KR102100168B1 - Cosmetic composition containing the extracts of natural substances, Palmaria palmata, Chondrus crispus, Sargassum pallidum and Codium fragile - Google Patents

Abstract

The present invention relates to a cosmetic composition which comprises a complex extract of Palmaria palmata, Chondrus crispus, Sargassum pallidum, and Codium fragile as an effective component, and thus exhibits excellent antibacterial effects against skin pathogens, as well as immune cell activation effects and anti-inflammatory effects on excessive inflammatory reactions. The complex extracts exhibit excellent antibacterial effects against the bacteria that may adversely affect the skin and female genitalia; activate NK cells; and reduce inflammatory mediators generated in excess in macrophage cell lines, and thus may be beneficially used as an antibacterial, immunity-enhancing, and anti-inflammatory cosmetic material.

Description

Cosmetic composition containing Cosmetic composition containing the extracts of natural substances, Palmaria palmata, Chondrus crispus, Sargassum pallidum and Codium fragile}

The present invention relates to a cosmetic composition containing a complex extract of Palmson palmata , Chondrus crispus , Sargassum pallidum and Codium fragile as an active ingredient, specifically, these composites The present invention relates to a cosmetic composition having an excellent antimicrobial effect against microorganisms that contain an extract as an active ingredient and may have an adverse effect on skin, and has excellent immune cell activation and anti-inflammatory effects.

There are various dermatophytes on the skin. Most dermatophytes are non-pathogenic that do not harm humans or are bacteria that provide benefits such as preventing harmful bacteria and supplying nutrients. However, some infiltrate the blood of patients with reduced immunity and cause various diseases (Cogen et al., 2008). Skin diseases that cause skin diseases include Candida albicans (C. albicans), Escherichia coli (E. coli), Gardnerella vaginalis (G. vaginalis), Propionibacterium acnes, Malassezia furfur, and Staphylococcus aureus (Kim Sun-young, etc.) 2010; Jiyoung Lee et al., 2014; Changsoo Kim, 2012; Jeongjun Park etc., 2010).

Among them, Candida albicans ( C. albicans ) is a group of normal bacteria present in the human skin, respiratory tract, intestinal tract, and female genital mucosa. When overgrown, it causes superficial infections such as candidiasis on the skin, mouth, and vulva. The causative agent of pathogenic blood flow infection is the fourth place, and it is also a pathogen with a mortality rate of almost 40% (Lee Joo-hee et al., 2005). E. coli is a normal bacterial flora mainly found in human skin, intestines, and female genital organs. Most of them are known to be non-pathogenic, but some of them are pathogenic. Pathogenic Escherichia coli ( E. coli ) is known to cause various diseases such as sepsis, urinary tract infections, gastroenteritis, meningitis, and pneumonia. On the basis of these problems, in order to prevent contamination of microorganisms in cosmetics, the Ministry of Food and Drug Affairs in 2006 enacted a method for testing microorganisms in cosmetics and C. albicans and E. Coli has been included in regulated microorganisms (Korea Food and Drug Administration, 2006).

Gardnerella gana vaginalis ( G. vaginalis ) is a bacterium commonly found in the female genitalia and is the main causative agent of bacterial vaginosis and is found in more than 98% of women with bacterial vaginosis. Bacterial vaginosis is characterized by the appearance of a homogeneous white vaginal discharge in which the normal bacterium of the vagina, Lactobacillus , is replaced by G. vaginalis , anaerobic bacteria, Mycoplasma hominis, etc., and when left untreated, obstetric complications, preterm birth, endometriosis, and pelvis It causes inflammation and inflammation around the uterus and vagina, and increases the infection rate of human immunodeficiency virus (HIV) (Sung Hyun-ah et al., 2010).

Therefore, it is necessary to use these effective materials in developing products that directly apply to the human body, such as cosmetics and foods, by evaluating the antibacterial activity against these strains and conducting relevant studies on human safe materials. Although various preservatives and antibacterial agents are used in cosmetics to suppress the growth of microorganisms that cause these skin diseases, synthetic substances can cause inflammatory side effects such as erythema, rash, and allergies on the skin, so it is necessary to develop safer and more effective natural products ( Cho Chun-gu et al., 2002).

The immune response means a defense mechanism against various pathogenic factors coming from outside and abnormal cells produced in our body. When external pathogens, such as bacteria and viruses, penetrate into our body, become infected with parasites, or even develop cancer cells in our body, the immune system detects them and directly removes these pathogenic factors or kills the cells infected with them. In our body, there are systems called innate immunity and acquired immunity, of which the innate immunity response is the primary immune system, especially natural killer cells (NK cells), one of the immune cells responsible for innate immunity, are receptors without prior sensitization. It plays an important role not only in the immune response to various pathogenic microorganisms but also in the anti-cancer immune response by the interaction of and ligands (Hyojun Lee, 2013). Therefore, a material capable of activating NK cells can enhance the body's immune response.

Inflammation is an important defensive reaction of a living organism that removes substances that pose a danger to it and initiates treatment. Inflammatory response is an innate immune function that quickly recognizes and removes external intruders and internal dangerous substances. Macrophages, neutrophils and dendritic cells, which are inflammatory cells that secrete inflammatory mediators. And others (Lee., 2013). Inflammatory mediators secreted by macrophages may play an important role in activating the immune function of peripheral cells, but excessive nitric oxide (NO), prostaglandin E ₂ (PGE ₂ ), etc. may also cause inflammation-related symptoms and disease exacerbation. (Kim et al., 2004). NO and PGE ₂ are representative indicators of inflammation, and in general, they play an important role in killing microorganisms such as bacteria, suppressing tumors, or regulating inflammatory reactions, but when macrophages are excessively activated, NO and PGE ₂ are various inflammatory cytokines. Will produce Excessive production of these factors in the inflammatory reaction causes tissue damage, genetic variation, and nerve damage, which in particular causes erythema, rash, and itching in the skin. Therefore, inhibition of the production of these inflammatory mediators is an important target in treating or preventing inflammatory symptoms and diseases (Shim Joong-Hyun, 2018).

The present inventors tested skin antibacterial, immune cell activation and anti-inflammatory activity against domestic native plants in order to respond to the Nagoya Protocol, which has been in effect since 2018, while 4 types of excellent seaweed, pink palm, and Irish Moss, Al-Amos, and hearing were discovered. Seaweeds are nutritionally low in calories, rich in vitamins, minerals, and dietary fiber, and contain a large amount of non-digestible viscous polysaccharides that are not found in land plants, and are characterized by having many essential amino acids and unsaturated fatty acids compared to vegetables. In addition, various physiological control functions such as anti-tumor, anti-virus, and immunity enhancement have been revealed (Park et al., 2012).

Palson-i-hongchi, also known as 'dulse', is rich in protein and has shown its potential as a cheap and nutritious food that can compete with protein crops such as 'bean'.

Irish moss has a high carbon content and is known to be a source of dietary fiber with prebiotic efficacy (Liu et al., 2015). Korean Patent Publication Nos. 2013-0018739, 2018-0099885, 2014-0041467, Patents related to skin anti-inflammatory, Korean Patent Publications 2010-0131809, 2018-0099885, 2014- 0041467 and the like are searched, but there is no direct relationship with the present invention.

It is a seaweed belonging to the algae Imojaban, and it is known that the fatty acids and esters contained in the Algamojaban affect the antibacterial activity against bacteria such as C. albicans and E. coli (Gerasimenki et al. al., 2014).

Hearing is a green algae belonging to the auditory family of feather horse wood, and is widely used in Korea as a subsidiary material of kimchi. Hearing has a strong antimicrobial effect, and because it has an anthelmintic component, it was previously used as a roundworm. In addition, it is known that it is rich in beta-carotene and thus suppresses cancer cells and enhances immune function (Jun Eun-bi et al., 2019). Anti-inflammatory and immunomodulatory effects have been reported in the macrophage cell line Raw264.7 (Lee et al., 2017; Tabarsa et al., 2015). Hearing skin antibacterial related patent is Korean Patent No. 10-1768613, but it is limited to the genus Staphylococcus. Patents related to hearing immunity enhancement and anti-inflammatory include Korean Patent Publication Nos. 2015-0117741 and 2018-0064103, but have antibacterial, immunomodulatory, and antibacterial activities against complex extracts of ulchi, pink, Irishmos, and Alsamozoban, including hearing. Nothing is known about it.

The present inventors conducted research to discover a complex of marine-derived natural materials that can exhibit antibacterial, immune cell activation, and anti-inflammatory effects on the skin. Four types of materials were selected. In the case of mixing them to produce a complex extract, the present invention was completed by confirming that it has excellent antimicrobial activity against microorganisms that may have harmful effects on the skin, activates immune cells, and greatly enhances inflammation-relieving effects.

An object of the present invention is to provide a cosmetic composition containing as an active ingredient a hand-held pink iris, Irish moss, alcheni cap and auditory complex extract.

According to the present invention in order to achieve the above object is provided a cosmetic composition containing 0.01 to 10% by weight relative to the total weight of the cosmetic composition as an active ingredient in the palm of the hand pink, Irish moss, almond mother's egg and auditory complex extract.

The forearm pink, iris moss, almond cap, and auditory complex extracts have a weight ratio of dried arm, pink, iris moss, al cap, and hearing, respectively, 1 to 10: 1 to 10: 1 to 10: 1 to 10 It is prepared by mixing extraction with.

The cosmetic composition is characterized by having excellent antimicrobial activity against microorganisms that may have harmful effects on skin or female genital organs, and activating immune cells and alleviating excessive inflammatory reactions.

The cosmetic composition containing the palmson bicolor pink iris, Irish moss, alchenimojaban, and auditory complex extract as an active ingredient is safe by containing natural extracts, and its synergistic effect has excellent antibacterial, immune cell activation and anti-inflammatory efficacy Indicates.

Hereinafter, the contents of the invention will be described in detail in order to help the understanding of the invention.

According to the present invention, there is provided a cosmetic composition containing 0.01 to 10% by weight based on the total weight of the cosmetic composition as an active ingredient of the palmson's pink iris, Irish moss, almond mother's egg and auditory complex extract.

According to one embodiment of the present invention, the arm horn pink iris, Irish moss, algae capsicum and auditory complex extract are prepared as follows. First, the dried palmson's pink iris, Irish moss, and almond capsicum are mixed in a weight ratio of 1 to 10: 1 to 10: 1 to 10: 1 to 10, respectively. Subsequently, at least one extraction solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethanol, propylene glycol and butylene glycol is added to extract the mixture according to a conventional method. Then, filtered and dried to prepare a complex extract.

At this time, it showed better activity when mixed with the weight ratio of 5 to 10: 1 to 5: 1 to 5: 5 to 10, respectively, and extracting the palms of the hand, Irish moss, Irish moss, and hearing, respectively, 5 It exhibited the best activity when mixed and extracted at a weight ratio of 1: 1: 1: 10.

The complex extract of the palmson bischile, iris moss, alcheniforma and auditory, thus prepared, exhibits excellent antibacterial, immune cell activation and anti-inflammatory efficacy compared to extracts of the palmian dichroic, iris moss, albino miban or auditory, respectively. The synergistic effect between the active ingredients according to the mixing was confirmed.

The present invention is a microbial organism, particularly Candida, which can have a detrimental effect on the skin or female genital organs without affecting the survival rate of skin-derived cell lines (Perimental Example 1). Albicans (Candida albicans), Escherichia coli (Escherichia coli), and showed excellent antimicrobial activity against Gardnerella vaginalis (Test Examples 2-4), activated immune cells, NK cells (Test Example 5), the amount of inflammatory mediators excessively produced in activated macrophages was significantly reduced (Test Examples 6-7). In addition, when this complex extract was applied to serum and cream formulations, it exhibited formulation safety under room temperature, refrigeration, and constant temperature conditions (Test Example 8). Therefore, the cosmetic composition can be usefully used as a cosmetic for antibacterial, immune response activation and anti-inflammatory.

The Palson's pink iris, Irish Moss, Albino stool and hearing complex extract may be contained in an amount of 0.01 to 10% by weight based on the total weight of the cosmetic composition as an active ingredient.

 The cosmetic composition of the present invention can be prepared in any conventionally prepared formulation, for example, lotion, cream, essence, cleansing foam, cleansing water, female cleanser, pack, body lotion, body oil, body gel, shampoo, Rinse, hair conditioner, hair gel, foundation, lipstick, mascara and makeup base.

[Example]

Hereinafter, examples will be described in detail to help understanding of the present invention. However, the following examples are merely illustrative of the contents of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

Preparation Examples 1-4: Preparation of Palson's Ichigochi, Irish Moss, Albino Capsicum or Auditory Extract

As the extraction solvent for dried palmson's pink, iris moss, almonds, and hearing, add 10 times the weight of hydrous ethanol and heat it at 80 ℃ ~ 100 ℃ in an extractor with cooling condenser (Cosmos-660, Gyeongseo Machinery) for 2 hours. It was extracted three times in total.

 After extraction by the above method, the mixture was left at room temperature for 3 days, and the precipitate was filtered with a 300 mesh filter paper, and the precipitate was filtered twice with a filter paper of Edbentech No. 5 and a 150 mm filter paper by Whatman GFC. Then, using a vacuum concentrator (Coolace CCA-1100, EYELA), concentrate it at a temperature of 40 ℃ ~ 50 ℃, and then use an inlet temperature of 180 ℃ using a spray dryer (B-290, BUCHI), and an aspirator. Drying under conditions of 100% efficiency (35 cm 3 / hour), 25% pump efficiency (7.5 ml / min), Nozzle Cleaner 4 and Rotameter: 30 mm (357 liters / hour) To give 5-15 g of the extracted powder of the title.

Examples 1-25: Preparation of pink and pink palm, Irish moss, algae capsicum and auditory complex extract

To a mixture of dried palmson's pink iris, Irish moss, almond capsicum and hearing in the weight ratio shown in Table 1 below (equal to the weight of the extract of each preparation example), add 10 times the weight of hydrous ethanol as the extraction solvent and cool the condenser. The extractor was heated at 80 ℃ ~ 100 ℃ in an extractor (Cosmos-660, Kyungseo Machine) and extracted three times for 2 hours.

 After extraction by the above method, cooled at room temperature, the precipitate was filtered with a 300 mesh filter paper, and the precipitate was filtered twice with a filter paper of Edbentech No. 5 and a Whatman GFC 150 mm filter paper. Then, using a vacuum concentrator (Coolace CCA-1100, EYELA), concentrate it at a temperature of 40 ℃ ~ 50 ℃, and then use an inlet temperature of 180 ℃ using a spray dryer (B-290, BUCHI), and an aspirator. Drying under conditions of 100% efficiency (35 cm 3 / hour), 25% pump efficiency (7.5 ml / min), Nozzle Cleaner 4 and Rotameter: 30 mm (357 liters / hour) To give 5-15 g of the extracted powder of the title.

Weight ratio Pink arm Irish Moss Aunt's hat ear Example 1 One One One One Example 2 5 One One One Example 3 10 One One One Example 4 5 5 One One Example 5 5 10 One One Example 6 10 5 One One Example 7 10 10 One One Example 8 5 One 5 One Example 9 5 One 10 One Example 10 5 5 One 5 Example 11 10 5 One 5 Example 12 5 5 One 10 Example 13 10 5 One 10 Example 14 5 10 One 5 Example 15 5 10 One 10 Example 16 5 One 5 5 Example 17 10 One 5 5 Example 18 5 One 5 10 Example 19 10 One 5 10 Example 20 5 One 10 5 Example 21 5 One 10 10 Example 22 5 One One 5 Example 23 10 One One 5 Example 24 5 One One 10 Example 25 10 One One 10

Test Example 1: Confirmation of cytotoxicity

To check for cytotoxicity, the keratinocyte cell line HaCaT was cultured in DMEM medium with 10% FBS added, and inoculated at a cell concentration of 5 × 10 ⁵ in a 96 well plate and cultured in a 37% 5% CO ₂ incubator for 24 hours. . After cultivation, the medium was removed, and the extract prepared in the above Preparation Examples and Examples was diluted in dimethyl sulfoxide so that the sample concentrations were 0.1, 0.5, and 1.0%. [4,5-dimethylthiazol-2yl] -2,5-diphenyltetrazoliumboromide, Sigma) was added 100 ml to each well (3 mg / ml) and further incubated for 4 hours. Thereafter, the supernatant was removed, 150 μl of dimethyl sulfoxide was added, and formazan produced by shaking for 30 minutes was dissolved, and absorbance at 540 nm was measured using a multimicroplate reader (Molecular device Spectra max190). Cell viability was calculated according to the following formula and the results are shown in Table 2 below.

Cell viability (%) = Absorbance of the sample-added group / Absorbance of the control group × 100

division Cell viability (%) 0.1% 0.5% 1.0% Preparation Example 1 101 101 100 Preparation Example 2 101 101 100 Preparation Example 3 100 100 100 Preparation Example 4 100 100 100 Example 1 101 100 99 Example 2 100 100 101 Example 3 100 101 101 Example 4 101 100 99 Example 5 100 101 100 Example 6 100 101 100 Example 7 101 100 99 Example 8 101 101 100 Example 9 100 101 100 Example 10 101 101 100 Example 11 100 100 99 Example 12 100 100 101 Example 13 101 100 100 Example 14 100 99 99 Example 15 100 99 100 Example 16 101 100 100 Example 17 100 99 101 Example 18 100 100 100 Example 19 100 100 100 Example 20 100 100 101 Example 21 101 100 101 Example 22 100 100 101 Example 23 99 99 100 Example 24 100 99 99

As shown in the results of Table 2, the hand applied to the pink iris, Irish Moss, algae mojaban or auditory extract, and a mixture extract thereof, the cell viability is not affected as it exhibits a cell viability of 95% or more. It was confirmed that there was no problem in safety.

Test Example 2: C. albicans Antibacterial effect against

The C. albicans strain used in the experiment was distributed from the Korea Institute of Biotechnology and Biotechnology Resource Center (KCTC; Korea Collection for Type Culture), and was used after 2 to 3 consecutive passages as a fresh culture grown in a liquid medium or a solid medium. . A single colony of colonies was taken as a loop, C. albicans was inoculated into YM Broth, and cultured at 25 ° C for 72 hours, and the culture medium was inoculated into the medium so that the culture solution was contained at 1 × 10 ⁶ CFU / ml. After preparing samples in concentrations of 0.1%, 0.5%, and 1.0%, extracts of Preparation Examples or Examples were loaded twice into filter paper discs (8mm paper discs (advantec, Toyo)) at 20 µl. The antibacterial activity was searched for the presence and size of proliferation inhibition zones around the disc, and the results are shown in Table 3.

division Inhibition zone size (mm) 0.1% 0.5% 1.0% Preparation Example 1 14 15 16 Preparation Example 2 17 18 19 Preparation Example 3 16 18 18 Preparation Example 4 15 17 18 Example 1 23 24 25 Example 2 24 24 26 Example 3 24 24 25 Example 4 23 25 26 Example 5 24 26 27 Example 6 25 25 28 Example 7 23 26 27 Example 8 24 25 25 Example 9 25 26 27 Example 10 32 33 34 Example 11 31 33 35 Example 12 33 33 34 Example 13 35 36 37 Example 14 25 26 28 Example 15 25 26 27 Example 16 32 33 35 Example 17 33 34 36 Example 18 34 35 37 Example 19 35 36 38 Example 20 26 26 27 Example 21 25 26 28 Example 22 31 33 34 Example 23 32 34 36 Example 24 38 40 43 Example 25 33 35 36 1,2-Hexanediol - - 44

As shown in the results in Table 3, the size of the inhibition zone for the C. albicans strain, when compared to the respective extracts of the preparation example, the present invention examples of the palms of the hands, Irish moss, Illmosmosa and auditory complex extracts It appeared largely and it was confirmed that the antibacterial activity against the strain was excellent. In Examples 10 to 13, 16 to 19, and 22 to 25, excellent antibacterial activity was exhibited, and in Example 24, excellent activity similar to that of the positive control was shown.

Test Example 3: E. coli Antibacterial effect against

The E. coli strain used in the experiment was distributed from the Korea Institute of Biotechnology and Biotechnology Resource Center (KCTC; Korea Collection for Type Culture). The antibacterial activity was searched for the presence and size of the proliferation inhibition zone formed around the disc, and the results are shown in Table 4.

division Inhibition zone size (mm) 0.1% 0.5% 1.0% Preparation Example 1 14 15 16 Preparation Example 2 16 17 19 Preparation Example 3 17 18 19 Preparation Example 4 16 16 17 Example 1 25 27 28 Example 2 24 25 26 Example 3 25 26 27 Example 4 23 25 26 Example 5 24 24 26 Example 6 25 26 28 Example 7 26 26 27 Example 8 24 27 29 Example 9 23 25 27 Example 10 38 39 42 Example 11 37 38 40 Example 12 35 36 38 Example 13 38 40 41 Example 14 25 26 26 Example 15 26 27 29 Example 16 35 36 37 Example 17 38 39 40 Example 18 37 38 41 Example 19 38 39 40 Example 20 24 25 26 Example 21 26 27 27 Example 22 37 38 40 Example 23 36 37 41 Example 24 42 45 47 Example 25 37 40 42 1,2-Hexanediol - - 52

As shown in the results of Table 4, when compared to the respective extracts of the preparation examples, the size of the inhibition zone for the E. coli strain is compared to the respective extracts of the preparation examples of the present invention examples of palmson's pink iris, iris moss, albino motban, and auditory complex extracts. It appeared largely, and it was confirmed that the antibacterial activity against the strain was excellent. In Examples 10 to 13, 16 to 19, and 22 to 25, excellent antibacterial activity was exhibited, and in particular, the best activity was obtained in Example 24.

Test Example 4: G. vaginalis Antibacterial effect against

The strain G. vaginalis was used by pre-sale from the Korea Institute of Biotechnology and Biotechnology Resource Center (KCTC; Korea Collection for Type Culture). The strain was cultured in an anaerobic chamber maintained at 37 ° C, and the anaerobic conditions for culture were maintained at 5% CO ₂ , 10% H ₂ , and 85% N ₂ , and the culture medium was 5% fetal calf. Brucella broth containing serum (fetal bovine serum) and 2% agar powder was used. After preparing the sample in the concentration of 0.1%, 0.5%, and 1.0% of the preparation example or the example, and loading it twice into filter paper disc (8mm paper disc (advantec, Toyo)) at 20 µl each time, completely absorbed, and then solvent And evaporated to dryness. The prepared paper disc was placed on a plate of Brucella agar plated with G. vaginalis and incubated for 24 hours at 37 ° C. under anaerobic conditions, and the antibacterial activity was determined by the presence and size of an inhibition zone generated around the disc. Was searched, and the results are shown in Table 5.

division Inhibition zone size (mm) 0.1% 0.5% 1.0% Preparation Example 1 14 16 17 Preparation Example 2 17 17 19 Preparation Example 3 16 17 18 Preparation Example 4 15 16 18 Example 1 23 25 26 Example 2 24 25 27 Example 3 23 23 24 Example 4 22 25 26 Example 5 24 26 27 Example 6 25 26 27 Example 7 24 25 26 Example 8 22 24 27 Example 9 22 23 24 Example 10 31 32 34 Example 11 32 35 36 Example 12 33 34 36 Example 13 34 35 37 Example 14 25 27 28 Example 15 26 27 29 Example 16 35 36 37 Example 17 32 34 35 Example 18 34 37 38 Example 19 35 36 37 Example 20 27 28 29 Example 21 28 29 31 Example 22 34 35 37 Example 23 35 36 38 Example 24 38 41 43 Example 25 34 35 39 Ampocollin 45 - -

As can be seen from the results of Table 5, the size of the inhibition zone for the G. vaginalis strain, compared to the respective extracts of the preparation example, the present invention examples of palmson's pink, iris moss, albinosmojaban and auditory complex extracts It appeared largely, and it was confirmed that the antibacterial activity against the strain was excellent. In particular, Examples 10 to 13, 16 to 19, and 22 to 25 exhibited excellent antibacterial activity, and exhibited the best activity in Example 24.

Test Example 5: NK cell activity promoting effect

The human NK cell line, NK-92 cells, is 37 ° C. using α-MEM medium containing 10% fetal bovine serum, 10% horse serum, 0.2 mM inositol, 0.1 mM β-mercaptoethanol and 10 ng / mL IL-2. Cultured in a 5% CO ₂ incubator.

After dispensing the NK-92 cell line to a 24-well plate at 1 × 10 ⁶ cells / well density and attaching it to the plate for 24 hours, a new medium containing 0.1%, 0.5%, and 1.0% concentration samples was treated, and 4 Incubated for hours. Then, cells were recovered and RNA was extracted using TRIzol reagent, and cDNA was synthesized using oligo- (dT) 20 primer and Superscript III RT. Real-time quantitative PCR was performed using the Fast Start DNA Master SYBR Green I kit. Since interferon-γ (IFN-γ) is generated when NK cells are activated, the mRNA expression level of IFN-γ was confirmed in this test, and results were calculated using β-actin as an internal reference. The primer sequence of IFN-γ (5 '→ 3') was Forward: GATGCTCTTCGACCTCGAAACAGCAT, Reverse: ATGAAATATACAAGTTATAATCTTGGCTTT. Table 6 shows the results.

division IFN-γ expression 0.1% 0.5% 1.0% Control 1.00 Preparation Example 1 1.01 1.03 1.04 Preparation Example 2 1.00 1.02 1.05 Preparation Example 3 1.02 1.04 1.05 Preparation Example 4 1.01 1.03 1.06 Example 1 1.10 1.12 1.13 Example 2 1.10 1.11 1.12 Example 3 1.11 1.12 1.13 Example 4 1.10 1.10 1.12 Example 5 1.12 1.13 1.13 Example 6 1.11 1.12 1.12 Example 7 1.10 1.13 1.14 Example 8 1.11 1.12 1.13 Example 9 1.12 1.13 1.15 Example 10 1.21 1.22 1.24 Example 11 1.20 1.21 1.23 Example 12 1.21 1.23 1.24 Example 13 1.21 1.24 1.25 Example 14 1.12 1.13 1.14 Example 15 1.13 1.13 1.14 Example 16 1.22 1.24 1.26 Example 17 1.21 1.23 1.25 Example 18 1.22 1.23 1.24 Example 19 1.23 1.24 1.25 Example 20 1.12 1.13 1.15 Example 21 1.13 1.14 1.15 Example 22 1.20 1.21 1.22 Example 23 1.22 1.24 1.26 Example 24 1.29 1.32 1.37 Example 25 1.23 1.25 1.26

As can be seen from the results of Table 6, compared to the respective extracts of the preparation example, the present invention examples of palmson's pink iris, iris moss, albinozimaban and auditory complex extracts, mRNA expression of IFN-γ in NK cell lines was further improved. Appeared to increase. In particular, in Examples 10 to 13, 16 to 19, and 22 to 25, excellent NK cell line activation efficacy could be confirmed, and Example 24 showed the best efficacy.

Test Example 6: NO production inhibitory effect

The mouse macrophage cell line RAW 264.7 cells were cultured in a 37 ° C, 5% CO ₂ anti-incubator using DMEM medium containing 10% fetal bovine serum and 1% penicillin / stereptomycin.

The raw 264.6 cell line was dispensed into a 96-well plate at a 3 × 10 ⁵ cells / well density and attached to the plate for 24 hours. In order to induce an inflammatory reaction, a new medium containing 100% ng / ml LPS (lipopolysaccharide) and 0.1%, 0.5% and 1.0% concentration samples was treated and cultured for 24 hours. The positive control N-monomethyl-L-arginine (NMMA) was treated at a concentration of 25 μM.

The NO level generated in the cells and present in the culture was measured using a Greases reaction. After 50 µl of the culture solution was dispensed into a 96-well plate, 25 µl of a sulfanil amide solution and 25 µl of a naphthyl ethylene diamine solution were added, reacted at room temperature for 10 minutes, and absorbance was measured at 570 nm. Each NO production amount was calculated using a standard calibration curve obtained using a nitrite standard, and the results are shown in Table 7.

division NO production (Nitrite, μM) 0.1% 0.5% 1.0% Control 2 LPS 41 Preparation Example 1 35 32 31 Preparation Example 2 37 36 32 Preparation Example 3 36 35 33 Preparation Example 4 38 35 33 Example 1 31 29 28 Example 2 30 27 26 Example 3 33 31 27 Example 4 34 30 27 Example 5 30 28 27 Example 6 32 30 26 Example 7 31 28 24 Example 8 29 27 23 Example 9 33 30 27 Example 10 22 20 18 Example 11 20 19 17 Example 12 21 20 18 Example 13 22 19 17 Example 14 30 28 26 Example 15 31 27 25 Example 16 20 18 16 Example 17 22 20 17 Example 18 20 16 15 Example 19 21 18 14 Example 20 29 27 25 Example 21 30 26 54 Example 22 23 20 18 Example 23 22 18 16 Example 24 18 13 7 Example 25 21 17 14 NMMA 6

As can be seen from the results of Table 7, the present invention examples, compared to the respective extracts of the preparations of the palms of the hand pink, Irish moss, algae mojaban and auditory complex, the NO production in the hyperactive macrophage cell line more It has been shown to decrease. Particularly, in Examples 10 to 13, 16 to 19, and 22 to 25, excellent NO inhibitory ability was confirmed, and the best activity was obtained in Example 24.

Test Example 7: PGE ₂  Production suppression effect

The culture of RAW 264.7 cells was tested in the same manner as in Test Example 6. The Raw 264.6 cell line was dispensed into a 48-well plate at a 5 × 10 ⁵ cells / well density and attached to the plate for 24 hours. In order to induce an inflammatory reaction, a new medium containing 100% ng / ml LPS and 0.1%, 0.5% and 1.0% concentration samples was treated and cultured for 24 hours. Dexamethasone was used as a positive control.

The amount of PGE ₂ generated in the cells and present in the culture medium was measured according to the usage by purchasing a competitive enzyme immuno assay kit (Cayman Chemical). The production amount of each PGE ₂ was calculated by drawing a standard calibration curve using the standard added to the kit, and the results are shown in Table 8.

division PGE ₂ production (pg / ml) 0.1% 0.5% 1.0% Control 84 LPS 425 Preparation Example 1 402 387 365 Preparation Example 2 422 398 376 Preparation Example 3 412 386 371 Preparation Example 4 398 380 357 Example 1 321 305 284 Example 2 334 299 275 Example 3 326 310 289 Example 4 315 284 257 Example 5 320 302 278 Example 6 331 319 286 Example 7 317 285 254 Example 8 335 297 266 Example 9 327 275 264 Example 10 256 234 211 Example 11 244 228 207 Example 12 250 236 201 Example 13 264 246 218 Example 14 314 265 241 Example 15 302 278 255 Example 16 240 221 208 Example 17 251 236 219 Example 18 241 216 209 Example 19 235 218 202 Example 20 334 294 258 Example 21 321 274 240 Example 22 240 227 209 Example 23 235 217 198 Example 24 197 180 162 Example 25 221 208 187 Dexamethasone 158

As can be seen from the results in Table 8, in the embodiment of the present invention, the arm of the hand, pinkish iris, Irish moss, and auricular complex extracts are inflamed in the Raw264.7 cell line, which was excessively activated with LPS compared to the respective extracts of the preparation example. It has been shown to further reduce the production of the mediator PGE ₂ . It showed the best activity in Example 24.

Example 26: Preparation of serum containing Palson's pink iris, Irish moss, algae capsicum and auditory complex extract

The serum containing the complex extract of Example 24 was prepared according to a conventional method with the composition and content of Table 9 below.

Raw material Content (% by weight) Complex extract (Example 24) 1.0 Wax 1.0 Polysorbate 60 1.5 Sorbitan sesquioleate 0.5 Mineral oil 10.0 Sorbitan stearate 0.5 Lipophilic glycerin monostearate 1.0 Stearic acid 1.5 Glyceryl stearate / page-400 stearate 1.0 Propylene glycol 3.0 Carboxy polymer 0.1 Triethanolamine 0.1 Phenoxyethanol Proper Purified water To 100

Example 27: Preparation of cream containing Palson's pink iris, Irish moss, almond capsicum and auditory complex extract

The cream containing the complex extract of Example 25 was prepared according to a conventional method with the composition and content of Table 10 below.

Raw material Content (% by weight) Complex extract (Example 25) 1.0 Shea butter 2.0 Polysorbate 60 1.5 Sorbitan sesquioleate 0.8 Mineral oil 10.0 Dimethicone 3.0 Sorbitan stearate 0.5 Lipophilic glycerin monostearate 1.0 Cetearyl alcohol 2.0 Glyceryl stearate / page-400 stearate 1.0 Propylene glycol 3.0 Carboxy polymer 0.25 Triethanolamine 0.25 Phenoxyethanol Proper Purified water To 100

Test Example 8: Confirmation of formulation stability

The formulations prepared in Examples 26 and 27 were placed in an opaque glass container in an indoor, refrigerator, and incubator kept constant at room temperature (25 ° C), refrigeration (4 ° C), and constant temperature (50 ° C) for 12 and 24 weeks. Storage and observation (discoloration, odor and separation), and stability was confirmed. Table 11 shows the results.

Temperature condition Stability check (discoloration, odor and separation) Example 26 Example 27 Room temperature (25 ℃) 0 0 Refrigeration (4 ℃) 0 0 Constant temperature (50 ℃) 0 0

<Formulation stability grade>

0: No change 1: Minor change 2: Change 3: Severe change

As shown in Table 11, it was confirmed that the formulations of Examples 26 and 27 were stable without discoloration odor and separation under 25 ° C, 4 ° C, and 50 ° C temperature conditions.

Claims (6)

It contains 0.01 to 10% by weight based on the total weight of the cosmetic composition as an active ingredient of Palson's Ichimochi, Irish Moss, Albinozimaban and auditory complex extract, and Candida albicans, Escherichia coli and Guard Antibacterial cosmetic composition showing antimicrobial activity against Nerella barginalis. The method of claim 1, wherein the forearm pink iris, iris moss, algae capsicum and auditory complex extracts have a palssum pink iris, iris moss, algae capsicum and hearing, respectively 1 to 10: 1 to 10: 1 to 10: 1 to Antibacterial cosmetic composition, characterized in that it is mixed and prepared by mixing in a weight ratio of 10. delete delete The antibacterial cosmetic composition according to claim 1, wherein the cosmetic composition has an immune response activation effect. The antibacterial cosmetic composition according to claim 1, wherein the cosmetic composition has an effect of alleviating inflammation.