KR102048812B1 - DNA aptamer binding specifically to dengue virus envelope protein domain III(DENV EDIII) and uses thereof - Google Patents
DNA aptamer binding specifically to dengue virus envelope protein domain III(DENV EDIII) and uses thereof Download PDFInfo
- Publication number
- KR102048812B1 KR102048812B1 KR1020180165204A KR20180165204A KR102048812B1 KR 102048812 B1 KR102048812 B1 KR 102048812B1 KR 1020180165204 A KR1020180165204 A KR 1020180165204A KR 20180165204 A KR20180165204 A KR 20180165204A KR 102048812 B1 KR102048812 B1 KR 102048812B1
- Authority
- KR
- South Korea
- Prior art keywords
- ediii
- denv
- dengue virus
- dna aptamer
- aptamer
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
- G01N2333/08—RNA viruses
- G01N2333/18—Togaviridae; Flaviviridae
- G01N2333/183—Flaviviridae, e.g. pestivirus, mucosal disease virus, bovine viral diarrhoea virus, classical swine fever virus (hog cholera virus) or border disease virus
- G01N2333/185—Flaviviruses or Group B arboviruses, e.g. yellow fever virus, japanese encephalitis, tick-borne encephalitis, dengue
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
Description
본 발명은 뎅기 바이러스 EDIII (Dengue virus envelope protein domain III; DENV EDIII)에 특이적으로 결합하는 DNA 압타머, 이를 포함하는 뎅기열 진단용 조성물, 뎅기열 진단 키트에 관한 것이다.The present invention relates to a DNA aptamer specifically binding to Dengue virus envelope protein domain III (DENV EDIII), dengue fever diagnostic composition, dengue fever diagnostic kit comprising the same.
뎅기열은 극심한 독감과 같은 증상을 보이는 질병이다. 뎅기 바이러스는 황열 바이러스와 같은 플라비바이러스(flavivirus)에 속하며 구조적, 병리학적 유사성을 보인다. 발열, 심각한 두통, 근육 및 관절의 통증, 임파선 염증 등의 증상이 나타난다. 뎅기열은 그 자체로는 사망율이 낮으나, 저체온증이나 출혈성 구토 등의 합병증을 동반할 위험성이 있다 뎅기 바이러스에는 네 가지의 항원형이 있으며 다른 종류의 항원에 의한 연속적인 감염은 위독한 상태로 진행될 수 있다. 세계 인구의 약 40%가 뎅기 바이러스 감염 위험에 노출되어 있으며, 매년마다 100만 건 이상의 뎅기 바이러스 감염이 발생한다. 약 50만 명의 위독성 환자들 중 상당수는 아이들이며, 발병한 환자들 중 2.5%가 사망한다. 주로 흰줄숲모기에 의해 전파된다.Dengue fever is a severe flu-like illness. Dengue viruses belong to flaviviruses such as yellow fever virus and have structural and pathological similarities. Symptoms include fever, severe headache, pain in muscles and joints, and inflammation of the lymph nodes. Dengue fever has a low mortality rate in itself, but there are risks of complications such as hypothermia and hemorrhagic vomiting. There are four types of antigens for dengue virus, and subsequent infections with other types of antigens can be dangerous. About 40% of the world's population is at risk of dengue virus infection, with more than 1 million dengue virus infections every year. Many of the approximately 500,000 patients with gastric toxicity are children, and 2.5% of those who die die. It is mainly transmitted by white line mosquitoes.
한편, 뎅기 바이러스 EDIII(Dengue virus envelope protein domain III; DENV EDIII)은 뎅기 바이러스의 표면 단백질에 위치하는 도메인 III(domain III)부분으로, 뎅기 바이러스가 속하는 플라비바이러스는 캡시드 단백질(capsid protein) 내부에 게놈 RNA(genomic RNA)가 위치하며, 바깥쪽을 표면(envelope; E) 단백질의 다이머(dimer)와 막 단백질(membrane(M) protein)이 둘러싸고 있는 구조를 가지고 있다. 플라비바이러스 항원의 가장 바깥쪽에 위치하는 envelope protein은 domain I, Ⅱ, III로 구성되어 있으며, 이 중 domain III는 바이러스 수용체가 결합하는 위치로, 혈청을 이용한 진단과 면역 연구의 주요한 타겟으로 주목받고 있다. domain III는 매우 항원적 특성이 강하며 바이러스-중화(virus-neutralizing) 단일 항체에 의해 인식되는 선형의 에피톱을 가지고 있다. 같은 플라비바이러스 속의 질병들은 바이러스 사이의 항원-교차반응이 강하므로 혈청학적 진단에 어려움이 있다. 그 일례로, 3 유형 뎅기열, 황열, 그리고 세인트루이스 뇌염 사이의 교차 반응에 의해 대부분의 감염이 오진단 되었다는 보고도 있다. 이러한 문제를 해결하기 위해, 같은 속의 바이러스에서도 뚜렷하게 구분되는 특성을 가지는 domain III의 서열이 주목 받고 있다.Dengue virus envelope protein domain III (DENV EDIII) is a domain III region located on the surface protein of dengue virus, and a flavivirus to which the dengue virus belongs is contained within a capsid protein. Genomic RNA is located, and the outer surface is surrounded by a dimer of membrane (E) protein and a membrane protein (Mmbrane (M) protein). The outermost envelope protein of flavivirus antigen is composed of domains I, II, and III. Among these, domain III is a binding site for viral receptors. have. domain III is highly antigenic and has a linear epitope recognized by virus-neutralizing single antibodies. Diseases of the same flaviviruses have difficulty in serological diagnosis because of strong antigen-crossing reactions between viruses. For example, most infections have been misdiagnosed by the cross-reaction between dengue fever, yellow fever, and St. Louis encephalitis. In order to solve this problem, the sequence of domain III, which has distinct characteristics in viruses of the same genus, has attracted attention.
현재 뎅기열과 같은 열대 풍토성 질환은 증상에 기반한 진단, 중합효소 연쇄반응(PCR)을 이용한 감염체 검출, 항원-항체 반응을 이용한 면역진단법 등에 의해 진단되고 있다. 그러나 현존하는 방법들은 의료 시설이 열악한 빈곤 국가에서는 비용 상의 문제로 널리 쓰이지 못하거나, 또는 민감도·선별도 등의 척도에서 적합한 수준에 미달되어 있다. 기존의 진단법이 갖는 한계를 극복하고 빈곤 국가에서 실제로 활용될 수 있는 소외질환 검출 플랫폼을 개발하는 것이 요구된다.Currently, tropical endemic diseases such as dengue fever are diagnosed by symptom-based diagnosis, infectious agent detection using polymerase chain reaction (PCR), and immunodiagnosis using antigen-antibody reactions. Existing methods, however, are not widely used as a cost issue in poor countries with poor health care facilities, or fall short of adequate measures of sensitivity and screening. It is necessary to overcome the limitations of existing diagnostic methods and to develop a platform for detecting alienation diseases that can be used in poor countries.
한편, 압타머는 특정물질에 대한 친화도가 매우 높고 안정하기 때문에 최근 많이 개발되고 있고 이를 이용한 치료제 및 진단용 센서로의 응용이 활발히 진행되고 있다. 압타머의 합성은 비교적 단순한 방법으로 가능하고 세포, 단백질 그리고 작은 유기물질까지도 표적물질이 될 수 있기 때문에 이를 이용한 새로운 검출방법들의 개발이 가능하며 그 특이성 및 안정성이 이미 개발되어 있는 항체에 비해 매우 높기 때문에 치료제 개발 및 약물전달 시스템, 진단용 바이오센서로의 응용이 가능하다.On the other hand, aptamers have been developed recently because of their high affinity for certain substances and their stability, and their application to therapeutics and diagnostic sensors using them is actively underway. Because the synthesis of aptamers is possible in a relatively simple manner and can target cells, proteins and even small organic substances, it is possible to develop new detection methods using them, and its specificity and stability are much higher than that of the already developed antibodies. The development of therapeutics, drug delivery systems, and diagnostic biosensors is possible.
따라서, 소외 질환 검출 플랫폼을 개발하기 위해, 신규 바이오 마커를 이용한 뎅기열의 진단이 주요한 과제의 대상이 되고 있고, 이에 대한 연구가 이루어지고 있으나, 아직 미비한 실정이다.Therefore, in order to develop an alienation disease detection platform, diagnosis of dengue fever using a new biomarker has been the subject of major challenges, and research on this has been made, but it is still inadequate.
본 발명은 상기와 같은 문제점을 해결하기 위해 안출된 것으로, 본 발명에서 제조된 DNA 압타머의 뎅기 바이러스 EDIII(Dengue virus envelope protein domain III; DENV EDIII)에 대한 특이적인 결합능을 확인하고 이에 기초하여 본 발명을 완성하게 되었다.The present invention has been made to solve the above problems, to determine the specific binding capacity of the DNA aptamer prepared for the dengue virus EDIII (Dengue virus envelope protein domain III; DENV EDIII) prepared in the present invention The invention was completed.
이에, 본 발명의 목적은 뎅기 바이러스 EDIII(Dengue virus envelope protein domain III; DENV EDIII)에 특이적으로 결합하는 DNA 압타머로서, 상기 DNA 압타머는 서열번호 4의 염기서열로 이루어지는 것을 특징으로 하는, DNA 압타머를 제공하는 것이다.Accordingly, an object of the present invention is a DNA aptamer specifically binding to Dengue virus envelope protein domain III (DENV EDIII), the DNA aptamer is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 4, DNA To provide an aptamer.
또한, 본 발명의 다른 목적은 DNA 압타머를 포함하는, 뎅기열 진단용 조성물 또는 뎅기열 진단키트를 제공하는 것이다.In addition, another object of the present invention is to provide a dengue diagnosis composition or dengue diagnosis kit comprising a DNA aptamer.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned can be clearly understood by those skilled in the art from the following description. There will be.
상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 뎅기 바이러스 EDIII(Dengue virus envelope protein domain III; DENV EDIII)에 특이적으로 결합하는 DNA 압타머로서, 상기 DNA 압타머는 서열번호 4의 염기서열로 이루어지는 것을 특징으로 하는, DNA 압타머를 제공한다.In order to achieve the object of the present invention as described above, the present invention is a DNA aptamer specifically binding to Dengue virus EDIII (Dengue virus envelope protein domain III; DENV EDIII), the DNA aptamer is the nucleotide sequence of SEQ ID NO: 4 It provides a DNA aptamer, characterized in that consisting of.
본 발명의 일 구현 예로서, 상기 DENV EDIII는 뎅기 바이러스 항원(antigen)의 표면에 포함되는 도메인 단백질일 수 있다.In one embodiment of the present invention, the DENV EDIII may be a domain protein contained on the surface of the dengue virus antigen (antigen).
또한, 본 발명은 DNA 압타머를 포함하는, 뎅기열 진단용 조성물을 제공한다.The present invention also provides a dengue diagnosis composition comprising a DNA aptamer.
또한, 본 발명은 DNA 압타머를 포함하는, 뎅기열 진단 키트를 제공한다.The present invention also provides a dengue diagnosis kit comprising a DNA aptamer.
본 발명자들은 뎅기열(Dengue fever)의 진단을 위한 신규 바이오 마커를 개발하기 위해 예의 연구한 결과, 뎅기 바이러스 EDIII(Dengue virus envelope protein domain III; DENV EDIII)에 대하여 특이적인 결합능을 갖는 DNA 압타머(DNA Aptamer)가 DENV EDIII와의 강한 결합력과 우수한 특이성이 있다는 것을 확인하였는 바, 기존의 항체를 이용한 ELISA 방법보다 뛰어난 안정성을 기대할 수 있으므로, 뎅기열 진단용 조성물, 뎅기열 진단 키트 등의 개발 시에 유용하게 이용될 수 있을 것으로 기대된다.The present inventors earnestly studied to develop a new biomarker for the diagnosis of Dengue fever, DNA aptamer (DNA) having a specific binding capacity to Dengue virus envelope protein domain III (DENV EDIII) It was confirmed that Aptamer) has strong binding capacity and excellent specificity with DENV EDIII, and thus, it can be expected to be more stable than the ELISA method using an existing antibody, so it can be usefully used in the development of dengue diagnosis compositions and dengue diagnosis kits. It is expected to be.
도 1은 ssDNA(single strand DNA)와 DENV EDIII의 결합 정도(%)를 확인하고, 선별 과정을 진행한 결과를 나타낸 그래프이다.
도 2는 DV4 압타머 서열에 대한 Kd 값을 형광측정을 통하여 확인한 결과를 나타낸 것이다.
도 3은 DV1, DV2, DV3, DV4 압타머의 DENV EDIII 단백질과의 결합여부를 EMSA(Electrophoric Mobility Shift Assay) 방법을 통하여 확인한 결과를 나타낸 것이다.1 is a graph showing the result of confirming the binding degree (%) of ssDNA (single strand DNA) and DENV EDIII and proceeding the selection process.
Figure 2 shows the result of confirming the Kd value for the DV4 aptamer sequence through fluorescence measurement.
Figure 3 shows the results of confirming the binding of the DV1, DV2, DV3, DV4 aptamer with the DENV EDIII protein by EMSA (Electrophoric Mobility Shift Assay) method.
본 발명자들은 뎅기열(Dengue fever)의 진단을 위한 신규 바이오 마커를 개발하기 위해 예의 연구한 결과, 뎅기 바이러스 EDIII(Dengue virus envelope protein domain III; DENV EDIII)에 대하여 특이적인 결합능을 갖는 DNA 압타머(DNA Aptamer)가 DENV EDIII와의 강한 결합력과 우수한 특이성이 있다는 것을 확인하고, 본 발명을 완성하였다.The present inventors earnestly studied to develop a new biomarker for the diagnosis of Dengue fever, DNA aptamer (DNA) having a specific binding capacity to Dengue virus envelope protein domain III (DENV EDIII) Aptamer) confirmed that there is a strong binding force and excellent specificity with DENV EDIII, and completed the present invention.
이하, 본 발명에 대해 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명의 일 실시예에서는 SELEX를 이용하여 DENV EDIII에 대한 압타머를 탐색한 결과, DV4 압타머의 서열 및 구조를 분석 및 확인하였고(실시예 1 참조), 형광 측정을 이용하여 DENV EDIII와 압타머 간의 결합력을 측정하였다(실시예 2 참조).In one embodiment of the present invention, the aptamer for DENV EDIII was searched using SELEX, and the sequence and structure of the DV4 aptamer were analyzed and confirmed (see Example 1), and DENV EDIII and pressure were measured using fluorescence measurements. The binding force between the timers was measured (see Example 2).
따라서, 본 발명은 DENV EDIII에 특이적으로 결합하는 DNA 압타머를 제공한다.Accordingly, the present invention provides a DNA aptamer that specifically binds to DENV EDIII.
본 발명에서 사용되는 용어, "뎅기 바이러스 EDIII(Dengue virus envelope protein domain III; DENV EDIII)"란, 뎅기 바이러스의 표면 단백질에 위치하는 도메인 III(domain III)부분으로, 뎅기 바이러스가 속하는 플라비바이러스는 캡시드 단백질(capsid protein) 내부에 게놈 RNA(genomic RNA)가 위치하며, 바깥쪽을 표면(envelope; E) 단백질의 다이머(dimer)와 막 단백질(membrane(M) protein)이 둘러싸고 있는 구조를 가지고 있다. 플라비바이러스 항원의 가장 바깥쪽에 위치하는 envelope protein은 domain I, Ⅱ, III로 구성되어 있으며, 이 중 domain III는 바이러스 수용체가 결합하는 위치로, 혈청을 이용한 진단과 면역 연구의 주요한 타겟으로 주목받고 있다. Domain III는 매우 항원적 특성이 강하며 바이러스-중화(virus-neutralizing) 단일 항체에 의해 인식되는 선형의 에피톱을 가지고 있다. 같은 플라비바이러스 속의 질병들은 바이러스 사이의 항원-교차반응이 강하므로 혈청학적 진단에 어려움이 있다. 그 일례로, 3 유형 뎅기열, 황열, 그리고 세인트루이스 뇌염 사이의 교차 반응에 의해 대부분의 감염이 오진단 되었다는 보고도 있다. 이러한 문제를 해결하기 위해, 같은 속의 바이러스에서도 뚜렷하게 구분되는 특성을 가지는 domain III의 서열이 주목 받고 있는 바, DENV EDIII의 검출을 통해 효과적으로 뎅기열을 진단할 수 있고, 뎅기 바이러스 EDIII는 뎅기 바이러스 항원(antigen)의 표면에 포함되는 도메인 단백질일 수 있으나, 이에 제한되지 않는다.As used herein, the term "Dengue virus envelope protein domain III (DENV EDIII)" is a domain III portion located on the dendritic virus surface protein. Genomic RNA is located inside the capsid protein and has a structure surrounded by the dimer and membrane protein of the envelope (E) protein on the outside. . The outermost envelope protein of flavivirus antigen is composed of domains I, II, and III. Among these, domain III is a binding site for viral receptors. have. Domain III is highly antigenic and has a linear epitope recognized by virus-neutralizing single antibodies. Diseases of the same flaviviruses have difficulty in serological diagnosis because of strong antigen-crossing reactions between viruses. For example, most infections have been misdiagnosed by the cross-reaction between dengue fever, yellow fever, and St. Louis encephalitis. In order to solve this problem, the sequence of domain III, which has distinctive characteristics in the same genus virus, is attracting attention. Therefore, dengue fever can be effectively diagnosed through detection of DENV EDIII, and dengue virus EDIII is a dengue virus antigen (antigen). It may be a domain protein included in the surface of), but is not limited thereto.
본 발명에서 사용되는 용어, "압타머"란 특정 물질에 대해 높은 특이성과 친화도를 가지는 단일가닥 DNA(ssDNA) 또는 RNA이다. 기존에 개발되어 있는 항체를 이용한 방법은 생체의 면역시스템을 이용하여 만들어지기 때문에 비교적 많은 시간이 들고 고비용이라는 점, 단백질이기 때문에 그 안정성이 문제가 되는 경우가 있는 반면, 압타머는 합성에 있어서, 비교적 단순한 방법으로 가능하고 세포, 단백질 그리고 작은 유기물질까지도 표적물질이 될 수 있기 때문에 이를 이용한 새로운 검출방법들의 개발이 가능하며 그 특이성 및 안정성이 이미 개발되어 있는 항체에 비해 매우 높은 점에 착안하여, DENV EDIII의 특이적 검출을 위하여 DNA 압타머를 사용하였다. DENV EDIII의 특이적 검출이 가능한 DNA(ssDNA) 또는 RNA라면 모두 본 발명의 압타머에 해당할 수 있고, 바람직하게는 서열번호 4의 염기서열로 이루어질 수 있으나, 이에 제한되는 것은 아니다.As used herein, the term "aptamer" refers to single-stranded DNA (ssDNA) or RNA having high specificity and affinity for a specific substance. The method using an antibody developed in the past is relatively time-consuming and expensive because it is made by using the immune system of a living body, and its stability may be a problem because it is a protein. Since it is possible with a simple method and can be a target material even for cells, proteins, and even small organic substances, it is possible to develop new detection methods using the same, and the specificity and stability thereof are much higher than that of the already developed antibody. DNA aptamer was used for specific detection of EDIII. Any DNA (ssDNA) or RNA capable of specific detection of DENV EDIII may correspond to the aptamer of the present invention, and may be preferably composed of the nucleotide sequence of SEQ ID NO: 4, but is not limited thereto.
또한, 본 발명은 상기 DNA 압타머를 포함하는, 뎅기열 진단용 조성물을 제공한다.The present invention also provides a dengue fever diagnostic composition comprising the DNA aptamer.
본 발명의 조성물은 상기 DNA 압타머 외에 약리학적으로나 생리학적으로 허용되는 담체, 부형제, 및 희석제를 더 포함할 수 있다. 또한 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제, 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.The composition of the present invention may further comprise a pharmacologically or physiologically acceptable carrier, excipient, and diluent in addition to the DNA aptamer. It may also be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral formulations, external preparations, suppositories, and sterile injectable solutions according to conventional methods.
상기 조성물에 포함될 수 있는 담체, 부형제, 및 희석제로는 락토오스, 덱스트로오스, 수크로오스, 소르비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시 벤조에이트, 프로필히드록시 벤조에이트, 탈크, 마그네슘 스테아레이트, 및 광물유 등이 있다. 상기 조성물을 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.Carriers, excipients, and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, mineral oil and the like. In formulating the composition, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.
또한, 본 발명은 상기 DNA 압타머를 포함하는, 뎅기열 진단 키트를 제공한다.The present invention also provides a dengue diagnosis kit comprising the DNA aptamer.
상기 키트는 DENV EDIII에 특이적으로 결합하는 본 발명의 압타머를 포함하고 있으며, 압타머에는 당업계에 널리 사용되는 검출 표지들, 예를 들어 바이오틴 잔기가 부착될 수 있다. 바이오틴이 부착된 압타머에 표지물질을 도입한 다음, 이의 분석을 통해 DENV EDIII의 검출, 정량 및 진단에 이용할 수 있다. 바이오틴에 사용되는 표지물질로서 다양한 공지된 분석용 표지물질이 사용될 수 있으며, 예를 들면, 스트렙타비딘, 아비딘, Cy3, Cy5, Alexa, BODIPY, Rhodamine 또는 Q-dot 등을 사용하여 형광분석을 할 수 있다. 또한, DENV EDIII 검출을 위한 압타머에는 바이오틴 잔기 외에도, 기타 형광물질, 자성체, 염색물질, 효소, 방사성동위원소 등과 같은 통상의 표지 물질로 표지할 수 있으며, 통상의 검출 수단, 예를 들어, 형광 현미경,The kit includes an aptamer of the invention that specifically binds to DENV EDIII, to which aptamers can be attached detection markers, such as biotin residues, which are widely used in the art. The labeling material may be introduced into the biotin-attached aptamer, and then used to detect, quantify, and diagnose DENV EDIII. As a label used in biotin, various known analytical labels may be used, and for example, fluorescence analysis may be performed using streptavidin, avidin, Cy3, Cy5, Alexa, BODIPY, Rhodamine or Q-dot. Can be. In addition, in addition to biotin residues, the aptamer for DENV EDIII detection can be labeled with conventional labeling materials, such as other fluorescent materials, magnetic materials, dyes, enzymes, radioisotopes, and the like. microscope,
Radioimmnodetection(RAID) 등을 통하여 검출할 수 있다.It can be detected through radioimmnodetection (RAID).
또한, 상기 키트는 압타머와 시료 내 DENV EDIII의 결합 여부를 정성 또는 정량적으로 측정하는데 사용할 수 있는 각종 도구 또는 시약으로서, 지지체(기재), 완충용액, 반응 정지제, 용해제, 세척제 또는 안정화제 등을 추가로 포함할 수 있다.In addition, the kit is a variety of tools or reagents that can be used to qualitatively or quantitatively determine the binding of DENV EDIII to aptamers in a sample. It may further include.
본 발명에서 압타머가 고정된 기재는, 예컨대 고체 기재로서 고분자, 유리, 금, 종이 및 생체막(membrane)으로 이루어진 군에서 선택된 것을 사용할 수 있다. 보다 구체적으로는, 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 아가로스, 셀룰로즈, 니트로셀룰로즈, 덱스트란, 세파덱스, 세파로즈, 리포솜, 카복시메틸 셀룰로즈, 폴리아크릴아미드, 폴리스테린, 반려암, 여과지, 이온교환수지, 플라스틱 필름, 플라스틱 튜브, 폴리아민-메틸 비닐-에테르-말레산 공중합체, 아미노산 공중합체, 에틸렌-말레산 공중합체, 나일론, 금속, 유리, 글래스 비드, 또는 자성 입자 등을 사용할 수 있다. 그 외의 다른 고체 기질로는 세포배양 플레이트, ELISA 플레이트, 튜브 및 폴리머성 막 등을 사용할 수 있다. 상기 기재는 임의의 가능한 형태, 예를 들어 구형(비드), 원통형(시험관 또는 웰 내면), 평면형(시트, 시험 스트립)을 가질 수 있으며, 보다 바람직하게는 멀티 웰 플레이트(예를 들어, 24웰, 96웰, 192웰, 384웰, 576웰 등)를 사용할 수 있다.In the present invention, the substrate to which the aptamer is fixed may be selected from the group consisting of a polymer, glass, gold, paper, and a membrane as a solid substrate. More specifically, polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluorine resin, agarose, cellulose, nitrocellulose, dextran, Sephadex, sepharose, liposome, carboxymethyl cellulose, polyacrylamide, Polyester, pam, filter paper, ion exchange resin, plastic film, plastic tube, polyamine-methyl vinyl-ether-maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, metal, glass, glass beads, or Magnetic particles and the like can be used. Other solid substrates may include cell culture plates, ELISA plates, tubes, polymeric membranes, and the like. The substrate may have any possible form, for example, spherical (bead), cylindrical (test tube or well surface), planar (sheet, test strip), more preferably multi-well plate (eg, 24 wells). , 96 well, 192 well, 384 well, 576 well, etc.) can be used.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.
실시예EXAMPLE 1. One. SELEX을SELEX 이용한 Used DENVDENV EDIII에On EDIII 대한 About 압타머Aptamer 탐색 quest
1-1. 1-1. ssDNA(single strand DNA)single strand DNA (ssDNA) 라이브러리의 제조Preparation of the Library
양 말단에 PCR 증폭 및 클로닝을 위한 프라이머의 결합서열을 갖고 가운데 40개의 무작위 DNA염기서열을 포함하는 90개의 서열을 가지는 합성된 라이브러리(5'-CACCTAATACGACTCACTATAGCGGATCCGA-N40-CTGGCTCGAACAAGCTTGC-3'; 서열번호 1)를 설계하였다. 또한, PCR 증폭 및 ssDNA 생성을 위하여 Forward 프라이머 (5'-CACCTAATACGACTCACTATAGCGGA-3; 서열번호 2)와 Reverse 프라이머(5'-GCAAGCTTGTTCGAGCCAG-3'; 서열번호 3) 및 비오틴이 결합된 Reverse 프라이머(5'-Biotin-GCAAGCTTGTTCGAGCCAG-3')을 사용하였다. 여기서 사용된 모든 올리고 뉴클레어티드는 바이오닉스 사(한국)에서 합성 및 PAGE 정제하였다.Synthesized library having a binding sequence of primers for PCR amplification and cloning at both ends and 90 sequences including 40 random DNA base sequences (5'-CACCTAATACGACTCACTATAGCGGATCCGA-N40-CTGGCTCGAACAAGCTTGC-3 '; SEQ ID NO: 1) Was designed. In addition, the reverse primer (5'-) combined with the forward primer (5'-CACCTAATACGACTCACTATAGCGGA-3; SEQ ID NO: 2), reverse primer (5'-GCAAGCTTGTTCGAGCCAG-3 '; SEQ ID NO: 3) and biotin for PCR amplification and ssDNA production Biotin-GCAAGCTTGTTCGAGCCAG-3 ') was used. All oligonucleotides used herein were synthesized and PAGE purified by Bionics (Korea).
1-2. 1-2. DENVDENV EDIII의Of EDIII NiNi -- NTANTA 자성 magnetism 비드에On the bead 고정화 Immobilization
정제된 DENV EDIII는 표면에 코발트로 코팅되어 있어 단백질의 His-tag과 결합하는 자성 비드 (magnetic bead)인 Dynabeads (Invitrogen, 노르웨이)를 이용하여 bead에 고정하였다. Purified DENV EDIII was coated on the surface with cobalt and fixed to bead using Dynabeads (Invitrogen, Norway), a magnetic bead that binds to the His-tag of the protein.
구체적으로 단백질 결합 버퍼 (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2, pH 8.0) 100 uL에 녹아 있는 단백질 1000 pmole과 15 ul의 bead를 외부 자석을 이용하여 결합버퍼로 세척 후, 한 시간 동안 실온에서 반응하여 bead에 고정하였다.Specifically, 1000 pmole and 15 ul of bead dissolved in 100 uL of protein binding buffer (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl 2 , pH 8.0) were washed with a binding buffer using an external magnet. The reaction was fixed at room temperature for 1 hour at room temperature.
1-3. 1-3. DENVDENV EDIII에On EDIII 특이적인 Specific 압타머Aptamer 선별 Selection
DENV EDIII에 특이적인 압타머를 선별하기 위해 자성을 이용한 특이적 분리 방법을 수행하였다. Magnetic separations were performed to select aptamers specific for DENV EDIII.
구체적으로, 먼저 ssDNA의 가장 안정한 구조형성을 위해, 100 uL의 결합 버퍼에 녹아 있는 ssDNA 라이브러리 (500 pmole)를 90℃에서 3분 동안 배양 후, 4℃에서 30분 동안 배양하였다. 그 후, 앞서 magnetic bead에 고정화된 DENV EDIII와 함께 약하게 흔들어주면서 1시간 동안 반응하였다. 그 다음, bead에 결합된 DENV EDIII과 결합하지 않는 ssDNA를 제거하기 위해 결합 버퍼로 bead를 두 번 세척하였다. Specifically, for the most stable structure formation of ssDNA, ssDNA library (500 pmole) dissolved in 100 uL binding buffer was incubated at 90 ° C. for 3 minutes and then incubated at 4 ° C. for 30 minutes. Thereafter, the reaction was performed for 1 hour while gently shaking with DENV EDIII immobilized on the magnetic bead. The bead was then washed twice with binding buffer to remove ssDNA that did not bind DENV EDIII bound to the bead.
그 후, magnetic bead에서 단백질과 결합한 ssDNA를 분리하기 위해 용출 버퍼(20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2, 0.01% tween 20, 300 mM immidazole, pH 8.0)를 이용해 단백질 및 결합 ssDNA를 용출하였다. 용출된 ssDNA는 에탄올을 이용해 침전시킨 후, 60 uL의 증류수에 용해한 다음 Forward 프라이머 및 비오틴이 결합된 Reverse 프라이머를 이용하여 i-pfu polymerase(인트론 바이오테크놀로지, 한국)를 이용하여 PCR에 의해 증폭시켰다. 다음 선별 과정을 위한 ssDNA를 생성하기 위해, 비오틴이 결합된 PCR 산물을 비오틴과 결합하는 스트렙타아비딘(streptavidin)이 코팅된 자성 비드와 함께 커플링 버퍼(5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl, 0.005% tween 20, pH 7.5)조건에서 1시간 배양하였다. 배양 후 ssDNA만을 분리하기 위해 100 ul의 100 mM NaOH와 10분 동안 배양하였고, 외부 자석을 이용해 선별된 ssDNA만을 얻을 수 있었다. 또한, 첫 번째 선별된 ssDNA를 다음 선별에 사용하여 선별을 반복하였다. 이때 ssDNA의 양 및 DENV EDIII의 농도는 엄격한 선별을 위해 보다 감소시키면서 진행하였으며, 반복되는 선별에서 용출된 ssDNA를 UV 분광광도계(UV spectrometer, Biochrom Libra S22 spectromether)로 농도를 측정하여 남아 있는 ssDNA의 DENV EDIII와의 결합 정도를 확인하며 선별 과정을 진행하였다. 상기 결합 정도(%)는 도 1에 나타난 바와 같다.Thereafter, the protein and ssDNA were separated from the magnetic bead using elution buffer (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl 2 , 0.01
1-4.1-4. 압타머Aptamer 서열분석 및 구조분석 Sequencing and Structural Analysis
11 번째의 반복 선별된 ssDNA는 변형되지 않은 Forward 프라이머와 Reverse 프라이머를 이용하여 PCR 과정을 통해 증폭하였고, pENTR/TOPO 벡터(TOPO TA Cloning kit, Invitrogen, 미국)에 클로닝한 후, E. coli TOP10 세포(Invitrogen, 미국)에 형질전환하였다. ssDNA가 삽입된 클론을 miniprep 키트(GeneAll, 한국)를 이용하여 정제한 후, 염기서열을 분석(COSMO Genetech, 한국)하였다. 그 결과, 하기 표1 과 같은 서열을 분석할 수 있었다.The 11 th repeated selected ssDNA was amplified by PCR using an unmodified forward primer and a reverse primer, cloned into a pENTR / TOPO vector (TOPO TA Cloning kit, Invitrogen, USA), and then E. coli TOP10 cells. (Invitrogen, USA). Clones into which ssDNA was inserted were purified using a miniprep kit (GeneAll, Korea), and then sequenced (COSMO Genetech, Korea). As a result, the sequence shown in Table 1 could be analyzed.
ATGGGGTGGTTGTGTTAGGTGTAGTGGGTCTGGCTCGAACAAGCTTGCCACCTAATACGACTCACTATAGCGGATACGAGGGAGAGTCGG
ATGGGGTGGTTGTGTTAGGTGTAGTGGGTCTGGCTCGAACAAGCTTGC
실시예EXAMPLE 2. 형광 측정을 이용한 단백질과 2. Proteins using fluorescence measurements 압타머Aptamer 간의 결합력 측정 Binding force between
400pmole의 DENV EDIII를 10uL 자성 비드(megnetic bead)와 혼합한 후, 100uL의 결합 버퍼(20mM Tris, 50mM NaCl, 5mM KCl, 5mM MgCl2, pH 8.0)에서 1시간 동안 배양하였다. 결합하지 않은 DENV EDIII를 분리하기 위해 결합 버퍼로 2번 세척하였다. 그 후 다양한 농도의 6-FAM으로 표지된 압타머와 1시간 동안 배양하고, 결합하지 않은 압타머는 세척을 통해 제거하였다. DENV EDIII가 고정된 자성 비드에 결합된 6-FAM이 표지된 ssDNA 압타머의 양은 자석을 이용하여 DENV EDIII에 결합된 6-FAM가 표지된 ssDNA만을 분리하여 형광측정(1420 Victor multilabel counter, PerkinElmer, USA)을 통해 측정하였다. 그 결과, 도 2 및 하기 표 2에 나타낸 바와 같이, DV4 염기서열이 갖는 DNA 압타머의 kd값을 측정할 수 있었다.400 pmole of DENV EDIII was mixed with 10 uL of magnetic beads (megnetic bead), and then incubated in 100 uL of binding buffer (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2, pH 8.0) for 1 hour. Wash twice with binding buffer to separate unbound DENV EDIII. Thereafter, the cells were incubated with various concentrations of 6-FAM-labeled aptamer for 1 hour, and unbound aptamers were removed by washing. The amount of 6-FAM-labeled ssDNA aptamer bound to DENV EDIII-fixed magnetic beads was measured by fluorescence by separating only 6-FAM-labeled ssDNA bound to DENV EDIII using a magnet (1420 Victor multilabel counter, PerkinElmer, USA). As a result, as shown in FIG. 2 and Table 2 below, the kd value of the DNA aptamer of the DV4 nucleotide sequence could be measured.
실시예EXAMPLE 3. 3. EMSA를EMSA 이용한 Used DENVDENV EDIII에On EDIII 대한 결합 유무 측정 For binding
상기 실시예 1의 SELEX(Systematic Evolution of Ligands by Exponential enrichment) 기법을 통해 선별된 DV4 압타머가 실제 DENV EDIII에 결합하는지 측정하기 위하여 본 발명자들은 EMSA(Electrophoric Mobility Shift Assay) 방법을 통해 결합의 유무를 확인하였다. 재조합 DENV EDIII 5uM과 압타머 DV1, DV2, DV3, DV4 1uM 을 1시간 동안 상온에서 20uL 의 결합버퍼에서 배양한 후, 6% acrylamide gel에 running하였다. sybr green과 coomassie blue 염색 결과, 도 3에 나타낸 바와 같이, 개발된 DV4 압타머는 다른 압타머에 비해 DENV EDIII에 더 잘 결합하는 것을 확인할 수 있었다.In order to measure whether the DV4 aptamer selected through the SELEX (Systematic Evolution of Ligands by Exponential enrichment) technique of Example 1 binds to the actual DENV EDIII, the inventors confirmed the presence or absence of binding through the EMSA (Electrophoric Mobility Shift Assay) method. It was. Recombinant DENV EDIII 5uM and aptamer DV1, DV2, DV3, DV4 1uM was incubated in 20uL binding buffer for 1 hour at room temperature, and then run on 6% acrylamide gel. As a result of sybr green and coomassie blue staining, as shown in FIG. 3, the developed DV4 aptamer was found to bind better to DENV EDIII than other aptamers.
참고로, 본 발명의 서열목록 리스트는 하기 표 3과 같다.For reference, the sequence list of the present invention is shown in Table 3 below.
ATGGGGTGGTTGTGTTAGGTGTAGTGGGTCTGGCTCGAACAAGCTTGCCACCTAATACGACTCACTATAGCGGATACGAGGGAGAGTCGG
ATGGGGTGGTTGTGTTAGGTGTAGTGGGTCTGGCTCGAACAAGCTTGC
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다름 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 아닌 것으로 이해해야 한다.The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it is to be understood that the embodiments described above are exemplary in all respects and not restrictive.
<110> POSTECH Academy-industry Foundation & MD Healthcare Inc. <120> DNA aptamer binding specifically to dengue virus envelope protein domain III(DENV EDIII) and uses thereof <130> MP18-243 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> ssDNA library <400> 1 cacctaatac gactcactat agcggatccg annnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nctggctcga acaagcttgc 90 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 2 cacctaatac gactcactat agcgga 26 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 3 gcaagcttgt tcgagccag 19 <210> 4 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> DV4 Aptamer <400> 4 cacctaatac gactcactat agcggatacg agggagagtc ggatggggtg gttgtgttag 60 gtgtagtggg tctggctcga acaagcttgc 90 <110> POSTECH Academy-industry Foundation & MD Healthcare Inc. <120> DNA aptamer binding specifically to dengue virus envelope protein domain III (DENV EDIII) and uses <130> MP18-243 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> ssDNA library <400> 1 cacctaatac gactcactat agcggatccg annnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nctggctcga acaagcttgc 90 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 2 cacctaatac gactcactat agcgga 26 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 3 gcaagcttgt tcgagccag 19 <210> 4 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> DV4 Aptamer <400> 4 cacctaatac gactcactat agcggatacg agggagagtc ggatggggtg gttgtgttag 60 gtgtagtggg tctggctcga acaagcttgc 90
Claims (4)
상기 DNA 압타머는 서열번호 4의 염기서열로 이루어지는 것을 특징으로 하며,
상기 뎅기 바이러스 EDIII는 뎅기 바이러스 항원(antigen)의 표면에 포함되는 도메인 단백질을 포함하는 단백질인 것을 특징으로 하는, 뎅기열 진단용 조성물.
A dengue fever diagnostic composition comprising a DNA aptamer specifically binding to Dengue virus envelope protein domain III (DENV EDIII),
The DNA aptamer is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 4,
The dengue virus EDIII is a protein comprising a domain protein contained on the surface of a dengue virus antigen (antigen), dengue fever diagnostic composition.
상기 DNA 압타머는 서열번호 4의 염기서열로 이루어지는 것을 특징으로 하며,
상기 뎅기 바이러스 EDIII는 뎅기 바이러스 항원(antigen)의 표면에 포함되는 도메인 단백질을 포함하는 단백질인 것을 특징으로 하는, 뎅기열 진단 키트.
A dengue diagnostic kit comprising a DNA aptamer specifically binding to Dengue virus envelope protein domain III (DENV EDIII),
The DNA aptamer is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 4,
The dengue virus EDIII is a dengue virus diagnostic kit, characterized in that the protein comprising a domain protein contained on the surface of the dengue virus antigen (antigen).
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020180165204A KR102048812B1 (en) | 2018-12-19 | 2018-12-19 | DNA aptamer binding specifically to dengue virus envelope protein domain III(DENV EDIII) and uses thereof |
PCT/KR2019/017998 WO2020130626A1 (en) | 2018-12-19 | 2019-12-18 | Dna aptamer binding specifically to dengue virus ediii and use thereof |
CN201980084587.XA CN113227378B (en) | 2018-12-19 | 2019-12-18 | DNA aptamer specifically bound with dengue virus EDIII and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020180165204A KR102048812B1 (en) | 2018-12-19 | 2018-12-19 | DNA aptamer binding specifically to dengue virus envelope protein domain III(DENV EDIII) and uses thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
KR102048812B1 true KR102048812B1 (en) | 2019-11-26 |
Family
ID=68731418
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020180165204A KR102048812B1 (en) | 2018-12-19 | 2018-12-19 | DNA aptamer binding specifically to dengue virus envelope protein domain III(DENV EDIII) and uses thereof |
Country Status (3)
Country | Link |
---|---|
KR (1) | KR102048812B1 (en) |
CN (1) | CN113227378B (en) |
WO (1) | WO2020130626A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020130626A1 (en) * | 2018-12-19 | 2020-06-25 | 주식회사 엠디헬스케어 | Dna aptamer binding specifically to dengue virus ediii and use thereof |
KR20230107461A (en) | 2022-01-08 | 2023-07-17 | 광운대학교 산학협력단 | Severe Dengue Fever Controlling System Using Severe Dengue Fever Diagnostic Apparatus and Controlling Method by the Same |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101520084B1 (en) | 2014-01-09 | 2015-05-29 | 주식회사 젠바디 | Rapid diagnostic kit for detecting anti-dengue virus antibodies using monoclonal antibody specific to the domain 1 of dengue envelope protein and its manufacturing method |
US20170226511A1 (en) * | 2013-11-13 | 2017-08-10 | National University Of Singapore | Aptamers for binding flavivirus proteins |
Family Cites Families (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
MX2011003588A (en) * | 2008-10-13 | 2011-10-14 | Inst Research In Biomedicine | Dengue virus neutralizing antibodies and uses thereof. |
CN102816764A (en) * | 2011-06-07 | 2012-12-12 | 浦项工科大学校产学协力团 | DNA aptamer specifically binding to human cardiac troponin I |
KR101763745B1 (en) * | 2016-01-08 | 2017-08-01 | 전북대학교산학협력단 | Monoclonal antibody against envelope domain Ⅲ of four serotype dengue virus and uses thereof |
US10551381B2 (en) * | 2016-02-11 | 2020-02-04 | Massachusetts Institute Of Technology | Anti-dengue virus NS1 protein monoclonal antibodies |
KR101837856B1 (en) * | 2016-10-18 | 2018-03-13 | 단국대학교 산학협력단 | RNA aptamers that inhibit methyltransferase activity of Dengue virus serotype 2 and 3 |
KR101837855B1 (en) * | 2016-10-18 | 2018-03-13 | 단국대학교 산학협력단 | RNA aptamers that inhibit methyltransferase activity of Dengue virus serotype 2 |
KR101923197B1 (en) * | 2017-09-25 | 2018-11-28 | 주식회사 엠디엡투스 | DNA aptamer specifically binding to ESAT6 and use thereof |
KR101923198B1 (en) * | 2017-09-25 | 2018-11-28 | 주식회사 엠디엡투스 | DNA aptamer specifically binding to TB7.7 and use thereof |
KR102016668B1 (en) * | 2018-12-19 | 2019-08-30 | 주식회사 엠디헬스케어 | DNA aptamer binding specifically to chikungunya virus envelope protein 2(CHIKV E2) and uses thereof |
KR102048812B1 (en) * | 2018-12-19 | 2019-11-26 | 주식회사 엠디헬스케어 | DNA aptamer binding specifically to dengue virus envelope protein domain III(DENV EDIII) and uses thereof |
KR101970963B1 (en) * | 2018-12-19 | 2019-04-23 | 주식회사 엠디헬스케어 | DNA aptamer binding specifically to yellow fever virus envelope protein domain III (YFV EDIII) and uses thereof |
-
2018
- 2018-12-19 KR KR1020180165204A patent/KR102048812B1/en active IP Right Grant
-
2019
- 2019-12-18 WO PCT/KR2019/017998 patent/WO2020130626A1/en active Application Filing
- 2019-12-18 CN CN201980084587.XA patent/CN113227378B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20170226511A1 (en) * | 2013-11-13 | 2017-08-10 | National University Of Singapore | Aptamers for binding flavivirus proteins |
KR101520084B1 (en) | 2014-01-09 | 2015-05-29 | 주식회사 젠바디 | Rapid diagnostic kit for detecting anti-dengue virus antibodies using monoclonal antibody specific to the domain 1 of dengue envelope protein and its manufacturing method |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020130626A1 (en) * | 2018-12-19 | 2020-06-25 | 주식회사 엠디헬스케어 | Dna aptamer binding specifically to dengue virus ediii and use thereof |
CN113227378A (en) * | 2018-12-19 | 2021-08-06 | Md保健株式会社 | DNA aptamer specifically binding with dengue virus EDIII and application thereof |
CN113227378B (en) * | 2018-12-19 | 2023-11-24 | Md保健株式会社 | DNA aptamer specifically bound with dengue virus EDIII and application thereof |
KR20230107461A (en) | 2022-01-08 | 2023-07-17 | 광운대학교 산학협력단 | Severe Dengue Fever Controlling System Using Severe Dengue Fever Diagnostic Apparatus and Controlling Method by the Same |
Also Published As
Publication number | Publication date |
---|---|
CN113227378A (en) | 2021-08-06 |
CN113227378B (en) | 2023-11-24 |
WO2020130626A1 (en) | 2020-06-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
ES2617226T3 (en) | Multiplexed trials based on aptamers | |
KR102016668B1 (en) | DNA aptamer binding specifically to chikungunya virus envelope protein 2(CHIKV E2) and uses thereof | |
US7855054B2 (en) | Multiplexed analyses of test samples | |
US9404919B2 (en) | Multiplexed analyses of test samples | |
ES2604764T3 (en) | Analysis of test samples | |
US20160202259A1 (en) | Aptamers screening method based on graphene without target immobilization and the aptamers obtained from the method | |
CN111693712A (en) | Method for detecting new coronavirus SARS-CoV-2N protein by adopting aptamer | |
CN111304208B (en) | Aptamer specifically binding to P-glycoprotein, preparation method and application thereof | |
US20230228751A1 (en) | Aptamers against sars-cov-2 | |
KR102048812B1 (en) | DNA aptamer binding specifically to dengue virus envelope protein domain III(DENV EDIII) and uses thereof | |
CN113227377B (en) | DNA aptamer specifically combined with yellow fever virus EDIII and application thereof | |
US10751359B2 (en) | Nucleic acid aptamer specifically binding to avian influenza virus subtype H5 and method of detecting avian ifluenza virus subtype H5 using the same | |
CN114127282A (en) | Method for screening aptamer and immunoassay method using aptamer | |
KR20120077154A (en) | Dna aptamer binding to kanamycin with specificity | |
CN109444414A (en) | Using the method and corresponding composition, kit of AlphaLISA detection dengue virus | |
KR101237858B1 (en) | Aptamer specific S.Enteritidis and use of the same | |
KR20120092938A (en) | Dna aptamer specifically binding to alpha-fetoprotein and its use | |
JP2022048030A (en) | Detection method and kit of target nucleic acid | |
JP2023504683A (en) | Methods of obtaining profiles for target molecular populations of samples | |
BR112021011850A2 (en) | APTAMETER, COMPLEX, BIOSENSOR OR TEST STRIP, APPLIANCE, USE, METHOD OF DETECTION, METHOD OF TREATMENT OR PREVENTION OF CANCER AND KIT | |
BR112021010418A2 (en) | Aptamer, complex, biosensor or test strip, apparatus to detect the presence, absence or level of imatinib, use of an aptamer, detection method, cancer treatment or prevention method and kit | |
CN114381460B (en) | Aptamer for detecting mumps virus, kit and application | |
CN114410640B (en) | Aptamer for detecting measles virus, kit and application | |
Yu | Rapid and sensitive detection of Escherichia coli O157: H7 using a QCM sensor based on aptamers selected by whole-bacterium SELEX and a multivalent aptamer system | |
KR101480495B1 (en) | Aptamer for envelope protein E2 of Hepatitis C Virus and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AMND | Amendment | ||
X091 | Application refused [patent] | ||
AMND | Amendment | ||
GRNT | Written decision to grant | ||
X701 | Decision to grant (after re-examination) |