KR102081003B1 - Composition comprising suberic acid for preventing hair loss or stimulating hair growth - Google Patents

Abstract

The present invention relates to a composition for preventing hair loss or promoting hair growth comprising suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient, and more specifically, the present invention provides hair loss comprising suveric acid or a salt thereof as an active ingredient. The present invention relates to a pharmaceutical composition for preventing, treating hair loss, promoting hair growth, or promoting hair growth, a quasi-drug composition, a cosmetic composition, and a nutraceutical composition. The composition of the present invention not only contains a natural compound having no side effects even during long-term administration of hair loss as a chronic disease as an active ingredient, and shows excellent and stable effects on hair growth and hair growth, or prevents or treats hair loss, or promotes hair growth or hair growth. It can be usefully used as a drug, quasi-drug, cosmetics, health functional food composition.

Description

A composition for preventing hair loss or promoting hair growth that includes suveric acid as an active ingredient {COMPOSITION COMPRISING SUBERIC ACID FOR PREVENTING HAIR LOSS OR STIMULATING HAIR GROWTH}

The present invention relates to a composition for preventing hair loss or promoting hair growth comprising suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient, and more specifically, the present invention provides hair loss comprising suveric acid or a salt thereof as an active ingredient. The present invention relates to a pharmaceutical composition for preventing, treating hair loss, promoting hair growth, or promoting hair growth, a quasi-drug composition, a cosmetic composition, and a nutraceutical composition.

According to the National Institutes of Health Insurance, Korea Health Insurance Policy Institute analyzed the health insurance payment data from 2001 to 2008, the number of patients diagnosed with 'hair loss disease' was 103,000 in 2001 and 142,000 in 2005. And 165,000 in 2008, up 60% over the last seven years. By age, 114,000 patients in their 20s and 40s were diagnosed, accounting for 69.5% of the patients, and over 22,000 patients were in their teens. As of 2008, there were 84,000 males and 80,000 females, and males were slightly higher than females. In 2008, alopecia areata (130,000), scarring alopecia (20,000), androgenetic alopecia (9,000), and other non-scarious hair loss (8,000) were followed.

Meanwhile, according to data from the June 2003 International Hair and Cosmetic Beauty Research Forum, 2.5 million people worldwide had hair loss, and the incidence of hair loss was 30 to 65% at 24 to 50 years of age. As of 2008, there are about 300 million alopecia in China, about 30% of male population in their 30s and 50% of male population in their 50s, and the number of hair loss patients increases by 10-15% every year. Doing. According to data from Japanese companies that sell wigs and hair transplant surgery in 2007, the incidence of Japanese hair loss was 26.5%, and the estimated population of hair loss patients was estimated at 1,293 million.

Currently, drugs for treating hair loss are classified into medicines, quasi-drugs, and cosmetics. One specialty drug that can be purchased with a doctor's prescription is Propesia, developed and sold by Merck. Finasteride, the main ingredient of propecia, was approved by the US FDA in December 1997 to treat hair loss. Finasteride is a drug that inhibits 5-alpha-reductase, which converts testosterone into dihydrotestosterone (DHT), which is responsible for growing hair into thick and long hair. It is effective in improving hair loss in the short term, but is accompanied by side effects such as erectile dysfunction, decreased sexual function, and breast enlargement in men.

Minoxidil is a generic drug that can be purchased without a doctor's prescription because of its safety and effectiveness. In December 1997, it was approved by the US FDA as the first anti-hair loss treatment. This drug has the effect of promoting hair growth by improving blood circulation and opening potassium channels, but local reactions such as itching and rashes may occur, and tachycardia may occur.

The KFDA is authorized to prevent hair loss and hair growth, and the quasi-drugs that can be sold at supermarkets and convenience stores by the Minister of Health and Welfare are representative of 'hair competence' of CJ Lion and 'hair tonic' of Moracle. LG H & H's 'Mo & Moa' products are available, and cosmetics are sold as shampoos or products used for scalp or hair to maintain or promote the health of skin and hair.

Human hair loss cycle is divided into anagen, catagen, and telogen. Growth phase is a time when hair growth grows rapidly due to active cell division and cell division. The lifespan of the growing season varies depending on the type of hair, but for hair it is about 3 to 6 years. Growth hair accounts for 80 to 90% of the total hair, the hair loss is progressing people will have a short hair growth period and a long rest period hair cycle will reduce the proportion of growth hair in the total hair. The degenerative stage of hair growth is slowed down and hair production gradually slows down, and cell division and growth stops lasting for 1 to 1.5 months. About 1% of all hairs belong to this stage. Resting phase is the final stage of growth when hair follicles and papillae are completely separated, causing hair follicles to atrophy and hair roots to rise upwards and hair fall out. The rest period lasts 3 to 4 months and 4 to 14% of all hairs fall into this phase. After the rest period, the activity of the nipple is active again, new nipples are created and the hair in the resting period is pushed out of the scalp completely.

Well known signaling systems involved in hair follicle development and hair growth are known as the Wnt / β-Catenin signal pathway. When the Wnt ligand binds to the receptor, the beta-catenin in the cytoplasm is stabilized and no degradation occurs and the movement to the cell nucleus is increased, thereby controlling the expression of the target gene. The results of Walter Birchmeier's team, published in the 2001 international journal Cell, confirmed that hair loss occurred in experimental animals knocked down betacatenin, indicating that betacatenin plays an important role in preventing and promoting hair loss. it means. In particular, activation of protein kinase A (PKA), AKT and glycogen synthase-3β (GSK-3β) is well known to activate the Wnt / betacatenin signaling pathway (Monick, 2001., Akira 2005). It is known to be activated by cAMP as a dependent enzyme, which inhibits beta-catenin degradation and increases stabilization in the cytoplasm, promotes migration to the cell nucleus and regulates expression of target heredity (Akira, 2005).

Meanwhile, suberic acid is mainly contained in plants such as Hollyhock, Althaea rosea , Rose-of-sharon, Hibiscus syriacus , Castor-oil-plant, and Ricinus communis . It is also an essential oil component of these plants. It is mainly used for industrial manufacturing purposes and is not approved as a flavoring agent. It is used, for example, in the manufacture of working fluids in plastic lubricants and hydraulic machinery, or in the manufacture of candles. Suveric acid has also been reported to be detected at high concentrations in the urine of diabetic patients (Yoshioka et al., Measurements of urianry adipic acid and suberic acid using high-performance liquid chromatography. J chromatogr B Biomed Appl. 655: 189-93). , 1994.) However, the effect of subcutaneous hair loss prevention or hair growth is unknown.

The present inventors have sought to find a naturally occurring compound that can prevent hair loss or promote hair growth or hair growth without side effects. As a result, the present invention was completed by confirming that suveric acid effectively promotes hair growth and hair growth and prevents hair loss.

Accordingly, an object of the present invention is to solve the above problems, hair loss prevention or treatment containing suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient, or for promoting hair growth or hair growth pharmaceutical It is to provide a composition.

Still another object of the present invention is to provide a quasi-drug composition for preventing or improving hair loss, or for promoting hair growth or hair growth, including suveric acid or a pharmaceutically acceptable salt thereof.

Still another object of the present invention is to provide a cosmetic composition for preventing or improving hair loss, or promoting hair growth or hair growth comprising suveric acid or a cosmetically acceptable salt thereof as an active ingredient.

Still another object of the present invention is to provide a health food composition for preventing or improving hair loss, or promoting hair growth or hair growth, including suveric acid or a food acceptable salt thereof as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating hair loss, or promoting hair growth or hair growth, including suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

According to a preferred embodiment of the present invention, the composition is β-catenin (β-catenin), PKA Cα (protein kinase A Cα), LEF-1 (lymphoid enhancer factor-1), IGF-1 (insulin-like growth factor-1), Vascular endothelial growth factor (VEGF), and cyclin D may be increased.

According to another preferred embodiment of the present invention, the pharmaceutical composition is a skin external preparation in the group consisting of creams, gels, patches, sprays, ointments, warnings, lotions, linen, pasta and cataplasma It may be the formulation of choice.

In addition, the present invention provides a quasi-drug composition for preventing or improving hair loss or promoting hair growth or hair growth comprising suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a cosmetic composition for preventing or improving hair loss, or promoting hair growth or hair growth comprising suveric acid or a cosmetically acceptable salt thereof as an active ingredient.

According to another preferred embodiment of the present invention, the cosmetic composition is scalp tonic, scalp lotion, scalp cream, scalp serum, scalp essence, scalp ampoule, scalp treatment, scalp conditioner, scalp shampoo, scalp pack, hair tonic, Hair Lotion, Hair Cream, Hair Spray, Hair Mousse, Hair Gel, Hair Conditioner, Hair Shampoo, Hair Rinse, Hair Pack, Hair Treatment, Eyebrow Regrowth, Eyelash Regrowth, Eyelash Nutritional Supplement, Pet Shampoo or Pet Rinse It may be that.

In addition, the present invention provides a health functional food composition for preventing hair loss or promoting hair growth comprising suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention has been made to solve the above problems, to provide a composition for preventing or improving hair loss, or to promote hair growth or hair growth comprising suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The composition of the present invention not only contains a natural compound having no side effects even during long-term administration of hair loss as a chronic disease as an active ingredient, and shows excellent and stable effects on hair growth and hair growth, or prevents or treats hair loss, or promotes hair growth or hair growth. It can be usefully used as a quasi-drug, cosmetics, health functional food composition.

1 is a graph showing the results of toxicity evaluation of suberic acid in human dermal papilla cells. Each value is the mean ± standard error (SEM). ns = p> 0.05, * = p <0.05, ** = p <0.01, *** = p <0.001 [one-way ANOVA, Tukey's test]
Figure 2 is a graph showing the results of the evaluation of cell proliferation efficacy of suberic acid in human dermal papilla cells. Each value is the mean ± standard error (SEM). ns = p> 0.05, * = p <0.05, ** = p <0.01, *** = p <0.001 [one-way ANOVA, Tukey's test]
Figure 3 is a graph showing the effect of increasing the concentration of growth factors (VEGF and IGF-1) of subveric acid in human dermal papilla cells. Each value is the mean ± standard error (SEM). ns = p> 0.05, * = p <0.05, ** = p <0.01, *** = p <0.001 [one-way ANOVA, Tukey's test]
Figure 4 is a graph showing the effect of increasing the concentration of cAMP concentration of human dermal papilla cells. Each value is the mean ± standard error (SEM). ns = p> 0.05, * = p <0.05, ** = p <0.01, *** = p <0.001 [one-way ANOVA, Tukey's test]
5 is a graph showing the effect of the expression of the hair growth regulator signaling protein (PKA Cα, β-cateinin) of subvertic acid in human dermal papilla cells. Each value is the mean ± standard error (SEM). ns = p> 0.05, * = p <0.05, ** = p <0.01, *** = p <0.001 [one-way ANOVA, Tukey's test]
Figure 6 is a graph showing the effect of increasing expression of hair growth promoting related genes (LEF-1, Cyc-D, VEGF and IGF-1) of subvertic acid in human dermal papilla cells. Each value is the mean ± standard error (SEM). ns = p> 0.05, * = p <0.05, ** = p <0.01, *** = p <0.001 [one-way ANOVA, Tukey's test]

Hereinafter, the present invention will be described in detail.

As described above, in addition to hormonal secretion changes, there has been an increase in the demand for pharmaceutical compositions that can prevent hair loss and / or promote hair growth due to an increase in hair loss due to stress, but effective hair loss among natural derived compounds known to be safe for the human body. There is not much reported about compounds capable of preventing and / or promoting hair growth.

Subveric acid of the present invention can significantly exhibit hair growth promoting effects in mice with hair removed by controlling the expression of hair tissue-related genes and proteins, thereby providing a composition effective in preventing hair loss and promoting hair growth. .

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating hair loss, or promoting hair growth or hair growth, including suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The term "suberic acid" of the present invention is a dicarboxylic acid-based compound represented by the following Formula 1, the IUPAC name is octanedioic acid, and 1,8-octanedioic acid It is also called (1,8-octanedioic acid), 1,6-hexanedicarboxylic acid, and cork acid. The structural formula of suberic acid is C ₈ H ₁₄ O ₄ and has a molecular weight of 174 g / mol. Suberic acid is a colorless crystalline solid, insoluble in water, and soluble in alcohol and propylene glycol.

[Formula 1]

Subic acid is an essential oil component of various plants and is mainly used for industrial purposes. According to the oral toxicity test, the half lethal dose (LD ₅₀ value) of suveric acid was reported as 2,000 mg / kg in rats. In addition, clinical trial results: 4% solution reported no skin irritation or sensitization.

Therefore, oral administration of suveric acid at 0.1 mg / kg to 1,500 mg / kg, preferably 10 mg / kg to 1,000 mg / kg is not very toxic or cosmetic compositions, dietary supplements, pharmaceuticals or It may be used as a quasi-drug composition and the like.

In the present invention, the suveric acid may include a suveric acid hydrate, a suveric acid derivative, and the like, and a solvate or stereoisomer thereof.

In the present invention, by identifying the mechanism regulating the expression of genes and proteins related to hair growth of skin tissues, the sub acid was identified as a novel use for preventing hair loss or promoting hair growth of sub acid.

The term "hair loss" of the present invention refers to a phenomenon in which the hair completely exits the scalp. A person who is undergoing hair loss has a short growth period and a long resting period, and as demonstrated in the following examples, suveric acid converts hair from a resting period to a growing phase, and growth factors related to hair growth and wool in skin tissue. Increasing the expression of it was confirmed that there is a prevention, improvement or treatment effect of hair loss.

The term "hair growth" of the present invention means that the hair from the scalp, "hair growth" means that the length of the hair (long hair growth) is the same as the "wool" which is another term used in the art Used in the sense.

 The composition of the present invention is β-catenin (β-catenin), PKA Cα (protein kinase A Cα), LEF-1 (lymphoid enhancer factor-1), IGF-1 (insulin-like growth factor-1), VEGF (Vascular) endothelial growth factor) and cyclin D may be to increase the expression of one or more selected from the group consisting of. Specifically, as shown in Example 2 of the present invention, the gene expression of β-catenin associated with the Wnt / β-catenin signaling system involved in entering the hair follicle cycle into the growth phase in skin tissue is increased. The expression of lymphoid enhancer factor-1 (LEF-1), insulin-like growth factor-1 (IGF-1), vascular endothelial growth factor (VEGF) and cyclin D All were found to increase significantly. In addition, it was confirmed that the expression level of the protein or gene was significantly increased compared to the group treated with minoxidil, which is a representative drug that can promote hair growth and hair growth. Therefore, the composition of the present invention is more harmless to the human body than the conventional synthetic composition, and can be usefully used as a hair regrowth or wool composition showing various and stable hair growth and wool promoting effects.

The suveric acid is preferably an external skin composition, wherein the external skin pharmaceutical composition comprising the suveric acid of the present invention as an active ingredient is a cream, gel, patch, spray, ointment as a skin external agent for preventing hair loss and improving hair growth and promoting it. It may be used as a pharmaceutical composition in the form of an external preparation for skin, warning, lotion, lining, pasta or cataplasma, but is not limited thereto.

Suberic acid of the present invention can be used in the form of a pharmaceutically acceptable salt, and acid salts formed by pharmaceutically acceptable free acid are useful as salts. Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid and aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. Obtained from non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids. These pharmaceutically toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide and iodide. Id, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suverate , Sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitro benzoate, hydroxybenzoate, meth Oxybenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfonate, chlorobenzenesulfo Yate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β-hydroxybutyrate, glycolate, malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1- Sulfonates, naphthalene-2-sulfonates or mandelate.

The acid addition salts according to the present invention can be dissolved in conventional methods, for example, by dissolving the suberic acid in an aqueous solution of excess acid, using the water miscible organic solvents such as methanol, ethanol, acetone or acetonitrile. It can be prepared by precipitation. The same amount of suveric acid and acid or alcohol in water can be heated and then the mixture is evaporated to dryness or prepared by suction filtration of the precipitated salt.

Bases can also be used to make pharmaceutically acceptable metal salts. Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving the compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and evaporating and drying the filtrate. At this time, it is pharmaceutically suitable to prepare sodium, potassium or calcium salt as the metal salt. Corresponding silver salts are also obtained by reacting alkali or alkaline earth metal salts with a suitable silver salt (e.g., silver nitrate).

In addition, the suveric acid of the present invention includes not only pharmaceutically acceptable salts, but also all salts, hydrates, and solvates that can be prepared by conventional methods.

The addition salt according to the present invention can be prepared by a conventional method, for example, by dissolving suveric acid in a water miscible organic solvent such as acetone, methanol, ethanol or acetonitrile and adding an excess of an organic acid or an inorganic acid. It can be prepared by adding an aqueous acid solution followed by precipitation or crystallization. The solvent or excess acid may then be evaporated and dried in this mixture to obtain an addition salt or the precipitated salt may be prepared by suction filtration.

When the composition of the present invention is used as a medicament, a pharmaceutical composition containing suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient may be formulated and administered in various oral or parenteral dosage forms as described below. It may be, but is not limited thereto.

Formulations for oral administration include, for example, tablets, pills, hard / soft capsules, solutions, suspensions, emulsifiers, syrups, granules, elixirs, etc. These formulations may contain, in addition to the active ingredients, diluents (e.g., lactose, dexter). Rose, sucrose, mannitol, sorbitol, cellulose and / or glycine), lubricants such as silica, talc, stearic acid and its magnesium or calcium salts and / or polyethylene glycols. Tablets may also contain binders such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidine, and optionally such as starch, agar, alginic acid or its sodium salt. Disintegrant or boiling mixtures and / or absorbents, colorants, flavors, and sweeteners.

Pharmaceutical compositions comprising suveric acid or a pharmaceutically acceptable salt thereof of the present invention as an active ingredient may be administered parenterally, and parenteral administration may be performed by subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. By method At this time, in order to formulate into a formulation for parenteral administration, the suveric acid or a pharmaceutically acceptable salt thereof is mixed with water together with a stabilizer or a buffer to prepare a solution or suspension, which may be prepared in an ampule or vial unit dosage form. Can be. The compositions may contain sterile and / or preservatives, stabilizers, hydrating or emulsifying accelerators, auxiliaries such as salts and / or buffers for the control of osmotic pressure, and other therapeutically useful substances, and conventional methods of mixing, granulating It may be formulated according to the formulation or coating method.

In addition, the dosage of the compound of the present invention to the human body may vary depending on the age, weight, sex, dosage form, health condition and degree of disease of the patient, and generally based on an adult patient having a weight of 60 kg. It is 0.001 to 1,000 mg / day, preferably 0.01 to 500 mg / day, and may be dividedly administered once a day to several times at regular time intervals according to the judgment of a doctor or a pharmacist.

In addition, the present invention provides a quasi-drug for preventing or improving hair loss, or promoting hair growth or hair growth comprising suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient. Details of the subic acid are as described above.

When using suveric acid of the present invention as an active ingredient of a quasi-drug composition, the above-mentioned suveric acid, which shows the effect of preventing hair loss and promoting hair growth, may be added as it is, or may be used together with other quasi-drugs or quasi-drug ingredients, Can be used as appropriate. The amount of the active ingredient to be mixed may be appropriately determined depending on the intended use.

The quasi-drug composition for preventing hair loss and promoting hair growth of the present invention is not particularly limited in its formulation, and may be variously formulated in the form of quasi-drugs known in the art to exhibit a hair loss prevention and hair growth promoting effect. The formulated quasi-drugs include scalp tonic, scalp lotion, scalp cream, scalp serum, scalp essence, scalp ampoule, scalp treatment, scalp conditioner, scalp shampoo, scalp pack, hair tonic, hair lotion, hair cream, hair spray, hair Mousse, Hair Gel, Hair Conditioner, Hair Shampoo, Hair Rinse, Hair Pack, Hair Treatment, Eyebrow Regrowth, Eyelash Regrowth, Eyelash Nutritional Supplement, Pet Shampoo, Pet Rinse, Hand Cleanser, Detergent Soap, Soap, Disinfectant, Wet wipes, masks, ointments, patches or filter fillers and the like, including all quasi-drugs in the usual sense.

In addition, the quasi-drug composition for hair loss prevention and hair growth promotion in each formulation can be arbitrarily selected and blended with other components according to the formulation or purpose of use of the other quasi-drug. The blending amount of the active ingredient may be suitably determined according to the purpose of use, and may include, for example, conventional auxiliaries such as thickeners, stabilizers, solubilizers, vitamins, pigments and flavors, carriers and the like.

The content of the composition is preferably 0.0001 to 10% by weight based on the total weight, and when the content exceeds 10% by weight, the color and stability during the preparation of the composition, and less than 0.0001% by weight, the effect is insignificant There is this. The quasi-drug composition comprising suveric acid of the present invention as an active ingredient can be usefully used as a quasi-drug material because it has little toxicity and side effects on cells as confirmed in the therapeutic index.

In addition, the present invention provides a cosmetic composition for preventing or improving hair loss, or promoting hair growth or hair growth comprising suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The components included in the cosmetic composition of the present invention include components conventionally used in cosmetic compositions in addition to suveric acid or a pharmaceutically acceptable salt thereof as the active ingredient, and include, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments. And conventional adjuvants such as perfumes, and carriers.

Cosmetic compositions of the invention can be prepared in any formulation conventionally prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing , Oils, powder foundations, emulsion foundations, wax foundations and sprays, etc. may be formulated, but is not limited thereto.

When the formulation of the present invention is a paste, cream or gel, animal oils, vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide may be used as carrier components. Can be.

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular in the case of a spray, additionally chloro fluorohydrocarbon, propane Propellant such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizing agent or emulsifying agent is used as the carrier component, such as water, ethanol, isopropanol, ethylcarbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of, 3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, a liquid diluent such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, and microcrystals are used as carrier components. Soluble cellulose, aluminum metahydroxy, bentonite, agar or tracant and the like can be used.

When the formulation of the present invention is a surfactant-containing cleansing, the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid amide. Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.

In addition, the present invention provides a health food composition for preventing or improving hair loss, or promoting hair growth or hair growth, including suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The food composition according to the present invention can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods (e.g. canned fruit, canned foods, jams, marmalade, etc.), fish, meat and processed foods (e.g. hams, sausages) Cornbeans, etc.), breads and noodles (e.g. udon, soba noodles, ramen, spagate, macaroni, etc.), fruit juices, various drinks, cookies, malts, dairy products (e.g. butter, cheese), edible vegetable oils, margarine , Vegetable protein, retort food, frozen food, various seasonings (e.g., miso, soy sauce, sauce, etc.) and the like can be prepared by adding the suveric acid of the present invention. In addition, as a nutritional supplement, but not limited to this, it can be prepared by adding the suveric acid of the present invention to capsules, tablets, pills, and the like. In addition, as a health functional food, but not limited to, for example, liquefied, granulated, encapsulated and powdered so that it can be produced (tea drink) by preparing the suveric acid of the present invention in the form of tea, juice and drinks Can be consumed. In addition, in order to use the suveric acid of the present invention in the form of a food additive, it can be prepared in powder or concentrate form. In addition, it can be prepared in the form of a composition by mixing with suberic acid of the present invention and known active ingredients known to have hair loss prevention and hair growth promoting effects.

In the case of using the suveric acid of the present invention as a health beverage, the health beverage composition may contain various flavors or natural carbohydrates, etc. as additional components, as in the usual beverage. Natural carbohydrates described above include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; Polysaccharides such as dextrin, cyclodextrin; Sugar alcohols such as xylitol, sorbitol, and erythritol. Sweeteners include natural sweeteners such as taumartin, stevia extract; Synthetic sweeteners such as saccharin and aspartame; The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g, per 100 mL of the composition of the present invention.

In addition, the suveric acid of the present invention may be contained as an active ingredient of the health functional food for preventing hair loss and promoting hair growth, the amount is not particularly limited to an amount effective to achieve the hair loss prevention and hair growth promoting effect, the whole composition It is preferably from 0.01 to 100% by weight relative to the total weight. The food composition of the present invention may be prepared by mixing with suveric acid together with other active ingredients known to be effective in preventing hair loss and promoting hair growth.

In addition to the above, the health food of the present invention is various nutrients, vitamins, electrolytes, flavors, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, Glycerin, alcohol or carbonation agent and the like. In addition, the health food of the present invention may contain a flesh for preparing natural fruit juice, fruit juice beverage, or vegetable beverage. These components can be used independently or in combination. The proportion of such additives is not critical but is usually selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

Hereinafter, the present invention will be described in detail by way of examples. However, these examples are intended to illustrate the present invention in more detail, the scope of the present invention is not limited to these examples.

<Example>

Example 1 Evaluation of Hair Growth Promoting Effect of Suberic Acid

1-1. Experiment method

1) Sample preparation and human dermal papilla cell culture

Suberic acid used in this experiment was purchased from Sigma-Aldrich Co., Ltd.

Human dermal papilla cells were purchased from PromoCell GmbH (Heidelberg, Germany). Human dermal papilla cells were incubated at 37 ° C. in a 5% CO ₂ incubator using fetal bovine serum (FBS) and Dulbecoco's modified Eagle's medium (Gbco BRL, Gaithersburg, MD, USA) medium in HFDPC Medium (PromoCell, Germany). Incubated at. Due to the nature of the cells, all experiments used cells between passages 2-5.

2) MTT assay analysis

Human dermal papilla cells were dispensed to 1 × 10 ⁵ cell / well in a 24-well plate and then stabilized by incubating in 37 ° C., 5%, CO ₂ incubator for 24 hours. The samples were treated by concentration (0, 10, 20, 50, 100, 200, 400 μg / ml) and incubated for 24 hours, followed by 3- (4,5-dimethylthiazol-2- at a concentration of 200 mg / ml. yl) 2,5-diphenyltetrazolium bromide (MTT; Sigma Aldrich, St. Louis, USA) was incubated for 4 hours with 100ul of reagent. After removing the medium, the precipitate (formazan) was dissolved in DMSO to measure the absorbance at 540 nm wavelength, and the proliferation rate was evaluated based on the absorbance of the control group containing only DMSO.

1-2. Experiment result

1) Toxicity of Suberic Acid in Human Hair Papillary Cells

 The group containing only DMSO was set as a control group, treated with suveric acid according to the concentration, and cultured for 24 hours to measure cell viability by MTT assay. There was no effect (FIG. 1).

2) Cell Proliferation Effect of Suberic Acid in Human Breast Papillary Cells

When treated with human dermal papilla cells at concentrations of 10, 20, and 50 μΜ, respectively, it was confirmed that proliferation was significantly increased to 10.5%, 24%, and 21%, respectively (FIG. 2). After that, the experiment was performed by setting the optimum effective concentration of suveric acid to 20 μΜ.

Example 2: Identification of hair growth promoting mechanism in human dermal papilla cells by subvertic acid

2-1. Experiment method

1) Enzyme-Linked Immunosorbent assay (ELISA)

Human dermal papilla cells were divided into 12 well plates (3 × 10 ⁴ cells / well) and treated with suveric acid at 20 μM in culture, and DMSO was used as a negative control. Suveric acid-treated cultures were collected after 24 hours, and the human VEGF ELISA Kit (Enzo Life Sciences, NY, USA), human IGF-1 ELISA kit (Enzo Life Sciences, NY, USA) and cAMP complete ELISA kit ( Enzo Life Sciences, NY, USA) and the experiment was conducted according to the manufacturer's protocol.

2) Protein extraction and Western blot assay

The supernatant of human dermal papilla cells incubated with 20 μM Subic acid was homogenized with lysis buffer, and then centrifuged at 13,000 × g, 4 ° C. for 20 minutes in a Bradford assay. Protein was quantified by

40 μg of protein was electrophoresed on a 10% SDS polyacrylamide gel and then transferred to a nitrocellulose membrane, followed by PKA Cα, β-catenin and β-actin ( β-actin) and GAPDH antibody (GAPDH antibody: Cell Signaling Technology, Danvers, MA, USA) respectively. The signal of each protein was visualized with a chemiluminescent detection system (mersham) and the thickness of the band was quantified using Quantity One Analysis Software (Bio-Rad Laboratories).

3) RNA isolation method using Trizol method

In order to verify the activity of subvertic acid on human dermal papilla cells (DPCs) in the present invention, 5% after treatment with submersible acid at 20 μΜ at the time when the DP cell becomes 70-80% confluency. Incubated under CO ₂ , 37 ° C. After 24 hours of material treatment, cells were recovered and total RNA was extracted with Trizol Reagent (Trizol Reagent: Gibco BRL, USA), and total RNA was quantified by absorbance measurement at 260 nm.

4) RT-PCR (Real time-Polymerase Chain Reaction) method

After RNA was isolated, cDNA was synthesized by performing reverse transcription using an oligo dT primer and a superscript reverse transcriptase (GIBCOBRL, Gaithersburg, MD, USA). PCR was performed using cDNA obtained through reverse transcription as a template and using the 5 'and 3' flanking sequences of the gene cDNA to be amplified as a primer. At this time, the required primer was used by requesting synthesis to a primer manufacturing company (주, Bioneer, Korea), and the primer sequence is shown in [Table 1]. 5 μl of 10 × reaction buffer [100 mM KCL, 20 mM Tris-HCl (pH 8.0), 2.5 mM MgCl 2], 4 μl of 10 mM dNTP, 0.2 μM sense and antisense primer, respectively. 2 μl of the reacted cDNA reaction mixture and 2.5 units of Taq polymerase (Takara, Japan) were added to the mixture, and the volume was adjusted to 50 μl of distilled water and PCR was performed using a PCR device. PCR conditions were set to 94 ℃ 4 minutes, 94 ℃ (30 seconds), 30 cycles of [52 ℃ (30 seconds), 72 ℃ (45 seconds)], and 72 ℃ 10 minutes.

Primer sequence used for RT-PCR Gene description Primers Sequences (5 ’→ 3 ') Length
(bp) Lymphoid enhancer factor (LEF) F TGCCAAATATGAATAACGACCCA 150 R GAGAAAAGTGCTCGTCACTGT Cyclin d F ATGTTCGTGGCCTCTAAGATGA 138 R CAGGTTCCACTTGAGCTTGTTC Vascular endothelial growth factor (VEGF) F TTCATGGATGTCTATCAGCG 234 R CATCTCTCCTATGTGCTGGC Insulin growth factor-1 (IGF-1) F CTTCAGTTCGTGTGTGGAGACAG 75 R CGCCCTCCGACTGCTG

2-2. Experiment result

1) Increased concentration of subdermal growth factor (VEGF and IGF-1) in human dermal papilla cells

In human dermal papilla cells, subvertic acid significantly increased concentrations of VEGF and IGF-1, which are involved in hair growth, by 36% and 18%, respectively (FIG. 3). Therefore, it can be seen that suberic acid according to the present invention has excellent hair growth promoting effect.

2) Increasing Effect of Suberic Acid cAMP in Human Hair Papillary Cells

cAMP is a mediator that amplifies signals of hormones or growth factors that bind to cell surface receptors and transfers them into cells, and cAMP synthesized in the cytoplasm is known to regulate PKA Cα activity. Suberic acid in human dermal papilla cells significantly increased cAMP concentration by 55% (FIG. 4). This means that subvertic acid increases cAMP concentration in human dermal papilla cells to activate the Wnt / β-catenin hair growth regulation signaling system induced by PKA Cα.

3) Increased Expression of Subcutaneous Regulatory Signaling Protein (PKA Cα, β-Cateinin) in Human Breast Papillary Cells

 PKA Cα inhibits the degradation of β-catenin in the cytoplasm and promotes migration to the cell nucleus, and β-catenin is known as a signaling protein that regulates the expression of target genes that promote hair growth in the nucleus. In human dermal papilla cells, subvertic acid significantly increased the expression of PKA Cα by 65% (FIG. 5A) and increased the expression of β-catenin in the cell nucleus by 62% (FIG. 5B). Through this, it can be seen that subvertic acid induces proliferation of human dermal papilla cells and promotes hair growth by increasing the expression of the hair growth signaling protein.

4) Increased expression of hair growth regulator signaling genes (LEF-1, Cyc-D, VEGF and IGF-1) in human dermal papilla cells

LEF is known as an important transcription factor that regulates cyclin D (Cyc-D) expression by binding to β-catenin in the cell nucleus, and cyc-D is a target gene for wnt / β-catenin signal transduction. Suberic acid significantly increased mRNA expression of LEF and target gene cyc-D, transcription factors of the wnt / β-catenin signaling system, by 250% and 198%, respectively (Fig. 6). It can be seen that there is an effect to activate.

On the other hand, VEGF and IGF-1 are growth factors that induce entry into growth follicles and promote differentiation of hair follicle cells by promoting angiogenesis in resting follicles. Suberic acid significantly increased the mRNA expression of VEGF and IGF by 202% and 180%, respectively (Fig. 6).

Hereinafter, the preparation examples of medicines, foods or cosmetics containing the suveric acid according to the present invention as an active ingredient, but the present invention is not intended to limit it, only intended to explain in detail. The drug, food or cosmetic composition of Preparation Examples 1 to 3 was prepared according to a conventional method according to the composition components and the composition ratios with the components having excellent effects for preventing and treating the hair loss disease or improving hair loss.

Preparation Example 1 Preparation of Pharmaceutical Composition

<1-1> Preparation of Powder

Suberic Acid 20 mg

Lactose 100 mg

Talc 10 mg

The above ingredients were mixed and filled in airtight cloth to prepare a powder.

<1-2> Preparation of Tablet

Suberic acid 10 mg

Corn starch 100 mg

Lactose 100 mg

Magnesium stearate 2mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

<1-3> Preparation of capsule

Suberic acid 10 mg

3 mg of microcrystalline cellulose

Lactose carb 14.8 mg

Magnesium Stearate 0.2 mg

After mixing the above components, it was filled in gelatin capsules in accordance with a conventional method for producing a capsule to prepare a capsule.

<1-4> Preparation of Injection

Suberic acid 10 mg

Mannitol 180 mg

Sterile distilled water for injection 2974 mg

Sodium dihydrogen phosphate 26 mg

After mixing the above components, it was prepared in the above ingredient content per ampoules (2 mL) according to the conventional method for preparing injections.

<1-5> Preparation of Liquid

Suberic acid 10 mg

Isomerized sugar 10 mg

Mannitol 5 mg

Purified water

Lemon flavor

The above components are dissolved in purified water according to a conventional manufacturing method, dissolved in purified water, lemon juice is added in an appropriate amount, adjusted to 100 mL by adding purified water, and sterilized to fill a brown bottle to prepare a liquid formulation.

Preparation Example 2 Preparation of Health Food

<2-1> Preparation of Health Supplements

Suberic acid 10 mg

Vitamin Mixture

70 μg of Vitamin A Acetate

Vitamin E 1.0 mg

Vitamin B ₁ 0.13 mg

Vitamin B ₂ 0.15 mg

Vitamin B ₆ 0.5 mg

0.2 μg of vitamin B ₁₂

Vitamin C 10 mg

10 μg biotin

Nicotinamide 1.7 mg

50 μg folic acid

Calcium Pantothenate 0.5mg

Mineral mixture

Ferrous Sulfate 1.75 mg

Zinc Oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium phosphate monobasic 15 mg

Dicalcium Phosphate 55 mg

Potassium Citrate 30 mg

Calcium Carbonate 100 mg

Magnesium chloride 24.8 mg

The composition ratio of the above-mentioned vitamin and mineral mixture is a composition suitable for a relatively healthy food in a preferred embodiment, but may be arbitrarily modified by the blending ratio, and the above ingredients are mixed according to a conventional health food manufacturing method. The granules may be prepared and used for preparing a health food composition according to a conventional method.

<2-2> Preparation of health drink

Suberic Acid 10 mg

15 g of vitamin C

100 g of vitamin E (powder)

Iron lactate 19.75 g

3.5 g of zinc oxide

3.5 g of nicotinic acid amide

0.2 g of vitamin A

0.25 g of vitamin B1

0.3 g of vitamin B2

Purified Water Quantification

After mixing the above components according to a conventional healthy beverage production method, and then stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container, sealed sterilization and then refrigerated and stored in the present invention For the preparation of healthy beverage compositions.

Although the composition ratio is mixed and formulated in a preferred embodiment, the components suitable for the favorite beverage, but may be arbitrarily modified according to the regional and ethnic preference, such as the demand hierarchy, the demand country, the intended use.

Preparation Example 3 Preparation of Cosmetic Composition

Hereinafter, an example of preparation of a cosmetic composition containing an extract of the present invention will be described, but the present invention is not intended to be limited thereto, but is intended to be described in detail.

<3-1> Nutrients (Milk Lotion)

Subic acid 2.0 wt%

Squalane 5.0 wt%

Beeswax 4.0 wt%

Polysorbate60 1.5 wt%

Sorbanthesquioleate 1.5 wt%

0.5% by weight of liquid paraffin

Caprylic / Capric Triglyceride 5.0 wt%

Glycerin 3.0 wt%

Butylene Glycol 3.0 wt%

Propylene Glycol 3.0 wt%

Carboxy vinyl polymer 0.1 wt%

0.2% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the blending ratio is a composition that is relatively suitable for nutritional longevity in a preferred embodiment, the blending ratio may be arbitrarily modified, it can be prepared according to the manufacturing method in the general cosmetic field.

<3-2> Softener (Skin Lotion)

Subic acid 2.0% by weight

Glycerin 3.0 wt%

Butylene glycol 2.0% by weight

Propylene Glycol 2.0 wt%

Carboxy vinyl polymer 0.1 wt%

PEG 12 nonylphenylether 0.2% by weight

Polysorbate 80 0.4% by weight

Ethanol 10.0 wt%

Triethanolamine 0.1% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed and formulated in a preferred embodiment with a component suitable for a relatively softening longevity, the compounding ratio may be arbitrarily modified, and can be prepared according to the manufacturing method in the general cosmetic field.

<3-3> nutrition cream

Subic acid 2.0% by weight

Polysorbate60 1.5 wt%

Solbitan Sesquioleate 0.5% by weight

PEG60 Cured Castor Oil 2.0% by weight

10% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservative

Pigment amount

Spices

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nourishing cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-4> massage cream

Subic acid 1.0% by weight

Beeswax 10.0 weight%

Polysorbate60 1.5 wt%

PEG 60 Cured Castor Oil 2.0% by weight

Sorbanthesquioleate 0.8 wt%

40.0% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglycerides 4.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a massage cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

<3-5> pack

Subic acid 1.0% by weight

Polyvinyl alcohol 13.0 wt%

Sodium Carboxymethylcellulose 0.2% by weight

Glycerin 5.0 wt%

Allantoin 0.1 wt%

Ethanol 6.0 wt%

PEG 12 nonylphenylether 0.3 wt%

Polysorbate60 0.3 wt%

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a pack in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

<3-6> gel

Subic acid 0.5% by weight

Ethylenediamine sodium acetate 0.05% by weight

Glycerin 5.0 wt%

Carboxy vinyl polymer 0.3 wt%

Ethanol 5.0 wt%

PEG 60 Cured Castor Oil 0.5% by weight

0.3% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a gel in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

The compounding ratio is a relatively suitable composition for the cosmetic composition, but is mixed with the preferred embodiment, it can be applied to cosmetics of various uses, including other color cosmetics, according to the efficacy that can be applied to a thin coating on the human body, that is, It can be used for manufacturing as ointment, and the compounding ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> COMPOSITION COMPRISING SUBERIC ACID FOR PREVENTING HAIR LOSS OR          STIMULATING HAIR GROWTH <130> 1064740 <150> KR 10-2017-0139173 <151> 2017-10-25 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> LEF_F primer <400> 1 tgccaaatat gaataacgac cca 23 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> LEF_R primer <400> 2 gagaaaagtg ctcgtcactg t 21 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Cyclin D_F primer <400> 3 atgttcgtgg cctctaagat ga 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Cyclin D_R primer <400> 4 caggttccac ttgagcttgt tc 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> 223 VEGF_F primer <400> 5 ttcatggatg tctatcagcg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> 223 VEGF_R primer <400> 6 catctctcct atgtgctggc 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IGF-1_F primer <400> 7 cttcagttcg tgtgtggaga cag 23 <210> 8 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> IGF-1_R primer <400> 8 cgccctccga ctgctg 16

Claims (7)

A pharmaceutical composition for preventing or treating hair loss, or promoting hair growth or hair growth, including suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.
The method of claim 1,
The composition is β-catenin (β-catenin), PKA Cα (protein kinase A Cα), LEF-1 (lymphoid enhancer factor-1), IGF-1 (insulin-like growth factor-1), VEGF (Vascular endothelial growth) factor) and cyclin D (cyclin D) for increasing the expression of one or more selected from the group consisting of preventing or treating hair loss, or hair growth or hair growth promoting pharmaceutical composition.
The method of claim 1,
The pharmaceutical composition is a skin external preparation for the prevention or treatment of hair loss, characterized in that the formulation selected from the group consisting of creams, gels, patches, sprays, ointments, warnings, lotions, linings, pasta and cataplasma. Or a pharmaceutical composition for promoting hair growth or hair growth.
Subcutaneous (Suberic acid) or a pharmaceutically acceptable salt thereof as an active ingredient for preventing or improving hair loss, or a quasi-drug composition for promoting hair growth or hair growth.
Cosmetic composition for preventing or improving hair loss, or promoting hair growth or hair growth comprising suberic acid or its cosmetically acceptable salt as an active ingredient.
The method of claim 5,
The cosmetic composition is scalp tonic, scalp lotion, scalp cream, scalp serum, scalp essence, scalp ampoule, scalp treatment, scalp conditioner, scalp shampoo, scalp pack, hair tonic, hair lotion, hair cream, hair spray, hair mousse, Hair gel, hair conditioner, hair shampoo, hair rinse, hair pack, hair treatment, eyebrow regrowth, eyelash regrowth, eyelash nourishment, pet shampoo or pet rinse, Cosmetic composition for promoting hair growth or hair growth.
Health functional food composition for preventing or improving hair loss, or promoting hair growth or hair growth comprising suberic acid or its food acceptable salt as an active ingredient.

Images