KR102048812B1 - DNA aptamer binding specifically to dengue virus envelope protein domain III(DENV EDIII) and uses thereof - Google Patents

Abstract

The present invention relates to a DNA aptamer specifically binding to dengue virus envelope protein domain III (DENV EDIII), a composition for diagnosing dengue fever including the same, and a kit for diagnosing dengue fever. As a result of an example research for developing a novel biomarker for diagnosing dengue fever, the present inventors confirm that a DNA aptamer having a binding ability specific to DENV EDIII has strong binding ability and excellent specificity with respect to DENV EDIII, and therefore, the present invention is expected to be useful in developing a composition for diagnosing dengue fever, a kit for diagnosing dengue fever, and the like, since excellent stability compared to an ELISA method using an existing antibody can be expected.

Description

DNA aptamer binding specifically to dengue virus envelope protein domain III (DENV EDIII) and uses according to DNA aptamer binding specifically to dengue virus EDIII

The present invention relates to a DNA aptamer specifically binding to Dengue virus envelope protein domain III (DENV EDIII), dengue fever diagnostic composition, dengue fever diagnostic kit comprising the same.

Dengue fever is a severe flu-like illness. Dengue viruses belong to flaviviruses such as yellow fever virus and have structural and pathological similarities. Symptoms include fever, severe headache, pain in muscles and joints, and inflammation of the lymph nodes. Dengue fever has a low mortality rate in itself, but there are risks of complications such as hypothermia and hemorrhagic vomiting. There are four types of antigens for dengue virus, and subsequent infections with other types of antigens can be dangerous. About 40% of the world's population is at risk of dengue virus infection, with more than 1 million dengue virus infections every year. Many of the approximately 500,000 patients with gastric toxicity are children, and 2.5% of those who die die. It is mainly transmitted by white line mosquitoes.

Dengue virus envelope protein domain III (DENV EDIII) is a domain III region located on the surface protein of dengue virus, and a flavivirus to which the dengue virus belongs is contained within a capsid protein. Genomic RNA is located, and the outer surface is surrounded by a dimer of membrane (E) protein and a membrane protein (Mmbrane (M) protein). The outermost envelope protein of flavivirus antigen is composed of domains I, II, and III. Among these, domain III is a binding site for viral receptors. have. domain III is highly antigenic and has a linear epitope recognized by virus-neutralizing single antibodies. Diseases of the same flaviviruses have difficulty in serological diagnosis because of strong antigen-crossing reactions between viruses. For example, most infections have been misdiagnosed by the cross-reaction between dengue fever, yellow fever, and St. Louis encephalitis. In order to solve this problem, the sequence of domain III, which has distinct characteristics in viruses of the same genus, has attracted attention.

Currently, tropical endemic diseases such as dengue fever are diagnosed by symptom-based diagnosis, infectious agent detection using polymerase chain reaction (PCR), and immunodiagnosis using antigen-antibody reactions. Existing methods, however, are not widely used as a cost issue in poor countries with poor health care facilities, or fall short of adequate measures of sensitivity and screening. It is necessary to overcome the limitations of existing diagnostic methods and to develop a platform for detecting alienation diseases that can be used in poor countries.

On the other hand, aptamers have been developed recently because of their high affinity for certain substances and their stability, and their application to therapeutics and diagnostic sensors using them is actively underway. Because the synthesis of aptamers is possible in a relatively simple manner and can target cells, proteins and even small organic substances, it is possible to develop new detection methods using them, and its specificity and stability are much higher than that of the already developed antibodies. The development of therapeutics, drug delivery systems, and diagnostic biosensors is possible.

Therefore, in order to develop an alienation disease detection platform, diagnosis of dengue fever using a new biomarker has been the subject of major challenges, and research on this has been made, but it is still inadequate.

Republic of Korea Patent Publication 10-1520084

The present invention has been made to solve the above problems, to determine the specific binding capacity of the DNA aptamer prepared for the dengue virus EDIII (Dengue virus envelope protein domain III; DENV EDIII) prepared in the present invention The invention was completed.

Accordingly, an object of the present invention is a DNA aptamer specifically binding to Dengue virus envelope protein domain III (DENV EDIII), the DNA aptamer is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 4, DNA To provide an aptamer.

In addition, another object of the present invention is to provide a dengue diagnosis composition or dengue diagnosis kit comprising a DNA aptamer.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned can be clearly understood by those skilled in the art from the following description. There will be.

In order to achieve the object of the present invention as described above, the present invention is a DNA aptamer specifically binding to Dengue virus EDIII (Dengue virus envelope protein domain III; DENV EDIII), the DNA aptamer is the nucleotide sequence of SEQ ID NO: 4 It provides a DNA aptamer, characterized in that consisting of.

In one embodiment of the present invention, the DENV EDIII may be a domain protein contained on the surface of the dengue virus antigen (antigen).

The present invention also provides a dengue diagnosis composition comprising a DNA aptamer.

The present invention also provides a dengue diagnosis kit comprising a DNA aptamer.

The present inventors earnestly studied to develop a new biomarker for the diagnosis of Dengue fever, DNA aptamer (DNA) having a specific binding capacity to Dengue virus envelope protein domain III (DENV EDIII) It was confirmed that Aptamer) has strong binding capacity and excellent specificity with DENV EDIII, and thus, it can be expected to be more stable than the ELISA method using an existing antibody, so it can be usefully used in the development of dengue diagnosis compositions and dengue diagnosis kits. It is expected to be.

1 is a graph showing the result of confirming the binding degree (%) of ssDNA (single strand DNA) and DENV EDIII and proceeding the selection process.
Figure 2 shows the result of confirming the Kd value for the DV4 aptamer sequence through fluorescence measurement.
Figure 3 shows the results of confirming the binding of the DV1, DV2, DV3, DV4 aptamer with the DENV EDIII protein by EMSA (Electrophoric Mobility Shift Assay) method.

The present inventors earnestly studied to develop a new biomarker for the diagnosis of Dengue fever, DNA aptamer (DNA) having a specific binding capacity to Dengue virus envelope protein domain III (DENV EDIII) Aptamer) confirmed that there is a strong binding force and excellent specificity with DENV EDIII, and completed the present invention.

Hereinafter, the present invention will be described in detail.

In one embodiment of the present invention, the aptamer for DENV EDIII was searched using SELEX, and the sequence and structure of the DV4 aptamer were analyzed and confirmed (see Example 1), and DENV EDIII and pressure were measured using fluorescence measurements. The binding force between the timers was measured (see Example 2).

Accordingly, the present invention provides a DNA aptamer that specifically binds to DENV EDIII.

As used herein, the term "Dengue virus envelope protein domain III (DENV EDIII)" is a domain III portion located on the dendritic virus surface protein. Genomic RNA is located inside the capsid protein and has a structure surrounded by the dimer and membrane protein of the envelope (E) protein on the outside. . The outermost envelope protein of flavivirus antigen is composed of domains I, II, and III. Among these, domain III is a binding site for viral receptors. have. Domain III is highly antigenic and has a linear epitope recognized by virus-neutralizing single antibodies. Diseases of the same flaviviruses have difficulty in serological diagnosis because of strong antigen-crossing reactions between viruses. For example, most infections have been misdiagnosed by the cross-reaction between dengue fever, yellow fever, and St. Louis encephalitis. In order to solve this problem, the sequence of domain III, which has distinctive characteristics in the same genus virus, is attracting attention. Therefore, dengue fever can be effectively diagnosed through detection of DENV EDIII, and dengue virus EDIII is a dengue virus antigen (antigen). It may be a domain protein included in the surface of), but is not limited thereto.

As used herein, the term "aptamer" refers to single-stranded DNA (ssDNA) or RNA having high specificity and affinity for a specific substance. The method using an antibody developed in the past is relatively time-consuming and expensive because it is made by using the immune system of a living body, and its stability may be a problem because it is a protein. Since it is possible with a simple method and can be a target material even for cells, proteins, and even small organic substances, it is possible to develop new detection methods using the same, and the specificity and stability thereof are much higher than that of the already developed antibody. DNA aptamer was used for specific detection of EDIII. Any DNA (ssDNA) or RNA capable of specific detection of DENV EDIII may correspond to the aptamer of the present invention, and may be preferably composed of the nucleotide sequence of SEQ ID NO: 4, but is not limited thereto.

The present invention also provides a dengue fever diagnostic composition comprising the DNA aptamer.

The composition of the present invention may further comprise a pharmacologically or physiologically acceptable carrier, excipient, and diluent in addition to the DNA aptamer. It may also be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral formulations, external preparations, suppositories, and sterile injectable solutions according to conventional methods.

Carriers, excipients, and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, mineral oil and the like. In formulating the composition, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.

The present invention also provides a dengue diagnosis kit comprising the DNA aptamer.

The kit includes an aptamer of the invention that specifically binds to DENV EDIII, to which aptamers can be attached detection markers, such as biotin residues, which are widely used in the art. The labeling material may be introduced into the biotin-attached aptamer, and then used to detect, quantify, and diagnose DENV EDIII. As a label used in biotin, various known analytical labels may be used, and for example, fluorescence analysis may be performed using streptavidin, avidin, Cy3, Cy5, Alexa, BODIPY, Rhodamine or Q-dot. Can be. In addition, in addition to biotin residues, the aptamer for DENV EDIII detection can be labeled with conventional labeling materials, such as other fluorescent materials, magnetic materials, dyes, enzymes, radioisotopes, and the like. microscope,

It can be detected through radioimmnodetection (RAID).

In addition, the kit is a variety of tools or reagents that can be used to qualitatively or quantitatively determine the binding of DENV EDIII to aptamers in a sample. It may further include.

In the present invention, the substrate to which the aptamer is fixed may be selected from the group consisting of a polymer, glass, gold, paper, and a membrane as a solid substrate. More specifically, polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluorine resin, agarose, cellulose, nitrocellulose, dextran, Sephadex, sepharose, liposome, carboxymethyl cellulose, polyacrylamide, Polyester, pam, filter paper, ion exchange resin, plastic film, plastic tube, polyamine-methyl vinyl-ether-maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, metal, glass, glass beads, or Magnetic particles and the like can be used. Other solid substrates may include cell culture plates, ELISA plates, tubes, polymeric membranes, and the like. The substrate may have any possible form, for example, spherical (bead), cylindrical (test tube or well surface), planar (sheet, test strip), more preferably multi-well plate (eg, 24 wells). , 96 well, 192 well, 384 well, 576 well, etc.) can be used.

Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

EXAMPLE  One. SELEX  Used DENV On EDIII  About Aptamer  quest

1-1. single strand DNA (ssDNA) Preparation of the Library

Synthesized library having a binding sequence of primers for PCR amplification and cloning at both ends and 90 sequences including 40 random DNA base sequences (5'-CACCTAATACGACTCACTATAGCGGATCCGA-N40-CTGGCTCGAACAAGCTTGC-3 '; SEQ ID NO: 1) Was designed. In addition, the reverse primer (5'-) combined with the forward primer (5'-CACCTAATACGACTCACTATAGCGGA-3; SEQ ID NO: 2), reverse primer (5'-GCAAGCTTGTTCGAGCCAG-3 '; SEQ ID NO: 3) and biotin for PCR amplification and ssDNA production Biotin-GCAAGCTTGTTCGAGCCAG-3 ') was used. All oligonucleotides used herein were synthesized and PAGE purified by Bionics (Korea).

1-2. DENV Of EDIII Ni - NTA  magnetism On the bead  Immobilization

Purified DENV EDIII was coated on the surface with cobalt and fixed to bead using Dynabeads (Invitrogen, Norway), a magnetic bead that binds to the His-tag of the protein.

Specifically, 1000 pmole and 15 ul of bead dissolved in 100 uL of protein binding buffer (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl ₂ , pH 8.0) were washed with a binding buffer using an external magnet. The reaction was fixed at room temperature for 1 hour at room temperature.

1-3. DENV On EDIII  Specific Aptamer  Selection

Magnetic separations were performed to select aptamers specific for DENV EDIII.

Specifically, for the most stable structure formation of ssDNA, ssDNA library (500 pmole) dissolved in 100 uL binding buffer was incubated at 90 ° C. for 3 minutes and then incubated at 4 ° C. for 30 minutes. Thereafter, the reaction was performed for 1 hour while gently shaking with DENV EDIII immobilized on the magnetic bead. The bead was then washed twice with binding buffer to remove ssDNA that did not bind DENV EDIII bound to the bead.

Thereafter, the protein and ssDNA were separated from the magnetic bead using elution buffer (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl ₂ , 0.01% tween 20, 300 mM immidazole, pH 8.0). Binding ssDNA eluted. The eluted ssDNA was precipitated with ethanol, dissolved in 60 uL of distilled water, and then amplified by PCR using i-pfu polymerase (Intron Biotechnology, Korea) using a reverse primer combined with a forward primer and biotin. To generate ssDNA for the next screening process, biotin-coupled PCR products were combined with streptavidin-coated magnetic beads that bind biotin to the coupling buffer (5 mM Tris-HCl, 0.5 mM EDTA, 1). M NaCl, 0.005% tween 20, pH 7.5) was incubated for 1 hour. After culturing, only ssDNA was incubated for 10 minutes with 100 ul of 100 mM NaOH to separate only ssDNA. In addition, the selection was repeated using the first selected ssDNA for the next selection. At this time, the amount of ssDNA and the concentration of DENV EDIII were further reduced for strict screening. The concentration of ssDNA eluted in repeated screening was measured by UV spectrophotometer (UV spectrometer, Biochrom Libra S22 spectromether) to determine the remaining DENV of ssDNA. The screening process was performed by checking the degree of binding to EDIII. The degree of binding (%) is as shown in FIG.

1-4. Aptamer  Sequencing and Structural Analysis

The 11 th repeated selected ssDNA was amplified by PCR using an unmodified forward primer and a reverse primer, cloned into a pENTR / TOPO vector (TOPO TA Cloning kit, Invitrogen, USA), and then E. coli TOP10 cells. (Invitrogen, USA). Clones into which ssDNA was inserted were purified using a miniprep kit (GeneAll, Korea), and then sequenced (COSMO Genetech, Korea). As a result, the sequence shown in Table 1 could be analyzed.

Aptamer Sequences (5 'to 3') Length (bases) DV4 CACCTAATACGACTCACTATAGCGGATACGAGGGAGAGTCGG
ATGGGGTGGTTGTGTTAGGTGTAGTGGGTCTGGCTCGAACAAGCTTGC 90

EXAMPLE  2. Proteins using fluorescence measurements Aptamer  Binding force between

400 pmole of DENV EDIII was mixed with 10 uL of magnetic beads (megnetic bead), and then incubated in 100 uL of binding buffer (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2, pH 8.0) for 1 hour. Wash twice with binding buffer to separate unbound DENV EDIII. Thereafter, the cells were incubated with various concentrations of 6-FAM-labeled aptamer for 1 hour, and unbound aptamers were removed by washing. The amount of 6-FAM-labeled ssDNA aptamer bound to DENV EDIII-fixed magnetic beads was measured by fluorescence by separating only 6-FAM-labeled ssDNA bound to DENV EDIII using a magnet (1420 Victor multilabel counter, PerkinElmer, USA). As a result, as shown in FIG. 2 and Table 2 below, the kd value of the DNA aptamer of the DV4 nucleotide sequence could be measured.

Aptamer Kd  (nM) DV4 44.0 ± 10.1 nM

EXAMPLE  3. EMSA  Used DENV On EDIII  For binding

In order to measure whether the DV4 aptamer selected through the SELEX (Systematic Evolution of Ligands by Exponential enrichment) technique of Example 1 binds to the actual DENV EDIII, the inventors confirmed the presence or absence of binding through the EMSA (Electrophoric Mobility Shift Assay) method. It was. Recombinant DENV EDIII 5uM and aptamer DV1, DV2, DV3, DV4 1uM was incubated in 20uL binding buffer for 1 hour at room temperature, and then run on 6% acrylamide gel. As a result of sybr green and coomassie blue staining, as shown in FIG. 3, the developed DV4 aptamer was found to bind better to DENV EDIII than other aptamers.

For reference, the sequence list of the present invention is shown in Table 3 below.

Sequence Listing designation order SEQ ID NO: 1 ssDNA library CACCTAATACGACTCACTATAGCGGATCCGA-N40-CTGGCTCGAACAAGCTTGC SEQ ID NO: 2 Forward primer cacctaatac gactcactat agcgga SEQ ID NO: 3 Reverse primer gcaagcttgt tcgagccag SEQ ID NO: 4 DV4 Aptamer CACCTAATACGACTCACTATAGCGGATACGAGGGAGAGTCGG
ATGGGGTGGTTGTGTTAGGTGTAGTGGGTCTGGCTCGAACAAGCTTGC

The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it is to be understood that the embodiments described above are exemplary in all respects and not restrictive.

<110> POSTECH Academy-industry Foundation & MD Healthcare Inc. <120> DNA aptamer binding specifically to dengue virus envelope protein          domain III (DENV EDIII) and uses <130> MP18-243 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> ssDNA library <400> 1 cacctaatac gactcactat agcggatccg annnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nctggctcga acaagcttgc 90 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 2 cacctaatac gactcactat agcgga 26 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 3 gcaagcttgt tcgagccag 19 <210> 4 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> DV4 Aptamer <400> 4 cacctaatac gactcactat agcggatacg agggagagtc ggatggggtg gttgtgttag 60 gtgtagtggg tctggctcga acaagcttgc 90

Claims (4)

A dengue fever diagnostic composition comprising a DNA aptamer specifically binding to Dengue virus envelope protein domain III (DENV EDIII),
The DNA aptamer is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 4,
The dengue virus EDIII is a protein comprising a domain protein contained on the surface of a dengue virus antigen (antigen), dengue fever diagnostic composition.
delete A dengue diagnostic kit comprising a DNA aptamer specifically binding to Dengue virus envelope protein domain III (DENV EDIII),
The DNA aptamer is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 4,
The dengue virus EDIII is a dengue virus diagnostic kit, characterized in that the protein comprising a domain protein contained on the surface of the dengue virus antigen (antigen).

delete

Images