KR102065493B1 - A root hair-specific promoter from Oryza sativa Os03g42100 gene and uses thereof - Google Patents

Abstract

The present invention relates to a root hair-specific promoter of Oryza sativa, and uses thereof. The promoter of the present invention can be advantageously used for the improvement of root hair traits, such as improving the absorption of nutrients by the root hairs of major monocotyledonous plants or grains including Oryza sativa, by controlling the expression of a gene necessary for root hair trait improvement.

Description

Root hair specific promoter derived from rice Os03g42100 gene and its use {A root hair-specific promoter from Oryza sativa Os03g42100 gene and uses approximately}

The present invention relates to a root hair specific promoter derived from rice Os03g42100 gene and its use. More specifically, the promoter derived from rice Os03g42100 gene relates to a promoter capable of expressing a foreign gene specifically in root hair.

Advances in molecular biology have enabled the isolation and editing of foreign useful genes, and these results have allowed us to obtain transformants with new genes combined. As a transformation method to make a transformant to date, a large number of transformants were obtained by prototyping in the 80's by polyethylene glycol (PEG) and electroporation. Recently, Agrobacterium (Agrobacterium) has been widely used in dicotyledonous plants. In addition, there are pollen method and microinjection method.

Promoters can achieve the purpose of transformation by confining the expression of foreign genes only to systemic or specialized tissues of plants, and can be classified into several promoters depending on their function.

First, systemic expression induction promoters. The promoter of the 35S RNA gene of CaMV: cauliflower mosaic virus (CaMV) is used as a representative dicotyledonous promoter as a plant whole body induction promoter. Rice actin and corn ubiquithin gene promoters have been mainly used as a systemic expression induction promoter for monocotyledonous plants such as rice. Recently, a promoter of rice cytochrome C gene (OsOc1) has been developed and used by domestic researchers. (Korean Registered Number 10-0429335). These are promoters that are specifically considered when attempting to uncover plant functions of the gene of interest in research terms.

Second, it is a root specific expression promoter. Arabidopsis peroxidase (peroxidase, prxEa) was isolated to confirm root-specific expression. Recently, the sweet potato-derived Maz gene (ibMADS) and the sugar-induced ADP-glucose pyrophosphatase (ADP-) gene were isolated. The promoter has been registered in the patent by confirming that the promoter induces specific expression in the roots and induces root-specific transient expression in carrots and radishes (Korean Registration No. 10-0604186, 10-0604191).

As above, promoters for specific expression are known in a large class, but there is a need to develop promoters for the purpose of organ specific expression in greater detail. Among them, root hairs are cylindrical protrusions made from the epidermal cells of the roots, which effectively increase the surface area of the roots, play an important role in the absorption of moisture and nutrients, and the interaction between plants and microorganisms. The ability to absorb key nutrients, heavy metals and diffusion-limiting ions is expected to make a significant contribution in the agricultural and environmental sectors. These facts indicate the continued development of promoters with increased organ specificity, including root hairs.

Therefore, the present inventors introduced the root hair specific promoter derived from the rice Os03g42100 gene into the pGA3519 vector and introduced it into the rice. As a result, the foreign hair necessary for the improvement of the root hair was specifically expressed in the root hair of the transformed rice. By confirming that the present invention was completed.

KR 10-0604186 B KR 10-0604191 B

An object of the present invention is to provide a root hair specific promoter derived from the rice Os03g42100 gene to specifically express the foreign genes required to improve the trait in the root hair of rice.

Therefore, in order to achieve the above object, the present invention provides a promoter for the root hair specific expression characteristics of rice containing the rice Os03g42100 gene.

In addition, the present invention provides a root hair specific expression vector comprising the promoter.

In addition, the present invention comprises the steps of recombining a foreign gene necessary for improving the root hair trait in the vector; And it provides a method for expressing the root hair specific expression in the transformed plant root hair transformation improved gene comprising the step of transforming the recombinant root hair specific expression vector to the plant.

The present invention also provides a transgenic plant in which the root hair improvement foreign gene produced by the above method is specifically expressed in the hair root.

The present invention also provides seeds of the transgenic plant.

The promoter of the present invention is a promoter capable of expressing foreign genes specifically to root hairs, and by controlling gene expression necessary for improving root hair traits, the root hair trait improvement, such as the regulation of root hair elongation and the absorption of nutrients, particularly in rice, which is a major crop It can be usefully used.

Figure 1 shows a graph quantifying the expression level of each organ of the LOC_Os03g42100 gene.
Figure 2 shows a diagram of the vector used for the production of GUS plants comprising part of the LOC_Os03g42100 promoter and genes.
Figure 3 shows the results of GUS staining showing the LOC_Os03g42100 promoter specifically expressed in the root hair in the transgenic plant.

The present invention relates to a root hair specific promoter derived from rice Os03g42100 gene and its use. More specifically, the promoter derived from rice Os03g42100 gene is a promoter capable of expressing a foreign gene specifically in root hair, and a gene necessary for improving root hair trait. It has a feature that can regulate expression. According to the improvement of the root hair trait, it may have various effects in plants, such as reducing the amount of free radicals, promoting growth.

The present invention is directed to a promoter capable of regulating tissue or organ specific gene expression of a plant. Specifically, it is possible to provide a system capable of specifically expressing or inhibiting a gene of interest by confining to a specific tissue or organ of a plant. In this process, the promoter of LOC_Os03g42100 of rice can specifically induce expression in root hairs. Therefore, the gene can be specifically expressed in the root hair in the transformant using the promoter.

More specifically, the inventors of the present invention are representative organs of rice, such as shoot (root), root (root), leaf (leaf), heath (heaticle), (icle), (flower), seed (seed), root hair ( quantitative real time polymerase chain reaction (qRT-PCR) was performed using samples from eight organs, and the LOC_Os03g42100 gene was found to be specifically expressed only in the root hair, whereas the expression was rarely expressed in other organs. .

According to one embodiment of the present invention, the promoter of the present invention was separated according to the following procedure.

Using the nucleotide sequence information, the promoter region of -1,846 to +914 of LOC_Os03g42100 and the region including the second exon were separated by genomic DNA PCR, and cloned into pGEM T-Egy vector for nucleotide sequence decoding.

The isolated promoter was inserted into the pGA3519 vector to prepare a transformed vector, and the transformed plant was prepared using the transformed vector. By verifying the β-Glucuronidase (GUS) reaction in the transformed plants by fluorescence display, it was confirmed that gene expression was specifically induced in the root hairs of the transformed plants using the promoter.

The isolated promoter includes a nucleotide sequence represented by SEQ ID NO: 1.

Promoters are essential elements for regulating the environmental, temporal and histological expression of genes. The root hair specific expression promoters according to the present invention can be used to specifically induce the expression sites of foreign useful genes in the root hairs in plants. The present invention provides a promoter derived from LOC_Os03g42100 of rice, which is a root hair specific expression promoter (hereinafter referred to as a 'promoter') that induces the expression of a foreign gene to be specific to root hair.

In the present invention, the term "specific" refers to an increase in specific expression in some organs of a plant, including all of the high expression, specificity, etc. by the promoter according to the present invention. For example, an increase in expression of at least 50%, at least 100%, at least 200%, at least five times or more compared to plants lacking a promoter according to the present invention.

LOC_Os03g42100 encodes a basic helix-loop-helix (bHLH) DNA-binding domain containing protein consisting of approximately 310 amino acids and consists of five exons. The LOC_Os03g42100 gene is a gene that functions as a basic helix-loop-helix region bHLH domain contaning protein and functions as a eukaryotes transcription factor. The LOC_Os03g42100 gene is known to affect root hair differentiation and root hair extension in plants.

The present invention also provides an expression vector comprising the promoter and a foreign gene operably linked thereto.

The term "vector" refers to DNA fragment (s), nucleic acid molecules that are delivered into a cell, which can replicate DNA and be independently reproduced in a host cell. An "expression vector" refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence necessary to express a coding sequence operably linked in a particular host organism. Expression vectors are generally derived from plasmid or viral DNA, or may include elements of both. Thus, expression vectors refer to recombinant DNA or RNA constructs, such as plasmids, phages, recombinant viruses or other vectors that result in the expression of cloned DNA upon introduction into an appropriate host cell. Suitable expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic and / or prokaryotic cells and those that remain episomal or that integrate into the host cell genome.

The conventional vector may be any of the promoters of the present invention, but preferably pCAMBIA, pGA, pGWB, such as pGA3519, pCAMBIA3301, pCAMBIA3300, pGA3426, pGA3780, pGWB12, pGWB14. Ti-plasmid and a vector derived therefrom may be any one selected.

Expression vectors of the present invention comprises a nucleic acid consisting of the nucleotide sequence represented by SEQ ID NO: 1, and functionally equivalent fragments thereof.

A "functionally equivalent fragment" with a promoter of the present invention means a fragment or portion of a nucleic acid consisting of the nucleotide sequence represented by SEQ ID NO: 1, which exhibits an effect substantially equivalent to that of the promoter of the present invention. Such nucleic acid fragments are 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, compared to the nucleotide sequences set forth in SEQ ID NO: 1 With 96%, 97%, 98%, 99% or more sequence homology, such nucleic acid fragments can be readily produced by molecular biological methods well known in the art. In addition, the promoter and some gene regions represented by SEQ ID NO: 1 of the present invention are sequences including a promoter region of LOC_Os03g42100 and a part of the gene (up to the second exon) on the published rice genome sequence, which are represented by SEQ ID NO: 1 Even if some of the nucleotide sequences are substituted, inserted or deleted, homology with the promoter of LOC_Os03g42100 on the published rice genome sequence and the sequences located in some gene regions may be included in the scope of the present invention as long as they exhibit substantially equivalent effects.

In the expression vector of the present invention, a foreign gene for the target protein may be inserted in the 3 'direction, and the foreign gene may be a useful foreign gene to be specifically expressed in root hairs.

In order for plants to grow, the absorption of nutrients and water is important, and the root hair plays a major role. It also plays a role in fixing plants and synthesizing secondary metabolites. Thus, the foreign gene can be introduced as far as it relates to the aforementioned functions of root hair and the properties of the root hair. For example, R OOT HAIRLESS1, EXPA17, etc. of rice may be introduced as genes related to root hair development. In addition, CSLD1 involved in the development of root hair or OsPT1 genes involved in nutrient absorption may be introduced, and examples of such foreign genes are not limited to the types of genes that can be introduced.

The expression vector may be a promoter of the present invention introduced into a conventional vector, the preparation of the expression vector by introducing the promoter of the present invention is easily carried out according to a known method to those skilled in the art to which the present invention belongs. It is possible.

The expression vectors described above can be inserted into cultured host cells using well known techniques such as infection, transduction, transfection, electroporation and transformation. Representative examples of hosts include bacterial cells such as Escherichia coli, Streptomyces, Salmonella typhimurium or Agrobacterium tumefaciens; Or plant cells, for example, monocotyledonous plants such as corn, barley, wheat, rice, oats, rye or sugarcane or Arabidopsis, potatoes, eggplants, tobacco, pepper, lettuce, cabbage, cabbage, watermelon, melon, etc. May be a cell of a dicotyledonous plant.

“Plant cells” used for plant transformation can be any plant cell. Plant cells may be cultured cells, cultured tissues, cultured organs or whole plants, preferably cultured cells, cultured tissues or cultured organs and more preferably any form of cultured cells. "Plant tissue" refers to the tissues of differentiated or undifferentiated plants, such as, but not limited to, stem, leaf, cancer tissue and various types of cells used in culture, namely single cells, protoplasts, shoots and Callus tissue.

In another aspect, the present invention provides a composition for inducing root hair specific expression comprising the expression vector or the transformed cell. The composition for inducing root hair specific expression can specifically induce the expression of the foreign gene in the root hair of the monocotyledonous plant by introducing a foreign gene into the monocotyledonous plant. In the present invention, the monocotyledonous plant includes all of the plants classified as monocotyledonous plants, including, without limitation, rice (Oryza sativa) according to an embodiment of the present invention. In the present invention, root hair specific expression induction means specific expression in the root hair of monocotyledonous plants. The plant according to an embodiment of the present invention is monocotyledonous plants such as corn, barley, wheat, rice, oats, rye or sugarcane and Arabidopsis, potato, eggplant, tobacco, pepper, lettuce, cabbage, cabbage, watermelon, melon Dicotyledonous plants such as, but are not limited thereto. Hereinafter, a detailed description of the present invention is disclosed for the application in rice, which is a monocotyledonous plant.

In another aspect, the present invention provides a monocotyledonous plant transformed with the expression vector, the transformed cells or a composition for inducing root hair specific expression comprising the same, preferably the plant is monocotyledonous plant, more preferably rice. Such transgenic monocotyledonous plants of the present invention exhibit the property that the introduced foreign gene is specifically expressed in monocotyledonous plant root hair.

"Transformed monocotyledonous plant" and "functionally equivalent transgenic monocotyledonous plant" of the present invention is 60%, 65%, 70%, 75%, 80% compared to the variant of the nucleic acid consisting of the nucleotide sequence represented by SEQ ID NO: 1 Transformation prepared using nucleotide sequences with sequence homology to 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more As a monocotyledonous plant, a monocotyledonous plant is a transformed monocotyledonous plant having substantially equivalent characteristics of the promoter effect throughout the whole monocotyledonous plant.

Transformation of the plants of the invention can be carried out by any method known in the art for transferring DNA to plants. Such transformation methods do not necessarily have a period of regeneration and / or tissue culture. Transformation of plant species is now common for plant species, including both dicotyledonous plants as well as monocotyledonous plants. For example, calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) , Electroporation of protoplasts (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microscopic injection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179 -185), Agrobacterium tume of various plant elements (DNA or RNA-coated) particle bombardment (Klein TM et al., 1987, Nature 327, 70), invasion of plants or transformation of mature pollen or vesicles Agrobacterium tumefaciens mediated gene transfer (incomplete) infection by virus (EP 0301316) and the like can be appropriately selected. Such variants can be readily produced by molecular biological methods well known in the art.

In another aspect, the present invention comprises the step of transforming a monocotyledonous plant with a promoter comprising a nucleotide sequence represented by SEQ ID NO: 1 and a vector comprising an operably linked foreign gene to express the foreign gene in the monocotyledonous plant. To provide a method for producing a transformed monocotyledonous plant expressing root hairs specifically.

Preferably, preparing a composition for inducing monocotyledonous plant root hair specific expression comprising the expression vector or the transformed cell; Introducing the composition into the monocotyledonous plant; And the composition is introduced to provide a method for producing a transformed monocotyledonous plant comprising the step of selecting a transformed monocotyledonous plant in which the foreign gene is specifically expressed in the monocotyledonous plant root hair.

Example 1 RNA Extraction and Complementary DNA Synthesis for 8 Organs of Rice

In order to select genes specifically expressed in rice root hairs, RNA extraction experiments were carried out in eight organs including rice root hairs, specifically above ground, roots, leaves, bunches, ears, flowers, seeds and root hairs. After grinding each organ sample into a powder form, TRI reagent (RNAiso) was added to 1ml per 0.1g of sample and mixed well. After 100ul of BCP (1-bromo-3-chloropropane) was added, it was centrifuged at 12,000 rpm for 15 minutes at 4 ° C. 500ul of supernatant was transferred to a new tube, and 500ul of Isopropanol was added and mixed well. After centrifugation for 10 minutes at 12,000rpm at 4 ℃, the supernatant was removed and 75% EtOH 700ul was added, and the RNA pellet was mixed enough to drop. EtOH was removed and 50ul of DEPC-treted DDW was added and then stored at 55-60 ° C. for 10-15 minutes. The extracted RNA was resynthesized into complementary DNA (cDNA) by reverse transcriptase and DNA polymerase.

Example 2 Analysis of Organ-specific Expression of LOC_Os03g42100 Gene by qRT-PCR

QRT-PCR was performed using the synthesized cDNA as a template. qRT-PCR conditions were at 20 ° C. after 20 seconds; 40 seconds were repeated 5 seconds at 95 ° C, 10 seconds at 58 ° C, and 20 seconds at 72 ° C. Primer sequences used to analyze the expression of LOC_Os03g42100 are shown in Table 1 below.

Prime name Sequencing (5'-3 ') Os03g42100 RT F
(SEQ ID NO: 2) GTCGAATGGCAAGGCTCAAT Os03g42100 RT R
(SEQ ID NO: 3) CTTCACGTAATGCATTGCCTC

Through this analysis, tissue expression patterns of LOC_Os03g42100 gene were analyzed and the results are shown in FIG. 1. In Figure 1, it was confirmed that the expression of the LOC_Os03g42100 gene is very strong in the root hair compared to other organs. This shows that tissue-specific expression of genes by the LOC_Os03g42100 promoter occurs specifically in root hairs.

Example 3 Cloning of a Promoter for Root Hair Specific Expression

PCR was performed using primers prepared for cloning the promoter of LOC_Os03g42100 and genomic DNA of Oryza sativa L. japonica cultivar-group.

The base sequences of the primers used for promoter cloning are shown in Table 2 below.

Prime name Sequencing (5'-3 ') LOC_Os03g42100-proF_KpnI
(SEQ ID NO: 4) GGTACCCAGGCTTGCAATTCATTTGG LOC_Os03g42100-proR_XbaI
(SEQ ID NO: 5) GTCTAGACCCTGCATCCAATAAACGAAGA

Template DNA was used at 100 ng and each primer was used at 5 pmol. PCR conditions were at 5 ° C. after 5 minutes; Repeat 4 times 30 seconds at 95 ° C., 30 seconds at 56 ° C., 300 seconds at 68 ° C .; 30 seconds at 95 ° C, 30 seconds at 62 ° C, and 300 seconds at 68 ° C were repeated 35 times, and finally, 68 ° C and 10 minutes. PCR products were subjected to electrophoresis to confirm their size, and cloned into pGEM T-Easy vectors for sequencing. The cloned DNA was digested with KpnI and Xba1, and then ligated with pGA3519 vector (promoter-GUS cloning vector) digested with the same restriction enzyme at 14 ° C for 12 hours. The ligation product was mixed with 200 μl of Top10 E. coli competent cell, transferred to a 1.5 ml tube and allowed to stand on ice for 15 minutes. Subsequently, 1 minute of standing again in a 37 ° C. oven, 1 ml of LB liquid medium was further added to the tube and then left in a 37 ° C. shaking incubator for 3 hours. Subsequently, the resulting colonies were plated in tetracycline resistant LB solid medium and waited for 12 hours to prepare mini-plasmid preparations after cell culture in 1 mL of LB liquid medium. The DNA obtained by miniprep was digested with restriction enzymes KpnI and XbaI and the agarose gel was separated by electrophoresis and the band was confirmed. The cloned DNA thus obtained was subjected to sequencing again to select a DNA in which no error occurred.

The base sequence analyzed above is shown in SEQ ID NO: 1, and a promoter region from -1,846 to +914 and a second exon of LOC_Os03g42100 were used as the promoter sequence. A diagram of the vector used for the preparation of the GUS plant comprising the LOC_Os03g42100 promoter and part of the gene is shown in FIG. 2.

Example 4 Preparation of Transgenic Cells

The plant expression vector produced in Example 3 was extracted.

50 µl of Agrobacterium competent cells (Agrobacterium tumefaciens LB4404) and 2 µg of plant expression vector were mixed and left on ice for 15 minutes. Subsequently, after 75 seconds in liquid nitrogen, 5 minutes was placed again in an oven at 37 ° C., 1 ml of LB liquid medium was added thereto, and then left in a 28 ° C. shaking incubator for 3 hours. Subsequently, Agrobacterium colonies, which were plated on tetracycline-resistant LB solid medium and waited for 36 hours, were miniprepped after cell culture in 1 mL of LB liquid medium, and the size was confirmed after enzyme cleavage using KpnI and Xba1. Transformed Agrobacterium strains were prepared.

The transformed Agrobacterium was used to transform rice.

Example 5 Preparation of Transgenic Plant

Dongjin rice seeds were grown in N6D solid medium in a 28 ° C. growth room for about 7 days to prepare a callus of rice. The resulting callus was mixed with the transformed Agrobacterium of Example 3 and cultured in a growth room at 22 ° C. in a medium containing N6D-acetosyringone.

Rinse the callus cultured with Agrobacterium with clean distilled water about 5 times, and then select the hygromycin selection in N6D solid medium for 1st (hygromycin 30 mg / L) and 2nd (hygromycin 40 mg / L). Proceed through. Selection took place for four weeks, two weeks each at 28 ° C growth. The cleaved callus was transferred to MSR (hygromycin 40 mg / L) solid medium, which is a regeneration medium, to induce re-differentiation in the growth room at 28 ° C. for 4 weeks, and then the plants were transferred to MS solid medium and grown in 28 ° C. Transferred to grow replanted plants.

Example 6 Verification of Predominant Expression of Root Hair Using Transgenic Plants

In order to confirm the organ specific GUS expression of the re-differentiated plants, 10 harvested seeds were incubated at 28 ° C. for 7 days, and then all individuals were subjected to GUS staining.

GUS solution contains 200 ml of 0.5 M sodium phosphate buffer, 100 ml of 12.5 mM potassium ferricyanide, 100 ml of 12.5 mM potassium ferrocyanide, 20 ml of 0.5 M EDTA, 50 ml of 10% Triton X-100, and 1 ml of X-gluc and Methanol in 10 ml of DMSO (dimethyl sulfoxide). 200 ml was added and prepared in a volume of 1 L with distilled water. All plants of each strain were treated with 15 ml of GUS staining for 24 hours and then destained at room temperature using 70% ethanol and 100% ethanol sequentially.

The results are shown in FIG. 3 (G) shows plant roots on day 5 after germination, and (H) and (I) show photographs of the root hairs in detail.

As shown in FIG. 3, the transgenic plants showed a predominant GUS expression in the root hairs, unlike the weak GUS expression at other sites. Based on the results of FIG. 3, it was confirmed that the LOC_Os03g42100 promoter specifically expressed root hairs.

In other words, it was confirmed that the promoter region of -1,846 to +914 of the LOC_Os03g42100 gene may act as a specific expression promoter through the analysis result.

<110> University-Industry Cooperation Group of Kyung Hee University <120> A root hair-specific promoter from Oryza sativa Os03g42100 gene          and uses <130> PN1906-317 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 2760 <212> DNA <213> Unknown <220> <223> LOC_Os03g42100 promoter <400> 1 caggcttgca attcatttgg tcaactgaaa gtgatgtcat tttcaaaaac tgaaaatgac 60 acaatgaaaa agatttcagg gaagttttcc acacaaaaga ataactgaat ccaacttgca 120 aacttaagta gcttggttag ttttcttaat aagatagcag tgagccagcg aggttgtttt 180 tccatatatg atacattatt ggtagtccta cttgatttat gcactaagga gaactgtata 240 ttttgcccct tcagatatac tttatggtct tcaaagggaa taatctcaat gtaatcaggg 300 ttcctcatta tgcaactgga cattatagaa gtcatgattc aagagacata tgccaagcgc 360 ttttcgcata tttgtgtatg atctatgatt ctaaattttt ttttagataa tatgtgattc 420 tacatttatt tctatgttta ttagaaatat aagatcggta ttaggtattc cgttattcat 480 gctatgcaat ttggctgcat atcagcatgg cattggaagt ttccgagttc atacttcata 540 cagctaaaaa tcagaggtac aagtaatcca cacctttggt cccttgaatt catttttctt 600 tgctggcatc tgagcttcat tttttattcc cctcattgat cctctgtgtg gaacaaagag 660 gcaagaggaa taaaaactct tttgaaggcg aaggggcatt gcagaaatac agctcatccc 720 ttctgctact tgtaggatct gagtcatgtg cagctcctat tgttgaggag atcagaaccg 780 gatcatcgga taattcagat tttgtcgggt tactgcaagg cagagtcctt ttgatttcac 840 atgctcagtg attttcaaga tatacaacta ccataatctg aatattattt ttctctcctg 900 caggtctctg gtaatgtttg cctggaacta ttacttggat aaccatcaga cagatgtcat 960 attgtctgac aattacatct agcaacagac tagcccagtc tttgctgtgt ccagatctat 1020 ccagcaaaca gtttaattta ctcccaaagt tatttcttct ttaaacttag ttcagaaaaa 1080 ggtatatgga tcactggaat gcctgtattt tcagtgggct atcttaccat gagacaatga 1140 tgaaaactgt gtgcatgtga agacaaagct cgagatctgc ggaggcagtg tccaatcctt 1200 tttgagctct gaagaatgat tagattcccc tccatgttcg tgcaagcctc tcctggtagc 1260 tccttgagtt tgtttattgg acgacttcat tgcagcaaca ttctctacaa tacaatctca 1320 taacatctga tcctgcatta attgctaaga taagcccatg tttgttcctg ttttgaacat 1380 aatgcagtat atacttgttt tttcattgtc ctttgatgca tctaaactgg ggatgatttt 1440 ctctccaatc attgaaacat gtccttgtga cacttgcctc ttgagctctg attggcttga 1500 cctcttaact gtgtctgatc ttggggcaag tcactatcct gtctaccaac ttgtaacagc 1560 tagcagttga aatttttttc taatcctcat aatgtgcaca ggggttgcta tcacccccag 1620 ttcatctcca gccgtgggca tctatttatt ttaagcatga tttaccattt cttaatcctg 1680 caagttgctg tgcttccatt caaccttttg tcttttcatc aggtataaat gatcctgcca 1740 taacctgcat ctcttcttca ccgagcacaa gtgtatcaaa ctatcaaaca cagcacggtc 1800 ctcacaccac ctctaacatc tctcacatcc aaaacttgta tcagaaatgg agtccggagg 1860 ggtgatcgcg gaggcggggt ggagctcgct cgacatgtcg tcgcaggccg aggagtcgga 1920 gatgatggcg cagctgcttg gaacctgctt cccctccaat ggcgaggatg atcatcacca 1980 agagcttcct tggtcggttg acacccccag tgcctactac ctccattgca atggaggtag 2040 ctcaagtgca tacagctcta ccactagcag caacagtgct agtggtagct tcactctcat 2100 tgcaccaaga tctgagtatg aggggtacta tgtgagtgac tctaatgagg cggccctcgg 2160 gatcagcatc caggagcaag gtgcagctca gttcatggat gccattctca accggaacgg 2220 cgatccgggc ttcgatgatc tcgctgactc gagcgttaat ctgctggatt ccatcggcgc 2280 ttctaacaag agaaagattc aggagcaagg caggctagat gaccaaacga aagtgagtta 2340 acctgatgat tttttatcat ttttgcgata acagtgtatt aaggctgctg tttaaattgc 2400 tggtgtgcag aatttgcatg ctgattttga ttgaaatgga tataatgcag agtaggaaat 2460 ctgcgaagaa ggctggctcg aagcggggaa agaaggcggc gcaatgtgaa ggtgaagatg 2520 gcagcattgc tgtcaccaac aggcaaagct tgagctgctg cacctctgaa aatgattcga 2580 ttggttctca agaatctcct gttgctgcta agtcgaatgg caaggctcaa tctggccatc 2640 ggtcagcaac cgatccccag agcctctatg caagggtact agagatgatc ttctgaattc 2700 actgtctaaa aacgttacag attggcaatc tcgctaatgc tcttcgttta ttggatgcag 2760                                                                         2760 <210> 2 <211> 20 <212> DNA <213> Unknown <220> <223> LOC_Os03g42100 promoter RT F <400> 2 gtcgaatggc aaggctcaat 20 <210> 3 <211> 21 <212> DNA <213> Unknown <220> <223> LOC_Os03g42100 promoter RT R <400> 3 cttcacgtaa tgcattgcct c 21 <210> 4 <211> 26 <212> DNA <213> Unknown <220> <223> LOC_Os03g42100 promoter Kpn1 F <400> 4 ggtacccagg cttgcaattc atttgg 26 <210> 5 <211> 29 <212> DNA <213> Unknown <220> <223> LOC_Os03g42100 promoter Xbal1 R <400> 5 gtctagaccc tgcatccaat aaacgaaga 29

Claims (10)

Plant root hair specific expression promoter consisting of the nucleotide sequence represented by SEQ ID NO: 1. Root hair specific expression vector of a plant comprising the promoter of claim 1. Agrobacterium transformed using the expression vector of claim 2. Plant transformed with the root hair specific expression vector of the plant of claim 2. 5. The transformed plant according to claim 4, wherein the plant is a monocotyledonous plant. 6. The transformed plant according to claim 5, wherein the monocotyledonous plant is rice. Seed of the transgenic plant of claim 4. Preparing a vector by recombining a root hair trait improving foreign gene to the root hair specific expression promoter of claim 1; And,
A method for expressing a root hair specific expression in a transgenic plant, wherein the root hair transformation-enhancing foreign gene comprising the step of transforming the vector into a plant. 9. The method of claim 8, wherein the plant is a monocotyledonous plant. Root hair transfection improved foreign gene produced by the method of claim 8 is a transgenic plant that is specifically expressed in the root hair.

Images