KR102160486B1 - PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same - Google Patents

PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same Download PDF

Info

Publication number
KR102160486B1
KR102160486B1 KR1020180156845A KR20180156845A KR102160486B1 KR 102160486 B1 KR102160486 B1 KR 102160486B1 KR 1020180156845 A KR1020180156845 A KR 1020180156845A KR 20180156845 A KR20180156845 A KR 20180156845A KR 102160486 B1 KR102160486 B1 KR 102160486B1
Authority
KR
South Korea
Prior art keywords
seq
nucleotide sequence
respiratory syndrome
syndrome virus
represented
Prior art date
Application number
KR1020180156845A
Other languages
Korean (ko)
Other versions
KR20200069603A (en
Inventor
김성희
이경기
김연희
문보연
박지영
소병재
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020180156845A priority Critical patent/KR102160486B1/en
Publication of KR20200069603A publication Critical patent/KR20200069603A/en
Application granted granted Critical
Publication of KR102160486B1 publication Critical patent/KR102160486B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/107—Modifications characterised by incorporating a peptide nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00—Reactions demanding special reaction conditions
    • C12Q2527/107—Temperature of melting, i.e. Tm

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 돼지생식기호흡기증후군 바이러스 유전형에 따라 표적 핵산과의 혼성화 양상이 상이한 서열번호 3의 염기서열로 표시되는 PNA 프로브와 서열번호 6의 염기서열로 표시되는 PNA 프로브 및 이를 이용한 돼지생식기호흡기증후군 바이러스 유전형 판별방법에 관한 것으로, 본 발명은 돼지생식기호흡기증후군 바이러스 유전형을 한 번의 실험으로 구분하고, 종래 방법으로 용이하게 구분하기 어려웠던 위양성결과에 대한 정확하게 음성을 판단할 수 있는 장점이 있다.The present invention is a PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6 with different hybridization patterns with the target nucleic acid according to the porcine reproductive respiratory syndrome virus genotype, and porcine reproductive respiratory syndrome virus using the same The present invention relates to a genotype determination method, and the present invention has the advantage of classifying the porcine reproductive respiratory syndrome virus genotype in one experiment, and accurately determining negative for false-positive results, which were difficult to distinguish easily by conventional methods.

Description

돼지생식기호흡기증후군(PRRS) 바이러스 유전형 판별용 PNA 프로브 및 이를 이용한 돼지생식기호흡기증후군(PRRS) 유전형 판별방법{PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same}PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus using the PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same}

본 발명은 돼지생식기호흡기증후군 바이러스 유전형 판별용 PNA 프로브 및 이를 이용한 돼지생식기호흡기증후군 바이러스 유전형 판별방법에 관한 것으로, 더욱 상세하게는 돼지생식기호흡기증후군 바이러스 1형 유전형에 특이적인 PNA 프로브와 돼지생식기호흡기증후군 바이러스 2형 유전형에 특이적인 PNA 프로브 및 이를 이용하여 돼지생식기호흡기증후군 바이러스의 유전형을 판별하는 방법에 관한 것이다.The present invention relates to a PNA probe for genotyping of porcine genital respiratory syndrome virus and a method for discriminating genotype of porcine genital respiratory syndrome virus using the same. The present invention relates to a PNA probe specific for virus type 2 genotype and a method for determining the genotype of porcine reproductive respiratory syndrome virus using the same.

돼지생식기호흡기증후군(PRRS)은 모돈인 경우 임신말기에 유산 및 조산을 일으키며 자돈이나 육성돈에서는 호흡기질환을 일으키는 질병이다. PRRSV의 PRRSV1 (European, EU)와 PRRSV2 (North American, NA) 두 유전형은 1880년대에 가장 빈번하게 발생하는 두 지역을 중심으로 다양하게 분기되며, 대략 60%의 뉴클레오티드 서열 동일성을 가지고, 현저한 유전 및 항원변이를 나타낸다. 한국에서는 1990년대 초반 PRRSV2이 발생하였고, PRRSV1는 2005년 최초 분리되었으며, 이후 두 유전형이 돼지 농가에서 함께 발생하고 있다.Porcine reproductive respiratory syndrome (PRRS) is a disease that causes miscarriage and premature birth in the end of pregnancy in sows and respiratory diseases in piglets and nursing pigs. The two genotypes of PRRSV, PRRSV1 (European, EU) and PRRSV2 (North American, NA) divergently diverge around the two most frequently occurring regions of the 1880s, have approximately 60% nucleotide sequence identity, and have significant genetic and Indicates antigenic mutation. In Korea, PRRSV 2 occurred in the early 1990s, and PRRSV 1 was first isolated in 2005, and since then, both genotypes have occurred in pig farms.

PRRS 유전체는 대략 15kb 길이로, 5' 말단은 캡핑되어 있고, 3' 말단은 폴이아데닐화되어 있다. 이는 ORF1a, 1b, 2a, 2b, 3, 4, 5a, 5b, 6, 및 7를 비롯하여 10개의 ORF를 가지고 있으며, ORF6 및 ORF7이 막단백질과 뉴클레오캡시드 단백질을 각각 인코딩하며 PRRSV 검출을 위한 표적 위치로 종종 이용된다. 2000년대에 한국형 PRRSV1 ORF7은 상호간 88.8-99.7% 서열 동일성을 보이고, 다른 지역의 PRRSV1 ORF7과는 79.1-95.0%의 서열 동일성을 보여주며, 범-유럽 서브타입 I내에 독특한 클러스터를 형성하였다. 유사하게, PRRSV2 ORF7은 상호간 86.2-100.0% 서열 상동성을 보이고, 다른 지역의 PRRSV2 ORF7과는 88.3-100.0% 서열 상동성을 보여주며, 한국형 PRRSV2가 독특한 계통 분기를 형성하는 한국형 균주(Group 2)와 함께 4개의 그룹으로 분류된다는 계통 분류학적 분석이 보고되었다(Yoon et al., 2008). 한편, 한국형 PRRSV1에 대한 2012년의 ORF6 서열 동일성은 한국형 간에는 93.2-98.6% , 한국형 이외의 분리균주와는 85.6-94.4%로 보고되었다. 따라서, ORF-6 및 ORF-7에 기초한 PCR 효율은 지속적으로 검증되어야 한다. 한편, 아직까지 하나의 역전사 중합연쇄반응만으로 PRRSV1의 매우 다양한 동 유럽 서브타입을 포함하여 모든 PRRSV 유전형을 검출할 수 있다고 OIE 보고된바 없다. The PRRS genome is approximately 15 kb long, the 5'end is capped and the 3'end is polyadenylation. It has 10 ORFs including ORF1a, 1b, 2a, 2b, 3, 4, 5a, 5b, 6, and 7, and ORF6 and ORF7 encode membrane proteins and nucleocapsid proteins, respectively, and are targets for PRRSV detection. Often used as a location. In the 2000s, Korean PRRSV1 ORF7 showed 88.8-99.7% sequence identity with each other, 79.1-95.0% sequence identity with PRRSV1 ORF7 in other regions, and formed a unique cluster within pan-European subtype I. Similarly, PRRSV2 ORF7 shows 86.2-100.0% sequence homology with each other, 88.3-100.0% sequence homology with PRRSV2 ORF7 in other regions, and Korean-type PRRSV2 forms a unique phylogenetic branch (Group 2). A phylogenetic analysis was reported that it was classified into 4 groups together with (Yoon et al., 2008). On the other hand, the 2012 ORF6 sequence identity to Korean PRRSV1 was reported to be 93.2-98.6% between Korean types and 85.6-94.4% with isolates other than Korean types. Therefore, the PCR efficiency based on ORF-6 and ORF-7 must be continuously verified. On the other hand, it has not yet been reported by OIE that only one reverse transcription polymerization chain reaction can detect all PRRSV genotypes, including a wide variety of Eastern European subtypes of PRRSV1.

몇 가지 연구에서 real-time RT-PCR (rRT-PCR)을 이용하여 PRRSV를 검출한 사례가 있으나, 낮은 커브 및 높은 사이클 임계값(Ct) 때문에 증폭된 산물과 형광 인공물(artifacts)을 구별하기 어려웠다.In several studies, PRRSV was detected using real-time RT-PCR (rRT-PCR), but it was difficult to distinguish between amplified products and fluorescent artifacts due to the low curve and high cycle threshold (Ct). .

이에 본 발명에서는 이러한 문제점을 극복하기 위하여 프로브 기반의 형광 멜팅 커브 분석(FMCA)를 이용하여 다른 염기서열을 갖는 PRRSV의 상이한 melting temperature (T m)에 기초하여 PRRSV를 구분할 수 있도록 하였다. 특히, 본 발명에서는 PNA 기반의 FMCA를 rRT-PCR과 조합하여 인공물(artifacts) 반응을 최소하였으며, PCR의 특이도를 증가시킬 수 있었다. 따라서, 본 발명은 원-스텝 rRT-PCR 반응을 통해 PRRSV1과 PRRSV2를 동시에 검출할 수 있는 특징이 있다.Accordingly, in the present invention, in order to overcome this problem, PRRSV can be distinguished based on different melting temperatures ( T m ) of PRRSVs having different base sequences by using probe-based fluorescence melting curve analysis (FMCA). In particular, in the present invention, the PNA-based FMCA was combined with rRT-PCR to minimize the reaction of artifacts, and the specificity of PCR could be increased. Accordingly, the present invention has a feature that can simultaneously detect PRRSV1 and PRRSV2 through a one-step rRT-PCR reaction.

Drigo, M. et al., 2014. Validation and comparison of different end point and real time RT-PCR assays for detection and genotyping of porcine reproductive and respiratory syndrome virus. J. Virol. Methods 201, 79-85.Drigo, M. et al., 2014. Validation and comparison of different end point and real time RT-PCR assays for detection and genotyping of porcine reproductive and respiratory syndrome virus. J. Virol. Methods 201, 79-85. Egli, C. et al., 2001. Quantitative TaqMan RT-PCR for the detection and differentiation of European and North American strains of porcine reproductive and respiratory syndrome virus. J. Virol. Methods 98, 63-75.Egli, C. et al., 2001. Quantitative TaqMan RT-PCR for the detection and differentiation of European and North American strains of porcine reproductive and respiratory syndrome virus. J. Virol. Methods 98, 63-75. Kleiboeker, S.B. et al., 2005. Simultaneous detection of North American and European porcine reproductive and respiratory syndrome virus using real-time quantitative reverse transcrpitase-PCR. J. Vet. Diagn. Invest. 17, 165-170.Kleiboeker, S.B. et al., 2005. Simultaneous detection of North American and European porcine reproductive and respiratory syndrome virus using real-time quantitative reverse transcrpitase-PCR. J. Vet. Diagn. Invest. 17, 165-170. Lurchachaiwong, W. et al., 2008. Rapid detection and strain identification of porcine reproductive and respiratory syndrome virus (PRRSV) by real-time RT-PCR. Lett. Appl. Microbiol. 46, 55-60.Lurchachaiwong, W. et al., 2008. Rapid detection and strain identification of porcine reproductive and respiratory syndrome virus (PRRSV) by real-time RT-PCR. Lett. Appl. Microbiol. 46, 55-60. Shi, X. et al., 2016. A multiplex real-time PCR panel assay for simultaneous detection and differentiation of 12 common swine viruses. J. Virol. Methods 236, 258-265.Shi, X. et al., 2016. A multiplex real-time PCR panel assay for simultaneous detection and differentiation of 12 common swine viruses. J. Virol. Methods 236, 258-265. Wu, H. et al., 2014. A sensitive multiplex real-time PCR panel for rapid diagnosis of viruses associated with porcine respiratory and reproductive disorders. Mol. Cell. Probes 28, 264-270.Wu, H. et al., 2014. A sensitive multiplex real-time PCR panel for rapid diagnosis of viruses associated with porcine respiratory and reproductive disorders. Mol. Cell. Probes 28, 264-270. Yoon, S.H. et al., 2008. Genetic characterization of the Korean porcine reproductive and respiratory syndrome viruses based on the nucleocapsid protein gene (ORF7) sequences. Arch. Virol. 153, 627-635.Yoon, S.H. et al., 2008. Genetic characterization of the Korean porcine reproductive and respiratory syndrome viruses based on the nucleocapsid protein gene (ORF7) sequences. Arch. Virol. 153, 627-635. Drigo, M. et al., 2014. Validation and comparison of different end point and real time RT-PCR assays for detection and genotyping of porcine reproductive and respiratory syndrome virus. J. Virol. Methods 201, 79-85.Drigo, M. et al., 2014. Validation and comparison of different end point and real time RT-PCR assays for detection and genotyping of porcine reproductive and respiratory syndrome virus. J. Virol. Methods 201, 79-85.

본 발명의 목적은 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 PNA 프로브를 제공하는데 있다.It is an object of the present invention to provide a PNA probe for genotyping porcine genital respiratory syndrome virus (PRRSV).

본 발명의 다른 목적은 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 조성물 및 키트를 제공하는데 있다.Another object of the present invention is to provide a composition and kit for genotyping porcine genital respiratory syndrome virus (PRRSV).

본 발명의 또 다른 목적은 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별방법을 제공하는데 있다.Another object of the present invention is to provide a method for genotyping porcine genital respiratory syndrome virus (PRRSV).

상기 목적을 달성하기 위하여 본 발명은 서열번호 3의 염기서열로 표시되는 돼지생식기호흡기증후군 바이러스 1형(PRRSV1) 유전형 판별용 PNA 프로브를 제공한다.In order to achieve the above object, the present invention provides a PNA probe for genotype determination of porcine reproductive respiratory syndrome virus type 1 (PRRSV1) represented by the nucleotide sequence of SEQ ID NO: 3.

본 발명은 또한, 서열번호 6의 염기서열로 표시되는 돼지생식기호흡기증후군 바이러스 2형(PRRSV2) 유전형 판별용 PNA 프로브를 제공한다.The present invention also provides a PNA probe for genotype identification of porcine reproductive respiratory syndrome virus type 2 (PRRSV2) represented by the nucleotide sequence of SEQ ID NO: 6.

본 발명은 또한, 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브를 포함하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 조성물을 제공한다.The present invention also provides a composition for discriminating porcine reproductive respiratory syndrome virus (PRRSV) genotype comprising a PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6.

본 발명은 또한, 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브를 포함하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 키트를 제공한다.The present invention also provides a kit for genotyping porcine reproductive respiratory syndrome virus (PRRSV) comprising a PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6.

본 발명은 또한, 다음 단계를 포함하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별방법을 제공한다.The present invention also provides a method for genotyping porcine genital respiratory syndrome virus (PRRSV) comprising the following steps.

(a) 검체 시료로부터 표적 핵산을 추출하는 단계;(a) extracting a target nucleic acid from the specimen;

(b) 상기 표적 핵산에 포함된 돼지생식기호흡기증후군 바이러스(PRRSV)를 주형으로 프라이머 쌍을 이용하여 증폭된 서열단편을 생성시키는 단계;(b) generating a sequence fragment amplified using a primer pair using the porcine genital respiratory syndrome virus (PRRSV) contained in the target nucleic acid as a template;

(c) 상기 증폭된 서열단편을 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브와 혼성화시키는 단계;(c) hybridizing the amplified sequence fragment with a PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6;

(d) 상기 혼성화된 산물의 온도를 높이며 온도별 융해곡선을 얻는 단계; 및(d) increasing the temperature of the hybridized product and obtaining a melting curve for each temperature; And

(e) 상기 융해곡선에서 서열번호 3의 염기서열로 표시되는 PNA 프로브에 의한 융해 피크가 관찰되면 돼지생식기호흡기증후군 바이러스 1형(PRRSV1) 유전형으로 판별하고, 상기 융해곡선에서 서열번호 6의 염기서열로 표시되는 PNA 프로브에 의한 융해 피크가 관찰되면 돼지생식기호흡기증후군 바이러스 2형(PRRSV2) 유전형으로 판별하는 단계.(e) If the melting peak of the PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 is observed in the melting curve, it is determined as the porcine reproductive respiratory syndrome virus type 1 (PRRSV1) genotype, and the nucleotide sequence of SEQ ID NO: 6 in the melting curve When the melting peak by the PNA probe represented by is observed, the step of determining as the porcine reproductive respiratory syndrome virus type 2 (PRRSV2) genotype.

본 발명은 종래 방법으로 용이하게 구분하기 어려웠던 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형을 한 번의 실험으로, 신속, 정확하게 검출할 수 있는 장점이 있다. The present invention has the advantage of being able to quickly and accurately detect the porcine reproductive respiratory syndrome virus (PRRSV) genotype, which was difficult to distinguish easily by the conventional method, in one experiment.

도 1은 본 발명의 일실시예에 따른 PNA-프로브 기반 원-스텝 rRT-PCR 방법을 사용하여 FMCA로 PRRSV를 검출한 결과이다. 10-배 순차적 희석법에 의해 107~101 카피수의 범위에 대해 표준곡선을 도출하고(A, B), 이에 따른 융해 곡선(C, D)과 융해 온도(E, F)를 확인하였다. 도면에서 파란선은 PRRSV1, 녹색선은 PRRSV2를 나타낸다.
도 2는 본 발명의 일실시예에 따른 PNA-프로브 기반 원-스텝 rRT-PCR 방법을 사용하여 낮은 융해 곡선과 높은 Ct 값을 갖는 7개의 위양성을 보이는 음성시료샘플을 확인한 결과이다. 도면에서 파란선은 PRRSV1, 녹색선은 PRRSV2를 나타낸다.
도 3은 본 발명의 일실시예에 따른 PNA-프로브 기반 원-스텝 rRT-PCR 방법을 사용하여 PRRSV1을 포함한 샘플, PRRSV2을 포함한 샘플, PRRSV1와 PRRSV2가 모두 포함된 샘플 및 음성 샘플에서 융해 곡선과 융해 온도를 확인한 결과이다.1 is a result of detecting PRRSV by FMCA using a PNA-probe-based one-step rRT-PCR method according to an embodiment of the present invention. A standard curve was derived for the range of 10 7 ~ 10 1 copy number by 10-fold sequential dilution method (A, B), and the melting curves (C, D) and melting temperatures (E, F) were confirmed accordingly. In the drawing, the blue line represents PRRSV1 and the green line represents PRRSV2.
FIG. 2 is a result of confirming 7 false-positive negative sample samples having a low melting curve and a high Ct value using a PNA-probe-based one-step rRT-PCR method according to an embodiment of the present invention. In the drawing, the blue line represents PRRSV1 and the green line represents PRRSV2.
3 is a melting curve in a sample containing PRRSV1, a sample containing PRRSV2, a sample containing both PRRSV1 and PRRSV2, and a negative sample using a PNA-probe-based one-step rRT-PCR method according to an embodiment of the present invention. This is the result of checking the melting temperature.

다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술 분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by an expert skilled in the art to which the present invention belongs. In general, the nomenclature used in this specification is well known and commonly used in the art.

ORF6 및 ORF7과 같이 보존된 영역에서 유전적 변이로 인한 PRRSV 검출을 위한 핵산 기반 분석을 진행하며 양성과 음성을 구분하는 데에는 많은 주의가 필요하다. 시간적 차이를 두고 수집한 한국형 PRRSV1에 대한 ORF6 및 ORF7의 유전적 거리는 각각 90.2-100% 및 87.3-100%이고, PRRSV2에 대한 ORF6 및 ORF7의 유전적 거리는 각각 86.5-100% 및 83.7-100%으로 나타난 최근 연구 결과를 살펴볼 때, 위음성 결과를 최소화하기 위해서는 최근 확인된 유전적 변이를 반영할 수 있도록 프라이머와 프로브를 설계하여야 한다. In conserved regions such as ORF6 and ORF7, a nucleic acid-based assay for detection of PRRSV due to genetic variation is performed, and a lot of care is required to distinguish between positive and negative. The genetic distances of ORF6 and ORF7 to Korean PRRSV1 collected with time differences were 90.2-100% and 87.3-100%, respectively, and the genetic distances of ORF6 and ORF7 to PRRSV2 were 86.5-100% and 83.7-100%, respectively. Looking at the results of recent studies that have appeared, in order to minimize false negative results, primers and probes should be designed to reflect the recently identified genetic variation.

본 발명에서는 ORF6가 서열 거리 면에서 ORF7에 비해 더 잘 보존되어 있기 때문에, ORF6를 PNA 기반 원스텝 rRT-PCR 개발을 위한 구역으로 선정하였다. 또한, PRRSV에 대한 630개의 ORF6 지역을 GenBank에서 확인하고, 본 발명에서 분리된 균주들을 함께 정렬하여 프라이머 세트와 PNA 프로브를 디자인함으로써, 한국에서 발견되는 PRRSV1과 PRRSV2의 두 유전형을 동시에 검출할 수 있도록 하였다. 본 발명자들의 연구결과에 따르면 PRRSV1 패널의 ORF6와 ORF7에 대한 뉴클레오티드 서열 분기는 0.2~11.4%, PRRSV2 패널의 ORF6와 ORF7에 대한 뉴클레오티드 서열 분기는 0.2~16.1%로 나타났으며, 이들 한국형 PRRSV 패널에 대한 in silico PCR 분석 결과, 본 발명의 종래의 검출 방법보다 프라이머와 프로브는 한국형 PRRSV에 대한 더 높은 특이성을 나타내었고, 본 발명에서 사용한 모든 한국형 바이러스의 검출이 가능하였다. In the present invention, since ORF6 is better preserved than ORF7 in terms of sequence distance, ORF6 was selected as an area for PNA-based one-step rRT-PCR development. In addition, 630 ORF6 regions for PRRSV were identified in GenBank, and the strains isolated in the present invention were aligned together to design a primer set and a PNA probe, so that two genotypes of PRRSV1 and PRRSV2 found in Korea can be detected at the same time. I did. According to the research results of the present inventors, the nucleotide sequence branching for ORF6 and ORF7 in the PRRSV1 panel was 0.2 to 11.4%, and the nucleotide sequence branching for ORF6 and ORF7 in the PRRSV2 panel was 0.2 to 16.1%, and these Korean PRRSV panels showed that As a result of in silico PCR analysis of the present invention, primers and probes showed higher specificity for Korean PRRSV than the conventional detection method of the present invention, and it was possible to detect all Korean-type viruses used in the present invention.

즉, 종래에 발표된 프라이머와 프로브는 한국형 PRRSV에 대해 적용 범위가 매우 낮아, PRRSV1에 대해 Egli et al.(2001)의 프라이머와 프로브를 사용하는 경우 오직 29%에 대해서만 적용이 가능하였는데 이는 in silico 분석시 패널 바이러스 10개와 Egli et al.(2001)이 사용한 프라이머 및 프로브의 3' 말단과의 미스매치가 바이러스 검출에 부정적 영향을 미친 것으로 판단되었다. 개발한 진단법의 검출 민감도는 10-15 카피로 이는 이전에 보고된 값(Drigo et al., 2014; Lurchachaiwong et al., 2008)과 유사하거나 10배 이상 높았으며, 반복 재현성(inter-/intra-run repeatability)도 CV 값이 최대 2.3%를 보였다.In other words, conventionally published primers and probes have a very low application range for Korean PRRSV, so when using the primers and probes of Egli et al. (2001) for PRRSV1, only 29% can be applied. This in silico In the analysis, it was determined that the mismatch between 10 panel viruses and the 3'end of the primer and probe used by Egli et al. (2001) had a negative effect on virus detection. The detection sensitivity of the developed diagnostic method was 10-15 copies, which was similar or more than 10 times higher than the previously reported value (Drigo et al., 2014; Lurchachaiwong et al., 2008), and repeated reproducibility (inter-/intra-). run repeatability) also showed a maximum CV of 2.3%.

PNA는 몇몇 병원균의 분자 진단에 적용되고 있으며, PNA의 비하전적 특성 때문에 강한 PNA/DNA 이중체를 형성할 수 있기 때문에 상보적 핵산과의 결합에서 높은 친화성 및 서열 특이성을 갖는다. 한편, FMCA는 PNA의 혼성화 반응속도론으로부터 발생하는 PNA/DNA 이중체의 Tm값을 분석하는데 사용될 수 있으며, 본 발명에서사용된 PNA-기반 rRT-PCR과 함께 FMCA를 이용한 비특이적 증폭과 특이적 증폭 사이의 차별성은 PRRSV 유전형의 정확하고 민감한 검출을 가능하게 하였다. PNA has been applied to molecular diagnosis of several pathogens, and because of its non-charged nature, it can form a strong PNA/DNA duplex, so it has high affinity and sequence specificity in binding to a complementary nucleic acid. On the other hand, FMCA can be used to analyze the Tm value of the PNA/DNA duplex generated from the kinetics of hybridization of PNA, and between non-specific amplification and specific amplification using FMCA together with the PNA-based rRT-PCR used in the present invention. The differentiation of PRRSV enabled accurate and sensitive detection of the genotype of PRRSV.

자연 감염된 돼지로부터 얻은 임상 샘플에 대한 PNA-기반 rRT-PCR을 이용한 FMCA 방법을 적용해 본 결과, 한국형 PRRSV를 높은 특이도로 검출할 수 있었고, 높은 Ct 값(Ct≥38)의 7개의 샘플은 모두 음성으로 진단되어 위양성 시료에 대한 진단 정확도도 높은 것으로 나타났다. 또한, 임상 샘플로부터 농장들간의 PRRSV1과 PRRSV2에 대한 바이러스 감염이 상이함을 구별해 낼 수 있었다. As a result of applying the FMCA method using PNA-based rRT-PCR to clinical samples obtained from naturally infected pigs, Korean PRRSV could be detected with high specificity, and all 7 samples with high Ct values (Ct≥38) As it was diagnosed as negative, the accuracy of diagnosis was also high for false-positive samples. In addition, it was possible to distinguish between the different farms in viral infections for PRRSV1 and PRRSV2 from clinical samples.

따라서, 본 발명은 일 관점에서 서열번호 3의 염기서열로 표시되는 돼지생식기호흡기증후군 바이러스 1형(PRRSV1) 유전형 판별용 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 돼지생식기호흡기증후군 바이러스 2형(PRRSV2) 유전형 판별용 PNA 프로브에 관한 것이다.Therefore, in one aspect, the present invention is a PNA probe for determining the genotype of porcine reproductive respiratory syndrome virus type 1 (PRRSV1) represented by the nucleotide sequence of SEQ ID NO: 3, and the porcine reproductive respiratory syndrome virus type 2 represented by the base sequence of SEQ ID NO: 6 ( PRRSV2) It relates to a PNA probe for genotyping.

본 발명에서 상기 PNA 프로브는 하나의 말단에 리포터(reporter)가 결합되어 있고 다른 말단에 상기 리포터 형광을 소광(quenching)할 수 있는 소광자가 결합되어 있는 소광자(quencher)의 형광 물질이 결합할 수 있다. 상기 리포터(reporter)는 FAM(6-carboxyfluorescein), Texas red, HEX(2',4',5',7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3 및 Cy5로 구성되는 군에서 선택되는 하나 이상일 수 있으며, 상기 소광자는 TAMRA(6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 및 Dabcyl로 구성되는 군에서 선택되는 하나 이상일 수 있으나, 이에 한정되는 것은 아니며, 바람직하게는 Dabcyl(FAM-labeled)을 사용할 수 있다.In the present invention, the PNA probe has a reporter attached to one end and a quencher fluorescent substance to which a quencher capable of quenching the reporter fluorescence is attached to the other end. have. The reporter is FAM (6-carboxyfluorescein), Texas red, HEX (2',4',5',7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3 and Cy5. It may be one or more selected from the group consisting of, and the quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2, and Dabcyl, but is not limited thereto, and preferably Dabcyl (FAM-labeled) can be used.

펩티드핵산(Peptide nucleic acid, PNA)이란 핵산염기가 인산 결합이 아닌 펩티드 결합으로 연결된 유사 DNA로, 1991년에 Nielsen 등에 의해 처음으로 합성되었으며, 자연계에서는 발견되지 않아 화학적인 방법으로 인공 합성될 수 있다. Peptide nucleic acid (PNA) is a similar DNA in which a nucleic acid base is linked by a peptide bond rather than a phosphoric acid bond.It was first synthesized by Nielsen et al. in 1991, and it is not found in nature, so it can be artificially synthesized by chemical methods. .

PNA는 LNA(Locked nucleic acid) 또는 MNA(Mopholino nucleic acid)와 같이 유전자 인식물질의 하나로, 기본 골격이 폴리아미드(polyamide)로 구성되어 있다. PNA는 친화도(affinity)와 선택성(selectivity)이 매우 우수하며, 핵산분해효소에 대한 안정성이 높아 현존하는 제한효소(restriction enzyme)로 분해되지 않는 장점이 있다. 또한, 열/화학적으로 물성 및 안정성이 높아 보관이 용이하고 쉽게 분해되지 않는 장점이 있다. PNA is one of the gene recognition materials such as LNA (Locked Nucleic Acid) or MNA (Mopholino nucleic acid), and its basic skeleton is composed of polyamide. PNA has very good affinity and selectivity, and has the advantage of not being degraded by existing restriction enzymes due to high stability against nucleases. In addition, thermal/chemical properties and stability are high, so storage is easy and it is not easily decomposed.

PNA는 상보적인 염기 서열의 천연 핵산과 혼성화(hybridization) 반응을 통해 이중가닥을 형성한다. 길이가 같은 경우 PNA/DNA 이중가닥은 DNA/DNA 이중가닥보다, PNA/RNA 이중가닥은 DNA/RNA 이중가닥보다 안정하다. 또한, PNA는 단일 염기 부정합(single base mismatch) 때문에 이중 가닥이 불안정해지는 정도가 크기 때문에 SNP(single nucleotide polymorphism)를 검출하는 능력이 천연핵산보다 더 뛰어나다PNA forms double strands through a hybridization reaction with a natural nucleic acid having a complementary base sequence. When the length is the same, the PNA/DNA double strand is more stable than the DNA/DNA double strand, and the PNA/RNA double strand is more stable than the DNA/RNA double strand. In addition, because PNA has a high degree of unstable double-strand due to single base mismatch, it has superior ability to detect single nucleotide polymorphism (SNP) than natural nucleic acids.

또한, DNA-DNA 결합력보다 PNA-DNA 결합력이 매우 우수하여 1개의 뉴클레오티드 미스 매치(nucleotide miss match)에도 10~15℃ 가량 차이가 난다. 이러한 결합력의 차이를 이용하여 SNP(Single-nucleotide polymorphism) 및 In/Del의 뉴클레오티드(nucleotide)의 변화를 검출(detection)할 수 있게 된다.In addition, the PNA-DNA binding power is very superior to the DNA-DNA binding power, so even one nucleotide miss match differs by about 10 to 15°C. Using this difference in avidity, it is possible to detect changes in SNP (Single-nucleotide polymorphism) and In/Del nucleotides.

본 발명에 따른 PNA 염기서열의 길이는 특별히 제한되지는 않지만, 바이러스 종류에 따른 특정 염기서열(예컨대, 염기변이 또는 단일염기 다형성(single nucleotide polymorphism, SNP))이 포함되도록 10~18mer 길이로 제작할 수 있다. 이 때, PNA 프로브의 길이를 조절하여 원하는 Tm값을 가지도록 PNA 프로브를 디자인할 수도 있고, 같은 길이의 PNA 프로브라도 염기서열에 변화를 주어 Tm값을 조절하는 것도 가능하다. 또한, PNA 프로브는 DNA보다 결합력이 우수하여 기본적인 Tm값이 높기 때문에 DNA보다 짧은 길이로 디자인이 가능하여 가깝게 이웃한 염기변이 또는 SNP라도 검출이 가능하다. 기존의 HRM(High Resolution Melt) 방법에 의하면 Tm값의 차이가 약 0.5℃로 매우 적어서 추가적인 분석프로그램이나 세밀한 온도 변화 또는 보정을 필요로 하고, 이 때문에 2개 이상의 염기변이 또는 SNP가 나타날 경우에는 분석이 어려웠지만, 본 발명에 따른 PNA 프로브는 PNA 프로브의 서열과 SNP에 대해서는 영향을 받지 않아 간편하게 분석이 가능하다.Although the length of the PNA nucleotide sequence according to the present invention is not particularly limited, it can be produced in a length of 10 to 18 mer to include a specific nucleotide sequence (e.g., base mutation or single nucleotide polymorphism (SNP)) according to the virus type. have. At this time, it is possible to design a PNA probe to have a desired Tm value by adjusting the length of the PNA probe, or it is possible to adjust the Tm value by changing the nucleotide sequence even with a PNA probe of the same length. In addition, since PNA probes have better binding power than DNA and have a high basic Tm value, they can be designed to have a shorter length than DNA, so that even a neighboring base mutation or SNP can be detected. According to the existing HRM (High Resolution Melt) method, the difference in Tm value is very small, about 0.5℃, requiring additional analysis programs or detailed temperature change or correction. For this reason, analysis when two or more base mutations or SNPs appear. Although this was difficult, the PNA probe according to the present invention is not affected by the sequence and SNP of the PNA probe, and thus can be conveniently analyzed.

예를 들어, PNA 프로브가 12개의 염기서열을 포함하는 경우에는, 가운데 염기서열 중 하나 이상의 위치에 바이러스의 염기변이 또는 SNP 부위에 상응하는 서열을 가지는 것이 바람직하다. 또한, PNA 프로브는 염기서열의 가운데 부분에 바이러스의 염기변이 또는 SNP 부위에 상응하는 서열을 포함하여 구조적인 변형을 가질 수 있고, 이를 통해 완전한 혼성화를 이루는 표적 핵산(perfect match)과의 융해온도(Tm) 차이를 더욱 크게 할 수 있다.For example, when the PNA probe includes 12 nucleotide sequences, it is preferable to have a sequence corresponding to the nucleotide mutation or SNP site of the virus at one or more of the nucleotide sequences in the middle. In addition, the PNA probe may have structural modifications by including a sequence corresponding to a virus base mutation or SNP site in the middle part of the base sequence, and through this, the melting temperature with the target nucleic acid (perfect match) ( Tm) The difference can be made even larger.

한편, 본 발명에서는 상기 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 PNA 프로브와 혼성화하는 표적 핵산을 특이적으로 증폭할 수 있는 프라이머 쌍과 2 종의 유전형 판별용 PNA 프로브를 함께 포함하는 조성물을 사용하면 한 번의 간단한 실험으로 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형을 판별할 수 있음을 확인하였다.On the other hand, in the present invention, a composition comprising a primer pair capable of specifically amplifying a target nucleic acid hybridizing with the PNA probe for determining the porcine reproductive respiratory syndrome virus (PRRSV) genotype and two PNA probes for determining the genotype is used. It was confirmed that the genotype of porcine genital respiratory syndrome virus (PRRSV) can be identified with one simple experiment.

따라서, 본 발명은 또 다른 관점에서 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브를 포함하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 조성물 및 키트에 관한 것이다.Therefore, in another aspect, the present invention is a composition and kit for discriminating porcine reproductive respiratory syndrome virus (PRRSV) genotype comprising a PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6 About.

본 발명에 있어서, 상기 조성물 및 키트는 각각 돼지생식기호흡기증후군 바이러스(PRRSV) 서열 단편 증폭용 프라이머 쌍을 추가로 포함하는 것을 특징으로 할 수 있으며, 이에 한정되지는 않으나, PRRSV1 서열 단편 증폭용 프라이머 쌍은 서열번호 1의 염기서열로 표시되는 프라이머와 서열번호 2의 염기서열로 표시되는 프라이머인 것을 특징으로 할 수 있고, PRRSV2 서열 단편 증폭용 프라이머 쌍은 서열번호 4의 염기서열로 표시되는 프라이머와 서열번호 5의 염기서열로 표시되는 프라이머인 것을 특징으로 할 수 있다.In the present invention, the composition and kit may each further include a primer pair for amplifying a porcine reproductive respiratory syndrome virus (PRRSV) sequence fragment, but is not limited thereto, but a primer pair for amplifying a PRRSV1 sequence fragment May be characterized by being a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2, and the primer pair for amplifying the PRRSV2 sequence fragment is a primer and sequence represented by the nucleotide sequence of SEQ ID NO: 4 It may be characterized by being a primer represented by the nucleotide sequence of number 5.

본 발명에 있어서, 상기 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브는 각각 서로 상이한 리포터가 결합되어 있는 것을 특징으로 할 수 있는데, 이는 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브를 하나의 튜브에 넣고 반응시킬 때, 융해 곡선과 융해 피크를 좀 더 명확히 구별하기 위한 것이므로, 융해 곡선과 융해 피크의 명확한 구별이 가능하다면 동일한 리포터와 소광자를 사용하여도 무방할 것이다. In the present invention, the PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and the PNA probe represented by the nucleotide sequence of SEQ ID NO: 6 may each be characterized in that different reporters are bonded to each other. When the PNA probe represented by the nucleotide sequence and the PNA probe represented by the nucleotide sequence of SEQ ID NO: 6 are put into one tube and reacted, the melting curve and the melting peak are more clearly distinguished. If it can be distinguished, it would be okay to use the same reporter and quencher.

본 발명의 키트는 버퍼, DNA 중합효소 조인자 및 데옥시리보뉴클레오타이드-5-트리포스페이트와 같은 표적 핵산 증폭 반응(예컨대, PCR 반응)을 실시하는데 필요한 시약을 선택적으로 포함할 수 있다. 선택적으로, 본 발명의 키트는 또한 다양한 폴리뉴클레오타이드 분자, 역전사효소, 다양한 버퍼 및 시약, 및 DNA 중합효소 활성을 억제하는 항체를 포함할 수 있다. 또한, 상기 키트는 특정 반응에서 사용되는 시약의 최적량은, 본 명세서에 개시사항을 습득한 당업자에 의해서 용이하게 결정될 수 있다. 전형적으로, 본 발명의 장비는 앞서 언급된 구성 성분들을 포함하는 별도의 포장 또는 컴파트먼트(compartment)로 제작될 수 있다.The kit of the present invention may optionally include a buffer, a DNA polymerase cofactor, and reagents necessary to perform a target nucleic acid amplification reaction (eg, PCR reaction) such as deoxyribonucleotide-5-triphosphate. Optionally, the kits of the present invention may also include various polynucleotide molecules, reverse transcriptases, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. In addition, in the kit, the optimal amount of the reagent to be used in a specific reaction can be easily determined by a person skilled in the art who has learned the disclosure herein. Typically, the equipment of the present invention may be manufactured in separate packaging or compartments containing the aforementioned components.

상기 키트를 이용하면, PNA 프로브에 의한 용해곡선 분석을 통하여 표적 핵산의 유전형을 효과적으로 검출할 수 있고, 이를 통하여 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별이 가능하다.Using the kit, it is possible to effectively detect the genotype of a target nucleic acid through analysis of a dissolution curve using a PNA probe, and through this, it is possible to discriminate the genotype of porcine reproductive respiratory syndrome virus (PRRSV).

돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별을 위해 표적 핵산을 서열번호 1의 염기서열로 표시되는 프라이머와 서열번호 2의 염기서열로 표시되는 프라이머 쌍 및 서열번호 4의 염기서열로 표시되는 프라이머와 서열번호 5의 염기서열로 표시되는 프라이머을 이용하여 증폭하고, 증폭된 서열단편을 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브와 혼성화시킨 후, 그 융해곡선을 확인한 결과, PRRSV1 유전형의 경우 서열번호 3의 염기서열로 표시되는 PNA 프로브와 혼성화된 후 융해 피크를 나타내고, PRRSV2 유전형의 경우 서열번호 6의 염기서열로 표시되는 PNA 프로브와 혼성화된 후 융해 피크를 나타내는 것을 확인할 수 있다(도 1).For genotyping of porcine reproductive respiratory syndrome virus (PRRSV), the target nucleic acid is a primer represented by the base sequence of SEQ ID NO: 1, a primer pair represented by the base sequence of SEQ ID NO: 2, and a primer and sequence represented by the base sequence of SEQ ID NO: 4 After amplification using a primer represented by the nucleotide sequence of No. 5, the amplified sequence fragment was hybridized with the PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and the PNA probe represented by the nucleotide sequence of SEQ ID NO: 6, and the melting curve As a result of confirming, the PRRSV1 genotype shows a melting peak after hybridization with the PNA probe represented by the nucleotide sequence of SEQ ID NO: 3, and in the case of PRRSV2 genotype, the melting peak after hybridization with the PNA probe represented by the nucleotide sequence of SEQ ID NO: 6 It can be seen that it is shown (Fig. 1).

따라서, 본 발명은 또 다른 관점에서 다음 단계를 포함하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별방법에 관한 것이다.Accordingly, the present invention relates to a method for genotyping porcine reproductive respiratory syndrome virus (PRRSV) comprising the following steps in another aspect.

(a) 검체 시료로부터 표적 핵산을 추출하는 단계;(a) extracting a target nucleic acid from the specimen;

(b) 상기 표적 핵산에 포함된 돼지생식기호흡기증후군 바이러스(PRRSV)를 주형으로 프라이머 쌍을 이용하여 증폭된 서열단편을 생성시키는 단계;(b) generating a sequence fragment amplified using a primer pair using the porcine genital respiratory syndrome virus (PRRSV) contained in the target nucleic acid as a template;

(c) 상기 증폭된 서열단편을 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브와 혼성화시키는 단계;(c) hybridizing the amplified sequence fragment with a PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6;

(d) 상기 혼성화된 산물의 온도를 높이며 온도별 융해곡선을 얻는 단계; 및(d) increasing the temperature of the hybridized product and obtaining a melting curve for each temperature; And

(e) 상기 융해곡선에서 서열번호 3의 염기서열로 표시되는 PNA 프로브에 의한 융해 피크가 관찰되면 돼지생식기호흡기증후군 바이러스 1형(PRRSV1) 유전형으로 판별하고, 상기 융해곡선에서 서열번호 6의 염기서열로 표시되는 PNA 프로브에 의한 융해 피크가 관찰되면 돼지생식기호흡기증후군 바이러스 2형(PRRSV2) 유전형으로 판별하는 단계.(e) If the melting peak of the PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 is observed in the melting curve, it is determined as the porcine reproductive respiratory syndrome virus type 1 (PRRSV1) genotype, and the nucleotide sequence of SEQ ID NO: 6 in the melting curve When the melting peak by the PNA probe represented by is observed, the step of determining as the porcine reproductive respiratory syndrome virus type 2 (PRRSV2) genotype.

본 발명에 있어서, 이에 한정되지는 않으나, 상기 프라이머 쌍은 서열번호 1의 염기서열로 표시되는 프라이머와 서열번호 2의 염기서열로 표시되는 프라이머; 및 서열번호 4의 염기서열로 표시되는 프라이머와 서열번호 5의 염기서열로 표시되는 프라이머인 것을 특징으로 할 수 있다. In the present invention, although not limited thereto, the primer pair may include a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; And a primer represented by the nucleotide sequence of SEQ ID NO: 4 and a primer represented by the nucleotide sequence of SEQ ID NO: 5.

본 발명에 있어서, 상기 융해 피크는 64±2℃에서 관찰되는 것이 바람직하나, 이에 한정되지는 않는다.In the present invention, the melting peak is preferably observed at 64 ± 2 ℃, but is not limited thereto.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다. Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

실시예Example 1. 실험방법 1. Experiment method

1-1. 바이러스 1-1. virus

두 참조 바이러스로, PRRSV1에 대해서는 Lelystad(GenBank No. AY035969), PRRSV2에 대해서는 LMY(GenBank No. DQ473474)를 사용하였으며, 이들 바이러스는 5% FBS와 항생제가 첨가된 RPMI 1640 배지에서 MA104 세포와 함께 배양하였다. Lelystad와 LMY는 각각 105.0 TCID50/mL과 105.5 TCID50/mL로 적정하고(titrated), 분석에서의 특이도(specificty)는 swine fever virus LOM strain(GenBank No. EU789580), swine influenza virus VDS1 strain(GenBank No. JN043428), porcine circovirus 2 PCK0101 strain(GneBank No. MF964235)과 비교하여 평가하였다. As two reference viruses, Lelystad (GenBank No. AY035969) for PRRSV1 and LMY (GenBank No. DQ473474) for PRRSV2 were used, and these viruses were cultured with MA104 cells in RPMI 1640 medium supplemented with 5% FBS and antibiotics. I did. Lelystad and LMY were titrated to 10 5.0 TCID 50 /mL and 10 5.5 TCID 50 /mL, respectively, and the specificity in the analysis was swine fever virus LOM strain (GenBank No. EU789580), swine influenza virus VDS1. strain (GenBank No. JN043428), porcine circovirus 2 PCK0101 strain (GneBank No. MF964235) and evaluated.

바이러스 분리를 위해 2010-2017년 농림축산검역본부로 보고된 저성장을 보이는 돼지(40-100일령)로부터 148개의 조직 샘플(114개의 폐 및 34개의 림프절)을 사용하였다. 분리된 바이러스는 50일 된 돼지의 폐로부터 확보된 폐포대식세포(porcine alvolar macrophages)에 접종하고 10% FBS와 항생제가 보충된 RPMI 1640 배지에서 배양하였다. 접종된 세포는 세포변성효과(CPE)를 매일 모니터링하였다. 바이러스 감염은 시퀀싱과 N-특이적 단일클론항체(mAB), SDOW17(Rural Technologies, Inc., Brookings, SD, USA), 항-NA 및 항-EU(Median, Gangwon, Korea)를 이용한 면역형광법으로 확인하였다. 본 발명에 따른 PCR 분석법의 평가를 위해, 분리된 PRRSV 유전자형에 대해 각각 최대한 유전자거리가 먼 바이러스들의 조합으로 PRRSV1 및 PRRSV2 패널을 구성하였다. For virus isolation, 148 tissue samples (114 lungs and 34 lymph nodes) from low-growth pigs (40-100 days old) reported to the Ministry of Agriculture, Forestry and Livestock Quarantine in 2010-2017 were used. The isolated virus was inoculated on porcine alvolar macrophages obtained from the lungs of 50-day-old pigs and cultured in RPMI 1640 medium supplemented with 10% FBS and antibiotics. The inoculated cells were monitored daily for cytopathic effect (CPE). Virus infection was performed by sequencing and immunofluorescence using an N-specific monoclonal antibody (mAB), SDOW17 (Rural Technologies, Inc., Brookings, SD, USA), anti-NA and anti-EU (Median, Gangwon, Korea). Confirmed. For the evaluation of the PCR analysis method according to the present invention, the PRRSV1 and PRRSV2 panels were constructed with a combination of viruses having a maximum gene distance for each isolated PRRSV genotype.

1-2. 시퀀싱을 위한 RT-1-2. RT- for sequencing PCRPCR

RNeasy Mini Kit(Qiagen, Valencia, CA, USA)를 이용하여 제조자 방식에 따라 PRRSV가 감염된 폐포대식세포의 배양 상청액으로부터 RNA를 추출하였다. PRRSV1 및 PRRSV2의 시퀀싱을 위하여, One-step RT-PCR Kit(Qiagen)를 이용하였다. ORF6 및 ORF7을 시퀀싱하기 위하여 두 PRRSV 유전자형 각각에 대한 분리된 프라이머 세트를 디자인하였다. RT-PCR 조건은 다음과 같다: PRRSV1의 ORF6 및 ORF7에 대해서는, 50℃ 30분, 95℃ 15분 후, 94℃ 30초, 53℃ 40초, 72℃ 50초를 35 사이클 반복하였다. PRRSV2의 ORF6 및 ORF7에 대해서는, 어닐링 온도만 53℃ 대신 50℃로 바꾸고, 상기 조건과 동일하게 진행하였다. 각 RT-PCR 증폭산물은 추가 분석을 위해 유전자 특이적 프라이머를 사용하여 양 방향으로 시퀀싱하였다. 각 서열은 다중서열정렬을 얻기 위해 사용되었고, 분리된 PRRSV들의 퍼센트 뉴클레오티드 서열 동일성은 BioEdi(Ibis Biosciences, Carlsbad, CA, USA)를 사용하여 계산하였다.RNA was extracted from the culture supernatant of alveolar macrophages infected with PRRSV according to the manufacturer's method using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). For sequencing of PRRSV1 and PRRSV2, One-step RT-PCR Kit (Qiagen) was used. A separate set of primers for each of the two PRRSV genotypes was designed to sequence ORF6 and ORF7. RT-PCR conditions were as follows: For ORF6 and ORF7 of PRRSV1, 35 cycles were repeated for 30 minutes at 50°C, 15 minutes at 95°C, 30 seconds at 94°C, 40 seconds at 53°C, and 50 seconds at 72°C. For ORF6 and ORF7 of PRRSV2, only the annealing temperature was changed to 50°C instead of 53°C, and proceeded in the same manner as in the above conditions. Each RT-PCR amplification product was sequenced in both directions using gene-specific primers for further analysis. Each sequence was used to obtain a multiple sequence alignment, and the percent nucleotide sequence identity of the isolated PRRSVs was calculated using BioEdi (Ibis Biosciences, Carlsbad, CA, USA).

1-3. 원-스텝 1-3. One-step rRTrRT -- PCRPCR 방법에 따른 According to the method PRRSVPRRSV 검출을 위한 PNA PNA for detection 프로브의Of the probe 설계 design

PRRSV 서열을 CLUSTRAL-X(version 1.81)를 사용하여 정렬하였다. PRRSV1의 100 strains 및 PRRSV2의 449 strains에 대한 ORF6를 정렬하고, 이를 기초로 프라이머와 프로브를 디자인하였다. 다중 색신호를 위하여 PRRSV1의 5'은 리포터 FAM을 결합시키고 3'에는 소광자 DABCYL을 결합시켰으며, PRRSV2의 5'은 리포터 HEX를 결합시키고 3'에는 소광자 DABCYL을 결합시켰다. 하기 표 1에 도시된 PNA 프로브와 프라이머를 시선 바이오머티리얼스(대전, 한국)에 의뢰하여 합성하고 HPLC 정제하였다.The PRRSV sequence was aligned using CLUSTRAL-X (version 1.81). ORF6 for 100 strains of PRRSV1 and 449 strains of PRRSV2 were aligned, and primers and probes were designed based on this. For the multi-color signal, 5'of PRRSV1 coupled with reporter FAM and 3'coupled with quencher DABCYL, 5'of PRRSV2 coupled with reporter HEX and 3'coupled with quencher DABCYL. The PNA probes and primers shown in Table 1 below were synthesized by requesting Gaze Biomaterials (Daejeon, Korea) and purified by HPLC.

Primers and probesPrimers and probes Sequences (5’-3’)Sequences (5’-3’) PositionPosition Amplicon sizeAmplicon size PRRSV1*PRRSV1* PRRSV2**PRRSV2** PRRS1F
(서열번호 1) PRRS1F
(SEQ ID NO: 1) CTGCCCAYCACGTAGAAAGTGCCTGCCCAYCACGTAGAAAGTGC 14,418-14,43914,418-14,439 115bp115bp PRRS1R
(서열번호 2)PRRS1R
(SEQ ID NO: 2) CCTGGTACTAGAGTGCCGTTCCTGGTACTAGAGTGCCGTT 14,513-14,53214,513-14,532 PRRS1 PNA
(서열번호 3)PRRS1 PNA
(SEQ ID NO: 3) FAM-ATACGCTGTGAG-BHQ1FAM-ATACGCTGTGAG-BHQ1 14,479-14,49014,479-14,490 PRRS2F
(서열번호 4)PRRS2F
(SEQ ID NO: 4) GGCCCCTGCCCACCACGGGCCCCTGCCCACCACG 14,704-14,72014,704-14,720 96bp96bp PRRS2R
(서열번호 5)PRRS2R
(SEQ ID NO: 5) GTAGTRGAGCCGGGACGCCGGTAGTRGAGCCGGGACGCCG 14,780-14,79914,780-14,799 PRRS2 PNA
(서열번호 6)PRRS2 PNA
(SEQ ID NO: 6) HEX-TGATAACCACGCA-BHQ2HEX-TGATAACCACGCA-BHQ2 14,758-14,77014,758-14,770

*Nucleotide sites were based in LV4.2.1 strain (Accession No. AY588319)*Nucleotide sites were based in LV4.2.1 strain (Accession No. AY588319)

**Nucleotide sites were based in ATCC VR-2332 strain (Accession No. U87392).**Nucleotide sites were based in ATCC VR-2332 strain (Accession No. U87392).

1-4. 원-스텝 1-4. One-step rRTrRT -- PCRPCR 방법에 따른 According to the method PRRSVPRRSV 검출 조건 Detection condition

원-스텝 rRT-PCR을 위하여, Quantitative One-Step RT-PCR Kit (SeaSun Biomaterials, Daejeon, Korea)를 사용하였다. 원-스텝 rRT-PCR은 3㎕ RNA, 각각의 0.3 μM PRRSV forward primer, 각각의 3 μM reverse primer, 0.5 μM PRRSV1-FAM probe, 0.5 μM PRRSV2-HEX probe, 1 U/μL Taq polymerase, 1 U/μL RT Enzyme Mix, 2.5 mM MgCl2, 200 μM dNTPs, 및 7 μL of Detection Buffer를 포함하는 20-μL 반응액으로 CFX96 TouchTMReal-Time PCR Detection System (Bio-Rad, Hercules, CA, USA)을 이용하여 하기와 같은 조건에서 진행하였다: 50℃ 30분, 95℃ 15분으로 반응 후, 95℃ 30초, 58℃ 45초, 72℃ 45초로 45 사이클 반복하였다. FMCA는 95℃에서 5분간 변성 단계 후, 75℃, 55℃, 45℃로 1분씩 단계적 혼성화를 거치고, 85℃까지 5초간 간격을 두고 1℃씩 온도를 증가시키며 분석하였다. FMCA의 광학 데이터는 Bio-Rad CFX Manager 3.1로 확인하였다.For one-step rRT-PCR, a Quantitative One-Step RT-PCR Kit (SeaSun Biomaterials, Daejeon, Korea) was used. One-step rRT-PCR is 3 μL RNA, each 0.3 μM PRRSV forward primer, each 3 μM reverse primer, 0.5 μM PRRSV1-FAM probe, 0.5 μM PRRSV2-HEX probe, 1 U/μL Taq polymerase, 1 U/ CFX96 Touch TM Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) with 20-μL reaction solution containing μL RT Enzyme Mix, 2.5 mM MgCl 2 , 200 μM dNTPs, and 7 μL of Detection Buffer. The reaction was carried out under the following conditions using: 50°C for 30 minutes, 95°C for 15 minutes, and then 45 cycles were repeated at 95°C for 30 seconds, 58°C for 45 seconds, and 72°C for 45 seconds. FMCA was analyzed by denaturing at 95°C for 5 minutes, followed by stepwise hybridization at 75°C, 55°C, and 45°C for 1 minute, and increasing the temperature by 1°C at intervals of 5 seconds to 85°C. The optical data of FMCA was confirmed with Bio-Rad CFX Manager 3.1.

1-5. 표준곡선과 분석의 확인1-5. Confirmation of standard curve and analysis

In vitro 전사된 RNA는 MEGAshortscript T7 Kit (Ambion, Foster City, CA, USA)를 사용하여 제조자 방식에 따라 표준곡선 분석에 사용되었다. 전사된 RNA는 정량화되어, PRRSV1은 1.5 Х 107 내지 1.5 Х 101, PRRSV2는 1.1 Х 107 내지 1.1 Х 101 카피수 범위로 10배 순차적 희석을 통해 준비하였고, 이로부터 표준곡선을 도출하였다. 시험 내 변동(intra-assay variation)은 각 유전형에 대해 3개의 샘플을 준비하여 독립적으로 평가하여 결정하였다(예를 들어, PRRSV1는 1.5 Х 106, 1.5 Х 104, 1.5 Х 102, PRRSV2는 1.1 Х 106, 1.1 Х 104, 1.1 Х 102). 시험 내 변동은 3개 샘플 각각에 대해 3개씩 복제하여 연속되는 3일에 걸쳐 실험하여 결정하였다. In vitro transcribed RNA was used for standard curve analysis according to the manufacturer's method using the MEGAshortscript T7 Kit (Ambion, Foster City, CA, USA). The transcribed RNA was quantified, and PRRSV1 was prepared through a 10-fold sequential dilution in the range of 1.5 Х 10 7 to 1.5 Х 10 1 , and PRRSV2 was 1.1 Х 10 7 to 1.1 Х 10 1 copy number, from which a standard curve was derived. . Intra-assay variation was determined by preparing three samples for each genotype and evaluating them independently (e.g., PRRSV1 is 1.5 Х 10 6 , 1.5 Х 10 4 , 1.5 Х 10 2 , PRRSV2 is 1.1 Х 10 6 , 1.1 Х 10 4 , 1.1 Х 10 2 ). Variations in the test were determined by experimenting over three consecutive days by replicating three for each of the three samples.

1-6. 1-6. In In silcosilco 분석analysis

rRT-PCR 분석에 의한 효율성을 평가하기 위하여, 이전에 공개된 문헌에서 선택된 ORF6 또는 ORF7을 타겟팅하는 TaqMan 프로브와 프라이머를 사용하여 6개의 rRT-PCR 분석을 진행하였다. FastPCR 6.6.34 (http://primerdigital.com)을 사용한 프라이머 특이도에 대한 In silico 테스트는 본 발명에서 사용된 프라이머와 프로브 및 PRRSV 각 유전형에 대해 공개된 프라이머 및 프로브(표 2)를 사용하였다. in silico PCR에서 1개의 미스매치 존을 3' 말단에 허용하였다.In order to evaluate the efficiency by rRT-PCR analysis, six rRT-PCR analyzes were performed using TaqMan probes and primers targeting ORF6 or ORF7 selected from previously published literature. In silico for primer specificity using FastPCR 6.6.34 (http://primerdigital.com) For the test, the primers and probes used in the present invention and the published primers and probes (Table 2) for each genotype of PRRSV were used. In silico PCR, one mismatch zone was allowed at the 3'end.

Figure 112018122795683-pat00001
Figure 112018122795683-pat00001

1-7. 자연 감염된 돼지로부터 임상 샘플1-7. Clinical samples from naturally infected pigs

2018년 농림축산검역본부에 보고된 다른 지역에 위치하는 41개의 한국 돼지 농가로부터 임상적으로 성장이 지연된 돼지(40-100일)의 폐와 편도로부터 총 100개의 조직 샘플을 준비하였다. 조직은 PBS 버퍼(0.1M, pH 7.2)에 1:10으로 희석하고 이를 갈아 격렬히 혼합한 후, 조직 잔해를 제거하기 위하여 4,000 Х g 에서 10분간 원심분리하였다. 바이러스 RNA를 300uL의 희석된 샘플에서 추출하여 원-스텝 RT-PCR을 위해 사용하였다. 종래 사용법과 검출률을 비교하기 위하여, 임상 샘플로부터 수득한 RNA를 이용하여 동물질병표준 진단요령내 기재된 전국 방역진단기관에서 사용하는 방법인 ORF7 지역에 대해 cRT-PCR (VDX PRRSV HP MP RT-PCR; Median)을 진행하였다. 이 때 사용한 프라이머 서열은 아래와 같다.A total of 100 tissue samples were prepared from the lungs and tonsils of pigs with clinically delayed growth (40-100 days) from 41 Korean pig farms located in different regions reported to the Agriculture, Forestry and Livestock Quarantine Headquarters in 2018. Tissue was diluted 1:10 in PBS buffer (0.1M, pH 7.2), ground and mixed vigorously, and centrifuged at 4,000 Х g for 10 minutes to remove tissue debris. Viral RNA was extracted from 300 uL of diluted samples and used for one-step RT-PCR. In order to compare the detection rate with the conventional usage, cRT-PCR (VDX PRRSV HP MP RT-PCR) for ORF7, a method used by national quarantine diagnostic institutions described in the standard diagnostic guidelines for animal diseases, using RNA obtained from clinical samples; Median). The primer sequence used at this time is as follows.

cRT-PCR Forward primer ATGGCCAGCCAGTCAATCA (서열번호 7)cRT-PCR Forward primer ATGGCCAGCCAGTCAATCA (SEQ ID NO: 7)

cRT-PCR Reverse primer TCGCCCTAATTGAATAGGTGA (서열번호 8) cRT-PCR Reverse primer TCGCCCTAATTGAATAGGTGA (SEQ ID NO: 8)

분석 후, 분석 결과의 정확도를 검증하기 위하여 ORF6 및 ORF7 지역에 대한 시퀀싱 분석을 진행하였다.After analysis, sequencing analysis was performed on the ORF6 and ORF7 regions to verify the accuracy of the analysis results.

실시예Example 2. 분리된 바이러스의 유전형 및 서열 동일성 분석 2. Genotype and sequence identity analysis of isolated viruses

148개의 샘플 중 96개의 strain이 분리되었고, 폐포대식세포에서 세포 변성 및 N-특이적 형광에 의해 확인되었다. 본 발명에서 개발된 원-스텝 rRT-PCR 방법에 의하면, 96개 균주는 각각 39개의 PRRSV1, 42개의 PRRSV2 및 15개의 PRRSV1과 PRRSV2가 혼합된 것으로 확인되었다. 이들 중 PRRSV1의 29개 균주 및 PRRSV2의 36개 균주를 포함하는 각 바이러스에 대한 한국형 PRRSV 패널이 PCR 법의 평가를 위해 확립되었다(표 3). PRRSV1 패널에서 ORF6 및 ORF7의 퍼센트 서열 동일성은 핵산(아미노산) 레벨에서 각각 89.5-99.8% (86.4-98.3%) 및 88.6-98.2% (85.7-99.2%)로 나타났고, PRRSV2 패널에서 각각 86.5-99.8% (89.7-99.4%) 및 83.9-99.7% (81.2-99.2%)로 나타나, 이 중 서열 상동성이 낮은 서열들의 조합으로 각각 PRRSV1 및 PRRSV2 패널을 구성하였다.Of the 148 samples, 96 strains were isolated and confirmed by cell degeneration and N-specific fluorescence in alveolar macrophages. According to the one-step rRT-PCR method developed in the present invention, it was confirmed that the 96 strains were a mixture of 39 PRRSV1, 42 PRRSV2, and 15 PRRSV1 and PRRSV2, respectively. Among these, a Korean-type PRRSV panel for each virus including 29 strains of PRRSV1 and 36 strains of PRRSV2 was established for evaluation of the PCR method (Table 3). The percent sequence identity of ORF6 and ORF7 in the PRRSV1 panel was 89.5-99.8% (86.4-98.3%) and 88.6-98.2% (85.7-99.2%), respectively, at the nucleic acid (amino acid) level, and 86.5-99.8%, respectively, in the PRRSV2 panel. % (89.7-99.4%) and 83.9-99.7% (81.2-99.2%), of which the PRRSV1 and PRRSV2 panels were composed of combinations of sequences with low sequence homology.

Figure 112018122795683-pat00002
Figure 112018122795683-pat00002

실시예Example 3. 원-스텝 3. One-step rRTrRT -- PCRPCR 방법의 검증 Method validation

상기 실시예 1-3에서 PRRSV1 및 PRRSV2의 말단 ORF6의 보전된 지역에 기초하여 원-스텝 rRT-PCR을 위한 프라이머 및 프로브 서열이 디자인되었다(표 1 참조). 프로토타입 Lelystad 및 LMY를 본 발명에 따른 rRT-PCR 방법으로 분석하였을 때 양성 Ct 및 Tm값을 얻을 수 있었다. 증폭의 특이도를 확인하기 위하여 FMCA가 포함되었고, 64±2℃의 융해 온도에서 뚜렷한 하나의 피크를 얻을 수 있었다. 한계값은 노이즈 밴드보다 높은 50 이상으로 설정하였다. 테스트의 특이도는 다른 호흡기 질환을 일으키는 CSFV, PCV2, 및 SIV 바이러스를 사용하여 평가하였으며, 원-스텝 rRT-PCR 방법에서 다른 교차-반응은 관찰되지 않았다. Primer and probe sequences for one-step rRT-PCR were designed based on the conserved regions of the terminal ORF6 of PRRSV1 and PRRSV2 in Examples 1-3 above (see Table 1). When the prototypes Lelystad and LMY were analyzed by the rRT-PCR method according to the present invention, positive Ct and Tm values were obtained. FMCA was included to confirm the specificity of amplification, and a distinct peak was obtained at a melting temperature of 64±2℃. The limit value was set to 50 or more higher than the noise band. The specificity of the test was evaluated using CSFV, PCV2, and SIV viruses causing other respiratory diseases, and no other cross-reactions were observed in the one-step rRT-PCR method.

민감도를 평가하기 위하여, 각각 1.5 Х 107 및 1.1 Х 107 카피수의 PRRSV1 및 PRRSV2의 전사체를 사용하였다. PRRSV1 및 PRRSV2의 표준 곡선의 기울기는 10-배 순차적 희석을 통해 확인하였으며, 각각 -3.257 및 -3.478로 나타내었다. 이들 곡선에 기초한 검출 한계는 1.5 Х 101 PRRSV1 및 1.1 Х 101 PRRSV2로 나타났다. 원-스텝 rRT-PCR 방법에 따라 실험을 진행한 결과, 모든 희석액에 대하여 64±2℃에서 피크를 갖는 선명한 융해 커브를 보여줌으로써, 광범위한 표적 RNA 농도에 걸쳐 FMCA가 일관성 있게 나타남을 확인하였다. 멀티플렉스 반응에 대한 평균 Ct 값은 단일 반응과 비교하여 ≤1 사이클 차이에 불과하도록 오버랩핑되어 있어, 프라이머와 프로브 사이의 간섭은 없는 것으로 평가되었다.In order to evaluate the sensitivity, transcripts of PRRSV1 and PRRSV2 of 1.5 Х 10 7 and 1.1 Х 10 7 copy numbers, respectively, were used. The slopes of the standard curves of PRRSV1 and PRRSV2 were confirmed through 10-fold sequential dilution, and are represented as -3.257 and -3.478, respectively. The limits of detection based on these curves were found to be 1.5 Х 10 1 PRRSV1 and 1.1 Х 10 1 PRRSV2. As a result of conducting the experiment according to the one-step rRT-PCR method, it was confirmed that FMCA appeared consistently over a wide range of target RNA concentrations by showing a clear melting curve having a peak at 64±2°C for all dilutions. The average Ct values for the multiplex reaction were overlapped to be only ≦1 cycle difference compared to the single reaction, so no interference between the primer and the probe was evaluated.

본 분석방법의 재현성과 반복성을 평가하기 위해, 시험 내 변동(intra-assay variation)을 두 바이러스에 대해 106, 104, 및 102 카피수에 대한 전사체 표준물을 이용하여 세 가지 샘플에 대한 세 가지 독립적인 실험으로 평가하였다. PRRSV1 및 PRRSV2에 대한 시험 내 변동은 낮은 것으로 나타났는데, 다른 바이러스 역가에서 PRRSV1에 대한 변동 계수는 0.23~0.82%, PRRSV2에 대한 변동 계수는 0.28~2.27% 범위로 나타났다. 한편, 시험 내 변동은 3일 동안 수행한 각각 다른 분석에 의해서도 평가되었는데, 이 경우에도 변동 계수는 두 바이러스에 대하여 0.70~1.64%를 나타내어 매우 낮게 나타났다.To evaluate the reproducibility and repeatability of this assay, intra-assay variation was measured in three samples using transcript standards for 10 6 , 10 4 , and 10 2 copy numbers for both viruses. Were evaluated in three independent experiments. The in vitro variability for PRRSV1 and PRRSV2 was found to be low. At different viral titers, the coefficient of variation for PRRSV1 was 0.23 to 0.82%, and the coefficient of variation for PRRSV2 ranged from 0.28 to 2.27%. On the other hand, the variation within the test was also evaluated by different analyzes performed for 3 days, and even in this case, the coefficient of variation was very low, indicating 0.70~1.64% for both viruses.

실시예Example 4. 공지된 4. Announced rRTrRT -- PCR법과의With PCR method 비교 compare

본 발명에 따른 프라이머와 프로브의 특이도를 조사하기 위하여 본 발명에서 수립된 PRRSV 패널을 이용한 in silico PCR을 수행하였다. 본 발명에서 디자인된 프라이머와 프로브는 한국형 PRRSVs 전반에 걸쳐 100% 커버리지를 나타내었다. 그러나, 이전에 알려진 프라이머와 프로브는 한국형 PRRSV에 대해 29.0~100.0% 커버리지를 나타내었다. 즉, PRRSV1 검출을 위한 Egli et al.의 rRT-PCR은 29%의 커버리지를 나타내었고, PRRSV2에 대한 Wu et al.의 rRT-PCR은 100%의 커버리지를 나타내어(표 4), 본 발명은 종래 공지 기술에 비해 특히 PRRSV1에 대한 커버리지가 크게 개선되었음을 알 수 있었다. In order to investigate the specificity of the primers and probes according to the present invention, in silico PCR was performed using the PRRSV panel established in the present invention. The primers and probes designed in the present invention showed 100% coverage across Korean PRRSVs. However, previously known primers and probes showed 29.0-100.0% coverage for Korean PRRSV. That is, Egli et al.'s rRT-PCR for PRRSV1 detection showed 29% coverage, and Wu et al.'s rRT-PCR for PRRSV2 showed 100% coverage (Table 4). It can be seen that the coverage for PRRSV1 in particular is significantly improved compared to the known technology.

Figure 112018122795683-pat00003
Figure 112018122795683-pat00003

실시예Example 5. 원-스텝 5. One-step rRTrRT -- PCRPCR 방법의 임상 샘플에의 적용 Application of the method to clinical samples

본 발명에 따른 원-스텝 rRT-PCR 방법을 임상 샘플에 적용해 보았다. 2018년 소모성 및 호흡기 질환을 보이는 돼지가 관찰된 농가로부터 얻은 100개의 샘플 중, PRRSV1, PRRSV2, 혼합형, 음성은 각각 14, 26, 7, 53개 샘플로 확인되었으며, 이와 같은 결과의 정확도는 샘플을 시퀀싱하여 재확인하였다. 임상 샘플로부터 확인된 PRRSV1 및 PRRSV2의 양은 102에서 108로 다양하였다. 혼합형 샘플에서는 101-104 카피수가 확인되었다. 높은 Ct 값(Ct ≥ 38)을 보이는 위양성의 7개의 샘플은 PRRSV에 대해 음성을 나타내었다. The one-step rRT-PCR method according to the present invention was applied to clinical samples. Of the 100 samples obtained from farms in which pigs with wasting and respiratory diseases were observed in 2018, PRRSV1, PRRSV2, mixed type, and negative were confirmed as 14, 26, 7, 53 samples, respectively, and the accuracy of these results Reconfirmed by sequencing. The amounts of PRRSV1 and PRRSV2 identified from clinical samples varied from 10 2 to 10 8 . In the mixed sample, 10 1 -10 4 copy numbers were identified. Seven samples of false positives with high Ct values (Ct ≥ 38) were negative for PRRSV.

한편, 종래 진단법인 cRT-PCR 분석에 따르면, 총 47개의 양성 샘플 중 42개의 양성 샘플만 양성으로 확인되고, 5개의 양성 샘플은 음성으로 판별되어(표 5 참조), 진단의 정확도가 95%에 불과하여, 본 발명에 따른 원-스텝 rRT-PCR은 종래의 cRT-PCR과 비교할 때, 진단의 정확도가 개선된 발명임을 알 수 있었다. Meanwhile, according to cRT-PCR analysis, a conventional diagnostic method, only 42 positive samples out of a total of 47 positive samples were identified as positive, and 5 positive samples were identified as negative (see Table 5), so that the accuracy of diagnosis was 95%. As a result, it was found that the one-step rRT-PCR according to the present invention is an invention with improved diagnostic accuracy as compared to the conventional cRT-PCR.

Figure 112018122795683-pat00004
Figure 112018122795683-pat00004

특히, 도 3에서와 같이 본 발명에 따른 원-스텝 rRT-PCR에서는 두 개의 PNA 프로브 함께 사용하여 임상 샘플에서 PRRSV1 및 PRRSV2를 정확히 검출할 수 있을 뿐만 아니라, PRRSV1 및 PRRSV2의 혼합 샘플에서도 두 바이러스 유형의 정확한 검출이 가능하다. In particular, in the one-step rRT-PCR according to the present invention, as shown in FIG. 3, PRRSV1 and PRRSV2 can be accurately detected in clinical samples by using two PNA probes together, as well as in a mixed sample of PRRSV1 and PRRSV2 Accurate detection of is possible.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다. As described above, specific parts of the present invention have been described in detail, and for those of ordinary skill in the art, it is obvious that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> REPUBLIC OF KOREA(Animal and Plant Quarantine Agency) <120> PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same <130> P18-B235 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRRS1 Forward Primer <400> 1 ctgcccayca cgtagaaagt gc 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRRS1 Reverse Primer <400> 2 cctggtacta gagtgccgtt 20 <210> 3 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> PRRS1 PNA Probe <400> 3 atacgctgtg ag 12 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PRRS2 Forward Primer <400> 4 ggcccctgcc caccacg 17 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRRS2 Reverse Primer <400> 5 gtagtrgagc cgggacgccg 20 <210> 6 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> PRRS2 PNA Probe <400> 6 tgataaccac gca 13 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> cRT-PCR Forward Primer <400> 7 atggccagcc agtcaatca 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> cRT-PCR Reverse Primer <400> 8 tcgccctaat tgaataggtg a 21 <110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same <130> P18-B235 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRRS1 Forward Primer <400> 1 ctgcccayca cgtagaaagt gc 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRRS1 Reverse Primer <400> 2 cctggtacta gagtgccgtt 20 <210> 3 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> PRRS1 PNA Probe <400> 3 atacgctgtg ag 12 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PRRS2 Forward Primer <400> 4 ggcccctgcc caccacg 17 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRRS2 Reverse Primer <400> 5 gtagtrgagc cgggacgccg 20 <210> 6 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> PRRS2 PNA Probe <400> 6 tgataaccac gca 13 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> cRT-PCR Forward Primer <400> 7 atggccagcc agtcaatca 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> cRT-PCR Reverse Primer <400> 8 tcgccctaat tgaataggtg a 21

Claims (14)

서열번호 3의 염기서열로 표시되는 돼지생식기호흡기증후군 바이러스 1형(PRRSV1) 유전형 판별용 PNA 프로브.PNA probe for genotype identification of porcine reproductive respiratory syndrome virus type 1 (PRRSV1) represented by the nucleotide sequence of SEQ ID NO: 3. 서열번호 6의 염기서열로 표시되는 돼지생식기호흡기증후군 바이러스 2형(PRRSV2) 유전형 판별용 PNA 프로브.PNA probe for genotype determination of porcine reproductive respiratory syndrome virus type 2 (PRRSV2) represented by the nucleotide sequence of SEQ ID NO: 6. 제1항 또는 제2항 있어서, 상기 PNA 프로브는 하나의 말단에 리포터가 결합되어 있고 다른 말단에 소광자가 결합되어 있는 것을 특징으로 하는 PNA 프로브.The PNA probe according to claim 1 or 2, wherein a reporter is bonded to one end of the PNA probe and a quencher is bonded to the other end. 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브를 포함하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 조성물.Pig reproductive respiratory syndrome virus (PRRSV) genotype discrimination composition comprising a PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6. 제4항에 있어서, 상기 조성물은 돼지생식기호흡기증후군 바이러스(PRRSV) 서열 단편 증폭용 프라이머 쌍을 추가로 포함하는 것을 특징으로 하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 조성물.[6] The composition of claim 4, wherein the composition further comprises a pair of primers for amplifying a porcine reproductive respiratory syndrome virus (PRRSV) sequence fragment. 제5항에 있어서, 상기 프라이머 쌍은 서열번호 1의 염기서열로 표시되는 프라이머와 서열번호 2의 염기서열로 표시되는 프라이머; 및 서열번호 4의 염기서열로 표시되는 프라이머와 서열번호 5의 염기서열로 표시되는 프라이머인 것을 특징으로 하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 조성물.The method of claim 5, wherein the primer pair is a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; And a primer represented by the nucleotide sequence of SEQ ID NO: 4 and a primer represented by the nucleotide sequence of SEQ ID NO: 5, wherein the composition for determining the genotype of the porcine reproductive respiratory syndrome virus (PRRSV). 제4항에 있어서, 상기 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브는 각각 서로 상이한 리포터가 결합되어 있는 것을 특징으로 하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 조성물.The porcine reproductive respiratory syndrome virus (PRRSV) according to claim 4, wherein the PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and the PNA probe represented by the nucleotide sequence of SEQ ID NO: 6 are each linked to a different reporter. ) Composition for genotyping. 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브를 포함하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 키트.Porcine reproductive respiratory syndrome virus (PRRSV) genotype identification kit comprising a PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6. 제8항에 있어서, 상기 키트는 돼지생식기호흡기증후군 바이러스(PRRSV) 서열 단편 증폭용 프라이머 쌍을 추가로 포함하는 것을 특징으로 하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 키트.[9] The kit of claim 8, wherein the kit further comprises a primer pair for amplifying a porcine genital respiratory syndrome virus (PRRSV) sequence fragment. 제9항에 있어서, 상기 프라이머 쌍은 서열번호 1의 염기서열로 표시되는 프라이머와 서열번호 2의 염기서열로 표시되는 프라이머; 및 서열번호 4의 염기서열로 표시되는 프라이머와 서열번호 5의 염기서열로 표시되는 프라이머인 것을 특징으로 하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 키트.The method of claim 9, wherein the primer pair comprises a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; And a primer represented by the nucleotide sequence of SEQ ID NO: 4 and a primer represented by the nucleotide sequence of SEQ ID NO: 5, characterized in that the kit for determining the genotype of porcine reproductive respiratory syndrome virus (PRRSV). 제8항에 있어서, 상기 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브는 각각 서로 상이한 리포터가 결합되어 있는 것을 특징으로 하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별용 키트.The porcine reproductive respiratory syndrome virus (PRRSV) according to claim 8, wherein the PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and the PNA probe represented by the nucleotide sequence of SEQ ID NO: 6 are each linked to a different reporter. ) Genotype identification kit. 다음 단계를 포함하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별방법:
(a) 검체 시료로부터 표적 핵산을 추출하는 단계;
(b) 상기 표적 핵산에 포함된 돼지생식기호흡기증후군 바이러스(PRRSV)를 주형으로 프라이머 쌍을 이용하여 증폭된 서열단편을 생성시키는 단계;
(c) 상기 증폭된 서열단편을 서열번호 3의 염기서열로 표시되는 PNA 프로브 및 서열번호 6의 염기서열로 표시되는 PNA 프로브와 혼성화시키는 단계;
(d) 상기 혼성화된 산물의 온도를 높이며 온도별 융해곡선을 얻는 단계; 및
(e) 상기 융해곡선에서 서열번호 3의 염기서열로 표시되는 PNA 프로브에 의한 융해 피크가 관찰되면 돼지생식기호흡기증후군 바이러스 1형(PRRSV1) 유전형으로 판별하고, 상기 융해곡선에서 서열번호 6의 염기서열로 표시되는 PNA 프로브에 의한 융해 피크가 관찰되면 돼지생식기호흡기증후군 바이러스 2형(PRRSV2) 유전형으로 판별하는 단계.Porcine genital respiratory syndrome virus (PRRSV) genotype determination method comprising the following steps:
(a) extracting a target nucleic acid from the specimen;
(b) generating a sequence fragment amplified using a primer pair using the porcine genital respiratory syndrome virus (PRRSV) contained in the target nucleic acid as a template;
(c) hybridizing the amplified sequence fragment with a PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 6;
(d) increasing the temperature of the hybridized product and obtaining a melting curve for each temperature; And
(e) If the melting peak of the PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 is observed in the melting curve, it is determined as the porcine reproductive respiratory syndrome virus type 1 (PRRSV1) genotype, and the nucleotide sequence of SEQ ID NO: 6 in the melting curve When the melting peak by the PNA probe represented by is observed, the step of determining as the porcine reproductive respiratory syndrome virus type 2 (PRRSV2) genotype. 제12항에 있어서, 상기 프라이머 쌍은 서열번호 1의 염기서열로 표시되는 프라이머와 서열번호 2의 염기서열로 표시되는 프라이머; 및 서열번호 4의 염기서열로 표시되는 프라이머와 서열번호 5의 염기서열로 표시되는 프라이머인 것을 특징으로 하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별방법.The method of claim 12, wherein the primer pair is a primer represented by the nucleotide sequence of SEQ ID NO: 1 and a primer represented by the nucleotide sequence of SEQ ID NO: 2; And a primer represented by the nucleotide sequence of SEQ ID NO: 4 and a primer represented by the nucleotide sequence of SEQ ID NO: 5, characterized in that the porcine reproductive respiratory syndrome virus (PRRSV) genotype identification method. 제12항에 있어서, 상기 융해 피크는 64±2℃에서 관찰되는 것을 특징으로 하는 돼지생식기호흡기증후군 바이러스(PRRSV) 유전형 판별방법.
The method of claim 12, wherein the melting peak is observed at 64±2° C., wherein the porcine genital respiratory syndrome virus (PRRSV) genotype is observed.
KR1020180156845A 2018-12-07 2018-12-07 PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same KR102160486B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020180156845A KR102160486B1 (en) 2018-12-07 2018-12-07 PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020180156845A KR102160486B1 (en) 2018-12-07 2018-12-07 PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same

Publications (2)

Publication Number Publication Date
KR20200069603A KR20200069603A (en) 2020-06-17
KR102160486B1 true KR102160486B1 (en) 2020-09-28

Family

ID=71405428

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020180156845A KR102160486B1 (en) 2018-12-07 2018-12-07 PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same

Country Status (1)

Country Link
KR (1) KR102160486B1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111676247A (en) * 2020-06-30 2020-09-18 扬州大学 Infectious clone construction, rescue and application of porcine reproductive and respiratory syndrome virus type 1 isolate
CN112195273A (en) * 2020-09-08 2021-01-08 华南农业大学 Kit for detecting porcine reproductive and respiratory syndrome virus by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology
CN116144836B (en) * 2022-09-20 2023-08-18 华中农业大学 Quadruple fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer set for PRRSV (porcine reproductive and respiratory syndrome virus) and detection method
KR102650676B1 (en) * 2023-05-31 2024-03-26 한국축산데이터 주식회사 Composition for testing prrs virus and test kit, test method using thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101707992B1 (en) * 2014-10-31 2017-02-20 경북대학교 산학협력단 Composition for diagnosing porcine reproductive and respiratory syndrome virus and method for diagnosing the same
KR101951172B1 (en) * 2014-11-07 2019-02-22 주식회사 파나진 Pna probes, kits and methods for detecting genotypes of human papillomavirus

Also Published As

Publication number Publication date
KR20200069603A (en) 2020-06-17

Similar Documents

Publication Publication Date Title
KR102160486B1 (en) PNA probe for detecting Porcine reproductive and respiratory syndrome virus genetic type and a method for detecting Porcine reproductive and respiratory syndrome virus genetic type using the same
Decaro et al. Genotype-specific fluorogenic RT-PCR assays for the detection and quantitation of canine coronavirus type I and type II RNA in faecal samples of dogs
Balasuriya et al. Detection of equine arteritis virus by real-time TaqMan® reverse transcription-PCR assay
KR102098772B1 (en) Adenovirus screening method associated gastrointestinal Infections and acute respiratory infections by PNA based real-timc PCR
CA2597383C (en) Method of detection of classical swine fever
Martínez et al. Simultaneous detection and genotyping of porcine reproductive and respiratory syndrome virus (PRRSV) by real-time RT-PCR and amplicon melting curve analysis using SYBR Green
KR102133995B1 (en) New primer set for detection of MERS-coronavirus using LAMP and uses thereof
Balka et al. Development of a one-step real-time quantitative PCR assay based on primer-probe energy transfer for the detection of porcine reproductive and respiratory syndrome virus
Wang et al. Development of a duplex real-time reverse transcription-polymerase chain reaction assay for the simultaneous detection of goose astrovirus genotypes 1 and 2
Park et al. Differential detection of porcine reproductive and respiratory syndrome virus genotypes by a fluorescence melting curve analysis using peptide nucleic acid probe-mediated one-step real-time RT-PCR
JP2005204664A (en) Detection of enterovirus nucleic acid
MX2010012275A (en) Method for detecting respiratory viral agents in a test sample.
KR20090131468A (en) Primers for detecting norovirus and method for identifying and detecting norovirus genes comprising the same
Balka et al. PriProET based melting point analyses on PRRSV positive field samples
KR102435209B1 (en) Composition for simultaneously distinguishing and detecting influenza type A and type B viruses and type 2 severe acute respiratory syndrome coronavirus and detection method using the same
JP2006223180A (en) Method for detecting herpes virus gene by using multiplex pcr
Cao et al. Genotyping of human adenoviruses using a PCR-based reverse line blot hybridisation assay
JP5315519B2 (en) Koi herpesvirus (KHV) detection method
US10017830B2 (en) Oligonucleotide probes, kit containing the same and method for pathotyping of H5 avian influenza viruses
Valentova et al. Restriction enzyme analysis of RT-PCR amplicons as a rapid method for detection of genetic diversity among bovine respiratory syncytial virus isolates
US20050260561A1 (en) Method for detecting and typing of cutaneous hpv and primers and probes for use therein
Sun et al. A novel HRM assay for differentiating classical strains and highly pathogenic strains of type 2 porcine reproductive and respiratory syndrome virus
Hornyák et al. Application of polymerase chain reaction and virus isolation techniques for the detection of viruses in aborted and newborn foals
TWI754967B (en) Kit and method for multiplex detection of chikungunya virus and zika virus and kit and method for detection of zika virus
KR20120076154A (en) Rt-pcr composition for detecting norovirus

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant