KR100410738B1 - Promotor system of translationally controlled tumor protein gene - Google Patents

Abstract

The present invention provides nucleic acid molecules isolated in the 5 ′ nontranscriptional region of the Arabidopsis translational regulatory tumor protein (TCTP) gene. Nucleic acid molecules referred to as TCTP promoters in the present invention regulate the reporter genes to be appropriately arranged and expressed at high levels. TCTP promoters initiate and regulate gene expression at levels comparable to those currently available in plant genetic engineering. At least 300 base sequence regions are sufficient for complete regulatory activity. TCTP promoters have the highest activity in rooted meristems and function in all tested plant tissues. The present invention can be used to express high levels of useful genes in agriculturally important plants.

Description

PROMOTOR SYSTEM OF TRANSLATIONALLY CONTROLLED TUMOR PROTEIN GENE}

The present invention relates to nucleic acid molecules isolated in the 5 ′ nontranscriptional region of the Arabidopsis translational regulatory tumor protein (TCTP) gene, which are appropriately arranged and regulated to high levels of reporter genes in transgenic plants.

Gene expression in eukaryotic systems is regulated through complex interactions between various cis-acting and trans-acting regulatory elements. Cis-acting elements are defined as DNA sequences adjacent to a gene that directly or indirectly regulate the expression of a gene by regulating the binding of trans-acting elements called various transcription elements. Promoters are one of the most important cis-acting elements and are generally regarded as nucleotide sequence regions located five terminal upstream of the transcription initiation site of a gene. The promoter contains a binding site for RNA polymerase II and initiates transcription of the gene. The promoter also includes several well-conserved sequence elements, such as a CAAT box near base position −70 and a TATA box near base position −30 associated with the transcription initiation site (+1) (Joshi 1987). TATA boxes are important for accurately positioning the onset of transcription. CAAT boxes are not present in all promoters, but in some promoters with GC-rich regions replaced. In addition to these base elements, the promoter also includes additional sequences that respond to environmental signals and physiological conditions such as dry stress, heat shock, cold stress, nutrient availability, light and ionic strength. In addition, some promoters include sequence elements that direct tissue-specific gene expression or cell-specific gene expression. In addition, promoters can express beneficial genes in important agricultural plants by regulating gene expression by conditions such as expression level, tissue specificity or cell-specificity, developmental stage dependence, and responsiveness to specific environmental stimuli. It is important.

Translational regulatory tumor proteins (TCTP) are one of the growth-related proteins recently identified from plants and animals. TCTP is a cytoplasmic protein that is highly conserved in a variety of organisms, including humans, animals, plants and yeast, has a very robust globular structure and is very stable against heat, pH, ionic strength and proteolytic enzymes (Woo et al. 1997). . One interesting property of TCTP protein is that its expression is closely related to the growth conditions of the cell. According to this, TCTP proteins have been isolated from rapidly growing tissues, including callus tissues of plants, normal stems and leaves, meristems of roots, and tissues of animal cancer. This observation indicates that TCTP proteins may have a regulatory role in cell proliferation (Woo et al. 1997; MacDonald et al. 1995; Hughes et al. 1993). However, it has since been discovered that TCTP proteins are expressed in healthy animal and plant tissues and their expression is regulated by calcium ions at the transcriptional and posttranscriptional levels (Wu et al. 1999; Sanchez et al. 1997; Xu et. al. 1999). TCTP proteins are associated with the microtubule network of the cytoskeleton as they interact directly with α-tubulin and β-tubulin in a calcium ion (Ca ²⁺ ) dependent manner in animal cells (Gachet et al. 1999; Gachet et al. 1997). The TCTP protein is an acidic protein with an isoelectric point (pI) of about 4.0 as a whole, but a domain consisting of about 50 amino acids in the central region is strongly basic with an isoelectric point of 9.4. This basic domain physically interacts with tubulin (Gachet et al. 1999). Taken together, these observations indicate that TCTP proteins play an administrative role in the regulation of cell growth and differentiation. Many TCTP genes and gene sequences have been isolated from various tissues of animals and plants (Sage-Ono et al. 1998; Tamaoki et al. 1997; Woo et al. 1997). However, with the exception of a few cases, especially in plants, only TCTP gene sequences have been deposited in the database without detailed molecular biological and functional analysis. Pea TCTP gene is expressed at high levels in rapidly differentiated cells within the root apical (Woo et al. 1997). In a single plant, Japanese Morning Glory (Pharbitis nil cv.Violet), TCTP mRNA accumulates to a high level when the plant grows in the dark, but its expression level decreases to an undetectable level in the light, which means that TCTP Means a role in at least light-controlled growth (Sage-Ono et al. 1998). Except for these two cases, no detailed studies have been reported on plants.

We found that pea TCTP protein is prominently expressed in the upper axis of pea seed grown in the dark and directly interacts with pea Pra3, a photo-inhibitory Rab-like small molecular weight GTPase. It was. Northern blot analysis showed that pea TCTP genes were transcribed to high levels in all plant parts tested, such as stems, leaves, and roots, but showed the highest levels of transcription in meristem at the top of the roots. In addition, the transcription was induced 2-3 times more by treating 15% PEG with dry stress conditions on the plants. In addition, the same expression pattern was observed in tobacco TCTP genes. Taken together, previous reports indicate that the promoter of the plant TCTP gene is usefully used to express beneficial genes in transgenic plants with high economic value. To study regulatory mechanisms for TCTP gene expression in plants and to assess the potential of TCTP promoters in plant genetic engineering, DNA sequences are isolated from the 5-terminal non-transcribed region of Arabidopsis TCTP genes and the promoters are subjected to a series of excisions. The expression level and pattern of the reporter gene placed under the control of the TCTP promoter in the transgenic plants were examined.

The Arabidopsis TCTP promoter region contains a unique TATA matching sequence associated with the ATG start codon at a base position of -120. However, no CAAT box or GC-rich sequence can be identified at the appropriate location in the 5-terminal non-transfer region. Consistent with the above observations, a pair of photoreactive elements are identified. TCTP promoters have the highest levels of transcription in rooted meristems and induce high levels of reporter gene expression in all plants, consistent with conventional results in pea plants (Woo et al. 1997). Several different TCTP promoters constructed by deletion of the 5 terminus were coupled to the reporter gene and expression cassettes were tested in transgenic Arabidopsis plants. At least 300 base sequences are sufficient for high level expression of the reporter gene. In addition, a promoter of 300 base sequences showed the most predominantly arranged expression in the meristem of the roots. This property indicates that the TCTP promoter can be used to induce high levels of expression of unique genes in appropriate host plants.

With recent developments and advances in plant tissue culture and plant genetic engineering techniques, it is now routine to introduce useful genes into host plants that are desirable for productivity and quality improvements not readily obtainable by conventional quality improvements. To achieve this goal, a foreign gene is precisely coupled to a TCTP promoter so that the gene can be expressed under the control of the promoter in a transgenic plant.

It is an object of the present invention to provide a genetic plant comprising an expression cassette and a method of producing the same.

Any desired gene was placed under the control of the TCTP promoter in the appropriate expression cassette and then the recombinant cassette was introduced into the host cell by a variety of transformation methods well known in the art. In addition, the promoter of the present invention further induced 2-3 times in response to the stress of drought. In this regard, the present invention can be used to manipulate genes, in particular to express genes at certain levels under standard conditions and to be further induced by drought stress.

Root growth is important in the field of agricultural plants. TCTP promoters according to the present invention can accelerate root growth, especially under drought stress or water deprivation. In one example of the invention, the TCTP promoter can be used to express genes involved in the regulation and stimulation of root growth and development.

The present invention for achieving the above object provides a transgenic plant cell comprising any gene of interest arranged under the control of TCTP and an experimental method for separating the TCTP promoter sequences of plants and Arabidopsis plants.

According to the present invention, plants can be manipulated in order to mass produce biologically important substances, to promote growth and development, or to adapt to environmental changes.

The method for producing a transgenic plant of the present invention comprises the steps of binding a nucleic acid molecule with a cloning vector under the control of a TCTP promoter comprising the nucleotide sequence shown in SEQ ID NO: 1, introducing the cloning vector into plant cells to transform plant cells. And the step of growing the transformed plant cells, characterized in that for expressing the gene.

In addition, the present invention is characterized by separating the TCTP promoter sequence comprising the nucleotide sequence shown in SEQ ID NO: 1 from the Arabidopsis by the PCR using arabidopsis genomic DNA as a template and a pair of specific PCR primers .

In addition, the transgenic plant cell of the present invention is characterized by expressing a gene under the control of a TCTP promoter isolated from the 5 'nontranscribed region of the Arabidopsis translation control tumor protein (TCTP) gene having the nucleotide sequence shown in SEQ ID NO: 1 do.

In addition, the plant is characterized in that the pea, Arabidopsis, tobacco or Japanese morning glory.

In addition, the present invention is characterized by the seeds, leaves, stems, cotyledon and root of the transgenic plant.

1 shows Northern blot analysis of pea TCTP gene expression.

FIG. 1A is a section of a pea plant grown in light with an organ of leaves, apical leaves, stems, top stems and flowers. The total RNA was selectively isolated from each plant part. 3 μg of total RNA was loaded into each lane and the PTP labeled TCTP gene sequence was probed. In this Northern blot analysis, the HiBond-N + filter was exposed for 30 minutes.

1B grew pea plants in the presence of various plant growth hormones at physiological concentrations. The stem portion was analyzed from each treatment. C; Untreated, G; GA3, P; 15% PEG, I; IAA, K; Kininetin, A; ABA. Similar results were obtained with other plant parts (roots and leaves).

2 shows the nucleotide sequence of the Arabidopsis TCTP promoter. DNA molecules were separated from the Arabidopsis genomic DNA by polymerase chain reaction (PCR) using a pair of specific primers. The nucleotide sequence is shown in SEQ ID NO: 1 and was deposited in the Gene Bank Database (Approval Number AF237735). The initiation codon of the TCTP gene is printed in bold and the putative TATA box consensus sequence is underlined in two lines. The promoter does not have a typical CAAT sequence, but has a pair of putative photo-reactive sequences as indicated. PCR primers were used to synthesize TCTP promoters (FIG. 3) having different lengths from PCR primers, and PCR primers were indicated by arrows from 5 to 3 terminals. Primer 1; -1990 to -1963, primer 2; -1312 to -1296, primer 3; -663 to -681, Primer 4 to -284 to -303, Primer 5; -1 to -28. Numbers indicate base positions related to the start codon of the TCTP gene.

3 shows a schematic of the TCTP promoter generated and tested in the present invention. Promoter regions with lengths of 2 kbp, 1.3 kbp, 0.7 kbp and 0.3 kbp were isolated by PCR run and are transcriptionally bound to the GUS gene sequence in a vector without a promoter based on pBI. All expression cassettes were identified by direct DNA sequencing. The 35S promoter was used as a control. The numbers represent base positions starting from the (+1) ATG codon as in FIG. 2. T; Nos terminator, A; Arabidopsis TCTP gene and its 5-terminal non-transcribed region, B; TCTP promoter produced by the present invention, C; CaMV 35S promoter used as a control.

4 shows GUS activity throughout the plants detected by histochemical analysis. Expression cassettes containing GUS-TCTP promoter fusions were transformed into Arabidopsis plants, and homozygous lines were isolated by repeating kanamycin selection. GUS staining was performed for 4 hours using the whole plant and chlorophyll was removed from pure ethanol overnight at room temperature. The lower panel shows transgenic plants treated with 15% PEG. Plants in the control group were transformed with the vector without the promoter without the TCTP promoter sequence.

5 shows the expression of the GUS gene in the roots. Roots were isolated from the transgenic plants used in FIG. 4 and treated in the same manner as in FIG. 4. Control plants are also as in FIG. 4.

FIG. 6 shows the activity of the TCTP promoter shown in FIG. 3. The 35S promoter was used as a control. Homozycotic lines of transgenic Arabidopsis plants with single-copy inserts were isolated by Southern blot analysis including control plants with 35S promoter. Fluorescent GUS analysis was performed with crude extracts isolated from seeds of transgenic plants grown in light. GUS activity was calculated as described in the Examples. Three independent measurements were averaged.

Hereinafter, exemplary embodiments of the present invention will be described in detail with reference to the accompanying drawings.

Molecular biological and biochemical studies in most animals and few plants have shown that translational regulatory tumor proteins (TCTPs) have a management role in the regulation of growth and development. Although TCTP proteins were originally isolated from tissues showing abnormally rapid growth, it was then confirmed that they were expressed at high levels in normal cells and their expression was regulated at the transcriptional and translational levels. The physiological role of TCTP protein in plants has not yet been identified. In the few cases where several molecular biological studies have been conducted, TCTP gene expression is controlled by light and predominantly expressed in rapidly dividing cells, such as in meristem of the roots, in which TCTP proteins are involved in cell division and differentiation in plants. It is present.

The term "promoter" refers to a nucleotide sequence located in the 5-terminal upstream region of a structural gene that initiates and regulates gene expression. In general, promoters include a variety of well-conserved sequences. One of them is a TATA box located upstream of about 10-40 bases at the transcription initiation site (+1) and having a sequence of 5'-TATAAT-3 '. The other is a CAAT box with the sequence 5'-CCAAT-3 'in most cases. It is generally located upstream of 40-110 bases of the transcription initiation site. The third sequence, the GC-rich region, is also present in some promoters. In other promoters, the CAAT box is replaced with an AGGA box having the sequence 5'-AG (or T) NGA-3 ', where N is one of four bases. Although a promoter may not always be enough to express a gene, it must be the most important component to regulate gene expression. Therefore, the description of the promoter system is essential for understanding the regulatory mechanisms underlying gene expression in plant growth and development. In addition, the promoter system is an important element in plant genetic engineering because the expression of certain genes is manipulated by specific promoters.

The present invention provides a strong constitutive promoter isolated from the Arabidopsis TCTP gene. Promoters express high levels of genes in all plant parts when the gene is properly bound to the promoter. In addition, promoter activity is further induced 2-3 times against drought stress, especially in stems.

“Properly bound to a promoter” refers to binding a beneficial structural gene to the 3 ′ end of a promoter sequence in order to regulate the expression of that gene by the promoter. Regulation of a gene can be constructed or induced depending on the promoter bound to that gene. Inducible expression can be controlled by environmental factors such as cold, drought or pathogen infection. In addition, gene expression can be regulated in a developmentally dependent method or in a cell-specific or tissue-specific method.

The regulatory role or effect of promoters on the expression of structural genes can be tested at the transcriptional or translational level. As a means to test this at the transcription level, DNA-RNA hybridization technology was used. To do this, whole RNA or mRNA was isolated from appropriate plant material, subjected to agarose gel, transferred to a supporting membrane, and tested with a radioactive isotope labeled DNA probe. In the analysis of transcription levels, crude extracts or purified proteins were isolated from plant materials using techniques known in the art and tested using specific antibodies.

The promoter in the present invention was designed as a TCTP promoter. The TCTP promoter is derived from the 5 'upstream region of Arabidopsis TCTP and has the nucleotide sequence shown in SEQ ID NO: 1 (GenBank Accession No. AF237735). The base sequence can be separated by PCR using Arabidopsis genomic DNA as a template and using a pair of specific PCR primers. Partial sequence regions of these base sequences were also synthesized in the same manner.

The present invention also relates to nucleic acid molecules hybridized to nucleic acid molecules having the nucleotide sequence of SEQ ID NO: 1 under very stringent conditions. "Hybridized under very stringent conditions" indicates that such nucleic acid molecules are hybridized to nucleic acid molecules via base pairing under conventional hybridization conditions, as described by Sambrook et al. (Sambrook et al. al., Molecular Cloning: A Laboratory Manual, 2 ^nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989). Nucleic acid molecules hybridized with such nucleic acid molecules generally include those obtained from any plant, optionally from plants that are beneficial in agriculture, forestry, horticulture.

As a means for isolating a nucleic acid molecule hybridized to the nucleic acid molecule shown in SEQ ID NO: 1, using the nucleic acid molecule described above as a probe through a colony hybridization method which is a molecular biological technique known in the art, a genomic DNA library Was screened.

In addition, the nucleic acid molecule in the present invention relates to a modification of the nucleic acid molecule shown in SEQ ID NO: 1. "Modified" means that the base sequence of such nucleic acid molecule differs from the nucleic acid molecule described above by one or more base positions and is highly homologous to the nucleic acid molecule.

"Homologous to said nucleic acid molecule" indicates that the base sequence of a nucleic acid molecule is at least 70%, in particular 80% or more identical, to the nucleic acid molecule in its base sequence.

The present invention also includes any derivative of the nucleic acid molecule produced by insertion, deletion, base substitution or recombination.

Furthermore, the present invention relates to recombinant DNA molecules comprising a TCTP promoter useful for evaluating said promoter in a transgenic plant cell or plant and functionally linked to a reporter gene.

In one embodiment of the present invention, the TCTP promoter is operably linked to the desired genes to express high levels of genes in all plant parts, particularly in the meristem of the roots, in order to enhance plant growth.

The invention also relates to expression cassettes and plasmids comprising a TCTP promoter for use in the transformation of plant cells.

With the recent rapid advances in plant tissue culture and genetic engineering, it is possible to introduce substantially beneficial genes into any economically important plant. For this purpose, gene expression regulatory elements such as the TCTP promoter of the present invention are important.

Therefore, the present invention is:

1. a nucleic acid molecule in the 5 'upstream region of the Arabidopsis TCTP gene comprising the nucleotide sequence of SEQ ID NO: 1, and

2. Provide E. coli strain XL1-blue (KCTC 0807BP) transformed with the vector pTCTP-2K. Vector pTCTP-2K includes a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 1.

(Example)

Construction of Expression Cassettes

Plant TCTP genes are constitutively expressed at extremely high levels in all plant parts. Its expression is also regulated by drought stress and light. This property indicates that the TCTP promoter is very useful for expressing the desired genes in genetically engineered plants. DNA fragments having a length of about 2.2 kbp were isolated from the 5 'upstream region of the Arabidopsis TCTP gene by PCR reaction using the Arabidopsis genomic DNA and a pair of specific primers. The complete nucleotide sequence was confirmed by DNA sequencing and deposited in the Gene Bank database (Approved Number: AF237735). In addition, several promoter sequences having different lengths were constructed by performing a series of PCRs (FIGS. 2 and 3). The TCTP promoter sequence was then fused transcriptionally to the gene sequence encoding β-glucuronidase (GUS) in a vector without a promoter based on pBI. An expression cassette comprising the GUS-TCTP promoter fusion was confirmed by DNA sequencing.

Plant material and growing conditions

Arabidopsis thaliana ecotype Columbia (Col-0) was used for the transformation. Sterilized seeds were germinated and grown in 0.5X MS medium (Murashige and Skoog medium) containing 1% agar and sucrose. All Arabidopsis cultures were maintained in a controlled environment with 70% humidity and 12 hours photoperiod in a 22 ° C. incubation chamber.

Plant transformation

GUS-TCTP promoter fusion expression constructs were introduced into Arabidopsis plants under stringent conditions. Agrobacterium-mediated transformation was carried out using a floral dip method that simplifies (Clough and Bent, 1998). First, the expression construct was transformed into Agrobacterium tumefaciens strain LBA4404 (LBA4404), and then cells containing the expression construct were used to infect Arabidopsis plants. In order to select a transformant, kanamycin (kanamycin) and cefotaxime were used at 200 mg / l and 500 mg / l, respectively.

RNA Extraction and Northern Hybridization

Total RNA samples were isolated from appropriate plant materials using the RNeasy Plant Total RNA Isolation Kit from Qiagen, Valencia, CA, according to the manufacturer's method. RNA samples were prepared at 10 ° C. in a MOPS buffer solution (20 mM MOPS, 8 mM sodium acetate, 1 mM EDTA) to which 50% (v / v) of formamide and 2.2 M of formaldehyde were added. It was denatured for a minute and fractionated with 1% agarose gel prepared in the same denaturing buffer. Probes were prepared by random injection in the presence of α- [P ³² ] dATP. Transfer to a Hybond-N membrane as described previously and then run the procedure (Sambrook et al. 1989).

DNA Extraction and Southern Hybridization

Several modifications to the manufacturer's method were used to isolate genomic DNA from Arabidopsis plants using the Qiagen DNeasy Plant Mini Kit. In short, the plant material was ground to fine powder using a mortar and pestle in liquid nitrogen. The powder was then transferred to an Eppendorf tube to evaporate liquid nitrogen. 500 μl of buffer AP1 and RNase A solutions were added and stirred vigorously. The mixture was incubated at 65 ° C. for 10 minutes. After digestion of the cells, 160 μl of buffer AP2 was added and the final mixture was incubated on ice for 5 minutes. This step is for precipitating surfactants, proteins and polysaccharides. The precipitate was removed by centrifugation for 5 minutes at full speed. The supernatant was then placed in a QIAshredder spin column and centrifuged for 2 minutes at full speed.

The solution was mixed with 1 vol pure ethanol and 0.5 buffer AP3 and placed in a DNeasy mini spin column and centrifuged at 8000 rpm for 1 minute. 500 μl of buffer AW was added to the column and centrifuged again for 2 minutes at maximum speed to dry the column membrane. To extract genomic DNA, 100 μl of preheated (65 ° C.) buffer AE was added directly to the membrane and incubated at room temperature for 5 minutes. The column was then centrifuged for 1 minute at full speed. The resulting genomic DNA solution was extracted with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1), precipitated with ethanol for 5 minutes at room temperature, and the DNA was recovered by centrifugation.

Genomic DNA was digested with EcoRI and HindIII, recognition sites that do not exist in the GUS gene in the expression cassette used to transform Arabidopsis plants. 5 units of restriction enzyme each per 1 μg genomic DNA were used and the mixture was incubated at 37 ° C. for 4 hours. To obtain better analysis results on agarose gels, the degradation mixture was precipitated with ethanol and then the pellet was rinsed twice with 70% ethanol and air dried. Samples were dissolved in 1 × loading buffer and loaded onto 0.8% gel. The probe used radio-labeled GUS gene sequence. Since Arabidopsis transgenic plants have their own TCTP promoter sequence, the GUS gene sequence was used as a probe instead of the TCTP promoter sequence.

Histochemical Analysis of GUS Activity

The whole plant or any part of the plant was treated with X-gluc solution (0.1 M sodium phosphate, pH 7.0, 10 mM EDTA, 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 0.1% Triton X-100, 0.3% 5-bromo-4-chloro-3-indolyl glucuronide and 20% methanol) for 2-4 hours. New Triton X-100 was added just before using the plant material. The plant material was then soaked in pure ethanol overnight at room temperature to remove chlorophyll. Ethanol was exchanged 4-5 times during the culture. The sample from which the dirt was removed was observed under an optical microscope and photographed if necessary.

Fluorescence Analysis of GUS Activity

Expression levels of GUS activity were analyzed using fluorescent methods (Jefferson 1988). 4-methylumbelliferyl-β-D-glucuronide (MUG) was used as a fluorescent substrate to analyze GUS activity. The crude extract of the plant was prepared as follows. Grind the plant material from liquid nitrogen to fine flour and lysate the cell lysis buffer (0.5M Tris.Cl, pH 7.5, 1 mM DTT, 1 mM 1,2-diaminocyclohexane-N, N, N ', N'- Tetraacetic acid, 10% glycerol, 1% Triton X-100, 1 mM EDTA). 200 μl of cell lysis buffer was used for 1 g of fresh plant material. Centrifugation was performed for 15 minutes at maximum speed at 4 ° C. to remove any insoluble material and cell debris. The supernatant was used without further purification for fluorescence measurements. Protein concentration was determined using the Bradford method. Fluorescence measurements were performed based on the method by Jefferson (Jefferson, 1998).

(result)

Dual Expression Patterns of Plant TCTP Genes: Constitutive and Inducible Expression

Translation-regulated tumor proteins (TCTPs) have specific structural and functional properties, although the exact physiological function is not yet known. Because TCTPs have high amino acid sequence homogeneity (60-70% of the total sequence) among various organisms, their physiological roles in plants and animals are expected to be the same. TCTP protein is very stable even against proteases. TCTP protein is a strong acidic cytoplasmic protein with an isoelectric point (pI) of 4.0, but has a high basic domain with an isoelectric point of 9.2 at its center. These basic domains interact directly with tubulin, and this interaction has been demonstrated to be involved in cell division and differentiation. TCTP proteins are highly expressed in rapidly growing tissues such as cancer cells in animals and callus tissues in plants. In addition, TCTP proteins are highly expressed in normal tissues, although they vary slightly from tissue to tissue. TCTP expression in plants is regulated by light in a species-specific manner. In addition, it has recently been found that TCTP expression is induced by 15% PEG treatment, indicating the role of TCTP protein in stress response in plants. A particular advantage is that the TCTP gene is transcribed at extremely high levels, at least in tobacco, pea and arabidopsis plants tested in the present invention, and possibly at higher levels in all higher plants.

To develop a promoter system useful for plant genetic engineering and to study the regulatory mechanism for TCTP gene expression, the 5 'non-transcribed region of the TCTP gene was isolated from Arabidopsis, and its regulatory role for reporter gene expression was tissue specificity, environmental factors. The conditions of reactivity and relative activity for were tested.

First, the transcription level and transcription pattern of TCTP gene in pea plants were examined by Northern blot analysis. The level of transcription was relatively high in the stems and relatively low in the organs of flowers, but slightly different among the different plant parts, but extremely high in all the tested plant parts (FIG. 1A). TCTP genes are highly transcribed in most rapidly growing parts, such as apical stems and leaves. This means that TCTP protein is involved in plant growth and development (Woo et al. 1997). When the plants were treated with various plant hormones, nothing affected the level of transcription except for the treatment of 15% PEG, which gave the plant drought conditions. Treatment with 15% PEG induced transcription 2-3-fold (FIG. 1B). Of particular note is the overall high level of transcription. Normal Northern blot analysis generally used 15-20 μg of total RNA, whereas the Northern blot analysis shown in FIG. 1 loaded 3 μg of total RNA into each lane. In addition, exposure for 10-20 minutes was sufficient for detection of TCTP transcription. Taken together, these observations indicate that TCTP genes are constitutively expressed at high levels in all plant tissues, and their expression is further induced by environmental factor (s) such as drought stress.

Surprisingly, contrary to the conventional results observed in Japanese morning glory plants (Sage-ono et al. 1998), light appeared to have no significant effect on the transcription of TCTP in pea plants. The same results were obtained for the tobacco TCTP gene. Therefore, it can be explained that the influence of light depends on the species of the plant. Alternatively, the plant may have several TCTP genes, each regulated by a different mechanism. Southern analysis of peas, tobacco, and Arabidopsis showed that each plant species had a single copy gene (pea, Arabidopsis) or at most two copy genes (tobacco, Japanese morning glory).

Taken together, plant TCTP genes are constitutively transcribed at very high levels in all plant parts, and their transcription is further regulated by environmental factors, which play an important regulatory role for TCTP proteins in cell proliferation and differentiation. It is proved. In addition, since the promoter of the plant TCTP gene is very high activity, it can be used to express a large amount of beneficial proteins in genetically engineered agricultural plants and to improve plant growth and development.

Promoter Regions of Arabidopsis TCTP Genes

An efficient method of choice for testing the regulatory role of the promoter is to construct a chimeric fusion that functionally binds the structural gene to the promoter and introduce the expression construct into the transgenic plant. Activity levels or expression levels of structural gene products in transgenic plants can be readily analyzed in vitro. Reporter genes often used in these experiments usually encode enzymes that catalyze the production of easily detectable substances. The product is then used to infer the activity of the fusion construct and consequently determine the regulatory activity of the promoter (Jefferson, 1988). In the reporter system of the invention, the promoter or putative promoter element was fused to a gene sequence encoding E. coli β-glucuronidase (GUS). GUS hydroxylates various β-glucuronides and has useful biochemical properties that can be used as reporters. It is virtually absent in all higher plants and is very stable against surfactants, pH and ionic conditions. In addition, it does not require supplementary cofactors. It is absolutely located in the cytoplasm and does not require post-transcriptional modifications. These characteristics make the GUS system a complete reporter that can be used on higher plants and analyzed on crude extracts isolated from plant material.

Promoters were isolated from the 5 'upstream region of the plant's TCTP gene to develop a useful promoter system for use in plant genetic engineering and to experiment with regulatory roles in gene expression. Pea TCTP genes were isolated based on the ability of the TCTP protein to interact directly with pea Pra3, a Ras-like small GTPase involved in stress (Nagano et al. 1995; Yoshida et al. 1993). Molecular biological analysis has shown that constitutive expression is at high levels in all plant parts. Database investigations identified the TCTP gene homolog for chromosome 3 of Arabidopsis. Based on the nucleotide sequence of the genomic clone MGL6 (Approval number: AB022217), a pair of specific primers were designed and the promoter region of 2181 bases was amplified by PCR using the Arabidopsis genomic DNA as a template. Primers for each of the 5 '5'-GCC GGATCC TGACCCAACCCAAGTGTCCC having a BamHI restriction site at the ends (5' terminal primer, SEQ ID NO: 2) and 5'-GCC GGATCC AAGATCTTGGTACACCAACATG (3 'terminal primer, SEQ ID NO: 3) for cloning Used. The PCR product was cloned into pGEM-7Z (+) in pTCTP-2K vector, and its base sequence was identified by DNA sequencing and deposited in the gene bank database (GenBank Accession No. AF237735). The 3 'end of the DNA fragment contains a short coding sequence that encodes the first seven amino acids of the putative Arabidopsis TCTP protein.

The putative TCTP promoter region contains a typical TATA box at the -120 base position associated with the ATG codon (FIG. 2). The putative CAAT box is located upstream of about 270 bases in the TATA box. However, the position does not seem to function in the regulation of TCTP gene expression because it does not match the position of the experimentally proven CAAT box in the plant gene. In addition, the base sequence around the putative CAAT box, 5'-GAACAATCA, is somewhat different from the 5'-GG (T / C) CAATCT, which is a typical sequence in plant genes. A pair of photo-reactive elements were identified in TCTP promoters experimentally identified in other plant genes, such as 5'-AGAAACAA and 5'-AGCTATCCA at the respective base positions of -1352 and -767 (Conley et al. 1994; Park et al. 1996). It is not clear whether the photo-reactive element functions or does not function, but it may be related to the conventional results in Japanese morning glory where the transcription of the TCTP gene is tightly inhibited by light. In addition, the GA-responsive sequence 5'-CCTTTTG was identified at base position -1396, as identified in the rice glutenlin gene (Takaiwa et al. 1991).

Plant organ dependent expression

To test the regulatory role of the TCTP promoter in gene expression, 3 'terminal primers, primer 5 and 5' terminal primers, primer 1 were used to reamplify a region of about 2 kbp from the pTCTP-2K vector (FIG. 2). The resulting PCR product was cloned into a promoter-free vector based on pBI using a method of transcriptionally fusion of the 3 'end of the promoter to a sequence encoding GUS. The resulting expression cassette (2K in FIG. 3) was then transformed into Arabidopsis plants and homozygous lines were isolated by sequential selection with kanamycin. In addition to the 2K construct, several constructs were designed by ablation of the base sequence at the 5 'end of the 2K construct to determine the boundaries of the TCTP promoter and define the consensus sequence needed to interact with the trans-acting elements. As shown in FIG. 2, each construct was calculated by PCR using an appropriate pair of primers. Primer 5 was used as the 3 'terminal primer for all promoter constructs. Primers 2, primers 3, and primers 4 were used as 5 'terminal primers used for constructs of 1.3K, 0.7K, and 0.3K, respectively (Figure 2). The resulting expression cassette is shown in FIG. 3. The 35S promoter was included as a positive control (FIG. 3C) and the vector without promoter without any insert was used as a negative control.

The GUS activity of the transgenic plants was then analyzed according to standard methods using the whole plant (Jefferson and Wilson 1991). The TCTP promoter showed the deepest pigmentation in vascular tissue, such as with the 35S promoter, and was clearly seen to function in all plant parts including leaves, stems, cotyledons and roots (FIG. 4). One difference was that in transgenic plants containing the TCTP expression cassette, the meristem of the root was most heavily pigmented, but the tissue containing the 35S promoter did not exhibit such a distribution pattern. In addition, for transgenic plants containing the TCTP promoter, blue spots were clearly visible within minutes after soaking in the staining solution much faster than in 35S control transgenic plants. This indicates that the TCTP promoter is at least as strong as the 35S promoter and stronger than the 35S promoter.

300-bp promoter

GUS activity analysis demonstrated that the 300 bp TCTP promoter functions in the regulation of reporter gene expression and its activity is not significantly different from that of the 2K promoter (FIG. 4). Interestingly, expression of GUS in the meristem of the roots was more dominant than the 5 'terminal sequence excised from the TCTP promoter (Figures 4 and 5). In other plant organs such as leaves and stems, the distribution of GUS activity was nearly identical among other promoter constructs, whereas a 0.3K promoter in root meristem induced almost exclusively GUS expression (FIG. 4). The sequence between base positions -300 and -1 indicates that it contains a cis-acting element that induces intensive expression of the TCTP gene in meristem of the root or inhibits the expression of the TCTP gene in other tissues.

The 0.3K promoter does not contain any recognizable cis-acting elements except for the TATA box, but exhibits strong regulatory activity in reporter gene expression. Of particular importance is the expression of reporter genes in the meristem of the roots. This property is very useful for the selective expression of desirable genes, particularly those related to root growth and development, in the meristem of the roots.

Relative Strength of TCTP Promoter

By comparing the GUS activity of the transgenic plant comprising the promoter fusion with the GUS activity of the transgenic plant comprising the control promoter fusion, more precise analysis of the regulatory function of the promoter during expression of the structural gene under control of the promoter can do. For more accurate measurements, experimental and control gene transgenic plants inserted the same number of promoter fusions.

10-15 homozygous lines were isolated from transgenic Arabidopsis plants infected with each TCTP promoter fusion as well as transgenic Arabidopsis plants with 35S promoter fusions. Next, Southern blot analysis was performed using genomic DNAs to determine the insertion numbers in each transgenic plant. Since the parental arabidopsis plants have the unique TCTP promoter used in the present invention, the copy number of the GUS sequence was used rather than the copy number of the TCTP promoter sequence. Genomic DNAs were digested with restriction enzymes of EcoR I and Hind III, which were not shown in the GUS sequence, and the digested DNAs were transferred to a membrane to perform agarose gel. The membrane was then experimented with radio-labeled GUS sequences to select transgenic plants with a single insert. The transgenic plants were grown for 9 days under light, and the whole seed was used for fluorescence GUS activity analysis. A crude extract was prepared and measured for GUS activity according to standard methods (Kim and Guiltinan 1999; Jefferson 1998). One result is shown in FIG.

All tested TCTP promoters showed about 25-38% higher GUS activity than the 35S promoter. The 0.3K TCTP promoter was also stronger than the control promoter. The 2K TCTP promoter was shown to have the lowest activity among the TCTP promoters (FIG. 6), indicating that a sequence comprising bases of −1300 to −2000 related to the initiation codon (+1) regulates the negative for Arabidopsis TCTP transcription. Indicates that the sequence is included. These results indicate that the TCTP promoter is superior to the 35S promoter in expressing useful genes in transgenic plants. In addition, the TCTP promoter has the added benefit of being able to express high levels of useful genes at the top of rapidly growing roots.

As described above, according to the present invention, there is an advantage in that plants can be manipulated to mass produce biologically important substances and to promote growth and development or to adapt to environmental changes.

Claims (5)

Binding a nucleic acid molecule with a cloning vector under the control of a TCTP promoter comprising the nucleotide sequence shown in SEQ ID NO: 1, introducing the cloning vector into a plant cell to transform the plant cell, and growing the transformed plant cell Including the step of, Gene expression plant, characterized in that for expressing a gene. Using arabidopsis genomic DNA as a template and separating a TCTP promoter sequence comprising the nucleotide sequence shown in SEQ ID NO: 1 from arabidopsis by said PCR using a pair of specific PCR primers. A transgenic plant cell expressing a gene under the control of a TCTP promoter that is isolated from the 5 ′ non-transcribed region of the Arabidopsis translational regulatory tumor protein (TCTP) gene having the nucleotide sequence shown in SEQ ID NO: 1. 4. The transgenic plant of claim 3, wherein the plant is pea, arabidopsis, tobacco or Japanese morning glory. Seed, leaf, stem, cotyledon and root of the transgenic plant of claim 4.