KR101480495B1 - Aptamer for envelope protein E2 of Hepatitis C Virus and uses thereof - Google Patents

Aptamer for envelope protein E2 of Hepatitis C Virus and uses thereof Download PDF

Info

Publication number
KR101480495B1
KR101480495B1 KR20130048749A KR20130048749A KR101480495B1 KR 101480495 B1 KR101480495 B1 KR 101480495B1 KR 20130048749 A KR20130048749 A KR 20130048749A KR 20130048749 A KR20130048749 A KR 20130048749A KR 101480495 B1 KR101480495 B1 KR 101480495B1
Authority
KR
South Korea
Prior art keywords
hepatitis
virus
sample
aptamer
platemer
Prior art date
Application number
KR20130048749A
Other languages
Korean (ko)
Other versions
KR20140130338A (en
Inventor
장승기
류성호
박지훈
Original Assignee
주식회사 포스코
포항공과대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 포스코, 포항공과대학교 산학협력단 filed Critical 주식회사 포스코
Priority to KR20130048749A priority Critical patent/KR101480495B1/en
Publication of KR20140130338A publication Critical patent/KR20140130338A/en
Application granted granted Critical
Publication of KR101480495B1 publication Critical patent/KR101480495B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/706Specific hybridization probes for hepatitis
    • C12Q1/707Specific hybridization probes for hepatitis non-A, non-B Hepatitis, excluding hepatitis D
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds

Abstract

본 발명은 C형 간염 바이러스 (Hepatitis C Virus, HCV) 표면 단백질 E2에 특이적으로 결합하는 압타머 및 이의 용도에 관한 것이다. 보다 상세하게, 본 발명은 C형 간염 바이러스 표면 단백질 E2에 특이적으로 결합하는 압타머, 및 상기 압타머를 이용하여 C형 간염 바이러스를 검출하거나, C형 간염 바이러스를 정량하거나, 또는 C형 간염을 진단하는 용도에 관한 것이다. 나아가, 본 발명은 상기 압타머를 이용하여 C형 간염 치료제를 모니터링 및 스크리닝 하는 방법에 관한 것이다.The present invention relates to a platemma that specifically binds to hepatitis C virus (HCV) surface protein E2 and uses thereof. More specifically, the present invention relates to an abatumer that specifically binds to the hepatitis C virus surface protein E2, and a method of detecting hepatitis C virus using the abatumer, quantifying hepatitis C virus, And the like. Further, the present invention relates to a method for monitoring and screening a hepatitis C therapeutic agent using the above-described platemaster.

Description

C형 간염바이러스의 표면 단백질 E2에 대한 압타머 및 이의 용도{Aptamer for envelope protein E2 of Hepatitis C Virus and uses thereof}Aptamer for envelope protein E2 of Hepatitis C virus and uses thereof,

본 발명은 C형 간염 바이러스 (Hepatitis C Virus, HCV)의 표면 단백질 E2에 특이적으로 결합하는 압타머 및 이의 용도에 관한 것이다. 보다 상세하게, 본 발명은 C형 간염 바이러스 표면 단백질 E2에 특이적으로 결합하는 압타머, 및 상기 압타머를 이용하여 C형 간염 바이러스를 검출하거나, C형 간염 바이러스를 정량하거나, 또는 C형 간염을 진단하는 용도에 관한 것이다. 나아가, 본 발명은 상기 압타머를 이용하여 C형 간염 치료제를 모니터링 및 스크리닝 하는 방법에 관한 것이다.
The present invention relates to an abatumer that specifically binds to the surface protein E2 of hepatitis C virus (HCV) and uses thereof. More specifically, the present invention relates to an abatumer that specifically binds to the hepatitis C virus surface protein E2, and a method of detecting hepatitis C virus using the abatumer, quantifying hepatitis C virus, And the like. Further, the present invention relates to a method for monitoring and screening a hepatitis C therapeutic agent using the above-described platemaster.

현재 C형 간염 바이러스에 감염된 사람은 전세계인구의 약 3%정도이고 우리나라에서도 그 수가 점차 증가하고 있다. C형 간염 바이러스에 감염되면 80%정도는 만성감염으로 진행되고, 10% 정도의 환자에서 간경변과 간암으로 발전하여 목숨을 잃게 된다. 그럼에도 불구하고 C형 간염 바이러스에 특이적이고 효율적인 치료제가 개발되어 있지 않다. 따라서 C형 간염 바이러스를 검침하고 정량하는 것이 C형 간염 바이러스의 진단과 연구에서 매우 중요하다. 특히 바이러스의 감염도(infectivity)를 측정하는 것은 모든 연구와 진단의 기초가 되고 있고, 또한 항바이러스제 개발을 위해서 바이러스 증식 저해 능력을 모니터링 하는데도 감염도 측정이 반드시 필요하다. Currently, about 3% of the world 's population is infected with the hepatitis C virus and its number is increasing in Korea. About 80% of patients with chronic hepatitis C virus develop chronic infection, and about 10% of patients develop liver cirrhosis and liver cancer. Nevertheless, no specific and efficient treatment for hepatitis C virus has been developed. Therefore, monitoring and quantification of hepatitis C virus is very important in the diagnosis and research of hepatitis C virus. In particular, measuring the infectivity of viruses is the basis of all research and diagnosis, and in order to develop antiviral agents, infection measurement is also necessary to monitor the inhibitory ability of virus.

C형 간염 바이러스는 대략 3,010개의 아미노산으로 구성된 중합 단백질을 해독하는 9,600개의 염기서열 길이의 단일 양성 가닥 RNA 게놈을 가지고 있다. 상기 중합 단백질의 전구체는 세포와 바이러스의 프로테아제에 의해 적어도 10개의 원숙한 구조적, 비구조적 단백질(C, E1, E2, p7, NS2, NS3, NS4A, NS4B, NS5A, NS5B)로 된다.The hepatitis C virus has a single positive strand RNA genome of 9,600 nucleotides in length that decodes a polymeric protein composed of approximately 3,010 amino acids. The precursor of the polymeric protein is at least 10 mature structural and nonstructural proteins (C, E1, E2, p7, NS2, NS3, NS4A, NS4B, NS5A, NS5B) by the cell and viral proteases.

현재 C형 간염 바이러스 감염도를 측정하는 방법에는 C형 간염 바이러스 단백질에 대한 항체를 이용한 항체염색 방법이 있다. 이 방법은 C형 간염 바이러스 단백질에 대한 항체를 이용해서 바이러스가 세포에 어느 정도 감염이 되는지를 확인하는 것이다. 그러나 이 방법은 바이러스를 세포에 감염시켜야 결과를 알 수 있기 때문에 시간이 오래 걸린다는 단점이 있고, 항체를 이용해서 감염된 세포를 염색한 뒤 감염된 세포를 일일이 세어야 하는 번거로움이 있는 방법이다.Currently, there is a method to measure the hepatitis C virus infection using an antibody against the hepatitis C virus antibody. This method uses antibodies against the hepatitis C virus protein to determine how much the virus is infecting the cells. However, this method has a disadvantage that it takes a long time because it is necessary to infect the cells with the virus, and it is a troublesome way to count the infected cells after staining the infected cells with the antibody.

또한, C형 간염 바이러스의 감염에 의해 발생하는 질환인 C형 간염의 진단 방법으로서, HCV 특이항원들을 사용하여 기존의 공지된 효소면역 측정법(ELISA immunoassay, EIA)원리에 따라 환자의 혈청으로부터 C형 간염 바이러스에 대한 항체를 검정하는 진단방법이 보고된 바 있으며 (한국등록특허 제236,765호), HCV의 표면 단백질들의 항원 결정기(epitope)를 밝히고 이들 항원결정기만을 융합시킨 단백질인 UB E1E2 단백질을 재조합 대장균에서 발현시키고(한국등록특허 제236,767호), 이 UB E1E2 단백질을 UB NS4 단백질과 융합시킨 UB NS4 E1E2 단백질을 재조합 대장균에서 발현시켜 이를 이용하여 더욱 정확한 C형 간염 환자의 진단을 가능케 하였다.As a method for diagnosing hepatitis C, which is a disease caused by hepatitis C virus infection, HCV-specific antigens are used to detect C-type from the serum of a patient according to the known ELISA immunoassay (EIA) (Korean Patent No. 236,765), a UB E1E2 protein, which is a fusion protein of the epitopes of HCV surface proteins and fused only with these antigenic determinants, was recombined (Korean Patent No. 236,767), and UB NS4 E1E2 protein, which is a fusion of UB E1E2 protein with UB NS4 protein, was expressed in recombinant E. coli, thereby enabling more accurate diagnosis of hepatitis C patients.

그러나 상기 ELISA방법을 이용한 진단의 경우, C형 간염 외의 다른 많은 간질환(예를 들면, 쓸개즙 간 경변증, 자가 면역성 간염, 잠원성 간 경변증 등)에 걸린 환자의 혈청들이 양성으로 나타나는 문제가 있고(Contreras M., et.al., Lancet 2, 505(1989);Cash J.D., et.al., Lancet 2 505 (1989)), 또 류마티스 관절염에 걸린 환자의 경우에는 약 60% 이상이 오르토사의 제1세대 C형 간염 진단방법에서 양성으로 나타났다는 보고도 있었다(Theilmann L. et.al., Lancet 335, 1346,(1990)). 이와 같은 사실은 기존의 ELISA 진단 방법의 경우 가양성(false positive)이 나타날 가능성이 높음을 시사한다.However, in the case of the diagnosis using the ELISA method, sera of patients suffering from many other liver diseases other than hepatitis C (for example, cirrhosis of bile, autoimmune hepatitis, amblyogenic liver cirrhosis, etc.) Cash JD, et. Al., Lancet 2 505 (1989)), and in patients with rheumatoid arthritis, about 60% (Theilmann L. et al., Lancet 335, 1346, (1990)). This suggests that false positives are more likely to occur in existing ELISA diagnostic methods.

따라서, 감염성이 있는 C형 간염 바이러스의 존재 여부를 검침하고 그 양을 측정하는 기존의 방법이 복잡하고, 효율적이지 않으며, 많은 시간이 필요하여 빠르고 쉬운 방법의 개발이 필요하다.Therefore, the conventional method of measuring the amount of infectious hepatitis C virus present and measuring the amount thereof is complicated, inefficient, and time consuming, and it is necessary to develop a quick and easy method.

이에, 본 발명자들은 세포 밖으로 방출되는 C형 간염 바이러스 중에 표피 단백질이 없어서 감염하는 능력은 없지만 RNA와 캡시드(capsid) 단백질인 코어(core)를 가지고 있는 비감염성인 바이러스 구조체들(non-infectious HCV particles)이 있고, 그것의 수가 표피단백질이 있는 감염성이 있는 C형 간염 바이러스 보다 훨씬 많다 많다는 점에 착안하여, 실제 감염성이 있는 바이러스의 양을 측정하기 위해서는 C형 간염 바이러스 RNA나 코어(core) 단백질의 양을 재는 것이 아닌, 표피 단백질의 양을 정량함으로써 기존의 ELISA 진단방법보다 더욱 특이도가 높은 C형 간염 진단방법, C형 간염 바이러스의 검침 및 정량방법을 개발하고자 하였다. The present inventors have found that non-infectious hepatitis C viruses that are released from the cells have no ability to infect them due to lack of epidermal proteins, but have non-infectious HCV particles having RNA and a core as a capsid protein, And the number of hepatitis C viruses is much higher than that of infectious hepatitis C viruses with epidermal protein. To measure the actual amount of infectious virus, the amount of hepatitis C virus RNA or core protein The aim of this study was to develop a method for the diagnosis of hepatitis C, hepatitis C virus, and methods for quantitative determination of hepatitis C virus.

그 결과 본 발명자들은 C형 간염 바이러스 표면 단백질 E2에 특이적으로 결합하는 압타머를 발굴하였고, 이를 이용하여 감염성이 있는 C형 간염 바이러스의 존재 여부를 검출 및 정량하고 C형 감염 질환을 정확하고 신속하게 진단할 수 있을 뿐만 아니라, C형 감염 치료제의 모니터링 및 치료제 개발에도 널리 활용할 수 있음을 확인하여 본 발명을 완성하였다.
As a result, the present inventors have uncovered aptamer that specifically binds to the surface protein E2 of hepatitis C virus, and using this information, it is possible to detect and quantify the presence of infectious hepatitis C virus, And can be widely used for the development of a monitoring and therapeutic agent for C-type infectious disease. The present invention has been completed based on this finding.

본 발명의 목적은 실제 감염에 중요한 C형 간염 바이러스 표피 단백질 E2에 특이적으로 결합하는 압타머를 발굴하고, 이를 이용해서 감염성이 있는 C형 간염 바이러스의 존재 여부를 검출 및 정량하고 질환을 진단하는 다양한 용도를 제공하는 것이다.It is an object of the present invention to provide a method for detecting an infectious hepatitis C virus, comprising the steps of: (i) identifying aptamer which specifically binds to the hepatitis C virus epidermal protein E2 which is important for actual infection, It provides various uses.

보다 상세하게, 본 발명은 C형 간염 바이러스 E2 에 특이적으로 결합하고, U(uracil) 또는 dU(deoxyuracil)에 벤질기가 첨가되어 있는 변형된 염기를 5 내지 15개 포함하며, 총 25 내지 100개의 염기로 이루어진 압타머를 제공하는 것을 목적으로 한다.More specifically, the present invention relates to a method for the treatment of hepatitis C virus comprising 5 to 15 modified bases which specifically bind to hepatitis C virus E2 and to which benzyl groups are added to U (uracil) or dU (deoxyuracil) It is an object of the present invention to provide an abatumer made of a base.

또한 본 발명은 상기 압타머를 포함하는, C형 간염 바이러스 검출용 조성물, 정량용 조성물, C형 간염 진단용 조성물을 제공하는 것을 목적으로 한다.It is another object of the present invention to provide a composition for detecting hepatitis C virus, a composition for quantification, and a composition for diagnosing hepatitis C, which comprises the above-described platemater.

또한 본 발명은 C형 간염 바이러스 검출용 조성물을 포함하는 C형 간염 바이러스 검출용 키트를 제공하는 것을 목적으로 한다.It is another object of the present invention to provide a kit for detecting hepatitis C virus comprising a composition for detecting hepatitis C virus.

또한 본 발명은 발명은 C형 간염 바이러스 정량용 조성물을 포함하는 C형 간염 바이러스 정량용 키트를 제공하는 것을 목적으로 한다.It is another object of the present invention to provide a kit for quantifying hepatitis C virus comprising a composition for quantitating hepatitis C virus.

또한 본 발명은 C형 간염 진단용 조성물을 포함하는 C형 간염 진단용 키트를 제공하는 것을 목적으로 한다.It is another object of the present invention to provide a kit for the diagnosis of hepatitis C comprising a composition for diagnosing hepatitis C infection.

본 발명의 또 다른 목적은 압타머가 고정된 기재를 포함하는 C형 간염 바이러스 검출용 칩을 제공하는 것이다.It is still another object of the present invention to provide a chip for detecting hepatitis C virus comprising a substrate coated with an aptamer.

또한 본 발명은 압타머가 고정된 기재를 포함하는, C형 간염 바이러스 정량용 칩을 제공하는 것을 목적으로 한다.It is another object of the present invention to provide a chip for hepatitis C virus quantification, which comprises a substrate on which an aptamer is immobilized.

또한 본 발명은 압타머가 고정된 기재를 포함하는, C형 간염 바이러스 진단용 칩을 제공하는 것을 목적으로 한다.It is another object of the present invention to provide a chip for hepatitis C virus diagnosis comprising an aptamer immobilized base material.

본 발명의 또 다른 목적은 압타머를 시료와 반응시키는 단계를 포함하는, C형 간염 바이러스를 검출하는 방법을 제공하는 것이다.It is still another object of the present invention to provide a method for detecting hepatitis C virus comprising the step of reacting an abatumer with a sample.

또한 본 발명은 압타머를 시료와 반응시키는 단계를 포함하는, C형 간염 바이러스를 정량하는 방법을 제공하는 것을 목적으로 한다.It is another object of the present invention to provide a method for quantifying hepatitis C virus comprising the step of reacting an abatumer with a sample.

본 발명의 또 다른 목적은 압타머를 환자의 시료와 반응시키는 단계를 포함하는, C형 간염 진단에 정보를 제공하는 방법을 제공하는 것이다.It is a further object of the present invention to provide a method of providing information to the diagnosis of hepatitis C, comprising the step of reacting the platemaker with a sample of the patient.

본 발명의 또 다른 목적은 항바이러스제 또는 C형 간염 치료제의 모니터링 방법을 제공하는 것이다. 바람직하게, C형 간염 바이러스, 또는 C형 간염 바이러스를 포함하는 시료에 항바이러스제 또는 C형 간염 치료제를 처리하는 단계, 및 상기 시료에서 항바이러스제 또는 C형 간염 치료제를 처리하기 전과 처리한 후의 압타머 결합 정도를 측정하는 단계를 포함한다. It is still another object of the present invention to provide a method for monitoring an antiviral agent or a therapeutic agent for hepatitis C virus. Preferably, the method comprises the steps of treating a sample containing hepatitis C virus or hepatitis C virus with a therapeutic agent for hepatitis C or an antiviral agent, and administering an antiviral agent or hepatitis C treatment agent And measuring the degree of coupling.

또한 본 발명은 C형 간염 치료제의 스크리닝 방법을 제공하는 것을 목적으로 한다. 바람직하게, C형 간염 바이러스, 또는 C형 간염 바이러스를 포함하는 시료에 C형 간염 치료제 후보물질을 처리하는 단계, 및 상기 시료에서 후보물질을 처리하기 전과 처리한 후의 압타머 결합 정도를 측정하는 단계를 포함한다.
It is another object of the present invention to provide a screening method for a hepatitis C therapeutic agent. Preferably, the method comprises the steps of: treating a sample containing hepatitis C virus or hepatitis C virus candidate with a candidate hepatitis C therapeutic agent; and measuring the degree of tympanic binding before and after treatment of the candidate substance in the sample .

상기 본 발명의 목적을 달성하기 위한 하나의 양태로서, 본 발명은 C형 간염 바이러스 E2 에 특이적으로 결합하고, U(uracil) 또는 dU(deoxyuracil)에 벤질기가 첨가되어 있는 변형된 염기를 5 내지 15개 포함하며, 총 25 내지 100개의 염기로 이루어진 압타머(aptamer)에 관한 것이다.In order to accomplish the object of the present invention, the present invention provides a method for producing a hepatitis C virus comprising the step of binding a modified base which specifically binds to hepatitis C virus E2 and a benzyl group is added to U (uracil) or dU (deoxyuracil) And a total of 25 to 100 bases.

본 발명은 C형 간염 바이러스의 감염에 중요한 표피 단백질 E2에 결합하는 압타머들을 개발하고, 표피 단백질 E2의 서로 다른 부위에 결합하는 압타머 조합을 찾아내며, 이 압타머들을 이용하며 C형 간염 바이러스의 존재 유무를 판별하며 정량화할 수 있는 방법을 제공한다. The present invention develops platamers that bind to the epidermal protein E2, which is important for infection of hepatitis C virus, and finds a combination of platamermes that bind to different sites of epidermal protein E2. Using these platelets, And a method for quantifying the presence or absence of the presence.

본 발명에서, 압타머란 특정 물질에 대해 높은 특이성과 친화도를 가지는 단일가닥 DNA(ssDNA) 또는 RNA 를 말한다. 압타머는 특정 물질에 대한 친화도가 매우 높고 안정하고, 비교적 단순한 방법으로 합성할 수 있으며, 결합력을 높이기 위해 다양한 변형이 가능하고, 세포, 단백질, 및 작은 유기물질까지도 표적물질이 될 수 있기 때문에, 그 특이성 및 안정성이 이미 개발되어 있는 항체에 비해 매우 높은 특징이 있다.In the present invention, platamer refers to single stranded DNA (ssDNA) or RNA having high specificity and affinity for a specific substance. Since aptamers can be synthesized in a relatively simple and highly stable manner with a high affinity for a specific substance, various modifications are possible in order to increase binding force, and even cells, proteins, and small organic substances can be target substances, Its specificity and stability are very high compared to antibodies that have already been developed.

바람직하게, 본 발명의 압타머는 C형 간염 바이러스의 E2 단백질에 특이적으로 결합하는 압타머를 말하며, 상기 E2 단백질은 C형 간염 바이러스 유전형 2a (UniProtKB: Q99IB8), 1b (UniProtKB: Q9WMX2) 및 1a (UniProtKB: P27958)에서 유래된 것일 수 있다.Preferably, the aptamer of the present invention refers to an umbilical cord specifically binding to the E2 protein of hepatitis C virus, wherein the E2 protein is selected from the group consisting of hepatitis C virus type 2a (UniProtKB: Q99IB8), 1b (UniProtKB: Q9WMX2) (UniProtKB: P27958).

상기 압타머는 E2에 특이적으로 결합하는 것이라면 특별히 제한되지 않으나, 바람직하게는 U(uracil) 또는 dU(deoxyuracil)에 벤질기가 첨가되어 있는 변형된 염기를 포함하여 총 염기 길이가 25 내지 100개, 보다 바람직하게는 25 내지 80개, 더욱 바람직하게는 25 내지 50개의 염기로 이루어진 것일 수 있다. 상기 변형된 염기 이외의 본 발명의 E2 압타머에 사용되는 염기는 특별한 언급이 없는 한, A, G, C, U 이들의 deoxy 형태의 염기들로 이루어진 군에서 선택된 것일 수 있다.The aptamer is not particularly limited as long as it specifically binds to E2, but preferably includes a modified base having a benzyl group added to U (uracil) or dU (deoxyuracil), and has a total base length of 25 to 100 Preferably 25 to 80, more preferably 25 to 50 bases. The base used in the E2 extender of the present invention other than the modified base may be selected from the group consisting of A, G, C and U deoxy type bases, unless otherwise specified.

상기 변형된 염기는, U(uracil) 또는 dU(deoxyuracil)에 소수성 작용기인 벤질기가 첨가됨으로써 변형되지 않은 경우와 비교하여 단백질과의 친화력(affinity)이 현저하게 높아지는 이점이 있다. 압타머 내의 상기 변형된 염기 개수는 5개 내지 15개일 수 있다.The modified base has an advantage that the affinity with protein is remarkably increased as compared with the case where the modified base is not modified by adding a benzyl group which is a hydrophobic functional group to U (uracil) or dU (deoxyuracil). The number of modified bases in the plastomer may be from 5 to 15.

바람직한 양태로서, 상기 압타머는 서열번호 1 내지 서열번호 4로 이루어진 군에서 선택된 염기서열을 포함하고, 총 염기길이가 25 내지 100개의 염기로 이루어진 것으로서, 이 때 상기 염기서열 중 U 은 U(uracil) 또는 dU(deoxyuracil)이거나, 벤질기가 첨가된 U(uracil) 또는 dU(deoxyuracil)것일 수 있다.In a preferred embodiment of the present invention, the aptamer comprises a base sequence selected from the group consisting of SEQ ID NOS: 1 to 4, wherein the total base length is 25 to 100 bases, wherein U in the base sequence is U (uracil) Or dU (deoxyuracil), U (uracil) or dU (deoxyuracil) to which a benzyl group is added.

보다 바람직한 양태로서, 상기 압타머는 서열번호 1 내지 서열번호 4로 이루어진 군에서 선택된 염기서열을 포함하고, 총 염기길이가 25 내지 100개의 염기로 이루어진 것으로서, 이 때 상기 염기서열 중 U 은 벤질기가 첨가된 U(uracil) 또는 dU(deoxyuracil)일 수 있다.In a more preferred embodiment, the aptamer comprises a base sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4 and having a total base length of 25 to 100 bases, wherein U in the base sequence is a nucleotide sequence in which a benzyl group is added Uracil or dU (deoxyuracil).

더욱 바람직한 양태로서, 상기 압타머는 서열번호 1 내지 서열번호 4로 이루어진 군에서 선택된 염기서열을 포함하고, 총 염기길이가 25 내지 100개의 염기로 이루어진 것으로서, 이 때 상기 염기서열 중 U 은 벤질기가 첨가된 dU(deoxyuracil)일 수 있다. More preferably, the aptamer comprises a base sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4 and has a total base length of 25 to 100 bases, wherein U in the base sequence is a base sequence in which a benzyl group is added Gt; dU < / RTI > (deoxyuracil).

가장 바람직한 양태로서, 상기 압타머는 서열번호 1 내지 서열번호 4로 이루어진 군에서 선택된 염기서열을 포함하고, 총 염기길이가 25 내지 100개의 염기로 이루어진 것으로서, 이 때 상기 염기서열 중 U 은 벤질아미노카보닐-데옥시우리딘(benzylaminocarbonyl-dUridine) 일 수 있다.In the most preferred embodiment, the aptamer comprises a base sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4 and has a total base length of 25 to 100 bases, wherein U in the base sequence is benzyl amino carbo Benzylaminocarbonyl-d uridine. ≪ / RTI >

또한, 상기 압타머는, 혈청 내 안정성 증진을 위하여, 5' 말단 부위, 중간 부위, 3' 말단 부위, 또는 양 말단 부위에 폴리에틸렌글리콜(polyethylene glycol, PEG), idT (inverted deoxythymidine), LNA (Locked Nucleic Acid), 2'-메톡시 뉴클레오사이드, 2'-아미노 뉴클레오사이드, 2'F-뉴클레오사이드, 아민 링커, 티올 링커 및 콜레스테롤로 이루어진 군에서 선택된 하나 이상의 것이 결합되어 변형된 것일 수 있다. The aptamer may further comprise polyethylene glycol (PEG), inverted deoxythymidine (IDT), or LNA (Locked Nucleic Acid) at the 5'-end, the middle or the 3'- Acid), 2'-methoxy nucleoside, 2'-amino nucleoside, 2'F-nucleoside, amine linker, thiol linker and cholesterol may be combined and modified .

상기 idT (inverted deoxythymidine)는 일반적으로 뉴클레아제에 대한 내성이 약한 압타머의 뉴클레아제에 의한 분해를 막기 위하여 사용되는 분자 중 하나로서, 핵산단위체는 앞 단위체의 3'-OH와 다음 단위체의 5'-OH와 결합하여 사슬을 이루지만, idT는 앞 단위체의 3'-OH와 다음 단위체의 3'-OH를 결합하여 3'-OH가 아닌 5'-OH가 노출이 되도록 인위적인 변화를 가함으로써 뉴클레아제의 일종인 3' 엑소뉴클레아제(3' exonuclease)에 의한 분해를 억제하는 효과를 일으키는 분자이다.The above-mentioned idT (inverted deoxythymidine) is one of the molecules used to prevent decomposition by a neclease of aptamer, which is generally resistant to nuclease, wherein the nucleic acid unit comprises 3'-OH of the preceding unit and the following unit 5'-OH, but idT binds the 3'-OH of the first unit and the 3'-OH of the next unit to form an artificial change so that 5'-OH, not 3'-OH, is exposed. (3 'exonuclease), which is a kind of nuclease.

바람직하게, 상기 압타머는 이합체, 삼합체 또는 사합체일 수 있다. Preferably, the aptamer may be a dimer, trimer, or trimer.

후술하는 실시예 2에서도 뒷받침되는 바와 같이, 본 발명에서 다중 압타머와 단일 압타머를 이용하여 바이러스 검침을 비교해 본 결과, 다중 압타머가 더 강한 민감도를 나타냄을 알 수 있었다. As a result of the comparison of the virus meter reading using the multiple pressure tamer and the single pressure thermometer in the present invention, the multiple aptamer shows a stronger sensitivity as shown in Example 2 described later.

C형 간염 바이러스의 구조를 살펴보면 바깥쪽에 표피(envelope)가 있고 그 안쪽으로는 게놈을 감싸고 있는 캡시드(capsid)로 이루어져 있다. 바이러스가 숙주세포에 감염하기 위해서는 세포 표면에 있는 단백질과 바이러스 표피에 있는 표피단백질(envelope protein)의 상호작용이 필수적이다. 알려진 바에 의하면 표피단백질 E2와 세포표면 단백질들인 CD81, claudin 1 및 SR-B1 등의 직접적인 결합이나 간접적인 상호작용에 의해서 바이러스가 세포 안으로 들어가게 된다. 그리고 최근 연구에 의하면 C형 간염 바이러스의 경우에 표피단백질이 있는 바이러스와 없는 바이러스로 나뉘게 되는데 표피단백질이 있는 바이러스가 강한 감염성을 가지고 있다고 알려져 있다. The structure of the hepatitis C virus is composed of an envelope on the outside and a capsid on the inside of the genome. In order for the virus to infect host cells, the interaction of proteins on the cell surface with envelope proteins in the viral epidermis is essential. It is known that direct binding or indirect interaction of epidermal protein E2 with cell surface proteins CD81, claudin 1 and SR-B1 causes the virus to enter the cell. Recent studies have shown that hepatitis C virus is divided into a virus with epidermal protein and a virus without epidermal protein. Viruses with epidermal protein are known to have strong infectivity.

본 발명자들은 상기 압타머가 E2 단백질 및 감염성 있는 바이러스에 결합하는 것을 이용하여 C형 간염 바이러스를 검출 및 정량할 수 있다는 것을 확인하였다 (실시예 2 및 실시예 3 참조). The present inventors confirmed that the above aptamer can bind to E2 protein and infectious virus to detect and quantify hepatitis C virus (see Example 2 and Example 3).

따라서, 본 발명의 압타머는 C형 간염 바이러스를 검출 및 정량하는 용도로 사용될 수 있으며, 나아가 C형 간염 바이러스의 감염에 의하여 발생하는 C형 감염 질환을 진단하는 용도로 사용될 수 있다. 이러한 바이러스의 검출, 정량 및 질환 진단 용도는 조성물, 키트, 칩 등의 형태로 다양하게 구현될 수 있다.Therefore, the aptamer of the present invention can be used for the detection and quantification of hepatitis C virus, and further can be used for diagnosing a C-type infectious disease caused by infection with hepatitis C virus. The detection, quantification and diagnosis of viruses can be variously implemented in the form of a composition, a kit, a chip, and the like.

이에, 또 하나의 양태로서, 본 발명은 상기한 바와 같은 압타머를 포함하는, C형 간염 바이러스 검출용 조성물에 관한 것이다. Accordingly, as another embodiment, the present invention relates to a composition for detecting hepatitis C virus comprising the above-mentioned abatumer.

또 하나의 양태로서, 본 발명은 상기 압타머를 포함하는, C형 간염 바이러스를 정량용 조성물에 관한 것이다. In another aspect, the present invention relates to a composition for quantitatively determining hepatitis C virus comprising the above-mentioned platemaster.

또 하나의 양태로서, 본 발명은 상기 압타머를 포함하는, C형 간염 진단용 조성물에 관한 것이다. In another aspect, the present invention relates to a composition for diagnosing hepatitis C infection comprising the above-mentioned platemaster.

종래 바이러스를 정량하는 방법으로서 바이러스 DNA량을 PCR에 의해 정량하는 방법 등이 알려져 있으며, 레트로 바이러스의 경우 바이러스 DNA량을 정량적 PCR에 의해 측정할 때, 표지 서열을 포함하는 바이러스 핵산을 포함하는 레트로 바이러스를 내부 표준으로서 이용하는 방법도 개시되어 있다 (국제특허공개 WO95/034684). 또한 바이러스 단백질의 양을 측정하는 방법으로 바이러스 단백질에 대한 항체를 이용한 면역 측정법으로서 샌드위치 ELISA법 등이 있으며 (Gerna, G.,et.al., J.Chn.Microbiol.,(1983) 17:942-944), 용액 중의 바이러스 농도를 높여서 측정하는 초원심법 등이 있다. 이러한 방법들은 고가의 기기와 긴 분리 시간을 요하고, 작업에 있어서 많은 노력을 필요로 하며, 정확도가 떨어지는 단점이 있다.In the case of retroviruses, when the amount of virus DNA is measured by quantitative PCR, a method of quantitating retroviruses containing a viral nucleic acid containing a label sequence (International Patent Publication No. WO95 / 034684). In addition, as a method for measuring the amount of virus protein, there is a sandwich ELISA method as an immunoassay method using an antibody against a virus protein (Gerna, G., et al., J. Clin. Microbiol., (1983) 17: 942 -944), and the ultracentrifugation method in which the concentration of virus in the solution is increased. These methods require expensive equipment and long separation time, require a great deal of effort in work, and have a disadvantage of poor accuracy.

이에, 본 발명은 C형 간염 바이러스의 E2 단백질에 특이적으로 결합하는 압타머를 시료와 반응시킴으로써, 신속하고 정확하게 C형 간염 바이러스의 존재 및 존재량을 확인할 수 있는 기술을 제공한다. 나아가, 본 발명의 압타머를 이용한 C형 간염 바이러스의 검출, 정량 및 진단 기술은 본 발명자가 개발한, 소위 ELASA(Enzyme Linked Apto-Sorbent Assay) 방법에 의해 구현될 수 있다. 상기 ELASA는 바이러스의 표피단백질의 양을 정량하는 것으로서 C형 간염 바이러스 감염여부에 대한 정확도를 높이고, 포획압타머와 탐지압타머를 사용하여 흡광도를 측정함으로서 보다 간편하게 C형 간염 바이러스의 검출 및 정량을 수행할 수 있는 기술을 말한다. 또한 C형 간염 바이러스의 검출 및 정량이 보다 정확하고 용이해짐으로써 C형 간염의 감염여부 진단이 더 정확하도록 할 수 있다.Accordingly, the present invention provides a technique for rapidly and accurately detecting the presence and the abundance of hepatitis C virus by reacting a platemma specifically binding to E2 protein of hepatitis C virus with a sample. Further, the detection, quantification and diagnosis of hepatitis C virus using the platemer of the present invention can be realized by the so-called ELASA (Enzyme Linked Apto-Sorbent Assay) method developed by the present inventor. The ELASA quantifies the amount of the epidermal protein of the virus. It increases the accuracy of the hepatitis C virus infection and measures the absorbance of the hepatitis C virus using capture thermometer and probe pressure tester. It refers to the technology that can be performed. In addition, the detection and quantification of hepatitis C virus can be made more accurate and easier, so that the diagnosis of hepatitis C infection can be made more accurate.

이하에서는, 본 발명의 압타머를 이용한 C형 간염 바이러스의 검출, 정량 및 진단 기술을 구현하기 위한 각종 구현예로서, 키트, 칩, 그리고 검출 방법, 정량 방법 및 질환 진단 방법에 대하여 보다 상세하게 설명한다.Hereinafter, the kit, the chip, the detection method, the quantification method, and the disease diagnosis method are described in detail as various embodiments for implementing the detection, quantification and diagnosis technology of hepatitis C virus using the platemer of the present invention do.

하나의 양태로서, 본 발명은 상기 C형 간염 바이러스 검출용 조성물을 포함하는 C형 간염 바이러스 검출용 키트에 관한 것이다. In one embodiment, the present invention relates to a kit for detecting hepatitis C virus comprising the composition for detecting hepatitis C virus.

또 하나의 양태로서, 본 발명은 상기 C형 간염 바이러스 정량용 조성물을 포함하는 C형 간염 바이러스 정량용 키트에 관한 것이다.In another aspect, the present invention relates to a kit for quantifying hepatitis C virus comprising the composition for quantifying hepatitis C virus.

또 하나의 양태로서, 본 발명은 상기 C형 간염 진단용 조성물을 포함하는, C형 간염 진단용 키트에 관한 것이다.In another aspect, the present invention relates to a kit for the diagnosis of hepatitis C comprising the composition for diagnosing hepatitis C infection.

또 하나의 양태로서, 본 발명은 상기 압타머가 고정된 기재를 포함하는, C형 간염 바이러스 검출용 칩에 관한 것이다.In another aspect, the present invention relates to a chip for hepatitis C virus detection, wherein the aptamer comprises a fixed substrate.

또 하나의 양태로서, 본 발명은 상기 압타머가 고정된 기재를 포함하는, C형 간염 바이러스 정량용 칩에 관한 것이다.In another aspect, the present invention relates to a chip for hepatitis C virus quantification, wherein the aptamer comprises a fixed substrate.

또 하나의 양태로서, 본 발명은 상기 압타머가 고정된 기재를 포함하는, C형 간염 바이러스 진단용 칩에 관한 것이다.In another aspect, the present invention relates to a chip for hepatitis C virus diagnosis, wherein the aptamer comprises a fixed substrate.

상기 키트 및 칩은 C형 간염 바이러스에 특이적으로 결합하는 본 발명의 압타머를 포함하고 있으며, 압타머에는 당업계에 널리 사용되는 검출 표지들, 예를 들어 바이오틴 잔기가 부착될 수 있다. 바이오틴이 부착된 압타머에 표지물질을 도입한 다음, 이의 분석을 통해 C형 간염 바이러스의 검출, 정량 및 진단에 이용할 수 있다. 바이오틴에 사용되는 표지물질로서 다양한 공지된 분석용 표지물질이 사용될 수 있으며, 예를 들면, 스트렙타비딘, 아비딘, Cy3, Cy5, Alexa, BODIPY, Rhodamine 또는 Q-dot 등을 사용하여 형광분석을 할 수 있다. 또한 C형 간염 바이러스 검출을 위한 압타머에는 바이오틴 잔기 외에도, 기타 형광물질, 자성체, 염색물질, 효소, 방사성동위원소 등과 같은 통상의 표지 물질로 표지할 수 있으며, 통상의 검출 수단, 예를 들어, 형광 현미경, Radioimmnodetection(RAID) 등을 통하여 검출할 수 있다.The kit and chip include an inventive platemma that specifically binds to hepatitis C virus, and the platamer may be attached with detection labels such as a biotin moiety widely used in the art. After the labeling substance is introduced into the biotin-attached platemater, it can be used for the detection, quantification and diagnosis of hepatitis C virus through its analysis. As a labeling substance used for biotin, various known labeling substances for analysis can be used. For example, fluorescence analysis is performed using streptavidin, avidin, Cy3, Cy5, Alexa, BODIPY, Rhodamine or Q-dot . In addition, the platemer for detecting hepatitis C virus may be labeled with a conventional labeling substance such as other fluorescent substance, magnetic substance, dye substance, enzyme, radioactive isotope and the like in addition to the biotin residue, Fluorescence microscopy, and radioimmunodetection (RAID).

또한, 상기 키트 및 칩은 압타머와 시료 내 C형 간염 바이러스의 결합 여부를 정성 또는 정량적으로 측정하는 데 사용할 수 있는 각종 도구 또는 시약으로서, 지지체(기재), 완충용액, 반응 정지제, 용해제, 세척제 또는 안정화제 등을 추가로 포함할 수 있다.The kit and the chip are various tools or reagents which can be used to qualitatively or quantitatively measure the binding of the platemaker and the hepatitis C virus in the sample. Examples of the kit include a support (substrate), a buffer solution, a reaction terminator, A detergent or a stabilizer, and the like.

본 발명에서 압타머가 고정된 기재는, 예컨대 고체 기재로서 고분자, 유리, 금, 종이 및 생체막(membrane)으로 이루어진 군에서 선택된 것을 사용할 수 있다. 보다 구체적으로는, 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 아가로스, 셀룰로즈, 니트로셀룰로즈, 덱스트란, 세파덱스, 세파로즈, 리포솜, 카복시메틸 셀룰로즈, 폴리아크릴아미드, 폴리스테린, 반려암, 여과지, 이온교환수지, 플라스틱 필름, 플라스틱 튜브, 폴리아민-메틸 비닐-에테르-말레산 공중합체, 아미노산 공중합체, 에틸렌-말레산 공중합체, 나일론, 금속, 유리, 글래스 비드, 또는 자성 입자 등을 사용할 수 있다. 그 외의 다른 고체 기질로는 세포 배양 플레이트, ELISA 플레이트, 튜브 및 폴리머성 막 등을 사용할 수 있다. 상기 기재는 임의의 가능한 형태, 예를 들어 구형 (비드), 원통형 (시험관 또는 웰 내면), 평면형 (시트, 시험 스트립)을 가질 수 있다.In the present invention, a substrate on which an aptamer is immobilized may be selected from the group consisting of polymer, glass, gold, paper and membrane as a solid substrate, for example. More specifically, there may be mentioned, for example, polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluorine resin, agarose, cellulose, nitrocellulose, dextran, sephadex, sepharose, liposome, carboxymethylcellulose, Polyvinylidene-ether-maleic acid copolymer, amino-acid copolymer, ethylene-maleic acid copolymer, nylon, metal, glass, glass beads, or Magnetic particles and the like can be used. Other solid substrates include cell culture plates, ELISA plates, tubes, and polymeric membranes. The substrate may have any possible shape, such as spherical (bead), cylindrical (test tube or well inner surface), planar (sheet, test strip).

보다 바람직하게는 멀티 웰 플레이트(예를 들어, 24웰, 96웰, 192웰, 384웰, 576웰 등)를 사용할 수 있다.More preferably, a multiwell plate (e.g., 24 wells, 96 wells, 192 wells, 384 wells, 576 wells, etc.) can be used.

본 발명의 압타머가 칩으로 구현되는 경우, 하나 이상의 압타머가 고체 기재 위의 정해진 위치에 배열되어 고밀도로 고정화되어 있는 칩으로 사용될 수 있다. 상기 칩에 대상 시료를 처리하여 시료 내 C형 간염 바이러스와 압타머가 결합체를 형성했는지 여부를 판독함으로써, 시료 내 C형 간염 바이러스의 존재 여부를 확인할 수 있다. When the aptamer of the present invention is implemented as a chip, one or more aptamers can be used as a chip arranged at a predetermined position on a solid substrate and fixed at high density. The presence or absence of the hepatitis C virus in the sample can be confirmed by treating the chip with the target sample and reading whether or not the hepatitis C virus and aptamer in the sample form a complex.

또 하나의 양태로서, 본 발명은 상기 압타머를 시료와 반응시키는 단계를 포함하는, C형 간염 바이러스를 검출하는 방법에 관한 것이다. In another aspect, the present invention relates to a method for detecting hepatitis C virus, comprising the step of reacting said squamometer with a sample.

보다 구체적으로, 본 발명은More specifically, the present invention relates to

제1 압타머를 고체 기재에 고정화하는 단계, Immobilizing the first plaster on the solid substrate,

상기 고체 기재에 시료를 처리하는 단계, 및 Treating the solid substrate with a sample, and

상기 고체 기재에 검출표지가 결합된, 제2 압타머를 처리하는 단계를 포함하며, Treating the second evacuator with the detection label bound to the solid substrate,

상기 제1 압타머 및 제2 압타머는 서로 다른 종류의 것임을 특징으로 하는, 시료 내 C형 간염 바이러스를 검출하는 방법을 제공한다. Wherein the first platemaker and the second platemaker are of different kinds. The present invention also provides a method for detecting hepatitis C virus in a sample.

바람직하게, 제2 압타머는 바이오틴 잔기 등의 검출 표지를 가지고 있어 스트랍타비딘과 결합할 수 있으며, C형 간염 바이러스의 검출은 스트랍타비딘에 결합된 호그래디쉬 퍼락시데이스(streptavidin conjugated HRP)의 활성을 재는 방법으로 수행할 수 있다. 예를 들어, 호그래디쉬 퍼락시데이스에서 나오는 화학발광을 흡광도 450nm에서 측정하는 방법으로 수행할 수 있다. 상기 C형 간염 바이러스 검출을 위한 제2 압타머에는 바이오틴 잔기 외에도, 기타 형광물질, 자성제, 염색물질, 효소, 방사성동위원소 등과 같은 통상의 표지 물질로 표지할 수 있다. 상기 제2 압타머는 제1 압타머와는 다른 E2 단백질 결합 부위와 반응할 수 있기 때문에 신호 증폭이 발생하여 압타머 및 시료 간의 상호작용 유무에 대한 가시적인 확인이 용이하며, 통상의 검출 수단, 예를 들어, 형광 현미경, Radioimmnodetection(RAID) 등을 통하여 검출할 수 있으며, 후술하는 정량방법에도 이용할 수 있다.Preferably, the second aptamer has a detectable label such as a biotin residue and can bind to streptavidin. The detection of hepatitis C virus is carried out by streptavidin-conjugated HRP conjugated to streptavidin ) In the presence or absence of water. For example, chemiluminescence from a horseradish peroxyacid can be measured by measuring the absorbance at 450 nm. The second tympanic membrane for detecting hepatitis C virus may be labeled with a conventional labeling substance such as other fluorescent substances, magnetic agents, dyeing substances, enzymes, radioactive isotopes, etc. in addition to the biotin residues. Since the second aptamer can react with an E2 protein binding site different from that of the first abdotamer, signal amplification occurs and it is easy to visually confirm the presence or absence of interaction between the abatumer and the sample. For example, fluorescence microscopy, radioimmunodetection (RAID), etc., and can be used for quantification methods described later.

또한, 바람직하게, 상기 제1 압타머(포획 압타머)는 서열번호 2의 압타머이고 제2 압타머(탐지 압타머)는 서열번호 4의 압타머인 경우 바이러스를 검출하는 효과가 특히 우수하다.Preferably, the first plummeter (captive plammer) is the platemer of SEQ ID NO: 2 and the second plummeter (detection pressure tamer) is the platemer of SEQ ID NO: 4, .

또 하나의 양태로서, 본 발명은 상기 압타머를 시료와 반응시키는 단계를 포함하는, C형 간염 바이러스를 정량하는 방법에 관한 것이다. In another aspect, the present invention relates to a method for quantitating hepatitis C virus, comprising the step of reacting the squamometer with a sample.

보다 구체적으로, 본 발명은 More specifically, the present invention relates to

제1 압타머를 고체 기재에 고정화하는 단계, Immobilizing the first plaster on the solid substrate,

상기 고체 기재에 시료를 처리하는 단계, 및 Treating the solid substrate with a sample, and

상기 고체 기재에 검출표지가 결합된 제2 압타머를 처리하는 단계를 포함하며, Treating the solid substrate with a second platemer having a detection label bound thereto,

상기 제1 압타머 및 제2 압타머는 서로 다른 종류의 것임을 특징으로 하는,Characterized in that the first plummeter and the second plummeter are of different kinds.

시료 내 C형 간염 바이러스를 정량하는 방법을 제공한다.A method for quantifying hepatitis C virus in a sample is provided.

바람직하게, 상기 제1 압타머(포획 압타머)는 서열번호 2의 압타머이고 제2 압타머(탐지 압타머)는 서열번호 4의 압타머인 경우 바이러스를 정량하는 효과가 특히 우수하다.Preferably, the first plummeter (captive pressure tamer) is the platemer of SEQ ID NO: 2 and the second plummeter (detection pressure tamer) is the platemer of SEQ ID NO: 4.

또 하나의 양태로서, 본 발명은, 상기 압타머를 환자의 시료와 반응시키는 단계를 포함하는, C형 간염 진단에 정보를 제공하는 방법에 관한 것이다. In another aspect, the present invention relates to a method of providing information to hepatitis C diagnosis, comprising the step of reacting said squamometer with a sample of a patient.

보다 구체적으로, 본 발명은More specifically, the present invention relates to

상기 압타머를 환자의 시료와 반응시키는 단계, 및 Reacting the platemaker with a sample of a patient, and

상기 환자의 시료에서의 압타머의 결합 정도를 측정하는 단계를 포함하고,Measuring the degree of binding of the platemaker in the sample of the patient,

상기 환자의 시료에서의 압타머의 결합 정도가 정상 시료에서의 결합 정도보다 높은 경우 상기 환자를 C형 간염 환자로 판단하는 것을 특징으로 하는, C형 간염 진단에 필요한 정보를 제공하는 방법을 제공한다.Wherein the patient is judged to be a hepatitis C patient when the degree of binding of the platemer in the patient sample is higher than the degree of binding in the normal sample, .

본 발명에서의 "시료"는 C형 간염 바이러스를 함유하거나 또는 함유할 것으로 추정되는 임의의 물질을 말한다. 시료는 천연 또는 합성된 것일 수 있고, 통상의 기술자에게 공지된 임의 수단을 통해 수득될 수 있다. 시료는 조직, 세포, 전혈, 혈장, 혈청, 혈액, 타액, 객담, 림프액, 뇌척수액, 세포간액 또는 뇨 뿐만 아니라, 시험관 내 세포 배양 성분의 시료, 예를 들면, 세포 성분, 세포배양배지, 재조합세포 등을 포함할 수 있다."Sample" in the present invention refers to any substance that contains or is suspected of containing hepatitis C virus. The sample may be natural or synthetic and may be obtained by any means known to one of ordinary skill in the art. The sample may be a sample of an in vitro cell culture component such as a tissue, a cell, a whole blood, a plasma, a serum, a blood, a saliva, a sputum, a lymphatic fluid, a cerebrospinal fluid, an intracellular fluid or a urine, And the like.

본 발명에서 "환자의 시료"는 C형 간염 질환의 발병 여부를 판단할 대상개체로부터 얻어진 생물학적 시료를 말하며, 조직, 세포, 전혈, 혈장, 혈청, 혈액, 타액, 객담, 림프액, 뇌척수액, 세포간액 또는 뇨일 수 있다.The term "patient sample" in the present invention refers to a biological sample obtained from a subject to be examined for the incidence of hepatitis C infection, and is a biological sample obtained from tissues, cells, whole blood, plasma, serum, blood, saliva, sputum, Or urine.

본 발명에서 "정상 시료"는 C형 간염 질환이 발병하지 않은 개체로부터 얻어진 생물학적 시료를 말한다.In the present invention, "normal sample" refers to a biological sample obtained from an individual who has not developed hepatitis C disease.

상기 생물학적 시료에서 압타머의 결합 정도를 측정하는 단계는 관련 기술분야에서 통상적으로 사용되는 DNA 압타머 결합 측정 기술을 이용하여 수행될 수 있으며, 예컨대, 압타머 말단에 형광 또는 방사성 물질 표지하거나 비오틴을 결합시켜 형광 또는 방사성 세기를 측정하거나, 이미지화하여 관찰하는 방법 등을 이용할 수 있으나, 이에 제한되는 것은 아니다.The step of measuring the degree of binding of the platemer in the biological sample may be performed using a DNA tympaner binding assay technique commonly used in the related art. For example, fluorescence or radioactive substance may be labeled at the end of the platum, A fluorescence or a radioactive intensity may be measured, or an image may be observed, but the present invention is not limited thereto.

또 하나의 양태로서, 본 발명은 In another aspect,

C형 간염 바이러스, 또는 C형 간염 바이러스를 포함하는 시료에 항바이러스제 또는 C형 간염 치료제를 처리하는 단계, Treating a sample containing hepatitis C virus or hepatitis C virus with an antiviral agent or hepatitis C therapeutic agent,

상기 시료에 압타머를 처리하는 단계, 및 Treating the sample with an abatumer, and

상기 시료에서 항바이러스제 또는 C형 간염 치료제를 처리하기 전과 처리한 후의 압타머 결합 정도를 측정하는 단계를 포함하는, And measuring the degree of tympanic binding after and before the treatment of the antiviral agent or the hepatitis C therapeutic agent in the sample.

항바이러스제 또는 C형 간염 치료제의 모니터링 방법에 관한 것이다.An antiviral agent or a hepatitis C therapeutic agent.

본 발명에서는 항바이러스제 또는 C형 간염 치료제를 처리한 시료에 대하여 본 발명의 압타머를 처리하여 압타머의 결합 정도의 변화를 측정함으로써, 해당 항바이러스제 또는 C형 간염 치료제의 바이러스 저해능 및 치료 효과를 모니터링 할 수 있다. 예를 들어, 항바이러스제 또는 C형 간염 치료제의 처리에 따라 시료 내 압타머 결합체의 검출 정도가 감소하는 경우, 해당 항바이러스제 또는 C형 간염 치료제의 항바이러스 효과 및 치료 효과가 우수한 것으로 판단할 수 있다.In the present invention, a sample treated with an antiviral agent or a hepatitis C treatment agent is treated with the platemer of the present invention to measure changes in the binding degree of the platamer, whereby the virus inhibiting effect and therapeutic effect of the antiviral agent or hepatitis C treatment agent Can be monitored. For example, when the degree of detection of the platelet aggregation in the sample decreases with the treatment of the antiviral agent or the hepatitis C treatment agent, it can be judged that the antiviral effect and the therapeutic effect of the antiviral agent or hepatitis C treatment agent are excellent .

또 하나의 양태로서, 본 발명은 In another aspect,

C형 간염 바이러스, 또는 C형 간염 바이러스를 포함하는 시료에 C형 간염 치료제 후보물질을 처리하는 단계, Treating a sample containing hepatitis C virus, or hepatitis C virus, with a hepatitis C therapeutic agent candidate,

상기 시료에 압타머를 처리하는 단계, 및 Treating the sample with an abatumer, and

상기 시료에서 후보물질을 처리하기 전과 처리한 후의 압타머 결합 정도를 측정하는 단계를 포함하는, And measuring the degree of tympanic binding before and after treating the candidate material in the sample.

C형 간염 치료제의 스크리닝 방법에 관한 것이다.And a screening method of a hepatitis C therapeutic agent.

본 발명에서는 C형 간염 치료제 후보물질을 처리한 시료에 대하여 본 발명의 압타머를 처리하여 압타머 결합 정도의 변화를 측정함으로써, 해당 후보물질의 바이러스 저해능 및 치료 효과를 결정할 수 있다. 예를 들어, 후보물질의 처리에 따라 시료 내 압타머 결합체의 검출 정도가 감소하는 경우, 해당 후보물질을 C형 간염 치료제로 선별할 수 있다.
In the present invention, it is possible to determine the virus-inhibiting ability and the therapeutic effect of the candidate substance by measuring the change in the degree of binding of the platamer by treating the platelma of the present invention with a sample treated with a candidate for hepatitis C treatment agent. For example, in the case where the degree of detection of the platem binding in the sample decreases with the treatment of the candidate substance, the candidate substance can be selected as a therapeutic agent for hepatitis C infection.

본 발명은 C형 간염 바이러스의 감염 여부를 판별하는데 사용할 수 있으며, 감염성이 있는 C형 간염 바이러스의 양을 측정할 수 있으며, C형 간염 바이러스에 대한 치료제의 개발을 위한 항바이러스 효과의 측정 도구로 사용할 수 있어, 기존의 방법보다 훨씬 간단하고 빠르게 C형 간염 바이러스의 감염 여부를 판단할 수 있다. 또한 C형 간염 바이러스의 검출 및 정량을 함에 있어서 용이하면서도 보다 정확할 수 있으며, C형 간염 치료제의 치료효과를 측정할 수 있다.
The present invention can be used to determine whether or not an infection with hepatitis C virus can be detected and can measure the amount of infectious hepatitis C virus and is a tool for measuring the antiviral effect for the development of a therapeutic agent against hepatitis C virus It is much easier and quicker to detect the hepatitis C virus infection than the conventional method. In addition, the detection and quantification of hepatitis C virus can be easily and accurately performed, and the therapeutic effect of the hepatitis C treatment agent can be measured.

도 1은 압타머 스크리닝을 위해 C형 간염 바이러스 E2 단백질의 분리정제 결과를 나타낸 것이다.
도 2는 벤질기가 붙어 있는 변형된 염기(benzylaminocarbonyl-dUridine)의 구조를 나타낸 것이다.
 도 3은 E2 압타머를 이용한 샌드위치 방식 에세이 과정을 그림으로 나타낸 것이다.
도 4는 여러 가지 E2 압타머 쌍 중 가장 효율이 높은 것을 찾은 결과를 나타낸다.
 도 5는 단일 탐지 압타머를 이용한 탐지 과정을 그림으로 나타낸 것이다.
도 6은 단일 압타머 와 다중 압타머의 효율을 농도별로 비교한 결과를 나타낸 것이다.
 도 7은 ELASA를 이용해서 C형 간염 바이러스의 E2 단백질을 농도별로 검침한 결과를 나타내는 것으로, (a)는 유전형 2a인 C형 간염 바이러스의 E2 단백질, (b)는 유전형 1a인 C형 간염 바이러스의 E2 단백질, (c)는 유전형 1b인 C형 간염 바이러스의 E2 단백질에 관한 것이다.
  도 8은 ELASA를 이용하여 C형 간염 바이러스를 감염 농도별로 검침한 결과를 나타내는 것으로서, (a)는 유전형 2a인 C형 간염 바이러스, (b)는 유전형 1a인 C형 간염 바이러스에 관한 것이다.
 도 9는 항바이러스제를 처리 하였을 때 바이러스가 증식하지 못하거나 치료되는 과정을 ELASA를 이용해 모니터링 한 것을 나타낸 것이다. (a)는 항바이러스제 처리시 배양액에 나오는 바이러스의 양을 나타내었으며, (b)는 바이러스에 감염된 세포에 항바이러스제 처리시의 치료 효과를 나타내었다.
 도 10은 바이러스 감염도와 ELASA값의 상관관계를 그래프로 보여주는 것이다. (a)는 절대값을 비교한 것이고 (b)는 (a)를 이용해서 correlation coeffeciency 를 구한 그래프이다.
도 11은 C형 간염바이러스의 RNA 카피 수와 ELASA값의 상관관계를 그래프로 보여주는 것이다. (a)는 절대값을 비교한 것이고 (b)는 (a)를 이용해서 correlation coeffeciency 를 구한 그래프이다.
Figure 1 shows the results of isolation and purification of hepatitis C virus E2 protein for screening of platemoker.
Figure 2 shows the structure of a benzylaminocarbonyl-dyridine with a benzyl group attached.
FIG. 3 is a diagram illustrating a sandwich method essay process using an E2 pressure tamer.
Figure 4 shows the result of finding the most efficient of the various pairs of E2 press tamer.
5 shows a detection process using a single detection pressure tamer.
6 shows the results of comparing the efficiencies of a single plummeter and multiple plumbers by concentration.
FIG. 7 shows the result of measuring the E2 protein of the hepatitis C virus by ELASA concentration, wherein (a) is the E2 protein of the hepatitis C virus type 2a and (b) is the hepatitis C virus E2 protein of hepatitis C virus, and (c) E2 protein of hepatitis C virus type 1b.
FIG. 8 shows the result of measuring the hepatitis C virus infection level by using ELASA, wherein (a) is hepatitis C virus type 2a and (b) is hepatitis C type C virus.
FIG. 9 shows that ELISA was used to monitor the process in which the virus did not proliferate or was treated when the antiviral agent was treated. (a) shows the amount of virus in the culture solution when the antiviral agent was treated, and (b) showed the therapeutic effect in treating the virus-infected cells with the antiviral agent.
FIG. 10 is a graph showing the correlation between the virus infection and the ELASA value. (a) is a comparison of absolute values and (b) is a graph of correlation coeffeciency using (a).
11 is a graph showing the correlation between the RNA copy number and the ELASA value of the hepatitis C virus. (a) is a comparison of absolute values and (b) is a graph of correlation coeffeciency using (a).

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명이 하기 실시예에 의해 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

실시예Example 1.  One. E2E2 압타머Abtamer 발굴 excavation

압타머 발굴을 위해서 E2 단백질의 소포체 바깥에 존재하는 부분 (UniProtKB Q99IB8 아미노산 383-729)을 효모에서 발현한 후에 분리정제 하였다 (도 1). 변형된 핵산 (도 2)를 이용한 advanced SELEX (PLoS One. 2010; 5(12): e15004)를 진행해서 최종적으로 E2에 강하게 결합하는 네 종류의 압타머를 얻게 되었다 (표 1과 2). For digestion, the portion of the E2 protein outside the ER (UniProtKB Q99IB8 amino acid 383-729) was isolated and purified after yeast expression (Fig. 1). We proceeded to advanced SELEX (PLoS One. 2010; 5 (12): e15004) using modified nucleic acid (Fig. 2) to finally obtain four types of plasters strongly binding to E2 (Tables 1 and 2).

발굴된 압타머 염기서열Excavated abalone nucleotide sequence AptamerAptamer Aptamer Sequence (variable region)Aptamer Sequence (variable region) 서열번호SEQ ID NO: E2-AE2-A CUUUAUGCGUUUGCCUCGGAGUUUGGAGAGACUCGGCCCUUUAUGCGUUUGCCUCGGAGUUUGGAGAGACUCGGCC 1One E2-BE2-B AUUAGACCCAUUGCCAUUUUAUCAUUAAUUUAUACCGUGCAUUAGACCCAUUGCCAUUUUAUCAUUAAUUUAUACCGUGC 22 E2-CE2-C UCGAGCUUUAUGCGUUUGCCUCGGAGUUUGCGAGCGGAAUCGAGCUUUAUGCGUUUGCCUCGGAGUUUGCGAGCGGAA 33 E2-DE2-D AAACGUGGGUGGUUUGGUGGGGGUUGGUGGGUGGGUUUAAAACGUGGGUGGUUUGGUGGGGGUUGGUGGGUGGGUUUA 44

* U: benzylaminocarbonyl-dUridine
* U: benzylaminocarbonyl-duridine

발굴된 압타머의 Kd 와 Bmax 값Kd and Bmax values of excavated compressors   PoolPool Round 6Round 6 Round 8Round 8 E2-AE2-A E2-BE2-B E2-CE2-C E2-DE2-D Kd(nM)Kd (nM) N/AN / A 9.9 ± 1.49.9 ± 1.4 4.6 ± 0.34.6 ± 0.3 1 ± 0.51 ± 0.5 4 ± 0.84 ± 0.8 3.5 ± 1.53.5 ± 1.5 0.8 ± 0.20.8 ± 0.2 Bmax(%)Bmax (%) 19 ± 219 ± 2 63 ± 363 ± 3 56 ± 156 ± 1 75 ± 675 ± 6 71 ± 871 ± 8 64 ± 1164 ± 11 80 ± 580 ± 5

상기 얻어진 E2 압타머와 SELEX round를 거친 pool간의 결합 친화력을 상기 표 2에 나타내었다. Bmax는 input 대비 결합한 압타머의 비율을 나타낸 것으로, 1에 가까울수록 좋은 성능을 의미하는 것이고, Kd(dissociation constant)는 친화력을 나타내는 수치로 수치가 낮을수록 결합력이 높음을 의미한다. Round는 SELEX 단계 중 특정 Round 후 얻어지는 pool을 의미한다.
Table 2 shows the binding affinities between the obtained E2 platemaker and the pool through the SELEX round. Bmax represents the ratio of the combined platamers to the input. The closer to 1, the better the performance. The dissociation constant (Kd) is the value indicating the affinity. The lower the value, the higher the binding force. Round means the pool obtained after a certain round of SELEX step.

실시예Example 2.  2. E2E2 에 대한  For 압타머를Abtammer 이용한 새로운 C형 간염 바이러스 검침 방법인 ' Hepatitis C virus infection, EnzymeEnzyme LinkedLinked AptoApto -- SorbentSorbent AssayAssay (( ELASAELASA )'개발)'Development

실시예 1에서 발굴한 네 종류의 E2 압타머를 이용해서 E2 단백질의 정량과 C형 간염 바이러스의 감염도를 정확히 측정할 수 있는 방법을 개발하였으며, 본 발명에서는 이를 ‘Enzyme Linked Apto-Sorbent Assay (ELASA)' 라고 명명하였다. The inventors of the present invention have developed a method for accurately measuring the amount of E2 protein and the infectivity of hepatitis C virus using four types of E2 depressors uncovered in Example 1. In the present invention, the 'Enzyme Linked Apto-Sorbent Assay ELASA) '.

ELASA의 작동 원리는 기본적으로 항체를 이용하는 ELISA의 그것과 유사하며, 한 종류의 압타머를 96 well 용기 바닥에 고정시켜 포획(Capture) 압타머로 사용하고, 다른 종류의 압타머에는 바이오틴을 붙여서 탐지(Detection) 압타머로 사용하였다. 조사하고자 하는 샘플에 C형 간염바이러스가 존재하면 포획 압타머와 결합하고, 포획되지 않는 샘플의 나머지 부분은 씻어낸 후 탐지 압타머를 처리하여 포획 압타머에 결합한 C형 간염바이러스에 결합하였다. 탐지 압타머가 바이오틴 잔기를 가지고 있어서 스트랍타비딘과 결합할 수 있음을 이용하여, 결합하지 않은 탐지 압타머는 씻어버리고, 용기에 남아 있는 탐지 압타머의 양은 스트랍타비딘에 결합된 호스래디쉬 퍼락시데이스 (streptavidin conjugated HRP)의 활성을 잴 수 있는 방법으로 정량하였다. 호스래디쉬 퍼락시데이스에서 나오는 화학발광을 흡광도 450 nm에서 측정하였다 (도 3). The principle of ELASA is basically similar to that of an ELISA using antibodies. One type of platamer is fixed on the bottom of a 96-well plate and used as a capturing platemaker. Detection) was used as an absorber. If the hepatitis C virus is present in the sample to be investigated, it binds to the hepatitis C virus bound to the capture tympanum by binding to the capture tympanic membrane and treating the remaining portion of the unaptured sample after washing. Detection The use of aptamers with biotin residues to combine with streptavidin allows the unattached detection aptamer to be washed away and the amount of detection abdominal tether remaining in the container to be quantified using a horseradish peroxidase conjugated to streptavidin The activity of streptavidin conjugated HRP was determined by a measurable method. Chemiluminescence from horseradish peroxidase was measured at 450 nm absorbance (Figure 3).

상기 고안된 방법을 이용해서 E2에 대한 4가지 압타머 중 가장 잘 작동하는 압타머 쌍을 찾기 위해서 세포배양액에 존재하는 바이러스 샘플을 이용해서 ELASA를 진행하였다. 그 결과 포획 압타머 B(서열번호 2)와 탐지 압타머 D(서열번호 4) 쌍이 가장 잘 바이러스를 검침하였다 (도 4). ELASA was performed using a virus sample present in the cell culture solution to find the best working platamer pair among the four compressors for E2 using the above designed method. As a result, the capture platemaker B (SEQ ID NO: 2) and the detection pressure tamer D (SEQ ID NO: 4) pair performed the best virus detection (FIG.

상기 발굴된 E2 압타머 (포획 압타머 B 와 탐지 압타머 D)의 결합력을 높이기 위해서 다중 압타머 (multivalent aptamer)를 디자인하였다. 스트랍타비딘에 4가지 바이오틴 결합 부위가 있다는 것을 이용해서 바이오틴에 결합된 압타머와 스트랍타비딘에 결합된 호스래디쉬 퍼락시데이스를 미리 반응시켜 다중 압타머와 호스래디쉬 퍼락시데이스의 결합체를 생성시켰다 (도 5). A multivalent aptamer was designed to increase the binding force between the excavated E2 pressure tamer (capture pressure tamer B and detection pressure tamer D). Using the fact that there are four kinds of biotin binding sites on streptavidin, the biotin-conjugated platamer and the horseradish perlactidase-bound horseradish perlactidase are reacted in advance to form the multitamper and the horseradish perlactidase (Fig. 5).

상기와 같이 만든 다중 압타머와 단일 압타머를 이용해서 바이러스 검침 한계를 비교하였다. 그 결과 다중 압타머가 4 배정도 (3.13 ~ 6.25 x 102 FFU/ml) 더 강한 민감도를 보였으므로 ELASA에서 다중 압타머를 이용하는 것이 더 바람직하다 (도 6).
The limits of virus detection were compared using the multiple pressure tamer and the single pressure tammer. As a result, it was more desirable to use multiple pressure tampers in ELASA (Fig. 6) since the multiple aspirators showed a stronger sensitivity four times (3.13 to 6.25 x 10 2 FFU / ml).

실시예Example 3.  3. ELASAELASA 를 이용한 분리 정제된 Separation and purification using E2E2 단백질 및 C형 간염 바이러스  Protein and hepatitis C virus 존재여부Presence 검침 및 정량 Metering and Quantification

ELASA가 E2 단백질이나 C형 간염바이러스를 어느 정도까지 검침할 수 있는지 확인하기 위해서 여러 유전형의 E2 단백질 (2a, 1a 및 1b) 및 바이러스 (2a 및 1a)를 각각 이용해서 검침 한계를 측정해보았다. 단백질의 경우 2a, 1a 및 1b 유전형 모두 약 16 ng/ml까지 측정할 수 있었고 (도 7), 바이러스의 경우 3.8 ~ 6.25 x 102 FFU/ml까지 측정 할 수 있었다 (도 8). To determine the extent to which ELASA can measure E2 protein or hepatitis C virus, we used the different types of E2 proteins (2a, 1a, and 1b) and viruses (2a and 1a) In the case of protein, 2a, 1a and 1b genotypes could be measured up to about 16 ng / ml (FIG. 7) and viruses could be measured from 3.8 to 6.25 x 10 2 FFU / ml (FIG. 8).

이러한 결과를 통해서 ELASA는 여러 가지 유전형의 E2 단백질 및 C형 간염바이러스를 측정하는데 있어서 적합한 검침 시스템임을 알 수 있었다. 
These results indicate that ELASA is a suitable meter reading system for measuring various genotypes of E2 protein and hepatitis C virus.

실시예Example 4.  4. ELASAELASA 를 이용한 항바이러스제의 효과 확인Of antiviral drugs

바이러스 증식을 정확히 모니터링 하는 것은 항바이러스제의 개발에 있어서 매우 중요하다. 위에서 언급한 감염성 있는 바이러스 양을 측정하는데 적합하다고 여겨지는 ELASA를 이용해서 항바이러스제를 투여하고 시간에 따라서 바이러스 증식여부를 확인하였다. 바이러스를 세포에 감염시키고 기존에 잘 알려진 항바이러스제 (BMS-790052, IFN-α)를 처리하였을 때 배양액에 나오는 바이러스의 양을 측정하였다. 항바이러스제를 처리하지 않았을 때는 ELASA 값이 바이러스 양과 마찬가지로 계속 증가하지만 항바이러스제를 처리하였을 때는 값이 증가하지 않았다 (도 9(a)). 그리고 이미 감염되어 있는 세포에 항바이러스제를 처리하였을 때의 치료 효과 역시 ELASA로 잘 관찰됨을 알 수 있었다 (도 9(b)).
Precise monitoring of virus proliferation is very important in the development of antiviral agents. The ELASA, which is considered to be suitable for measuring the amount of infectious virus mentioned above, was used to administer an antiviral agent and to confirm the virus proliferation over time. The amount of virus in the culture broth was measured when the virus was infected with the cells and treated with the well-known antiviral agent (BMS-790052, IFN-α). When the antiviral agent was not treated, the ELASA value increased continuously as in the case of the virus amount, but the value did not increase when the antiviral agent was treated (Fig. 9 (a)). In addition, the therapeutic effect of the antiviral agent on the cells already infected was also well observed by ELASA (Fig. 9 (b)).

실시예Example 5. C형 간염 바이러스의 감염도 및  5. Infection with hepatitis C virus and RNARNA 카피 수와  Number of copies ELASAELASA 값과의 상호 연관성 Correlation with values

본 발명에서 개발된 ELASA는 C형 간염바이러스 감염도와 직접적으로 관련이 있는 C형 간염바이러스 표면 단백질인 E2를 인식하므로, 실제 감염도와 ELASA 값이 상호 연관성이 있는지 확인해보았다. 또한 대조군으로 C형 간염바이러스 감염도와 상호 연관성이 낮은 C형 간염바이러스 RNA 카피 수와 비교하였다. ELASA developed in the present invention recognizes E2, a hepatitis C virus surface protein directly related to hepatitis C virus infection, and thus it is confirmed whether the actual infection and the ELASA value are correlated with each other. We also compared the number of hepatitis C virus RNA copies that were not correlated with hepatitis C virus infection as a control group.

ELASA 값은 감염성 있는 바이러스 양과 높은 상호 연관성이 보였으나 (도 10), RNA 카피수의 경우, 감염성 있는 바이러스 양과의 상관관계가 낮게 나타났다 (도 11). 이 결과는 ELASA가 감염성이 있는 C형 간염바이러스의 정량에 활용할 수 있음을 보여준다.
ELASA values were highly correlated with the amount of infectious virus (FIG. 10), but the RNA copy number correlated poorly with the amount of infectious virus (FIG. 11). These results show that ELASA can be used to quantify infectious hepatitis C virus.

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Aptamer for envelope protein E2 of Hepatitis C Virus and uses thereof <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> E2 aptamer (E2-A) <400> 1 cuuuaugcgu uugccucgga guuuggagag acucggcc 38 <210> 2 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> E2 aptamer (E2-B) <400> 2 auuagaccca uugccauuuu aucauuaauu uauaccgugc 40 <210> 3 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> E2 aptamer (E2-C) <400> 3 ucgagcuuua ugcguuugcc ucggaguuug cgagcggaa 39 <210> 4 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> E2 aptamer (E2-D) <400> 4 aaacgugggu gguuuggugg ggguuggugg guggguuua 39 <110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Aptamer for envelope protein E2 of Hepatitis C Virus and uses          the <160> 4 <170> Kopatentin 1.71 <210> 1 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> E2 aptamer (E2-A) <400> 1 cuuuaugcgu uugccucgga guuuggagag acucggcc 38 <210> 2 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> E2 aptamer (E2-B) <400> 2 auuagaccca uugccauuuu aucauuaauu uauaccgugc 40 <210> 3 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> E2 aptamer (E2-C) <400> 3 ucgagcuuua ugcguuugcc ucggaguuug cgagcggaa 39 <210> 4 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> E2 aptamer (E2-D) <400> 4 aaacgugggu gguuuggugg ggguuggugg guggguuua 39

Claims (29)

C형 간염 바이러스 E2 에 특이적으로 결합하고, 서열번호 1 내지 서열번호 4로 이루어진 군에서 선택된 염기서열을 포함하며, U(uracil) 또는 dU(deoxyuracil)에 벤질기가 첨가되어 있는 변형된 염기를 5 내지 15개 포함하며, 총 25 내지 100개의 염기로 이루어진 압타머.
A modified base which specifically binds to hepatitis C virus E2 and contains a nucleotide sequence selected from the group consisting of SEQ ID NOS: 1 to 4 and a benzyl group is added to U (uracil) or dU (deoxyuracil) To 15, and a total of 25 to 100 bases.
삭제delete 제1항에 있어서,
상기 압타머는 5' 말단 부위, 중간 부위, 3' 말단 부위, 또는 양 말단 부위에 폴리에틸렌글리콜(polyethylene glycol, PEG), idT (inverted deoxythymidine), LNA (Locked Nucleic Acid), 2'-메톡시 뉴클레오사이드, 2'-아미노 뉴클레오사이드, 2'F-뉴클레오사이드, 아민 링커, 티올 링커 및 콜레스테롤로 이루어진 군에서 선택되는 하나 이상이 결합되어 변형된 것을 특징으로 하는 압타머.
The method according to claim 1,
The aptamer has polyethylene glycol (PEG), inverted deoxythymidine (idT), locked nucleic acid (LNA), 2'-methoxy nucleotide at the 5 'end, middle, Wherein at least one member selected from the group consisting of 2'-amino nucleoside, 2'-amino nucleoside, 2'F-nucleoside, amine linker, thiol linker and cholesterol is combined and modified.
제1항에 있어서, 상기 압타머는 이합체, 삼합체 또는 사합체인 것을 특징으로 하는 압타머.
2. The platemaker according to claim 1, wherein the aptamer is a dimer, trimer or quadrature.
제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머를 포함하는, C형 간염 바이러스 검출용 조성물.
A composition for the detection of hepatitis C virus comprising the platemer of any one of claims 1, 3, and 4.
제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머를 포함하는, C형 간염 바이러스를 정량용 조성물.
A composition for quantitatively determining hepatitis C virus comprising the platemer of any one of claims 1, 3, and 4.
제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머를 포함하는, C형 간염 진단용 조성물.
A composition for the diagnosis of hepatitis C comprising the platemer of any one of claims 1, 3, and 4.
제5항의 조성물을 포함하는, C형 간염 바이러스 검출용 키트.
A kit for detecting hepatitis C virus comprising the composition of claim 5.
제6항의 조성물을 포함하는, C형 간염 바이러스 정량용 키트.
A kit for quantitating hepatitis C virus comprising the composition of claim 6.
제7항의 조성물을 포함하는, C형 간염 진단용 키트.
A kit for the diagnosis of hepatitis C comprising the composition of claim 7.
제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머가 고정된 기재를 포함하는, C형 간염 바이러스 검출용 칩.
A chip for detecting hepatitis C virus, wherein the aptamer of any one of claims 1, 3, and 4 comprises a fixed substrate.
제11항에 있어서, 상기 압타머가 고정된 기재는 고체기재로서 고분자, 유리, 금, 종이 및 생체막으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 C형 간염 바이러스 검출용 칩.
The chip for detecting hepatitis C virus according to claim 11, wherein the substrate on which the aptamer is immobilized is at least one selected from the group consisting of polymer, glass, gold, paper and biological film as a solid substrate.
제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머가 고정된 기재를 포함하는, C형 간염 바이러스 정량용 칩.
A chip for hepatitis C virus quantification, wherein the aptamer of any one of claims 1, 3, and 4 comprises a fixed substrate.
제13항에 있어서, 상기 압타머가 고정된 기재는 고분자, 유리, 금, 종이 및 생체막으로 이루어진 군에서 선택된 고체 기재인, C형 간염 바이러스 정량용 칩.
14. The chip for quantitating hepatitis C virus according to claim 13, wherein the substrate on which the aptamer is immobilized is a solid substrate selected from the group consisting of polymer, glass, gold, paper and biological film.
제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머가 고정된 기재를 포함하는, C형 간염 바이러스 진단용 칩.
A chip for hepatitis C virus diagnosis, wherein the aptamer of any one of claims 1, 3, and 4 comprises a fixed substrate.
제15항에 있어서, 상기 압타머가 고정된 기재는 고분자, 유리, 금, 종이 및 생체막으로 이루어진 군에서 선택된 고체 기재인, C형 간염 바이러스 진단용 칩.
16. The chip for diagnosis of hepatitis C virus according to claim 15, wherein the substrate on which the aptamer is immobilized is a solid substrate selected from the group consisting of polymer, glass, gold, paper and biological membrane.
제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머를 시료와 반응시키는 단계를 포함하는, C형 간염 바이러스를 검출하는 방법.
A method for detecting hepatitis C virus comprising the step of reacting a platemer according to any one of claims 1, 3, and 4 with a sample.
제17항에 있어서, 제1 압타머를 고체 기재에 고정화하는 단계,
상기 고체 기재에 시료를 처리하는 단계, 및
상기 고체 기재에 검출표지가 결합된 제2 압타머를 처리하는 단계를 포함하며,
상기 제1 압타머 및 제2 압타머는 서로 다른 종류의 것임을 특징으로 하는,
시료 내 C형 간염 바이러스를 검출하는 방법.
18. The method of claim 17, further comprising the steps of:
Treating the solid substrate with a sample, and
Treating the solid substrate with a second platemer having a detection label bound thereto,
Characterized in that the first plummeter and the second plummeter are of different kinds.
A method for detecting hepatitis C virus in a sample.
제18항에 있어서, 상기 검출표지는 바이오틴, 형광물질, 자성체, 염색물질, 효소, 방사성 동위원소로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 제2 압타머를 처리하는 단계를 포함하는, 시료 내 C형 간염 바이러스를 검출하는 방법.
The method of claim 18, wherein the detection label is at least one selected from the group consisting of biotin, a fluorescent material, a magnetic material, a dye material, an enzyme, and a radioactive isotope. A method for detecting hepatitis C virus.
제18항에 있어서, 상기 제1 압타머는 서열번호 2의 아미노산 서열로 이루어진 압타머이고, 상기 제2 압타머는 서열번호 4의 아미노산 서열로 이루어진 압타머인, 시료 내 C형 간염 바이러스를 검출하는 방법.
19. The method of claim 18, wherein the first aptamer is an uterine comprising the amino acid sequence of SEQ ID NO: 2, and the second aptamer is an uterine comprising the amino acid sequence of SEQ ID NO: 4, .
제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머를 시료와 반응시키는 단계를 포함하는, C형 간염 바이러스를 정량하는 방법.
A method for quantitating hepatitis C virus comprising the step of reacting a squamometer of any one of claims 1, 3, and 4 with a sample.
제21항에 있어서, 제1 압타머를 고체 기재에 고정화하는 단계,
상기 고체 기재에 시료를 처리하는 단계, 및
상기 고체 기재에 검출표지가 결합된 제2 압타머를 처리하는 단계를 포함하며,
상기 제1 압타머 및 제2 압타머는 서로 다른 종류의 것임을 특징으로 하는,
시료 내 C형 간염 바이러스를 정량하는 방법.
22. The method of claim 21, further comprising the steps of:
Treating the solid substrate with a sample, and
Treating the solid substrate with a second platemer having a detection label bound thereto,
Characterized in that the first plummeter and the second plummeter are of different kinds.
A method for quantifying hepatitis C virus in a sample.
제22항에 있어서, 상기 검출표지는 바이오틴, 형광물질, 자성체, 염색물질, 효소, 방사성동위원소로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 제2 압타머를 처리하는 단계를 포함하는, 시료 내 C형 간염 바이러스를 정량하는 방법.
The method according to claim 22, wherein the detection label is at least one selected from the group consisting of biotin, a fluorescent substance, a magnetic substance, a dye substance, an enzyme, and a radioactive isotope. Methods for quantifying hepatitis C virus.
제22항에 있어서, 상기 제1 압타머는 서열번호 2의 아미노산 서열로 이루어진 압타머이고, 상기 제2 압타머는 서열번호 4의 아미노산 서열로 이루어진 압타머인, 시료 내 C형 간염 바이러스를 정량하는 방법.
The method of claim 22, wherein the first aptamer is an uterus consisting of the amino acid sequence of SEQ ID NO: 2 and the second aptamer is an uterus consisting of the amino acid sequence of SEQ ID NO: 4, .
제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머를 환자의 시료와 반응시키는 단계를 포함하는, C형 간염 진단에 정보를 제공하는 방법.
A method of providing information to a hepatitis C diagnosis, comprising the step of reacting a platemer of any one of claims 1, 3, and 4 with a sample of a patient.
제25항에 있어서, 압타머를 환자의 시료와 반응시키는 단계, 및
상기 환자의 시료에서의 압타머의 결합 정도를 측정하는 단계를 포함하고,
상기 환자의 시료에서의 압타머의 결합 정도가 정상 시료에서의 결합 정도보다 높은 경우 상기 환자를 C형 간염 환자로 판단하는 것을 특징으로 하는,
C형 간염 진단에 필요한 정보를 제공하는 방법.
26. The method of claim 25, further comprising the steps of:
Measuring the degree of binding of the platemaker in the sample of the patient,
Wherein the patient is judged to be a hepatitis C patient when the degree of binding of the platemer in the patient sample is higher than the degree of binding in the normal sample.
A method for providing information necessary for the diagnosis of hepatitis C infection.
제26항에 있어서, 상기 환자의 시료는 조직, 세포, 전혈, 혈장, 혈청, 혈액, 타액, 객담, 림프액, 뇌척수액, 세포간액 또는 뇨 시료인 방법.
27. The method of claim 26, wherein the patient sample is tissue, cell, whole blood, plasma, serum, blood, saliva, sputum, lymphatic fluid, cerebrospinal fluid, intercellular fluid or urine sample.
C형 간염 바이러스, 또는 C형 간염 바이러스를 포함하는 시료에 항바이러스제 또는 C형 간염 치료제를 처리하는 단계, 및
상기 시료에서 항바이러스제 또는 C형 간염 치료제를 처리하기 전과 처리한 후의 제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머 결합 정도를 측정하는 단계를 포함하는,
항바이러스제 또는 C형 간염 치료제의 모니터링 방법.
Treating a sample containing hepatitis C virus or hepatitis C virus with an antiviral agent or hepatitis C therapeutic agent, and
The method according to any one of claims 1, 3, and 4, further comprising the step of measuring the degree of tympan binding of the sample before and after treatment of the antiviral agent or the hepatitis C therapeutic agent.
Methods for monitoring antiviral or hepatitis C drugs.
C형 간염 바이러스, 또는 C형 간염 바이러스를 포함하는 시료에 C형 간염 치료제 후보물질을 처리하는 단계, 및
상기 시료에서 후보물질을 처리하기 전과 처리한 후의 제1항, 제3항, 및 제4항 중 어느 하나의 항의 압타머 결합 정도를 측정하는 단계를 포함하는,
C형 간염 치료제의 스크리닝 방법.

Treating a sample containing hepatitis C virus, or hepatitis C virus, with a hepatitis C therapeutic agent candidate, and
And measuring the degree of piezometric bonding according to any one of claims 1, 3, and 4 before and after the treatment of the candidate material in the sample.
Screening method of hepatitis C therapeutic agent.

KR20130048749A 2013-04-30 2013-04-30 Aptamer for envelope protein E2 of Hepatitis C Virus and uses thereof KR101480495B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR20130048749A KR101480495B1 (en) 2013-04-30 2013-04-30 Aptamer for envelope protein E2 of Hepatitis C Virus and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR20130048749A KR101480495B1 (en) 2013-04-30 2013-04-30 Aptamer for envelope protein E2 of Hepatitis C Virus and uses thereof

Publications (2)

Publication Number Publication Date
KR20140130338A KR20140130338A (en) 2014-11-10
KR101480495B1 true KR101480495B1 (en) 2015-01-12

Family

ID=52452295

Family Applications (1)

Application Number Title Priority Date Filing Date
KR20130048749A KR101480495B1 (en) 2013-04-30 2013-04-30 Aptamer for envelope protein E2 of Hepatitis C Virus and uses thereof

Country Status (1)

Country Link
KR (1) KR101480495B1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080048382A (en) * 2006-11-28 2008-06-02 (주) 벡스코아 Nuclease-resistant rna aptamer inhibiting replication of hepatitis c virus replicon
KR20100072527A (en) * 2008-12-22 2010-07-01 한국전자통신연구원 Biochip and apparatus for detecting bio materials by using the biochip
US20100184837A1 (en) 2008-10-21 2010-07-22 Xiaolian Zhang Small-molecule nucleotide aptamer for hepatitis C virus, preparation method and use thereof
KR20130012140A (en) * 2013-01-09 2013-02-01 대한민국 (식품의약품안전청장) Aptamer specifically binding to erbb2 receptor and use thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080048382A (en) * 2006-11-28 2008-06-02 (주) 벡스코아 Nuclease-resistant rna aptamer inhibiting replication of hepatitis c virus replicon
US20100184837A1 (en) 2008-10-21 2010-07-22 Xiaolian Zhang Small-molecule nucleotide aptamer for hepatitis C virus, preparation method and use thereof
KR20100072527A (en) * 2008-12-22 2010-07-01 한국전자통신연구원 Biochip and apparatus for detecting bio materials by using the biochip
KR20130012140A (en) * 2013-01-09 2013-02-01 대한민국 (식품의약품안전청장) Aptamer specifically binding to erbb2 receptor and use thereof

Also Published As

Publication number Publication date
KR20140130338A (en) 2014-11-10

Similar Documents

Publication Publication Date Title
Orooji et al. An overview on SARS-CoV-2 (COVID-19) and other human coronaviruses and their detection capability via amplification assay, chemical sensing, biosensing, immunosensing, and clinical assays
Liu et al. A serological aptamer-assisted proximity ligation assay for COVID-19 diagnosis and seeking neutralizing aptamers
Zhou et al. Advancements in detection of SARS-CoV-2 infection for confronting COVID-19 pandemics
Nascimento et al. COVID-19 diagnosis by SARS-CoV-2 Spike protein detection in saliva using an ultrasensitive magneto-assay based on disposable electrochemical sensor
Zhang et al. SARS-CoV-2 detection using quantum dot fluorescence immunochromatography combined with isothermal amplification and CRISPR/Cas13a
Li et al. Development of up-converting phosphor technology-based lateral-flow assay for rapidly quantitative detection of hepatitis B surface antibody
US20140363808A1 (en) Aptamers screening method based on graphene without target immobilization and the aptamers obtained from the method
Burbelo et al. Rapid antibody quantification and generation of whole proteome antibody response profiles using LIPS (luciferase immunoprecipitation systems)
Roberts et al. Japanese encephalitis virus: a review on emerging diagnostic techniques
Alhamid et al. SARS-CoV-2 detection methods: A comprehensive review
KR102016668B1 (en) DNA aptamer binding specifically to chikungunya virus envelope protein 2(CHIKV E2) and uses thereof
CN112941078B (en) Aptamer for detecting novel coronavirus SARS-CoV-2S1 protein, screening method and use thereof
US20230228751A1 (en) Aptamers against sars-cov-2
CN103642942A (en) High-precision nucleic acid quantitative detection kit for hepatitis C virus (HCV)
Xu et al. A simple, rapid, and sensitive integrated protein microarray for simultaneous detection of multiple antigens and antibodies of five human hepatitis viruses (HBV, HCV, HDV, HEV, and HGV)
Martínez-Roque et al. DNA aptamer selection for SARS-CoV-2 spike glycoprotein detection
Wang et al. Track-etched membrane microplate and smartphone immunosensing for SARS-CoV-2 neutralizing antibody
Wei et al. Research progress of biosensors for detection of SARS-CoV-2 variants based on ACE2
KR101970963B1 (en) DNA aptamer binding specifically to yellow fever virus envelope protein domain III (YFV EDIII) and uses thereof
CN109444414A (en) Using the method and corresponding composition, kit of AlphaLISA detection dengue virus
US20100297610A1 (en) Molecularly imprinted polymers for detecting hiv-1
Ellipilli et al. Proof-of-concept for speedy development of rapid and simple at-home method for potential diagnosis of early COVID-19 mutant infections using nanogold and aptamer
WO2020130626A1 (en) Dna aptamer binding specifically to dengue virus ediii and use thereof
KR101480495B1 (en) Aptamer for envelope protein E2 of Hepatitis C Virus and uses thereof
JP4615567B2 (en) Prognosis of liver disease associated with hepatitis C virus infection

Legal Events

Date Code Title Description
A201 Request for examination
N231 Notification of change of applicant
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20180102

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20181102

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20200102

Year of fee payment: 6