KR102133995B1 - New primer set for detection of MERS-coronavirus using LAMP and uses thereof - Google Patents

Abstract

The present invention relates to a novel primer set for detecting MERS-coronavirus using loop-mediated isothermal amplification (LAMP), and to uses thereof. More particularly, the present invention relates to a primer set for LAMP for amplifying Nsp1 gene and Orf5; a composition for detection, comprising the same; a kit for detection; and a detection method using the same. By using the novel primer set for detection of MERS-coronavirus using LAMP; the composition for detection, comprising the same; the kit for detection; and the detection method using the same, it is possible to extremely simply, easily, and quickly detect MERS-coronavirus directly on the field without costly equipment. Also, due to an extremely high sensitivity, the present invention may be extremely usefully utilized in diagnosing the infection of MERS-coronavirus.

Description

New primer set for detection of MERS-coronavirus using LAMP and use thereof {New primer set for detection of MERS-coronavirus using LAMP and uses thereof}

The present invention relates to a novel primer set for the detection of MERS coronavirus using LAMP and uses thereof, specifically, the Nsp1 gene and Orf5 that enable the MERS corona virus to be specifically and quickly detected with high accuracy. LAMP primer set containing primers for amplifying the gene; A composition for detection comprising it; Detection kit; And a detection method using the same.

MERS-CoV (MERS-CoV) was discovered and reported in 2012 as the causative agent of Middle East Respiratory Syndrome (MERS). In the case of MERS coronavirus infection, there are some asymptomatic or mild acute upper respiratory tract diseases, but most show severe acute lower respiratory tract disease (pneumonia). In particular, the symptoms are severe in the case of underlying diseases (diabetes, kidney failure, chronic lung disease, immunodeficiency disease), and the resulting fatality rate is 20-46%.

Currently, antiviral agents or preventive vaccines against MERS coronavirus have not been developed, and countermeasures focused on preventing infections are being implemented, such as establishing and following the rules for preventing infectious diseases. Since the human-to-human infection of MERS coronavirus consists of propagation by close contact, it can be effective in preventing transmission through quarantine measures when an infected person occurs. However, depending on the condition, it is important to diagnose, quarantine, and treat quickly if a suspicious patient occurs because a super-propagator may occur.

For the diagnosis of MERS coronavirus infection, it is recommended to use the lower respiratory tract sample (sputum, aspirate, washing material) expressing DPP4, the cellular receptor of the virus, as a preferential sample, but also secure the upper respiratory tract sample (throat gauze) as a sample. do. As a test method, serum test methods such as ELISA and IFA and PCR (Polymerase Chain Reaction) or real-time RT-PCR (Reverse Transcription-Polymerase Chain Reaction) gene test methods are mainly used. Among these, the genetic test method is performed by performing a confirmatory test on genes such as Orf1a, Orf1b after the primary test with the UpE or N gene having high sensitivity as a primary target, and further sequencing may be performed.

In addition, PCR, which is the basis of the existing genetic test method, needs to be changed in three temperature stages: denaturation, annealing, and extension, so it takes 2~3 hours to react and realizes the temperature cycle. It is difficult to apply it to various sites because it requires expensive equipment to do so.

Loop-mediated Isothermal Amplification (LAMP) A loop or loop structure (stem loop DNA) at the primer binding site from 4 primers selected by combining 6 parts on a target or target DNA strand As a method of amplifying DNA through chain substitution reaction by using ), Bst polymerase (Bst polymerase) with high strand displace activity can be amplified at a constant temperature without temperature change in three steps, There is no DNA loss and damage due to temperature change, and even if there are DNA strands that interfere with complementary binding, the sample amount can be amplified 10 ⁸ within an hour, and has a fast reaction rate and high specificity. In addition, it is only necessary to maintain a constant temperature, and high field activity without expensive equipment can be diagnosed within 30 minutes to 1 hour.

Accordingly, the present inventors tried to find a new target discovery and diagnosis method using the LAMP method, which can be quickly and accurately diagnose the MERS corona virus at an early stage, and as a result, a non-structure not reported in a previous study. To prepare a new LAMP reaction primer set for amplifying 5'UTR to Nsp1 genes (hereinafter Nsp1) and Orf5 genes, which are proteins (non-structural proteins), and amplifying under reaction conditions using the primer set, The present invention was completed by quickly and accurately confirming the possibility of diagnosis of MERS coronavirus infection.

1. Shirato K. et al. Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP), Virol. J. 11 (2014), pp. 139 2. Miyamoto S. et al. Method for colorimetric detection of double-stranded nucleic acid using leuco triphenylmethane dyes, Anal. Biochem. 473 (2015), pp. 28-33

An object of the present invention is to provide a new primer set for detecting MERS coronavirus using LAMP that can quickly and specifically detect MERS coronavirus in a simple manner.

It is also an object of the present invention to provide a composition for detecting MERS corona virus containing the primer set.

It is also an object of the present invention to provide a kit for detecting MERS corona virus comprising the composition.

It is also an object of the present invention to provide a method for specifically detecting the MERS corona virus using the primer set.

According to one embodiment,

A first primer set consisting of SEQ ID NOs: 1 to 6 for amplifying the Nsp1 gene; And

Provided is a primer set for loop-mediated isothermal amplification (LAMP) reaction for detecting MERS coronavirus consisting of a second primer set consisting of SEQ ID NOs: 7 to 12 for amplifying the Orf5 gene.

According to one side, the LAMP is a primer set comprising a reverse transcription loop-mediated isothermal amplification RT-LAMP.

According to one side, the MERS coronavirus is characterized by at least one selected from the group consisting of GeneBank accession number, JX869059, KF600620, KM015348, KP209307, KT121578, KU308549 and KT374053.

According to one embodiment, a composition for detecting MERS coronavirus comprising the primer set is provided.

According to one side, the composition may further include a LAMP reaction buffer solution containing DNA polymerase, dNTP and Mg ²⁺ ions.

According to one embodiment, a kit for detecting MERS coronavirus including a primer set is provided.

According to one side, the detection kit may further include a LAMP reaction buffer solution containing DNA polymerase, dNTP and Mg ²⁺ ions.

According to one embodiment,

Extracting nucleic acid (RNA) from the sample;

a template preparation step including cDNA synthesis;

Mixing the template and the primer set according to claim 1 or 2 to construct a LAMP reaction solution;

Performing an isothermal amplification reaction at 60°C to 72°C using the LAMP reaction solution;

And confirming the formation of an amplification product according to the LAMP.

According to one side, the LAMP reaction solution may further include a reaction buffer solution containing a DNA polymerase, dNTP and Mg ²⁺ ions.

According to one side, the step of confirming the formation of the amplification product may be performed through DNA chip, gel electrophoresis, capillary electrophoresis, colorimetric method or real-time fluorescence detection.

According to one side, the sample may include, but is not limited to, one or more of sputum, aspirate, throat gauze, wash, whole blood, plasma, urine, sweat, tears, lymph, saliva or nasopharyngeal secretions.

According to one side, the MERS coronavirus is a method of detecting at least one MERS coronavirus selected from the group consisting of GeneBank accession number, JX869059, KF600620, KM015348, KP209307, KT121578, KU308549 and KT374053. to provide.

A novel ring-mediated isothermal amplification (LAMP) primer set for detecting MERS coronavirus according to the present invention, a composition for detecting MERS coronavirus comprising the primer set; Detection kit; And using the detection method using it, it is possible to detect the MERS corona virus very easily and quickly.

In addition, it can be specifically detected with high sensitivity and can be quantified, so that the MERS corona virus can be effectively used for management and diagnosis.

Figure 1 (A) is a diagram showing the target region of the ring-mediated isothermal amplification (LAMP) on the MERS coronavirus genome, the exact target position is 257 bp to 835 bp of the entire non-structured protein region, MERS corona virus genome , 5'UTR ~ Nsp1 gene (hereinafter referred to as Nsp1), Nsp1 gene region, and the Orf5 gene region of 26840 bp to 27514 bp of the entire genome of MERS coronavirus.
(B) shows the detailed structure of each primer set. Each sequence in (B) above corresponds to JX869059, KF600620, KM015348, KP209307, KT121578, KU308549, KT374053 as GeneBank accession numbers from above.
Figure 2 shows the RT-LAMP reaction for the MERS coronavirus RNA template of each primer set, serially diluted by 1/10 in the range of 10 ⁴ to 10 ^-2 templates per reaction. The leftmost Agarose gel is the BioFact 1Kb Plus ladder.
Fig. 3 accurately confirms the RT-LAMP response limit of each primer set by using the indicated number of MERS coronavirus genomes.
4 is a cross-specific comparison of the specificity of each primer set for MERS coronavirus with human coronavirus 229E and OC43. At this time, the number of dielectrics per reaction was 10 ⁶ levels.

The present invention

A first primer set consisting of SEQ ID NOs: 1 to 6 for amplifying the Nsp1 gene; And

Provided is a primer set for loop-mediated isothermal amplification (LAMP) reaction for detecting MERS coronavirus consisting of a second primer set consisting of SEQ ID NOs: 7 to 12 for amplifying the Orf5 gene.

The LAMP includes reverse transcription loop-mediated isothermal amplification RT-LAMP.

As used herein, the term “primer” refers to the genomic RNA of MERS coronavirus as a template on which a nucleic acid polymer is amplified, forms a complementary base pair thereto, binds it, and then causes a LAMP polymerization reaction. Nucleic acid polymer (Oligomer) means.

As used herein, the term “nucleic acid” refers to RNA or DNA molecules or analogs thereof and derivatives thereof comprising one or more nucleotides of any form, including single-stranded or double-stranded oligonucleotides or polynucleotides. The nucleic acid of the MERS corona virus, in which the primer set according to the present application is used, includes RNA derived from the MERS corona virus, for example, all or part of a genome, or DNA corresponding thereto.

As used herein, the term “detection” includes determining whether the MERS corona virus is infected or the prognosis of an infected subject, and whether to relapse after treatment after infection.

The term “target” or “target” as used herein refers to a nucleic acid sequence to which a primer set of the present application binds and is specifically amplified by the primer set according to the present application, and includes RNA or DNA.

The primer set of the present application is a primer set capable of specifically detecting the MERS corona virus by amplifying the Nsp1 gene and the orf5 gene of the MERS corona virus by the LAMP method.

The MERS-CoV virus (MERS-CoV) is a 30,000 Kb positive sense single stranded RNA virus, and the Nsp1 gene is a non-structural protein (Non-) that is involved in the replication and transcription of the MERS-Corona virus. Structural Proteins) 5'UTR to Nsp1 gene (hereinafter referred to as Nsp1), and corresponds to a region of 257 bp to 835 bp of the entire genome. In addition, the Orf5 gene (Open reading frame 5 gene) corresponds to a region of 26840 bp to 27514 bp of the entire genome.

In the present invention, the LAMP primer is composed of six types as follows. FIP (Forward Inner Primer) and BIP (Backward Inner Primer) are the main primers forming the amplification unit (amplicon), and are involved in the initiation of the amplification reaction and the formation of a ring structure. In addition, F3 (Forward 3) and B3 (Backward 3) result in a polymerization reaction in which a polymer made from FIP/BIP primers in the initial template induces strand displacement phenomenon that falls from the template. Loop forward (LF) and loop backward (LB) combine with the ring structure of the amplification unit to form more products.

According to an embodiment of the present invention, Bst polymerase was used as the polymerase. Bst2.0 polymerase, which is easy to control reaction initiation according to temperature developed by NEB, and Bst 3.0 enzyme, which has reactivity to RNA, were mainly used. However, the polymerase used in the LAMP reaction has a strand displacement (stranded object) activity and a polymerization reaction at a temperature (typically between 60°C and 72°C) at which the thermodynamic activity capable of forming a ring structure of the polymer as a reaction product is maintained. It is not limited to Bst polymerase if the two main requirements of being able to cause

The main background technology of the present invention, the LAMP reaction, includes a template, a primer, a polymerase, a buffer solution tailored to the polymerase, dNTP as a polymer unit, and MgSO ₄ that supplies Mg ²⁺ ions that maintain the activity of the polymerase.

The MERS corona virus is an RNA virus. When RNA is to be used as a template in the LAMP method, RT-LAMP can be performed by further including a reverse transcriptase in the LAMP analysis reaction.

Regarding the detection of the amplification reaction, real-time amplification reaction detection using a fluorescent dye, electrophoresis using an Agarose gel, DNA chip, capillary electrophoresis, and colorimetric method for detecting color change of a reaction-specific reaction solution are included, but are not limited thereto.

The above components and primers may be provided as a kit for detecting MERS coronavirus, which is the object of the present invention.

In the embodiment of the present invention, a method for detecting MERS coronavirus is provided for each polymerase, and details can be confirmed through the description of the example. At this time, the amount of the reaction solution, the concentration of dNTP, the concentration of Mg ²⁺ ions, the amount of the enzyme to be used, the selection of the detection method, etc., can be further optimized and the selection of a suitable replacement agent by those skilled in the art. .

In the embodiment of the present invention, the LAMP reaction can be detected by real-time polymerization reaction observation using SYTO9 fluorescent dye, Agarose gel electrophoresis, and LCV (Leuco Crystal Violet) colorimetric method. The LCV colorimetric method consists of 1 x LCV component consisting of 0.1 mM Crystal Violet, 12 mM Sodium Sulfite, and 1 mM β-Cyclodextrin, Miyamoto S. et al. Method for colorimetric detection of double-stranded nucleic acid using leuco triphenylmethane dyes, Anal. Biochem. 473 (2015), pp. Reference may be made to those described in 28-33. In addition, when performing the reaction shown in the examples, a 5 x LCV concentrate can be prepared and diluted directly in a LAMP reaction solution.

The nucleic acid template, which is a sample of the detection method of the present invention, is an RNA genome of MERS coronavirus, and extraction of an RNA sample from a sample can utilize conventional methods in the art. In addition, cDNA (complementary DNA) that has undergone a reverse transcription reaction from the extracted RNA sample can be used as a template.

LAMP primer set provided by the present invention; A composition for detection comprising it; Detection kit; And in the detection method using the same, the technician and the user can select a detailed process of preparing the reaction solution, temperature control, and the type of detection equipment. For example, in the embodiment of the present invention, a reaction process for 65 minutes at 65°C and a polymerization reaction for 5 minutes at 95°C is stopped using a LightCycler96 device manufactured by Roche.

Hereinafter, the present invention will be described in more detail through examples. Since these examples are only for illustrating the present invention, it should not be construed that the scope of the present invention is limited to these examples.

Example 1. LAMP reaction target material generation

The MERS coronavirus used for the present invention is a pre-sold isolate (GenBank registration number KT029139) in Korea and cultured in a VERO cell line. The RNA of the MERS coronavirus was obtained by extracting the total RNA of the infected cells with Qiagen's QIAamp Viral RNA Mini Kit. cDNA synthesis was performed using Invitrogen's Super Script IV reverse transcriptase with Random Hexamer (NNN NNN) and Oligo dT18 (TTT TTT TTT TTT TTT TTT) primers.

Example 2. LAMP reaction target selection, primer design and selection

Sequence information of each viral genome for sequence analysis was obtained from ViPR (Virus Pathogen Resource, https://www.viprbrc.org). For the design of LAMP primers specific for MERS coronavirus, the sequence between coronavirus species (MERS, SARS, 229E, OC43, HKU1, NL63) in which human infectious diseases have been reported was compared using the MEGA program. At this time, the MERS coronavirus was referred to by making a phylogenetic tree, and in case of other coronavirus species, strains were selected and compared based on the occurrence time and country. As a result, the sequence specific for MERS coronavirus could be identified at positions corresponding to 5'UTR-Nsp1-Nsp2, Nsp3, Spike glycoprotein, Orf3-4-5. Using this sequence, LAMP primer set candidates were secured and primary selection was made based on the presence or absence of mutations between the MERS coronavirus strains of the reaction products of each primer set, and the change in free energy when forming a ring of an amplicon.

Specific response to MERS coronavirus cDNA using the basic composition (F3, B3, BIP, FIP) of the primary selected primer set (1.6 μM FIP and BIP, 0.2 μM F3 and B3, 1 x polymerization A reaction solution consisting of an enzyme buffer solution, 1 mM dNTP, 4 mM MgSO ₄ , 0.8 M Betaine, 1 x LCV component, and 6 U NEB Bst3.0 polymerase was incubated at 72° C. for 60 minutes and then 95° C. At 5 minutes). The second selected primer set includes a loop primer and observes real-time amplification in a reaction solution to which 0.5 μM of SYTO9 fluorescent dye (Invitrogen) is added. Primer set 2 with a large time difference between rapid and specific reactions and non-specific reactions Species (Nsp1 gene and Orf5 gene) were finally selected (Fig. 1, Table 1).

gene division Sequence number order Nsp1 FIP One ACACCAGCCACGAAAGACATGACTCGGTCACAATAYACGGTT BIP 2 ACGTATCGAGCAGCGCTCAACCAGGTTTCCTGAACCACAGA F3 3 GCGTCGTGTCTCTTGTACG B3 4 TCGCCATCCATGAACCATG LF 5 AATTGCCACGCACCGGACG LB 6 ATCAAGACCATGTGTCTCTAACTGT Orf5 FIP 7 ACTCAATGCGATGAAATGCAGGGGCGTCTTTATTTAAACCCG BIP 8 GTTTTCACATACATTCCTGCTAGCGAGGGGAATGAGACACACAT F3 9 GATTTTAACGAACTATGGCTTTC B3 10 CGACAAGTATCTTGACGTAGC LF 11 AGAAACTGGGACTAGCTGGA LB 12 GCTATGTAGCTGCTTTAGCTGTC

Example 3. RT-LAMP reaction design

Bst3.0 polymerase has a reactivity to the RNA template, but shows a low reactivity to the RNA template of MERS coronavirus, so that a reverse transcription LAMP (RT-LAMP) reaction in which a reverse transcriptase was added was designed. WarmStart Colorimetric LAMP 2X master mix (NEB), Bst3.0 (NEB) polymerase and SuperScript IV (Invitrogen) reverse transcriptase combination, Bst2.0 (NEB) polymerase and WarmStart RTx (NEB) reverse transcriptase combination were compared and reacted Bst2.0+ WarmStart RTx combination was selected by comparing the sensitivity, specificity and degree of LCV color change.

Example 4. Confirmation of detection limits of each primer set

An experiment for measuring the sensitivity of the RT-LAMP reaction using the primer set of the present invention was performed as follows. The number of RNA templates of MERS coronavirus is RT-qPCR response to Orf1a gene presented by WHO (primer sequence is Forward: 5'-CCA CTA CTC CCA TTT CGT CAG-3', Reverse: 5'-CAG TAT GTG TAG TGC GCA TAT AAG CA-3', Probe: 5'-FAM-TTG CAA ATT GGC TTG CCC CCA CT-BHQ1-3') was confirmed using Luna ^® Universal Probe One-Step RT-qPCR Kit.

RT-LAMP reactions performed in the Examples are 1.6 μM FIP and BIP, 0.2 μM F3 and B3, 0.4 μM LF and LP, 1 x polymerase buffer solution, 1.4 mM dNTP, 6 mM (final Mg ²⁺ The ion concentration is 8 mM) of MgSO ₄ , 1 x LCV component, 0.5 μM of SYTO9 fluorescent dye, 6 U of Bst2.0 polymerase, 2.25 U of WarmStart RTx reverse transcriptase, and a total of 15 μl of the reaction solution is 65° C. It was performed by incubating for 60 minutes using a LightCycler96 instrument of Roche. At this time, the amplification reaction was stopped by adding 5 minutes of incubation at 95°C.

The results of the reaction were confirmed through real-time fluorescence, LCV color change after the reaction, and electrophoresis results in a 2% Agarose gel (FIG. 2).

In order to confirm the exact detection limit of the primer set of the present invention, as a result of confirming reactivity to low concentration, within 20 minutes to 30 minutes, 5 Copies/rxn to 50 Copies/rxn per reaction for the Nsp1 target gene, or the Orf5 target gene Reactivity to the RNA template of 50 Copies/rxn to 5000 Copies/rxn was confirmed. The results were confirmed through real-time fluorescence and LCV color change. As a result, the primer set for amplifying the Nsp1 gene under the above-mentioned reaction conditions, the 20Copies/rxn, and the primer set for amplifying the Orf5 gene, confirmed the detection limit of the template number level per reaction of 500 Copies/rxn (FIG. 3).

Example 5. RT-LAMP method, confirmation of detection specificity of each primer set

In order to confirm the specific amplification and detection ability of MERS coronavirus of the primer set of the present invention, it is confirmed whether amplification is performed in human coronavirus 229E (HCoV-229E, hereinafter 229E) and human coronavirus OC43 (HCoV-OC43, hereinafter OC43). Did. RT-LAMP reaction conditions were the same as in Example 4, and a template of 10 ⁶ levels per reaction was used. Genomic RNA of 229E and OC43 was extracted from the virus culture medium using Qiaamp's QIAamp Viral RNA Mini Kit.

The reaction results were confirmed by real-time amplification using fluorescent dyes and LCV color change after the reaction. The primer set of the present invention specifically reacted with the MERS coronavirus, and it did not react with the 229E or OC43 genome, thus confirming that the two primer sets of the present invention have specificity against the MERS coronavirus. (Figure 4).

Through the above results, the primitive isothermal amplification (LAMP) primer set for amplifying the Nsp1 gene and the Orf5 gene produced by the method of the present invention specifically reduces the MERS corona virus with a shorter time compared to the conventional genetic technique. It was confirmed that early diagnosis can be performed quickly and effectively in the field without expensive equipment and specialized personnel.

<110> KRICT <120> New primer set for detection of MERS-coronavirus using LAMP and uses thereof <130> M19-6058 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Nsp1 gene LAMP FIP primer <400> 1 acaccagcca cgaaagacat gactcggtca caatayacgg tt 42 <210> 2 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Nsp1 gene LAMP BIP primer <400> 2 acgtatcgag cagcgctcaa ccaggtttcc tgaaccacag a 41 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nsp1 gene LAMP F3 primer <400> 3 gcgtcgtgtc tcttgtacg 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nsp1 gene LAMP B3 primer <400> 4 tcgccatcca tgaaccatg 19 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nsp1 gene LAMP LF primer <400> 5 aattgccacg caccggacg 19 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Nsp1 gene LAMP LB primer <400> 6 atcaagacca tgtgtctcta actgt 25 <210> 7 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Orf5 gene LAMP FIP primer <400> 7 actcaatgcg atgaaatgca ggggcgtctt tatttaaacc cg 42 <210> 8 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Orf5 gene LAMP BIP primer <400> 8 gttttcacat acattcctgc tagcgagggg aatgagacac acat 44 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Orf5 gene LAMP F3 primer <400> 9 gattttaacg aactatggct ttc 23 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Orf5 gene LAMP B3 primer <400> 10 cgacaagtat cttgacgtag c 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Orf5 gene LAMP LF primer <400> 11 agaaactggg actagctgga 20 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Orf5 gene LAMP LB primer <400> 12 gctatgtagc tgctttagct gtc 23

Claims (12)

A first primer set consisting of SEQ ID NOs: 1 to 6 for amplifying the Nsp1 gene; or
A primer set for loop-mediated isothermal amplification (LAMP) reaction for detecting MERS coronavirus consisting of a second primer set consisting of SEQ ID NOs: 7 to 12 for amplifying the Orf5 gene.
The primer set according to claim 1, wherein the LAMP comprises a reverse transcription loop-mediated isothermal amplification RT-LAMP.
The primer set according to claim 1, wherein the MERS coronavirus is at least one selected from the group consisting of GeneBank accession number, JX869059, KF600620, KM015348, KP209307, KT121578, KU308549 and KT374053. .
A composition for detecting MERS coronavirus comprising the primer set according to claim 1.
The composition for detecting MERS coronavirus according to claim 4, wherein the composition comprises a LAMP reaction buffer solution containing DNA polymerase, dNTP and Mg ²⁺ ions.
Kit for detecting MERS coronavirus comprising the primer set according to claim 1.
The kit for detecting MERS coronavirus according to claim 6, wherein the detection kit includes a DNA polymerase, a dAMP and a LAMP reaction buffer solution containing Mg ²⁺ ions.
Extracting nucleic acid (RNA) from the separated sample;
a template preparation step including cDNA synthesis;
Mixing the template and the primer set of claim 1 to construct a LAMP reaction solution;
Performing an isothermal amplification reaction at 60°C to 72°C using the LAMP reaction solution;
And confirming the formation of an amplification product according to LAMP.
The method of claim 8, wherein the LAMP reaction solution comprises a reaction buffer solution containing DNA polymerase, dNTP and Mg ²⁺ ions.
The method of claim 8, wherein the step of confirming the formation of the amplification product comprises DNA chip, gel electrophoresis, capillary electrophoresis, colorimetric method, or real-time fluorescence detection.
The method of claim 8, wherein the sample is one or more of sputum, aspirate, throat gauze, wash, whole blood, plasma, urine, sweat, tears, lymph, saliva, or nasopharyngeal secretions.
The method of claim 8,
The MERS coronavirus is a method for detecting at least one MERS coronavirus selected from the group consisting of GeneBank accession number, JX869059, KF600620, KM015348, KP209307, KT121578, KU308549 and KT374053.

Images