNOSING ZIKA VIRUS AND METHOD OF DIAGNOSING ZIKA VIRUS USING THE SAME <130> APC-2019-0286 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ZIKV-Env_2293F <400> 1 tttggagcrg cyttcaaatc a 21 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ZIKV-Env_2381R <400> 2 agggaratrg atccattctt tgtgt 25 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ZIKV-Env_2316 probe <400> 3 tgtttggagg aatgtcctgg ttctcaca 28 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ZIKV-NS1_2467F <400> 4 gggtgytcrg tggacttctc 20 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ZIKV-NS1_2609R <400> 5 cargcytgct tgactgctgc tgc 23 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ZIKV-NS1_2552 probe <400> 6 ggtacaagta ccatcctgac tcccc 25 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> ZIKV-NS5_PC1_9527F <400> 7 atggargctg aggargt 17 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ZIKV-NS5_PC1_9691R <400> 8 rgcrtgtgca aacctatca 19 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ZIKV-NS5_PC1_9680 probe <400> 9 acctatcatc aattggcttc acaacgc 27 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ZIKV_NS2b_PC2_4533F <400> 10 ctgtggcatg aacccaatag 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ZIKV_NS2b_PC2_4624R <400> 11 atcccataga gcaccactcc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ZIKV_NS2b_PC2_4578 probe <400> 12 ccacgctcca gctgcaaagg 20

Claims (11)

A composition for diagnosing Zika virus comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a probe consisting of the nucleotide sequence of SEQ ID NO: 3.
A composition for diagnosing Zika virus comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, and a probe consisting of the nucleotide sequence of SEQ ID NO: 6.
The method according to claim 1 or 2,
The probe is a reporter and a quencher is attached, Zika virus diagnostic composition.
The method of claim 3,
The reporter is a FAM attached to the 5'end of the probe, Zika virus diagnostic composition.
The method of claim 3,
The quencher is BHQ1 attached to the 3'end of the probe, Zika virus diagnostic composition.
Zika virus diagnostic kit comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a probe consisting of the nucleotide sequence of SEQ ID NO: 3.
Zika virus diagnostic kit comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, and a probe consisting of the nucleotide sequence of SEQ ID NO: 6.
The method according to claim 6 or 7,
The diagnosis is by real-time reverse transcription polymerase chain reaction (RT-PCR), Zika virus diagnostic kit.
Diagnosis of Zika virus, comprising performing real-time qRT-PCR using an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a probe consisting of the nucleotide sequence of SEQ ID NO: 3 How to provide the necessary information.
Diagnosis of Zika virus, comprising performing real-time qRT-PCR using an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, and a probe consisting of the nucleotide sequence of SEQ ID NO: 6 How to provide the necessary information.
The method of claim 9 or 10,
The real-time qRT-PCR is a TaqMan probe type real-time RT-PCR, a method of providing information necessary for diagnosis of Zika virus.

Images