KR102226281B1 - Discrimination method for product traceability and identification of Felis catus using microsatellite DNA - Google Patents

Abstract

The present invention relates to the development of a microsatellite marker for genetic identification of cats. More particularly, the present invention relates to a technology for identifying individuals and verifying parentage in a faster and more economical way than conventional techniques through a multiplex PCR using a microsatellite marker. The multiplex PCR method of 14 microsatellite markers and one sex discrimination marker according to the present invention is very useful as an auxiliary means for animal registration by enabling high-speed and low-cost analysis using genes for individual identification and parentage verification of cats.

Description

Discrimination method for product traceability and identification of Felis catus using microsatellite DNA

The present invention relates to an individual identification method using a cat's supersatellite marker.

In recent years, as the importance of future utilization values for genetic resources has been recognized, a lot of attention and efforts are being made in securing, preserving, and managing resources, as well as evaluating and utilizing characteristics. In particular, evaluation of molecular biological characteristics is being actively conducted to identify the genetic characteristics of possessed resources, such as origin, cultivar formation, genetic diversity, and relationships with other cultivars, using several genetic markers based on DNA polymorphism (Groeneveld et al. al., 2010, Anim. Genet. 41:6-31).

Microsatellite (MS) has a structure in which 2 to 6 nucleotide sequences are repeated, and exists widely in a non-coding region on eukaryotic DNA. In addition, since about 10 alleles are shown per locus of a supersatellite, polymorphic information is abundant, and because of its small size, it can be easily amplified using DNA extracted from various samples such as blood, hair roots, and skin. In particular, since a multiplex PCR technique capable of reacting and amplifying two or more supersatellite-specific primers at once can be applied, there is an advantage of being able to easily analyze alleles at low cost (Butler, (2007) ) Biotechniques. 43:Sii-Sv).

Supersatellite markers are also called simple sequence repeats (SSR), and one of the most important features is that they can detect multiple alleles per loci, which is more useful than a single nucleotide polymorphism (SNP) marker. . Supersatellite markers have several advantages when compared to other molecular markers. Genetic diversity can be easily diagnosed through PCR using primers designed around simple sequence repeats (SSR) repeats and analysis of fragments to diagnose length polymorphism. SSR shows high reproducibility and has compatibility within the closely related species. The supersatellite PCR amplification protocol is standard (requires about 1 ng or less of DNA per reaction) and is suitable for high-efficiency analysis, such as automatic fluorescence analysis. Finally, the supersatellite loci are very abundant and relatively evenly distributed throughout the genome. However, these advantages are not fully utilized to make large-scale SSR markers targeting the entire genome due to the low efficiency of the supersatellite discovery and identification process.

Utilizing these advantages of supersatellites, since the 1990s, it has been used as the most efficient genetic marker in analyzing genetic characteristics and relationships of animals, including humans, and creating association maps (Naidoo and Chetty, (1998) Pathol. Oncol. Res. 4:310-315). In addition, it has been used to date for genetic diversity of varieties or groups, identification of quantitative genetic loci, individual identification and paternity (Gutierrez-Gil et al., (2010) Meat Sci. 85:721-729; Costa et al. , (2012) BMC Res. Notes. 5:479). In addition, several academic and industrial achievements are being derived through the analysis of supersatellite in Korea.

Meanwhile, the number of domestic companion animals gradually increases, and accordingly, the number of organic animals is increasing. Therefore, a companion animal registration system has been introduced and implemented in order to easily recover lost companion animals and reduce the occurrence of abandoned animals.

Companion animal registration includes a built-in wireless identification device, that is, inserting a microchip into the body of an animal, attaching an external wireless identification device, or attaching a registration identification tag. However, in the case of the built-in wireless identification device, there is a concern about side effects caused by inserting a foreign substance into the body of a companion animal, and in the case of an external type, since it can be easily separated, there are many questions about its effectiveness. Therefore, there is a need for a marker that can be used for more stable and practical individual identification. Currently, it is required under the Animal Protection Act to attach a built-in or external device for dogs over 3 months of age, and a fine of not more than 1 million won is imposed if they do not register. However, with regard to cats, animal registration has not been performed smoothly as it is still in the pilot registration stage.

Therefore, an animal identification method using a supersatellite marker is needed, and if each individual's unique microsatellite genetic fingerprint is secured and this information is registered with the companion animal's local government registration, the embedded chip inserted in the companion animal is removed. Even if it is, it is possible to accurately find the breeder, so it is possible to clarify the legal responsibility for violation of the breeder's obligation to protect companion animals. In addition, it can provide scientific and conclusive evidence for legal problems such as identification of biological biological births in case of forgery of the cat's lineage traded at a high price, and ownership disputes between the cat's original owner and the current guardian in case of loss of the cat.

As a prior art for identifying an individual as a supersatellite marker, Korean Patent Registration No. 10-1630806 discloses an individual identification method using a supersatellite marker of a pig, a composition for discriminating the sex and breed of a dog, and a discrimination method using the same. Korean Patent Registration No. 10-1960424 and Korean Patent Registration No. 10-1821554, which discloses a method for identifying the gene variety of arrowroot using a supersatellite marker, but the supersatellite marker for cat identification does not occur when performing multiplex PCR. No combination has been disclosed.

Accordingly, the present inventors select 14 supersatellite markers and one gender discrimination marker having a high heterozygous rate and polymorphism information, and the marker does not cause an interference reaction when performing multiplex PCR, and discriminates the individual and sex of cats. Therefore, as a complementary means of the animal registration system, it was confirmed that it can be usefully used for individual identification, paternity, and sex determination, and the present invention was completed.

It is an object of the present invention to select a gene marker from a cat's supersatellite marker gene, and to provide a method for identifying cat individuals and sex discriminating with excellent speed and accuracy using this.

In order to achieve the above object, the present invention

A set of primers of SEQ ID NOs: 7 and 8 for amplifying feline supersatellite DNA to identify feline individuals and discriminate sex; Primer sets of SEQ ID NOs: 13 and 14; Primer sets of SEQ ID NOs: 15 and 16; Primer sets of SEQ ID NOs: 23 and 24; Primer sets of SEQ ID NOs: 9 and 10; A set of primers of SEQ ID NOs: 1 and 2; A set of primers of SEQ ID NOs: 25 and 26; And it provides a supersatellite marker composition for cat individual identification and gender discrimination comprising a primer set of SEQ ID NOs: 29 and 30.

In addition, the present invention provides a kit for individual identification and gender identification of cats comprising the composition.

In addition, the present invention comprises the steps of: 1) extracting a nucleic acid from a target sample;

2) using the extracted nucleic acid as a template and performing a polymerase chain reaction with the composition to amplify feline supersatellite DNA; And

3) the step of identifying the individual of the cat by detecting the allele and analyzing the size of the product amplified in the amplification step through an electrophoresis device; provides a method for identifying the individual and sex of the cat comprising.

The present invention relates to an individual identification method using a cat's supersatellite marker, and the 14 supersatellite markers and one gender discrimination marker selected in the present invention have a high heterozygous rate and polymorphism information, so that the cat's individual can be identified. And gender can be discriminated, so it can be usefully used for individual identification, paternity, and gender discrimination as a supplement to the animal registration system.

Hereinafter, the present invention will be described in detail.

The present invention is a primer set of SEQ ID NOs: 7 and 8 for amplifying feline supersatellite DNA to identify feline individuals and determine sex; Primer sets of SEQ ID NOs: 13 and 14; Primer sets of SEQ ID NOs: 15 and 16; Primer sets of SEQ ID NOs: 23 and 24; Primer sets of SEQ ID NOs: 9 and 10; A set of primers of SEQ ID NOs: 1 and 2; A set of primers of SEQ ID NOs: 25 and 26; And it provides a supersatellite marker composition for cat individual identification and gender discrimination comprising a primer set of SEQ ID NOs: 29 and 30.

The primer sets of SEQ ID NOs: 7 and 8 are primer sets capable of amplifying the FCA770 supersatellite marker.

The primer sets of SEQ ID NOs: 13 and 14 are primer sets capable of amplifying the FCA176 supersatellite marker.

The primer sets of SEQ ID NOs: 15 and 16 are primer sets capable of amplifying the Cat2944 supersatellite marker.

The primer sets of SEQ ID NOs: 23 and 24 are primer sets capable of amplifying the FCA1240 supersatellite marker.

The primer sets of SEQ ID NOs: 9 and 10 are primer sets capable of amplifying the FCA123 supersatellite marker.

The primer sets of SEQ ID NOs: 1 and 2 are primer sets capable of amplifying the FCA170 supersatellite marker.

The primer sets of SEQ ID NOs: 25 and 26 are primer sets capable of amplifying Cat18588 supersatellite markers.

The primer sets of SEQ ID NOs: 29 and 30 are primer sets capable of amplifying the base sequence of a zinc finger protein (ZFP) gene on a feline sex chromosome.

Since the ZFP gene has a difference in nucleotide sequence length on the X chromosome and the Y chromosome, when the polymerase chain plaque is performed using the primer sets of SEQ ID NOs: 29 and 30, the ZFP gene on the X chromosome is amplified to a size of 166 bp. And the ZFP gene on the Y chromosome is amplified to a size of 163 bp. Therefore, when the amplified product is 166 bp, it is possible to determine the sex as a female cat, and when the amplified product is 166 bp and 163 bp, the sex can be determined as a male cat.

The term “primer” as used herein refers to a short sequence that functions as a starting point for template strand copying as a base sequence having a short free 3'terminal hydroxyl group. Primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. The PCR conditions, the length of the sense and antisense primers can be modified based on those known in the art.

The term "microsatellites" as used in the present invention means a short repeating sequence of mono-, di-, tri- and tetranucleotides distributed throughout eukaryotes genes. In general, such a repeat sequence exists in the form of a tandem repeat about 10 to 40 times within a chromosome.

"Microsatellite Marker" used in the present invention means a DNA polymorphism detection marker using microsatellite. Since each individual exhibits specificity in the genotype combination of markers, breed identification as well as individual identification is possible with a combination of a sufficient number of markers. In order to increase the accuracy and speed of the gene recognition technique, investigations should be performed on many supersatellite markers. When performing gene recognition on many supersatellite markers, the time and time required for allele identification for each of the many supersatellite markers. There was a problem of consumption of manpower. Therefore, in order to solve this problem, a multiplex-PCR method is useful in which primers of several markers are added to one PCR reaction and the reaction is performed at the same time.

The term "allele" used in the present invention refers to the DNA sequence of gene alleles that form a pair of homologous chromosomes and have different traits, and the number of these alleles in each supersatellite marker is defined as the number of alleles. do.

The "Allele frequency" used in the present invention means the relative occurrence ratio of each allele in a population, and the sum of the frequencies of each allele is 1.

The term "expected heterozygosity" used in the present invention is the estimated heterozygous rate based on the frequency of alleles, and can be derived by the following calculation formula, and the expected heterozygous rate value of the supersatellite marker is 0.6 In the case of abnormality, it can be judged as a marker with high polymorphism (Botstein, D., White, RL, Skolnick, M. and Davis, RW 1980.Construction of a genetic linkage map in man using restriction fragment length polymorphisms.Am. J. Hum. Genet. 32, 314-331.).

<Calculation 1>

(n=the number of alleles, Pi=the frequency of the i-th allele)

The term "polymorphic information content (PIC)" used in the present invention is a value representing the degree of genetic polymorphism for each marker, and can be derived by the following calculation formula, and the higher the value, the higher the diversity for each individual. . If the value of the polymorphism information of a supersatellite marker is 0.5 or more, it can be judged as a marker with high polymorphism (Botstein, D., White, RL, Skolnick, M. and Davis, RW 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms.Am. J. Hum. Genet. 32, 314-331.).

<Calculation Equation 2>

(n=the number of alleles, Pi, Pj=the frequency of the i or jth allele)

The cat individual identification and sex identification supersatellite marker composition comprises a primer set of SEQ ID NOs: 11 and 12; Primer sets of SEQ ID NOs: 19 and 20; Primer sets of SEQ ID NOs: 27 and 28; Primer sets of SEQ ID NOs: 3 and 4; And it may be to further include a primer set of SEQ ID NO: 17 and 18.

The primer sets of SEQ ID NOs: 11 and 12 are primer sets capable of amplifying the FCA954 supersatellite marker.

The primer sets of SEQ ID NOs: 19 and 20 are primer sets capable of amplifying the FCA441 supersatellite marker.

The primer sets of SEQ ID NOs: 27 and 28 are primer sets capable of amplifying the FCA178 supersatellite marker.

The primer sets of SEQ ID NOs: 3 and 4 are primer sets capable of amplifying the FCA1056 supersatellite marker.

The primer sets of SEQ ID NOs: 17 and 18 are primer sets capable of amplifying the FCA043 supersatellite marker.

The supersatellite marker composition for cat individual identification and gender identification includes a primer set of SEQ ID NOs: 21 and 22; And it may further include a primer set of SEQ ID NO: 5 and 6.

The primer sets of SEQ ID NOs: 21 and 22 are primer sets capable of amplifying the F42 supersatellite marker.

The primer sets of SEQ ID NOs: 5 and 6 are primer sets capable of amplifying the FCA1344 supersatellite marker.

In addition, the present invention provides a kit for individual identification and gender identification of cats comprising the composition.

If the kit of the present invention is applied to the PCR amplification process, the kit of the present invention optionally includes reagents necessary for PCR amplification, such as buffers, DNA polymerases (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermostable DNA polymerase obtained from Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), a DNA polymerase cofactor, and dNTPs, and when the kit of the present invention is applied to an immunoassay, the present invention The kit of may optionally include a secondary antibody and a substrate for a label. Furthermore, the kit according to the present invention may be manufactured as a plurality of separate packaging or compartments including the reagent components described above.

In addition, the present invention comprises the steps of: 1) extracting a nucleic acid from a target sample;

2) amplifying feline supersatellite DNA by using the extracted nucleic acid as a template and performing a polymerase chain reaction with the composition of any one of claims 1 to 3; And

3) the step of identifying the individual of the cat by detecting the allele and analyzing the size of the product amplified in the amplification step through an electrophoresis device; provides a method for identifying the individual and sex of the cat comprising.

In the present invention, the step of separating the nucleic acid from the target sample may be performed through a method known in the art. For example, it can be achieved by directly purifying DNA from tissues or cells or by specifically amplifying a specific region and isolating it using an amplification method such as PCR. In the present invention, a nucleic acid is meant to include not only DNA but also cDNA and RNA molecules synthesized from mRNA. Steps of extracting DNA from the target sample include, for example, PCR amplification method, ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription Transcription amplification (Kwoh et al., Proc Natl Acad Sci USA 86, 1173 (1989)) and self-maintaining sequence replication (Guatelli et al., Proc Natl Acad Sci USA 87, 1874 (1990)) and nucleic acid-based sequence amplification (NASBA ), etc. can be used.

In the present invention, the polymerase chain reaction (PCR) may be performed using a PCR reaction mixture containing various components known in the art required for the polymerase chain reaction. The PCR reaction mixture contains an appropriate amount of DNA polymerase, dNTP, PCR buffer, and water (dH2O) in addition to the DNA extracted from the sample to be analyzed and the primer set provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl, and the like. At this time, the MgCl ₂ concentration greatly affects the specificity and quantity of amplification, and may preferably be used in the range of 15-25 mM. In general, when Mg ²⁺ is excessive, non-specific PCR amplification products increase, and when Mg ²⁺ is insufficient, the yield of PCR products decreases. An appropriate amount of Triton X-100 may be additionally included in the PCR buffer solution.

In the present invention, the polymerase chain reaction begins with the first reaction at 95°C for 15 minutes, denaturation at 95°C for 60 seconds, binding at 62°C for 75 seconds, elongation at 72°C for 60 seconds, 5 cycles, at 95°C 60 seconds denaturation, bonding at 61°C for 75 seconds, stretching at 72°C for 60 seconds, 5 cycles, denaturation at 95°C for 60 seconds, bonding at 60°C for 75 seconds, stretching at 72°C for 60 seconds, performing 25 cycles, and finally The final elongation reaction can be carried out at 65° C. for 30 minutes.

In the present invention, the DNA of the PCR amplification product may be analyzed by size according to a method well known in the art. Preferably, it can be confirmed by an agarose gel or polyacrylamide gel electrophoresis or a fluorescence analyzer (ABI prism 3100 genetic analyzer-electropherogram). At this time, in order to use the fluorescence analyzer, it is performed in the PCR step using a primer set to which a fluorescent die is attached known in the art.

In a specific embodiment of the present invention, the present inventors extracted genomic DNA for 18 breeds of a total of 122 cats, and based on this, 14 supersatellite markers and one gender discriminating marker were selected, and these markers are for each breed. It has a high heterozygous rate and the number of alleles sufficient to identify an individual (see Table 2), each marker has a high heterozygous rate and a high amount of polymorphism (see Table 3), and each supersatellite marker is for each breed. With various observed heterozygosity rates and polymorphism values (see Table 4), it was confirmed that the gender discrimination marker had amplification products of different sizes depending on the sex (see Table 5).

Therefore, when a multiplex polymerase chain reaction (multiplex PCR) is performed using a primer combination that can specifically amplify 14 types of supersatellite markers selected in the present invention and 1 type of gender identification marker, the result of PCR Depending on the size of the amplification product, it is possible to identify whether the individual is the same as the control group, and to determine the sex, so it can be usefully used as an auxiliary means of the companion animal registration system.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following Examples and Experimental Examples.

<Example 1> Preparation of cat DNA sample

Specimen animals and DNA samples used in the present invention include 18 breeds of cats (Abyssinian (3 heads), American curls (1 head), American short hair (6 heads), Bengal (4 heads), British short hair (2 heads), Devon Rex (1 head), Highland Fold (1 head), Korean short hair (57 heads), Munchkin (4 heads), Mixed seedlings (4 heads), Norwegian Forest (2 heads), Persian (15 heads), Russian Blue Genome from blood using a total of 122 cats consisting of (7 heads), Rekdol (4 heads), Scottish Fold (3 heads), Siamese (3 heads), Scottish Straight (2 heads), and Turkey's Angora (3 heads). A DNA extraction kit (Promega, USA) was used to isolate genomic DNA according to the manufacturer's protocol.

<Example 2> Selection of supersatellite markers and gender discrimination markers and preparation of amplification primers

In order to identify the cat's genes, paternity, and sex determination, a gene recognition method through a multiplex PCR method was selected from among 127 supersatellite markers, and the selected microsatellite marker was NCBI (National Center for Biotechnology). Information), based on the cat's supersatellite gene markers reported in the Mapviewer database, multiple PCR combinations were constructed, and the final 15 markers without interference reactions were selected after the empirical experiment.

To determine the sex of a cat, the length difference of the ZFP (Zinc Finger Protein) gene sequence on the sex chromosome is used to determine the detailed selection conditions: Allele Frequency, Primer Annealing Temp., and amplification. In consideration of the product size, fluorescent material (Dye), etc., a total of 15 pieces were finally divided into 1 set and combined to enable multiplex polymerase chain reaction (multiplex PCR).

The gene label names in Table 1 have been clearly defined in the prior art, and are specifically shown in NCBI.

Table 1 shows the chromosome number where each supersatellite marker is located, the size of the amplification product (base pair, bp) that appears when multiplex PCR is performed with a primer pair specific to each supersatellite marker, and fluorescence for detecting the multiplex PCR peak. Type of substance, primer combinations for all 15 supersatellite markers are shown.

number Marker chromosome Amplification product size (bp) Number of repetitions (bp) Fluorescent substance Forward (5'→3') Reverse (5'→3') One FCA170 18 90-122 4 FAM CAAGGCGTTTGGTATTTTGG (SEQ ID NO: 1) TTTACAGTCTCCCTCCTGATGC (SEQ ID NO: 2) 2 FCA1056 7 123-142 2 FAM GGTGTGAGGGCCTATTCT (SEQ ID NO: 3) GAGGATGTCTCCCTTGACTGGT (SEQ ID NO: 4) 3 FCA1344 4 230-246 2 VIC ACAGTTCCCTTACACACACACG (SEQ ID NO: 5) GGCTTCGAAACCAAATTCAA (SEQ ID NO: 6) 4 FCA770 One 90-104 2 VIC TCAAGAGTCTTTGCTCAAGGG (SEQ ID NO: 7) TTTACTTAGGACTGACAGGGCA (SEQ ID NO: 8) 5 FCA123 One 137-149 3 VIC ACTGCGAGAGGACTTTCGAA (SEQ ID NO: 9) CTTCTGACAGGCTCCAGGTT (SEQ ID NO: 10) 6 FCA954 11 183-195 2 VIC ATGTTTTAAGTGCCAACGCC (SEQ ID NO: 11) CTTGACCGAGGTCAGAATTACC (SEQ ID NO: 12) 7 FCA176 One 216-244 3 VIC GGAAACTTGGAAAGCAAAACC (SEQ ID NO: 13) TCCACAGTTGGAGTTCTTAAGG (SEQ ID NO: 14) 8 Cat29444 4 258-285 3 VIC ATCTGAAAAGCAAAAAGCAG (SEQ ID NO: 15) TGCAATGCACAATTTACAG (SEQ ID NO: 16) 9 FCA043 9 122-128 4 NED GAGCCACCCTAGCACATATACC (SEQ ID NO: 17) AGACGGGATTGCATGAAAAG (SEQ ID NO: 18) 10 FCA441 12 153-183 4 NED ATCGGTAGGTAGGTAGATATAG (SEQ ID NO: 19) GCTTGCTTCAAAATTTTCAC (SEQ ID NO: 20) 11 F42 One 226-250 4 NED CCCACGTGGACTAATCAAAT (SEQ ID NO: 21) CACTGCACAAATTAAGAGGC (SEQ ID NO: 22) 12 FCA1240 11 117-137 2 PET TCCTGATGTGGCAGTTAAACC (SEQ ID NO: 23) GCATGCCTTGAACCTTTCAT (SEQ ID NO: 24) 13 Cat18588 17 203-235 3 PET CCTTTCCTAGGACGTTTACA (SEQ ID NO: 25) CTTGATTTCTTCCCCTTCTT (SEQ ID NO: 26) 14 FCA178 One 257-269 4 PET GTGCCCCATGAATCTCACTT (SEQ ID NO: 27) TACAACTCAGGGGTCGTATGG (SEQ ID NO: 28) 15 CatXY XY Male: 163,166
Female: 166 3 PET AAGTTTACACAACCACCTGG (SEQ ID NO: 29) CACAGAATTTACACTTGTGCA (SEQ ID NO: 30)

<Example 3> Establishment of multiple polymerase chain reaction conditions

Conditions for a multiplex polymerase chain reaction were established using a primer set capable of specifically binding to 14 supersatellite markers and one gender discriminant marker selected in Example 2 above.

Specifically, multiple polymerase chain reaction (Multiplex PCR) is a template genomic DNA (20 ng/µl) 6µl, each set of fluorescent staining primers (10 pmoles) according to the supersatellite marker 0.3µl to 0.4µl per set, Hot Start Taq DNA polymerization Distilled water was added to the composition of 1 µl of enzyme (2Unit/µl), 4µl of 10X buffer, and 3µl of 2.5mM dNTP so that the total reaction solution was 25µl. The mixture was denatured for 60 seconds at 95°C for 60 seconds, bonding at 62°C for 75 seconds, starting with the first reaction for 15 minutes at 95°C using Thermal Cycler PTC-0240 (MJ Research, Inc., MA, USA). Elongation for 60 seconds for 5 cycles, 95°C for 60 seconds denaturation, 61°C for 75 seconds binding, 72°C for 60 seconds extension for 5 cycles, 95°C for 60 seconds denaturation, 60°C for 75 seconds binding, 72°C for 60 seconds After stretching and performing 25 cycles, a final stretching reaction was performed at 65° C. for 30 minutes. The amplified product after PCR is subjected to electrophoresis to be classified by size and fluorescent substance using an ABI-3730 DNA automatic sequencing device (Applied Biosysytems, USA), and PCR using GeneMapper version 4.0 (Applied Biosystem, USA). Data were collected and organized by Microsoft Excel (USA) program by classifying product size and labeling factor by type.

<Example 4> Analysis of heterozygous rate and average allele number for each supersatellite marker in cats

Finally, the alleles for each microsatellite marker determined by Genotyper Software were analyzed by microsatellite toolkit software (Park, 2000) and sorted by group and individual, and then observed heterozygous rate for the entire group. heterozygosity) and allele frequency were calculated by the following calculation formula and shown in Table 2 below.

<Calculation 1>

Pi: frequency of the ith allele

HetE: expected heterozygosity

number Variety name (Korean) Variety name
(Abbreviation) sample water Number of markers Observed heterozygous rate Standard deviation of heterozygous rate Average number of alleles Standard deviation of the number of alleles One Abyssinian AB 3 14 0.6190 0.0749 2.86 1.03 2 American curl AC One 14 0.6429 0.1281 1.64 0.50 3 American Short Hair AS 6 14 0.6667 0.0514 5.07 1.44 4 Bengal BG 4 14 0.6429 0.0640 3.43 1.09 5 British Short Hair BS 2 14 0.6786 0.0883 2.93 0.83 6 Devon Rex DR One 14 0.7857 0.1097 1.79 0.43 7 Highland fold HF One 14 0.7143 0.1207 1.71 0.47 8 Korean Short Hair KS 57 14 0.6679 0.0167 8.57 2.74 9 Munchkin MC 4 14 0.8393 0.0491 4.00 1.04 10 Mix MX 4 14 0.8036 0.0531 4.64 1.39 11 Norwegian Forest NS 2 14 0.7143 0.0854 2.36 0.63 12 Persian PS 15 14 0.7048 0.0315 6.93 2.27 13 Russian blue RB 7 14 0.6327 0.0487 5.36 1.69 14 Lectol RD 4 14 0.6071 0.0653 4.07 1.21 15 Scottish Fold SF 3 14 0.6429 0.0739 3.14 1.10 16 Siam SM 3 14 0.6905 0.0713 3.36 1.01 17 Scottish straight SS 2 14 0.6786 0.0883 2.86 0.86 18 Turkey's Angora TA 3 14 0.7619 0.0657 3.00 0.96

As a result, it was confirmed that the observed heterozygous rate for each cultivar was 0.6 or more, confirming that the alleles were expressed in various combinations for each individual, and the average number of alleles was 1 to 8, confirming that the probability of individual identification was high.

<Example 5> Diversity index analysis of supersatellite markers

The observed heterozygosity rate and PIC (polymorphic information content) value for the specimen were calculated by the formula of Equation 2, and the diversity of allele types for each cat breed is shown in Table 3 below. In addition, the observed heterozygous rate and the amount of polymorphism information for 18 cat species of each supersatellite marker are shown in Table 4 below, and the sizes of amplification products in each sex chromosome of the gender discrimination marker are shown in Table 5 below.

<Calculation Equation 2>

(n=the number of alleles, Pi, Pj=the frequency of the i or jth allele)

As a result, it was confirmed that the amplification product size, the number of alleles, the heterozygous rate, and the amount of polymorphism information (PIC) of the supersatellite marker represent various values, and thus the supersatellite marker selected in the present invention can be used to identify cat individuals. (Table 3).

In addition, the diversity of 14 supersatellite markers was confirmed through the observed heterozygous rate and polymorphism information (PIC) values for 18 cat breeds of each marker, and it was confirmed that they can be used as individual identification or paternity gene markers ( Table 4).

In addition, the cat sex marker was amplified to a size of 166 bp on the X chromosome and 163 bp on the Y chromosome, so that it was XY in the male cat (♂), showing two peaks at 166 bp and 163 bp, and the female cat (♀) At XX, the genotype was expressed as 166bp and 166bp as one peak (Table 5).

Ob H: Objectived Heterozygosity

PIC: polymorphic information content

gender Cat_X Cat_Y Male cat_XY 166 163 Female cat 166 -

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Discrimination method for product traceability and identification of Felis catus using microsatellite DNA <130> 2019P-11-045 <160> 30 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FCA170 forward primer <400> 1 caaggcgttt ggtattttgg 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCA170 reverse primer <400> 2 tttacagtct ccctcctgat gc 22 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> FCA1056 forward primer <400> 3 ggtgtgaggg cctattct 18 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCA1056 reverse primer <400> 4 gaggatgtct cccttgactg gt 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCA1344 forward primer <400> 5 acagttccct tacacacaca cg 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FCA1344 reverse primer <400> 6 ggcttcgaaa ccaaattcaa 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FCA770 forward primer <400> 7 tcaagagtct ttgctcaagg g 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCA770 reverse primer <400> 8 tttacttagg actgacaggg ca 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FCA123 forward primer <400> 9 actgcgagag gactttcgaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FCA123 reverse primer <400> 10 cttctgacag gctccaggtt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FCA954 forward primer <400> 11 atgttttaag tgccaacgcc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FCA954 reverse primer <400> 12 atgttttaag tgccaacgcc 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FCA176 forward primer <400> 13 ggaaacttgg aaagcaaaac c 21 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCA176 reverse primer <400> 14 tccacagttg gagttcttaa gg 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cat 29444 forward primer <400> 15 atctgaaaag caaaaagcag 20 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Cat 29444 reverse primer <400> 16 tgcaatgcac aatttacag 19 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCA043 forward primer <400> 17 gagccaccct agcacatata cc 22 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FCA043 reverse primer <400> 18 agacgggatt gcatgaaaag 20 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCA441 forward primer <400> 19 atcggtaggt aggtagatat ag 22 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FCA441 reverse primer <400> 20 gcttgcttca aaattttcac 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F42 forward primer <400> 21 cccacgtgga ctaatcaaat 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F42 reverse primer <400> 22 cactgcacaa attaagaggc 20 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FCA1240 forward primer <400> 23 tcctgatgtg gcagttaaac c 21 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FCA1240 reverse primer <400> 24 gcatgccttg aacctttcat 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cat18588 forward primer <400> 25 cctttcctag gacgtttaca 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cat18588 reverse primer <400> 26 cttgatttct tccccttctt 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FCA178 forward primer <400> 27 gtgccccatg aatctcactt 20 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FCA178 reverse primer <400> 28 tacaactcag gggtcgtatg g 21 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CatXY forward primer <400> 29 aagtttacac aaccacctgg 20 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CatXY reverse primer <400> 30 cacagaattt acacttgtgc a 21

Claims (10)

A set of primers of SEQ ID NOs: 7 and 8 for amplifying feline supersatellite DNA to identify feline individuals and determine sex; Primer sets of SEQ ID NOs: 13 and 14; Primer sets of SEQ ID NOs: 15 and 16; Primer sets of SEQ ID NOs: 23 and 24; Primer sets of SEQ ID NOs: 9 and 10; A set of primers of SEQ ID NOs: 1 and 2; A set of primers of SEQ ID NOs: 25 and 26; And SEQ ID NO: 29 and 30 comprising a primer set, cat individual identification and sex determination supersatellite marker composition.
The method of claim 1, wherein the primer set of SEQ ID NO: 11 and 12; Primer sets of SEQ ID NOs: 19 and 20; Primer sets of SEQ ID NOs: 27 and 28; Primer sets of SEQ ID NOs: 3 and 4; And that further comprises a primer set of SEQ ID NO: 17 and 18, cat individual identification and sex determination supersatellite marker composition.
The method of claim 2, wherein the primer set of SEQ ID NO: 21 and 22; And that further comprises a primer set of SEQ ID NOs: 5 and 6, cat individual identification and sex determination supersatellite marker composition.
A kit for individual identification and gender discrimination of cats comprising the composition of any one of claims 1 to 3.
1) extracting a nucleic acid from a target sample;
2) using the extracted nucleic acid as a template and performing a polymerase chain reaction with the composition of claim 1 to amplify feline supersatellite DNA; And
3) the step of identifying the individual of the cat by detecting the allele and analyzing the size of the product amplified in the amplification step through an electrophoresis device; and the method of identifying the individual and sex of the cat comprising.
1) extracting a nucleic acid from a target sample;
2) using the extracted nucleic acid as a template and performing a polymerase chain reaction with the composition of claim 2 to amplify feline supersatellite DNA; And
3) the step of identifying the individual of the cat by detecting the allele and analyzing the size of the product amplified in the amplification step through an electrophoresis device; and the method of identifying the individual and sex of the cat comprising.
1) extracting a nucleic acid from a target sample;
2) amplifying feline supersatellite DNA by subjecting the extracted nucleic acid as a template and performing a polymerase chain reaction with the composition of claim 3; And
3) the step of identifying the individual of the cat by detecting the allele and analyzing the size of the product amplified in the amplification step through an electrophoresis device; and the method of identifying the individual and sex of the cat comprising.
The method of any one of claims 5 to 7, wherein the polymerase chain reaction is performed at 95°C for 15 minutes, 95°C for 60 seconds, 60 to 62°C for 75 seconds, and 72°C for 60 seconds. Repeating 25 to 35 times in one cycle, and reacting at 65° C. for 30 minutes, a method for individual identification and sex determination of cats.
The method of any one of claims 1 to 3, wherein the feline supersatellite DNA has a heterozygosity higher than 0.6 and a polymorphism information content (PIC) higher than 0.5, cat Supersatellite marker composition for individual identification and gender identification.
The method of any one of claims 5 to 7, wherein the feline supersatellite DNA has a heterozygous rate higher than 0.6 and a polymorphism information amount higher than 0.5.