KR102016668B1 - DNA aptamer binding specifically to chikungunya virus envelope protein 2(CHIKV E2) and uses thereof - Google Patents

Abstract

The present invention relates to DNA aptamer specifically binding to Chikungunya virus envelope protein 2, a Chikungunya diagnostic composition including the DNA aptamer, a Chikungunya diagnostic kit, a Chikungunya diagnostic biosensor, and an information providing method for Chikungunya diagnosis. According to research of the present inventors to develop a novel biomarker for the diagnosis of Chikungunya, it is confirmed that DNA aptamer having a specific binding ability to Chikungunya virus envelope protein 2 (CHIKV E2) has strong binding force with CHIKV E2 and excellent specificity. The DNA aptamer can be expected to be more stable than the ELISA method using a conventional antibody and thus, is also expected to be useful in the development of a Chikungunya diagnostic composition, a Chikungunya diagnostic biosensor, and an information providing method for Chikungunya diagnosis.

Description

DNA aptamer binding specifically to chikungunya virus envelope protein 2 (CHIKV E2) and uses approximately}

The present invention is a DNA aptamer specifically binding to Chikkununya virus envelope protein 2 (CHIKV E2), Chikungunya diagnostic composition comprising the same, Chikungunya diagnostic kit, Chikungunya diagnostic biosensor, and Chikun The present invention relates to a method for providing information for field diagnosis.

Chikungunya is an infectious disease accompanied by fever, pain in the muscles and joints, headaches, fatigue and rashes. In some patients, arthralgia may not recover for more than a few months, and complications of eye, nerve, and heart system have been reported. There is no specialized treatment and symptomatic therapy is used to alleviate pain. It is estimated that more than 3 million infections occur each year. Egyptian forest mosquitoes and white line mosquitoes are transmitted as a medium.

Chikungunya, meanwhile, has three structures: glycosylated E1 and E2 embedded in the virus envelope, and E3, a non-glycosylated capsid protein. Has protein At this time, E2 and E3 are known to be involved in the formation and budding process of the grown virion (virion). A single linear epitope is located at the N-terminus of the E2 glycoprotein and shows a strong antigen-antibody response. For this reason, Chikungunya virus E2 has been studied as a major target protein in the development of existing IgM and IgG based diagnostic methods and recombinant subunit vaccines.

Currently, tropical endemic diseases such as chikungunya are diagnosed by symptom-based diagnosis, detection of infectious agents using polymerase chain reaction (PCR), and immunodiagnostic methods using antigen-antibody reactions. Existing methods, however, are not widely used as a cost issue in poor countries with poor health care facilities, or fall short of adequate measures of sensitivity and screening. It is necessary to overcome the limitations of existing diagnostic methods and to develop a platform for detecting alienation diseases that can be used in poor countries.

On the other hand, aptamers have been developed recently because of their high affinity for certain substances and their stability, and their application to therapeutics and diagnostic sensors using them is actively underway. Because the synthesis of aptamers is possible in a relatively simple manner and can target cells, proteins and even small organic substances, it is possible to develop new detection methods using them, and its specificity and stability are much higher than that of the already developed antibodies. Therefore, it is possible to develop therapeutics, drug delivery systems, and applications as diagnostic biosensors.

Therefore, in order to develop an alienation disease detection platform, the diagnosis of chikungunya using a new biomarker has been the subject of major challenges, and research on this has been made, but it is still inadequate.

Republic of Korea Patent Registration 10-1792684

The present invention has been made to solve the above problems, to determine the specific binding capacity of Chikkununya virus envelope protein 2 (CHIKV E2) of the DNA aptamer prepared in the present invention based on this The present invention was completed.

Accordingly, an object of the present invention is a DNA aptamer specifically binding to Chikkununya virus envelope protein 2 (CHIKV E2), wherein the DNA aptamer comprises a nucleotide sequence of SEQ ID NO: 4 To provide DNA aptamers.

In addition, another object of the present invention is to provide a chikungunya diagnostic composition or chikungunya diagnostic kit comprising a DNA aptamer.

In addition, another object of the present invention is Chikungunya virus envelope protein 2 (CHIKV E2) specific DNA aptamer; And a chikungunya diagnostic biosensor comprising a substrate on which the DNA aptamer is fixed, wherein the DNA aptamer comprises a nucleotide sequence of SEQ ID NO: 4.

In addition, another object of the present invention (a) injecting a subject sample to the biosensor of claim 5; (b) injecting a detection probe including a quantum dot into the biosensor processing the subject sample of step (a); (c) injecting acid into the biosensor injecting the detection probe including the quantum dot of step (b); (d) obtaining a solution in which the quantum dots and the acid of step (c) react; And (e) provides a method of providing information for chikungunya diagnosis comprising the step of measuring the current (Ampere; A) of the solution of step (d).

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned can be clearly understood by those skilled in the art from the following description. There will be.

In order to achieve the above object of the present invention, the present invention is a DNA aptamer specifically binding to Chikkununya virus envelope protein 2 (CHIKV E2), the DNA aptamer of SEQ ID NO: It provides a DNA aptamer, characterized in that consisting of the nucleotide sequence.

In one embodiment of the present invention, the chikungunya virus E2 may be a domain protein contained on the surface of the chikungunya virus antigen (antigen).

The present invention also provides a chikungunya diagnostic composition comprising a DNA aptamer.

The present invention also provides a chikungunya diagnostic kit comprising a DNA aptamer.

In addition, the present invention provides Chikungunya virus envelope protein 2 (CHIKV E2) specific DNA aptamer; And a chikungunya diagnostic biosensor comprising a substrate on which the DNA aptamer is fixed, wherein the DNA aptamer comprises a nucleotide sequence of SEQ ID NO: 4.

In one embodiment of the present invention, the substrate may be a metal electrode layer and a metal nanoparticle layer, the metal may be gold (Au).

As another embodiment of the present invention, the DNA aptamer may be hybridized with a fixed sequence and fixed to a substrate by double strands.

In addition, the present invention comprises the steps of (a) injecting a subject sample to the biosensor of claim 5; (b) injecting a detection probe including a quantum dot into the biosensor processing the subject sample of step (a); (c) injecting acid into the biosensor injecting the detection probe including the quantum dot of step (b); (d) obtaining a solution in which the quantum dots and the acid of step (c) react; And (e) provides a method of providing information for chikungunya diagnosis comprising the step of measuring the current (Ampere; A) of the solution of step (d).

In one embodiment of the present invention, the quantum dot may be cadmium sulfide (CdS).

The present invention also provides a method for diagnosing chikungunya comprising administering to a subject a DNA aptamer specifically binding to CHIKV E2.

The present invention also provides a chikungunya diagnostic use of DNA aptamer specifically binding to CHIKV E2.

The present inventors earnestly researched to develop a novel biomarker for the diagnosis of Chikungunya, DNA aptamer having a specific binding capacity to Chikungunya virus envelope protein 2 (CHIKV E2) (DNA Aptamer) has a strong binding capacity and excellent specificity with CHIKV E2, and can be expected to be more stable than the ELISA method using conventional antibodies, Chikungunya diagnostic composition, Chikungunya diagnostic biosensor, Chikungunya diagnostic It is expected that it can be usefully used in the development of information providing methods.

1 is a graph showing the result of confirming the binding degree (%) of ssDNA (single strand DNA) and CHIKV E2 and proceeding the selection process.
Figure 2 shows the result of confirming the Kd value for the CV2 aptamer sequence through fluorescence measurement.
3 is a schematic diagram of a biosensor for detecting CHIKV E2 using DNA aptamer.
Figure 4a is a graph confirming the detection result of CHIKV E2 using a CV2 aptamer when the concentration of CHIKV E2.
4B is a graph confirming that the result of detecting CHIKV E2 using CV2 aptamer is quantitative when the concentration value of CHIKV E2 converted into Log is represented by the x-axis.
5 is a graph showing the results of changes in the relative current value according to the reaction with each protein in the binding specificity test for CHIKV E2.

The present inventors earnestly researched to develop a novel biomarker for the diagnosis of Chikungunya, DNA aptamer having a specific binding capacity to Chikungunya virus envelope protein 2 (CHIKV E2) (DNA Aptamer) confirmed that there is a strong binding strength and excellent specificity with CHIKV E2, and completed the present invention.

Hereinafter, the present invention will be described in detail.

The present invention provides a DNA aptamer that specifically binds CHIKV E2.

As used herein, the term "Chikungunya virus envelope protein 2 (CHIKV E2)" refers to glycosylated E2 embedded in the envelope of the virus. One of three structural proteins, E1 and E3, a non-glycosylated capsid protein. At this time, E2 and E3 are known to be involved in the formation and budding process of the grown virion (virion). A single linear epitope is located at the N-terminus of the E2 glycoprotein and shows a strong antigen-antibody response. Because of this, CHIKV E2 is a major target protein in the development of existing IgM and IgG-based diagnostic methods and recombinant subunit vaccines. Therefore, CHIKV E2 can effectively detect chikungunya by detecting CHIKV E2, and the CHIKV E2 is chikun It may be, but is not limited to, a domain protein included on the surface of the anti-viral virus antigen.

As used herein, the term "aptamer" refers to single-stranded DNA (ssDNA) or RNA having high specificity and affinity for a specific substance. The method using an antibody developed in the past is relatively time-consuming and expensive because it is made by using the immune system of a living body, and its stability may be a problem because it is a protein. It is possible to develop new detection methods using this method because it can be a simple method and can be a target material even for cells, proteins and even small organic substances. CHIKV is focused on the fact that its specificity and stability are much higher than that of antibodies already developed. DNA aptamer was used for specific detection of E2. Any DNA (ssDNA) or RNA capable of specific detection of CHIKV E2 may correspond to the aptamer of the present invention, and preferably, the base sequence of SEQ ID NO: 4, but is not limited thereto.

The present invention also provides a chikungunya diagnostic composition comprising the DNA aptamer.

The composition of the present invention may further comprise a pharmacologically or physiologically acceptable carrier, excipient, and diluent in addition to the DNA aptamer. It may also be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral formulations, external preparations, suppositories, and sterile injectable solutions according to conventional methods.

Carriers, excipients, and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, mineral oil and the like. In formulating the composition, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.

The present invention also provides a chikungunya diagnostic kit comprising the DNA aptamer.

The kit includes an aptamer of the present invention that specifically binds to CHIKV E2, to which aptamers can be attached detection markers, such as biotin residues, which are widely used in the art. The labeling material may be introduced into the biotin-attached aptamer, and then used to detect, quantify, and diagnose CHIKV E2 through its analysis. As a label used in biotin, various known analytical labels may be used, and for example, fluorescence analysis may be performed using streptavidin, avidin, Cy3, Cy5, Alexa, BODIPY, Rhodamine or Q-dot. Can be. In addition, the aptamer for detecting CHIKV E2 may be labeled with conventional labeling materials such as other fluorescent materials, magnetic materials, dyes, enzymes, radioisotopes, etc., in addition to biotin residues. microscope,

It can be detected through radioimmnodetection (RAID).

In addition, the kit is a variety of tools or reagents that can be used to qualitatively or quantitatively determine whether or not CHIKV E2 is bound to aptamers in a sample. It may further include.

In the present invention, the substrate to which the aptamer is fixed may be selected from the group consisting of a polymer, glass, gold, paper, and a membrane as a solid substrate. More specifically, polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluororesin, agarose, cellulose, nitrocellulose, dextran, Sephadex, sepharose, liposome, carboxymethyl cellulose, polyacrylamide, Polyester, pam, filter paper, ion exchange resin, plastic film, plastic tube, polyamine-methyl vinyl-ether-maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, metal, glass, glass beads, or Magnetic particles and the like can be used. Other solid substrates may include cell culture plates, ELISA plates, tubes, polymeric membranes, and the like. The substrate may have any possible form, for example, spherical (bead), cylindrical (test tube or well surface), planar (sheet, test strip), more preferably multi-well plate (eg, 24 wells). , 96 well, 192 well, 384 well, 576 well, etc.) can be used.

In addition, the present invention provides Chikungunya virus envelope protein 2 (CHIKV E2) specific DNA aptamer; And it provides a Chikungunya diagnostic biosensor comprising a substrate on which the DNA aptamer is fixed.

The substrate on which the DNA aptamer is fixed is composed of a metal electrode layer and a metal nanoparticle layer of a screen printed electrode chip, and the electrode layer and the nanoparticle material may be attracted by an electric or magnetic field, and the characteristics of the electric field. Any material capable of changing the material may be used, and may be preferably made of gold (Au), but is not limited thereto.

The DNA aptamer immobilized on the substrate may be hybridized with a fixed sequence to be immobilized on the substrate by a double strand, and the DNA aptamer specifically bound to CHIKV E2 is not limited to any one. Preferably, the DNA aptamer is CV2 aptamer. However, the present invention is not limited thereto.

In addition, the fixed sequence may be hybridized with the CV2 aptamer to be immobilized on the substrate by a thiol-gold reaction, preferably 5'-CAC ATT TCG GAT CCG CTG ACA T- (CH ₂ ) ₆ -SH-3 ' The sequence may be, but is not limited to.

In an embodiment of the present invention, the aptamer for CHIKV E2 was searched using SELEX, and the sequence and structure of the CV2 aptamer were analyzed and confirmed (see Example 1), and the CHIKV E2 and pressure were measured using fluorescence measurements. The binding force between the tamers was measured (see Example 2), and based on the above experimental results, a DNA aptamer and a biosensor having excellent stability and binding ability were prepared (see Example 3), and the biosensor was applied to CHIKV E2. When it was confirmed that the specificity is excellent, it was confirmed that it can be used as an information providing method for chikungunya diagnosis (see Example 4).

Accordingly, the present invention comprises the steps of (a) injecting a subject sample to the biosensor of claim 5; (b) injecting a detection probe including a quantum dot into the biosensor processing the subject sample of step (a); (c) injecting acid into the biosensor injecting the detection probe including the quantum dot of step (b); (d) obtaining a solution in which the quantum dots and the acid of step (c) react; And (e) provides a method of providing information for chikungunya diagnosis comprising the step of measuring the current (Ampere; A) of the solution of step (d).

The subject sample for diagnosing chikungunya may be tissue, cells, whole blood, blood, saliva, sputum, cerebrospinal fluid, or urine, but is not limited thereto.

In addition, the detection probes are filled with more detection probes as CHIKV E2 is separated from the biosensor aptamer and separated, and the detection probe sequence is preferably 5'-GCG GAT CCG AAA TGT GTT GTG GTT GGA GCT GC -(CH ₂ ) ₆ -NH ₂ -3 ', but is not limited thereto.

In addition, the quantum dot may be included in the detection probe, and is not limited to any one if it can react with the acid, for example, there may be cadmium sulfide (CdS), lead sulfide (PbS), etc., preferably sulfide Cadmium, but not limited thereto.

In addition, the acid is not limited to any one as long as it can react with the quantum dot, for example, nitric acid, sulfuric acid, hydrochloric acid, and the like, and preferably nitric acid, but is not limited thereto.

Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

Example 1.Aptamer Screening for CHIKV E2 Protein Using SELEX

1-1. Fabrication of single strand DNA (ssDNA) library

Synthesized library having a binding sequence of primers for PCR amplification and cloning at both ends and 90 sequences including 40 random DNA base sequences (5'-CACCTAATACGACTCACTATAGCGGATCCGA-N40-CTGGCTCGAACAAGCTTGC-3 '; SEQ ID NO: 1) Was designed. In addition, a forward primer (5'-CACCTAATACGACTCACTATAGCGGA-3 '; SEQ ID NO: 2) and a reverse primer (5'-GCAAGCTTGTTCGAGCCAG-3'; SEQ ID NO: 3) and a biotin-coupled reverse primer (5 ') for PCR amplification and ssDNA generation -Biotin-GCAAGCTTGTTCGAGCCAG-3 '). All oligonucleotides used herein were synthesized and PAGE purified by Bionics (Korea).

1-2. Immobilization of Ni-NTA Magnetic Beads in CHIKV E2

Purified CHIKV E2 was cobalt-coated on the surface and immobilized on bead using Dynabeads (Invitrogen, Norway), a magnetic bead that binds to the His-tag of the protein.

Specifically, 1000pmole and 15ul of bead dissolved in 100uL of protein binding buffer (20mM Tris, 50mM NaCl, 5mM KCl, 5mM MgCl ₂ , pH 8.0) were washed with a binding buffer using an external magnet, and then reacted at room temperature for one hour. Fixed to the bead.

1-3. Aptamer Screening Specific to CHIKV E2

Magnetic separations were performed to select aptamers specific for CHIKV E2. Specifically, for the most stable structure formation of ssDNA, ssDNA library (500 pmole) dissolved in 100 uL binding buffer was incubated at 90 ° C. for 3 minutes and then incubated at 4 ° C. for 30 minutes. Thereafter, the mixture was reacted for 1 hour while gently shaking with CHIKV E2 immobilized on the magnetic bead. The bead was then washed twice with binding buffer to remove ssDNA that did not bind CHIKV E2 bound to the bead. Then, the protein and bound ssDNA were eluted using elution buffer (20mM Tris, 50mM NaCl, 5mM KCl, 5mM MgCl ₂ , 0.01% tween 20, 300mM immidazole, pH 8.0) to separate the protein-ssDNA from the magnetic bead. . The eluted ssDNA was precipitated with ethanol, dissolved in 60 uL of distilled water, and then amplified by PCR using i-pfu polymerase (Intron Biotechnology, Korea) using a reverse primer combined with a forward primer and a biotin. To generate ssDNA for the next screening process, biotin-coupled PCR products were combined with streptavidin-coated magnetic beads that bind biotin to the coupling buffer (5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl). , 0.005% tween 20, pH 7.5) was incubated for 1 hour. After incubation, the cells were incubated with 100ul of 100mM NaOH for 10 minutes to separate only ssDNA, and only ssDNA selected using an external magnet was obtained. In addition, the selection was repeated using the first selected ssDNA for the next selection. At this time, the amount of ssDNA and the concentration of CHIKV E2 were further reduced for strict screening.The concentration of ssDNA eluted in repeated screening was measured by UV spectrophotometer (UV spectrometer, Biochrom Libra S22 spectromether) to measure the remaining CHIKV of ssDNA. The screening process was performed by checking the degree of binding to E2. The degree of binding (%) is as shown in FIG.

1-4. Aptamer Sequencing and Structural Analysis

The 13th repeated selected ssDNA was amplified by PCR using an unmodified forward primer and a reverse primer, and cloned into a pENTR / TOPO vector (TOPO TA Cloning kit, Invitrogen, USA), followed by E. coli TOP10 cells. (Invitrogen, USA). Clones into which ssDNA was inserted were purified using a miniprep kit (GeneAll, Korea), and then sequenced (COSMO Genetech, Korea). As a result, the sequence shown in Table 1 could be analyzed.

Aptamer candidate sequence (5 '→ 3') CV2
(90 mer) CACCTAATACGACTCACTATA GCGGATCCGAAATGTGTTGTGGTTGGAGCTGC ATAAACCCTTTCTTCCCGCTGGCTCGAACAAGCTTGC

Example 2. Measurement of binding force between protein and aptamer using fluorescence measurement

CHPMV E2 of 400 pmole was mixed with 10 uL of magnetic beads (megnetic bead), and then incubated in 100 uL of binding buffer (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2, pH 8.0) for 1 hour. Wash twice with binding buffer to separate unbound CHIKV E2. Thereafter, the cells were incubated with various concentrations of 6-FAM-labeled aptamer for 1 hour, and unbound aptamers were removed by washing. The amount of 6-FAM-labeled ssDNA aptamer bound to CHIKV E2-fixed magnetic beads was measured by fluorescence by separating only 6-FAM-labeled ssDNA bound to CHIKV E2 using a magnet (1420 Victor multilabel counter, PerkinElmer, USA). As a result, as shown in FIG. 2 and Table 2 below, the kd value of the DNA aptamer of the CV2 nucleotide sequence could be measured.

Aptamer Kd (nM) CV2 19.3 ± 7.3 nM

Example 3. Optimization of detection conditions and fabrication of biosensors

In order to detect CHIKV E2 using the DNA aptamer discovered in Example 1, a biosensor having excellent detection sensitivity was designed using stripping voltammetry technology. 3 is a schematic diagram of a biosensor for detecting CHIKV E2 using the DNA aptamer of the present invention.

5'GCG GAT CCG AAA TGT GTT GTG GTT GGA GCT GC 3 '

First, gold nanoparticles were adsorbed onto the gold electrode of the screen printed gold electrode (SPGE) chip, followed by fixed sequence (5'-CAC ATT TCG GAT CCG CTG ACA T-(CH ₂ ) ₆ -SH-3 '), CV2 pressure A double strand hybridized with a tammer (5′-GCG GAT CCG AAA TGT GTT GTG GTT GGA GCT GC-3 ′; SEQ ID NO: 4) is immobilized on the gold surface by a thiol-gold reaction. Then, CHIKV E2 to be detected is added, reacted for 40 minutes, and washed with distilled water. The CV2 aptamer that specifically reacts with CHIKV E2 binds to the protein and falls off, leaving the corresponding fixed sequence as a single strand. Finally, the detection probe sequence (5'- GCG GAT CCG AAA TGT GTT GTG GTT GGA GCT GC-(CH ₂ ) ₆ -NH ₂ -3 ') connected to a cadmium sulfide quantum dot (CdS) was reacted for 40 minutes and distilled water. After washing with water, the solution was further reacted with 70 μL of 1M nitric acid for 1 hour and transferred to 1 mL acetate / bismuth buffer (0.1 M acetate buffer, 400 μg / L bismuth, pH 4.5) for stripping square wave voltammetry analysis.

As more CHIKV E2 combines with the biosensor surface probe and falls off, more of the detection probe sequence fills the site, and cadmium sulfide (quantum dots) reacted with nitric acid releases large amounts of cadmium ions into the solution. This can be observed as a peak on the graph of stripping voltammetry technique, which detects metal ions with very high specificity and sensitivity, thereby enabling signal-on quantitative analysis.

Based on electrochemistry, recombinant CHIKV E2 was detected using a selected CV2 aptamer. As a result, as shown in Figures 4a and 4b, it was confirmed that the current value increases as the concentration of CHIKV E2 (1pM-100μM) increases (see Fig. 4a). Derived the graph of the concentration value of CHIKV E2 converted from the current value to the y-axis and the logarithm to the x-axis, the detection of CHIKV E2 is quantitatively confirmed by the biosensor, and the detection limit is 0.10pM. (See FIG. 4B).

Example 4. Confirmation of binding specificity of CHIKV E2 detection aptamer

In order for the DNA aptamer to be used as a biosensor, binding specificity that does not react with other proteins in the blood besides the target CHIKV E2 is important. It was confirmed. At this time, it was detected by mixing so that the concentration of each protein was 10 nM in PBS.

As a result, as shown in FIG. 5, it was confirmed that the specificity was excellent for CHIKV E2. In particular, YFV in the control protein is a surface protein of a tropical infectious virus similar to CHIKV, and although it is generally known to have high cross-reactivity between tropical infectious diseases, it has been confirmed that it does not bind to the DNA aptamer developed in the present invention. . This means that the DNA aptamer of the present invention reacts with CHIKV E2 with high binding specificity. It also had high specificity when compared to HSA, a serum protein.

From the above, it means that the DNA aptamer CV2 developed in the present invention not only has very high binding specificity to CHIKV E2, but also can be used as a biosensor in complex biological samples.

For reference, the sequence list of the present invention is shown in Table 3 below.

Sequence Listing designation order SEQ ID NO: 1 ssDNA library CACCTAATACGACTCACTATAGCGGATCCGA-N40-CTGGCTCGAACAAGCTTGC SEQ ID NO: 2 Forward primer cacctaatac gactcactat agcgga SEQ ID NO: 3 Reverse primer gcaagcttgt tcgagccag SEQ ID NO: 4 CV2 Aptamer GCG GAT CCG AAA TGT GTT GTG GTT GGA GCT GC

The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it is to be understood that the embodiments described above are exemplary in all respects and not restrictive.

<110> POSTECH Academy-industry Foundation & MD Healthcare Inc. <120> DNA aptamer binding specifically to chikungunya virus envelope          protein 2 (CHIKV E2) and uses <130> MP18-242 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 89 <212> DNA <213> Artificial Sequence <220> <223> ssDNA library <400> 1 cacctaatac gactcactat agcggatccg annnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn ctggctcgaa caagcttgc 89 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 2 cacctaatac gactcactat agcgga 26 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 3 gcaagcttgt tcgagccag 19 <210> 4 <211> 32 <212> DNA <213> Artificial Sequence <220> CV223 Aptamer <400> 4 gcggatccga aatgtgttgt ggttggagct gc 32

Claims (9)

A chikungunya diagnostic composition comprising a DNA aptamer specifically binding to Chikungunya virus envelope protein 2 (CHIKV E2),
The DNA aptamer is a diagnostic composition, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 4.
The method of claim 1,
The chikungunya virus E2 is characterized in that the domain protein contained on the surface of the chikungunya virus antigen (antigen), diagnostic composition.
delete A Chikungunya diagnostic kit comprising a DNA aptamer specifically binding to Chikungunya virus envelope protein 2 (CHIKV E2),
The DNA aptamer, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 4, diagnostic kit.
Chikkununya virus envelope protein 2 (CHIKV E2) specific DNA aptamers; And Chikungunya diagnostic biosensor comprising a substrate on which the DNA aptamer is fixed,
The DNA aptamer is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 4, Chikungunya diagnostic biosensor.
The method of claim 5,
The substrate comprises a metal electrode layer and a metal nanoparticle layer, wherein the metal is gold (Au) Chikungunya diagnostic biosensor.
The method of claim 5,
The DNA aptamer hybridized with a fixed sequence, characterized in that the double strand is fixed to the substrate, Chikungunya diagnostic biosensor.
Including the following steps, Chikungunya information providing method for diagnosis.
(a) injecting a subject sample into the biosensor of claim 5;
(b) injecting a detection probe including a quantum dot into the biosensor processing the subject sample of step (a);
(c) injecting acid into the biosensor injecting the detection probe including the quantum dot of step (b);
(d) obtaining a solution in which the quantum dots and the acid of step (c) react; And
(e) measuring the ampere (A) of the solution of step (d).
The method of claim 8,
The quantum dot is cadmium sulfide (CdS), characterized in that, Chikungunya information providing method for diagnosis.

Images