KR101997133B1 - Primer set for diagnosing Zika virus, kit with the same, and method of diagnosing Zika virus using the same - Google Patents

Abstract

The present invention relates to a Zika virus diagnostic primer set capable of detecting various Zika viruses, and capable of detecting only Zika viruses with high sensitivity, a diagnostic kit comprising the same, and a Zika virus diagnostic method using the same.
Zika virus diagnostic primer set according to the present invention comprises a forward primer having a nucleotide sequence of SEQ ID NO: 1; And a reverse primer having a nucleotide sequence of any one of SEQ ID NOs: 2 to 4.
Zika virus diagnostic kit according to the present invention comprises a forward primer having a nucleotide sequence of SEQ ID NO: 1; A reverse primer having a nucleotide sequence of any one of SEQ ID NOs: 2 to 4; And a probe having a nucleotide sequence of SEQ ID NO: 5 or 6.
Zika virus diagnostic method according to the present invention includes performing a real time RT-PCR (Real Time RT-PCR) using a diagnostic kit.

Description

Primer set for diagnosing Zika virus, kit with the same, and method of diagnosing Zika virus using the same}

The present invention relates to a primer and probe set for detecting the presence of Zika virus, and a diagnostic kit and diagnostic method using the same.

Zika virus (ZIKV) is an infectious disease that is transmitted by mosquitoes, such as Dengue and Chikkununya viruses. As of November 2016, a large number of infections have occurred in the southern hemisphere, mainly in Brazil, and are suspected to be the source of microcephaly and GBS (Guilin Barre).

The prevalence of the Zika epidemic in the Yap State, Federated States of Micronesia, in 2007 is estimated to have originated from a single strain virus, which has been triggered by a variety of strain viruses since 2015. Is expected. Due to the RNA viral nature, it is very likely that various mutation strains occurred during the period. Therefore, if the epidemic of Zika virus spreads to all regions including the northern hemisphere, it is more likely to generate more various strains of Zika virus than before.

However, Zika-related papers published before 2015 have designed primers and probes based on the Zika strains found at the time after the Zika epidemic, which is somewhat different from many kinds of Zika stains currently detected in NCBI. .

Some papers use wobble bases for primers and probes to overcome sequence differences in the various strains of Zika virus. However, if the wobble base is used in the primer manufacturing process, the difference in reactivity between strains of different sequences is likely to act as a cause of decreasing the sensitivity of the PCR reaction.

As a result, the conventional diagnostic method using primers and probes of RT PCR used as the final diagnostic method of Zika virus is difficult to diagnose various Zika virus strains. Therefore, based on the new Zika virus sequence information confirmed by the 2015 Southern Hemisphere epidemic, it is necessary to develop a diagnostic method capable of detecting various recent Zika viruses with high sensitivity and specificity.

[Non-Patent Document 1] Enfissi et al., Zika virus genome from the Americas. 2016.Lancet 387 (10015): 227-8 [Non-Patent Document 2] Kuno et al., Full-length sequencing and genomic characterization of Bagaza, Kedougou, and Zika viruses. Archives of Virology 152 (4): 687-696 [Non-Patent Document 3] Faye et al., One-step RT-PCR for detection of Zika virus. 2008.J Clin.Virol 43: 96-101 [Non-Patent Document 4] Balm et al., A Diagnostic polymerase chain reaction assay for Zika virus, 2012. J. Med. Virol. 84: 1501-1505 [Non-Patent Document 5] Lanciotti et al., Genetic and serologic properties of zika virus associated with an epidemic, Yap state, Micronesia, 2007. 2008 Emerg. Infect, Dis. 14 (8): 1232-1239

The present invention has been made to solve the above problems, the object of the present invention is to detect a variety of Zika virus recently, especially since 2015, and also Zika which can detect only Zika virus with high sensitivity specifically Provided are a primer set for diagnosing a virus, a diagnostic kit including the same, and a Zika virus diagnosis method using the same.

Zika virus diagnostic primer set according to the present invention for achieving the above object comprises a forward primer having a nucleotide sequence of SEQ ID NO: 1; And it is characterized in that it comprises a reverse primer having a base sequence of any one of SEQ ID NO: 2 to.

Zika virus diagnostic kit according to the present invention for achieving the above object comprises a forward primer having a nucleotide sequence of SEQ ID NO: 1; A reverse primer having a nucleotide sequence of any one of SEQ ID NOs: 2 to 4; And it is characterized in that it comprises a probe having a nucleotide sequence of SEQ ID NO: 5 or 6.

Zika virus diagnostic method according to the present invention for achieving the above object comprises a forward primer having a nucleotide sequence of SEQ ID NO: 1; A reverse primer having a nucleotide sequence of any one of SEQ ID NOs: 2 to 4; And real-time reverse transcription polymerase chain reaction (Real time RT-PCR) using a probe having a nucleotide sequence of SEQ ID NO: 5 or 6.

According to the present invention, the Zica virus can be detected with a high sensitivity by detecting a detection limit (LoD) of about 60 copies, and specific to Zica virus without reacting to dengue virus or West Nile virus similar to Zika virus. There is an effect that can be detected.

In addition, the primer and probe set of the present invention is designed to include the Zika virus strain found after 2015, unlike the conventional Zika virus diagnostic methods can detect the Zika virus as well as the past epidemic of 2015 and 2015. It works.

The terminology used herein is for the purpose of describing particular example embodiments only and is not intended to be limiting of the present invention. Singular expressions include plural expressions unless the context clearly indicates otherwise. As used herein, the terms "comprise" or "have" are intended to indicate that there is a feature, number, step, action, component, part, or combination thereof described on the specification, and one or more other features. It is to be understood that the present invention does not exclude the possibility of the presence or the addition of numbers, steps, operations, components, components, or a combination thereof.

In addition, in the present specification, when one component is referred to as "connected" or "connected" with another component, the one component may be directly connected or directly connected to the other component, but in particular It is to be understood that, unless there is an opposite substrate, it may be connected or connected via another component in the middle.

Hereinafter, preferred embodiments, advantages, and features of the present invention will be described in detail.

The inventors analyzed various Zika virus strain sequences listed in the NCBI, and designing primers and probes at the sequence sites where many sequence reports were made to detect many kinds of Zika viruses. It was judged to be advantageous. As a result, the most frequently reported sequences of Zika virus sequences were searched. As a result, the most frequently reported sequences of about 2600 bp were detected, and thus primers that can be used for RT-PCR for detecting Zika virus in the sequence were detected. And probes.

Specifically, a novel primer set was devised comprising a forward primer having an oligonucleotide of SEQ ID NO: 1, a reverse primer having an oligonucleotide of any one of SEQ ID NOs: 2 to 4, and an oligonucleotide of any of SEQ ID NOs: 5 and 6 A probe with was designed.

Sensitivity testing using this primer set and probe revealed a limit of detection (LoD) of about 60 copies, indicating that Zica virus can be detected with high sensitivity. The specificity of not responding to Dengue virus to West Nile virus but to Zika virus was confirmed.

In addition, the primer set and the probe are designed to include the Zika virus strain found after 2015. Unlike the conventional Zika virus diagnosis methods, it is possible to detect the Zika virus as well as the epidemic after 2015. There is this.

According to a preferred embodiment, the forward primer is formed with an oligonucleotide of SEQ ID NO: 1, the reverse primer consists of a primer set consisting of reverse primers with oligonucleotides of SEQ ID NO: 2, 3 and 4, the probe And a probe set having oligonucleotides of SEQ ID NOs: 5 and 6.

The primer set and the probe designed as described above may be implemented in the form of a diagnostic kit and used for diagnosing whether Zika virus is infected or for detecting a virus in a mosquito. The diagnostic kit may be configured in the form of reagents, instruments or devices capable of detecting Zika virus, but is not necessarily limited thereto.

In particular, when the diagnostic kit is prepared using the primer set and the probe set according to the above-described preferred embodiment, there is an advantage that only one diagnostic kit can detect most of the Zika virus including the Zika virus prevalent after 2015. .

In addition, the present invention comprises the steps of extracting RNA from the patient blood or subject; A forward primer having an oligonucleotide of SEQ ID NO: 1, a reverse primer (or primer set) having at least one oligonucleotide of SEQ ID NOs: 2 to 4, a probe having an oligonucleotide of at least one of SEQ ID NOs: 5 and 6 (or Using a probe set), and provides a Zika virus diagnostic method comprising the step of synthesizing and gene amplification of cDNA from the extracted RNA through Real Transcription polymerase chain reaction (Real time RT-PCR).

According to a preferred embodiment, the diagnostic method of the present invention may comprise the step of quantifying the amplification of the gene in real time, for example, in real time monitoring the gene amplification through real time RT-PCR (Real Time RT-PCR) By calculating the Ct value (Cycle threshold) from the amplification curve obtained by using it may be made of the step of quantifying the presence or absence of the target gene or amplification product in the gene amplification product.

< Example  One : Zika  For virus diagnosis Probe  And primer  Design>

(One) Probe Probe design

Various Zika virus strain sequences listed in the NCBI were analyzed and the most reported sequences were sorted. As a result, the most reported sequences were about 2600bp. Accordingly, a probe that can be used for RT-PCR for detecting Zika virus in the sequence was designed, and the probe prepared using the gene region is shown in Table 1 below.

SEQ ID NO:

designation

Sequence (5 '-3')
location
Usage
One

ZikF1
GGAGGAATGTCCTGGTTCTCACA
2346-2369
Forward primer
2

ZikR1
TCCACATGATGTTTTCCATTCT



2669-2697



Reverse primer
3

ZikR2
TCCACATGATGTTCTCCATTCT
4

ZikR3
TCCACATAATGTTTTCCATTCT
5

ZikPc
GGTACAAGTACCATCCTGACTCCCC

2578-2603

Probe
6

ZikPt
GGTACAAGTATCATCCTGACTCCCC

Probes having the nucleotide sequence of SEQ ID NO: 5 or 6 of the present invention can be labeled with a fluorescent material that acts as a reporter (Reporter) at the 5 'end to facilitate the detection of gene amplification products, and separately from the 3' end It may be labeled with a quencher.

In Example 1, the probe was labeled with FAM as a fluorescent material at the 5 'end, and labeled with Iowa Black FQ as a quencher at the 3' end. Furthermore, the probe was further labeled with ZEN as an inner quencher at the 3 'end.

(2) primer (Primer) design

Primers according to the present invention were designed in the peripheral sequence of the probe sequence selected in Example 1, the primers thus prepared are shown in Table 1. However, there are a number of Zika virus strains showing sequence differences in the designed primer sequence sites.

Therefore, the present inventors designed a specific primer for each strain type to detect various types of Zika virus strains while maintaining the sensitivity and specificity of the PCR reaction above the critical level. Specifically, specific reverse primers and probes for each Zika virus strain sequence were designed.

Table 2 below shows the base sequences of primers and probes specific to Zika virus strain sequences.

Zika virus
Strain Forward primer
Sequence Probe
Sequence Reverse primer
Sequence
MR 766






SEQ ID NO: 1

SEQ ID NO: 5




SEQ ID NO: 2
R116265


SEQ ID NO: 6
ArD128000

INMI1


SEQ ID NO: 5
SEQ ID NO: 3

6-740

SEQ ID NO: 4

Thus, the primer of the present invention may be composed of a primer set comprising a forward primer having a nucleotide sequence of SEQ ID NO: 1, and a reverse primer having any one of SEQ ID NO: 2 to 4.

Preferably, the primer of the present invention comprises a primer set including a forward primer having a base sequence of SEQ ID NO: 1, and a reverse primer set having both reverse primers having a base sequence of SEQ ID NOs: 2, 3, and 4 Can be. In this case, the probe may be composed of a probe set consisting of probes having the nucleotide sequences of SEQ ID NOs: 5 and 6. When the diagnostic kit is manufactured using the primer set and the probe set configured as described above, various types of diagnostic kits may be used as one diagnostic kit. There is an advantage to cope with Zika virus strain.

< Example  2: RNA standard production>

The present invention provides a real-time RT-PCR capable of detecting Zika virus using the primer set and the probe prepared in Example 1, the detection limit (LoD) experiment of the amplification product to be generated as a result of the real-time RT-PCR reaction In order to use as a positive control for the following RNA standard (standard) was prepared. In the case of oligo (RNA) RNA can not exceed 90base, it was produced to a size within 90base by deleting other site sequence except the primer and probe sequence of the present invention. In order to confirm the specificity of the primers and probes of the present invention, the corresponding region sequences of Dengue virus and West Nile virus having high sequence similarity were prepared together.

< Example  3: Zika virus  Real time RT- for detection PCR >

Real-time RT-PCR method for detecting Zika virus according to an embodiment of the present invention is as follows.

All oligos used in Examples and Experiments of the present invention were produced by requesting from IDT. RT-PCR reaction was performed using BioFACT OneStep RT-PCR kit (Biofact, Korea), 6μl of 5X onestep RT buffer, 1μl of dNTP (10mM each dNTP, solgent, Korea), 2U of RNasin (Promega, Madison, USA) , 2μl enzyme mix was used.

In addition, primers were used by 10 pmol, probes were used by 2 pmole, and RNA standard (positive and internal control) prepared in Example 2 was used by 5 μl, respectively. Rnase free water (sigma, USA) ) Was used.

And, MX3005P (Agilent Technologies, USA) equipment was carried out according to the experimental method provided by the manufacturer. Specifically, 40 cycles were performed under conditions of 50 ° C. 30 minutes (RT step), 94 ° C. 15 minutes (pre denatuer), 94 ° C. 40 seconds, 60 ° C. 45 seconds, and 72 ° C. 45 seconds. Real time fluorescence was performed at 72 ° C for each cycle.

< Example  4: real-time RT- PCR  Detection limit ( LoD )>

Sensitivity test conducted using the primer set and probe of the present invention was made by diluting the prepared standard RNA. As a result of analysis using DNA / RNA copy number calculation program (http://www.endmemo.com/bio/dnacopynum.php) provided by ENDMEMO, 6.02 × 10 ¹¹ copy per 1 pmole of Zika standard RNA Appeared.

After making the prepared Zika standard RNA at a concentration of 1P, the solution was diluted 10 times to 10 ^-12 to calculate the limit of detection (LoD) through real time RT-PCR. Table 3 is as follows.

Synthetic RNA copy / ul

nb positive / nb
Ct
6.02 × 10 ¹⁰

3/3
11.92 6.02 × 10 ⁹

3/3
7.35 6.02 × 10 ⁸

3/3
9.62 6.02 × 10 ⁷

3/3
13.47 6.02 × 10 ⁶

3/3
17.29 6.02 × 10 ⁵

3/3
20.72 6.02 × 10 ⁴

3/3
24.90 6.02 × 10 ³

3/3
29.11 6.02 × 10 ²

3/3
33.41 6.02 × 10

3/3
38.69
6.02 × 10 ⁰

0/3 No ct
0
0/3
No ct

In the limit of detection (LoD) test of Table 3, a total of 12 concentrations of RNA standards ranging from 0.1P or less to 10 ^-12 were used, and three tests were performed for each concentration of RNA standards.

As can be seen from Table 3, the lowest Ct value produced 7.35 at 6.02 × 10 ⁹ , and showed positive response in all three tests. The highest Ct value was 38.69 at 6.02 × 10, and no Ct value occurred at 6.02 × 10 ⁰ , which is lower than 6.02 × 10 ⁹ .

As a result, when the sensitivity test was performed using the primer set and the probe according to the present invention, the detection limit (LoD) was found to be about 60 copies, and the analysis result of the DNA / RNA copy number calculation program provided by ENDMEMO It is estimated that the sensitivity to Zika virus is high because of the similar degree.

On the other hand, in the case of 6.02 × 10 ¹⁰ , a Ct value of 11.92, which is higher than 6.02 × 10 ⁹ , was calculated, which is presumably due to the effect of inhibiting PCR reaction by too high a concentration of RNA standard.

< Example  5: real time RT- PCR  Specificity>

Real-time RT-PCR of nucleic acid sequences of Dengue virus and West Nile virus of the same Flavivirus genus as Zika virus to investigate the Zika virus specificity of primers and probes according to the present invention All of the results were negative.

Specifically, dengue virus 4 strain Haiti / 0324/2014 and corresponding regions of West Nile virus strain Greece / 2013 / Thessaloniki_3 were synthesized and analyzed as a result of dengue virus and West Nile virus synthetic DNA. It did not appear to respond.

Thus, it can be seen that the primer set and probe according to the present invention are Zika virus specific for detecting Zika virus only.

While preferred embodiments of the present invention have been described above using specific terms, such terms are only for clarity of the present invention, and embodiments and described terms of the present invention are departed from the spirit and scope of the following claims. It is obvious that various changes and modifications can be made without a change. Such modified embodiments should not be understood individually from the spirit and scope of the present invention, but should fall within the claims of the present invention.

<110> Industry-University Cooperation Foundation of Seokyeong University <120> Primer set for diagnosing Zika virus, kit with the same, and          method of diagnosing Zika virus using the same <130> p17-0045 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 1 ggaggaatgt cctggttctc aca 23 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 tccacatgat gttttccatt ct 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 3 tccacatgat gttctccatt ct 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 tccacataat gttttccatt ct 22 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 5 ggtacaagta ccatcctgac tcccc 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 6 ggtacaagta tcatcctgac tcccc 25

Claims (8)

delete delete Forward primer consisting only of the nucleotide sequence of SEQ ID NO: 1; A reverse primer consisting only of the nucleotide sequence of SEQ ID NO: 4; And Zika virus diagnostic kit comprising a probe consisting of only the nucleotide sequence of SEQ ID NO: 6.
Forward primer consisting only of the nucleotide sequence of SEQ ID NO: 1; A reverse primer set consisting only of the nucleotide sequences of SEQ ID NOs: 2, 3, and 4; And Zika virus diagnostic kit comprising a probe set consisting of only the nucleotide sequence of SEQ ID NO: 5 and 6.
The method according to claim 3 or 4,
The diagnosis is Zika virus diagnostic kit by real-time reverse transcription polymerase chain reaction (Real time RT-PCR).
The method according to claim 3 or 4,
The probe of SEQ ID NO: 5 or 6 is a Zika virus diagnostic kit, characterized in that the FAM is labeled with a fluorescent material at the 5 'end, Iowa Black FQ is labeled with a quencher at the 3' end.
delete delete