KR102002894B1 - Cosmetic composition containing the complex natural extracts - Google Patents

Abstract

The present invention relates to a cosmetic composition containing a natural complex extract as an active ingredient. More specifically, the present invention relates to a cosmetic composition excellent in anti-inflammatory, antioxidant, skin moisturizing and skin regeneration effects, containing, as an active ingredient, a complex extract of Hyssopus Officinalis, Tamarindus indica, Boswellia serrata and Acacia concinna, prepared by performing fermentation with Aspergillus kawachii and hydrolase treatment thereafter.

Description

[0001] The present invention relates to cosmetic compositions containing natural complex extracts,

The present invention relates to a cosmetic composition containing an extract of natural complex as an active ingredient, and more specifically, to a cosmetic composition containing a natural extract of hyssop, tamarind, frankincense, and Shikakai, , Antioxidation, skin moisturizing and skin regeneration.

Skin plays a very important role as a barrier function to protect individuals from the outside. The barrier function is to protect against various external stimuli such as chemicals, atmospheric pollutants, dry environment, ultraviolet ray and the like and to prevent the excessive divergence of water in the body through the skin. Such protection function is a function of protecting the stratum corneum Stratum corneum, horney layer) can be maintained only if it is normally formed. The skin is histologically composed of three layers of epidermis, dermis, and subcutis, and it plays the most important role in terms of skin aging by being present at the outermost part, The most intensive research is the epidermis. In the epidermis, the outermost layers of the stratum corneum constitute keratinocytes and skin lipids. Skin lipids are responsible for the barrier function of the skin. These barrier functions regulate cell division and differentiation of keratinocytes, It is an important function that protects, prevents leakage of substances in the body and prevents evaporation of skin moisture.

The human skin undergoes aging process with deterioration of physiological function over time, and the index of aging appears as skin. The cause of wrinkles in skin aging is largely divided into the generation of wrinkles caused by natural aging and the generation of wrinkles due to photoaging due to exposure to ultraviolet rays. In addition, common wrinkles are found in relation to natural aging and skin changes due to photoaging According to the results thus far, reduction and modification of collagen and elastin, which are main proteins in the dermis, are known to directly contribute to the generation of wrinkles and the reduction of elasticity of skin.

In particular, collagen is a major substrate protein produced in the fibroblasts of skin, and research has been reported that collagen reduction is closely related to wrinkling of the skin. Free radicals that affect collagen reduction are disrupted connective tissue formation of skin collagen etc. Inhibition of cell membrane function DNA mutation promoting protein action Modified intercell energy transduction It is known that it induces deformation of molecules related to metabolism and free radicals Involvement means that antioxidants that inactivate free radicals can be used to delay the aging process.

Especially, as the aging progresses, the skin metabolism is not smooth and various inflammation and allergy to the skin are increased. In addition, people are becoming more susceptible to skin irritation caused by dry indoor environments, pollution, ultraviolet rays, and misused cosmetics and detergents. The skin, which is sensitive to external stimuli, can sometimes be mild as in erythema, but the moisture of the skin's horny layer decreases and the skin becomes dry and the surface becomes rough and cracked. When water loss occurs, keratin is eliminated and it is easy to be exposed to the outside, causing irritation to the stimulation and skin diseases. Dry skin becomes weaker in immune function, and allergies such as itching and atopic dermatitis tend to occur. Therefore, it is important to prevent moisture loss of the skin.

In human keratinocytes and Langerhans cells, various cytokines can be produced by external substances and released. These cytokines are essential for inducing skin irritation and for progression of local inflammatory reactions (J Appl Toxicol 16: 6570, 1996). Indeed, it increases Interleukin-6 (IL-6), Interleukin-1 (IL-1) and Tumor Necrosis Factor-α (TNF-α) in stimulating contact dermatitis. (Contact Dermatitis 35: 355-60, 1996, Dec). In addition, there is a report that IL-6 and TNF-α are induced by applying specific chemicals to IL-6 ((Interleukin-6: IL-6) Dermat 8: 8: 158-64, 1997. The relationship of interleukin-8 (IL-8) to allergic reactions has also been reported (Contact Dermatitis, 35: 355-60, 1996 Dec) Relevant cytokines include IL-1 and TNF-α, and allergen-related cytokines include IL-6 and IL-8.

TNF-α is a cytokine that is mainly secreted from inflammatory cells or glandular cells in response to external stimuli or infectious agents. It is associated with interleukin-1 (IL-1) as well as infection, inflammation, autoimmune, Is a proinflammatory cytokine that plays a central role in the mediation of inflammatory cytokines. Chronic inflammatory diseases in the skin mediated by TNF- [alpha] include psoriasis, eczema or seborrheic dermatitis, and acute inflammatory diseases include contact dermatitis (Mache E Descapms V, Ann. Dermatol. -9, 2002). In addition, TNF-alpha-mediated allergic diseases include atopic dermatitis.

Inhibition of TNF-α activity may be blocked by inhibiting the production, processing and secretion of TNF-α or by inhibiting TNF-α-induced tumor necrosis factor-alpha converting enzyme (TNF -α converting enzyme (TACE), phosphodiesterase 4, an adenosine receptor that changes the level of intracellular cAMP that causes changes in TNF-α gene expression, and NF-kB (NIK, IKK, PKB) and mitogen activated protein kinase (MAPK) such as p38 and c-jun N-terminal kinase (JNK) (Patent Document 10-2008-0051831).

The present inventors selected natural products which are effective for anti-inflammation, antioxidation, moisturizing and skin regeneration, and prepared extracts by various methods and studied their activities. Hyssop, which is produced by hydrolytic enzyme treatment of fermented products by white germ- Tamarind, frankincense and Shikakai complex extract exhibit excellent anti-inflammatory, antioxidative, moisturizing and skin regeneration-promoting activities, and the present invention has been completed.

(0001) Korean Patent No. 10-1453217 (October 22, 2014). (0002) Korean Patent No. 10-1561579 (Oct. 20, 2015)

An object of the present invention is to provide a cosmetic composition which is excellent in anti-inflammatory, antioxidative, moisturizing and skin regenerating effects by containing Hosop, tamarind, frankincense and Shikakai complex extract as natural ingredients.

It is another object of the present invention to provide a method for preparing the hyssop, tamarind, frankincense and sikakai complex extracts.

To achieve the above object, according to the present invention, there is provided a cosmetic composition comprising 0.1 to 10% by weight of a combined extract of hyssop, tamarind, frankincense, and shikakai, which is prepared by hydrolyzing enzyme after fermentation with white gum, / RTI >

The hydrolytic enzyme is preferably? -Glucosidase.

The hyssop, tamarind, frankincense and sikakai complex extracts are prepared by mixing hyssop, tamarind, frankincense and sikakai at a ratio of 1: 3: 1 to 3: 1 to 3: 1 to 3, respectively, By weight in a weight ratio of 3: 2: 1: 3.

The cosmetic composition is characterized in that it is for skin inflammation improvement, antioxidation, moisturizing and skin regeneration.

According to another aspect of the present invention, there is provided a method for producing a composite material, comprising the steps of: (A) mixing washed and dried hyssop, tamarind, frankincense and sikakai at a weight ratio of 1: 3: 1 to 3: 1 to 3: Lt; / RTI > (B) an extraction solvent is extracted with at least one extraction solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol, Lt; / RTI > (C) Inoculating the extracted complex with Aspergillus kawachii and fermenting the mixture at 24 to 25 ° C for 3 to 5 days to prepare a fermented complex; (D) hydrolyzing the fermentation complex by adding? -Glucosidase; And (E) a step of filtration and drying, wherein the extract of hysop, tamarind, frankincense and sikakai is provided.

The extracts of hyssop, tamarind, frankincense and sikakai complex of the present invention prepared by eluting the useful components through white germ fermentation and enzyme treatment exhibit excellent antiinflammation, antioxidation, skin moisturizing and skin regeneration effects by its synergistic action.

Hereinafter, the present invention will be described in more detail.

The present invention relates to a cosmetic composition comprising an extract of natural complex as an active ingredient, and more specifically, it relates to a cosmetic composition comprising extracts of hyssop, tamarind, frankincense and sikakai complex through white germ fermentation and hydrolytic enzyme treatment, , Skin moisturizing effect and skin regeneration effect.

Hyssopus (Hyssopus Officinalis) is a perennial herb with a monocotyledonous plant and is sometimes referred to as hyssop in Korea. The hyssop's spicy malvin component is effective for the gonadal function, and the myrrh liquid and the crushed leaves are used as a cleaning agent or a poultice, and the hyssop extract itself has been reported to function as a virus inhibiting agent. In addition, it is known to be effective for respiratory diseases such as colds and bronchitis, digestion, vaginal action, tonic action, sweating action, diuretic action, astringent action, soothing action and astringent action (antioxidative effect and melanin formation inhibitory effect of hyssop extract, J Soc. Cosmet Sci. Korea, Vol. 42, No. 2, June 2016, 195-201). According to one embodiment of the present invention, a Hissop outpost is used for the production of the complex extract.

Tarindus indica is an evergreen tree of Leguminosae, native to northern Africa, distributed in the arid tropical regions of India and Indonesia, and about 20 meters high. The flowers bloom from the beginning of May to the middle of September, with five to twelve flowers hanging on the pistil, with a purple-red strip on the yellow background and white on the back. Leaves are alternate, feather-like, and leaves are about 2cm long. Two petals fall out of five. Fruit is 20cm long, butterfly is about 2.5cm, and surgical blood is thin. The crocus is sticky, thick, dark brown and contains flat seeds. Fruits are 10-20 cm in length and ripen in 2 ~ 4 months and do not spread. In the Philippines, herbal tea made from leaves has traditionally been used to heat malaria. Fruits are used as beverages, seasonings and medicines in addition to raw foods. Fruit of mature fruit contains about 30% of phytosphingosine and about 15% of pectin and other organic acids. According to one embodiment of the present invention, the fruit of tamarind is used for preparing the complex extract.

The Boswellia serrata resin used in the preparation of the complex extract of the present invention is a resin extract obtained from Indian oriental wood. Indian oriental wood is a boswellia tree like oriental wood. It is a large, branchy deciduous tree that grows in the dry hilly area of India. The resin obtained from wood is similar to frankincense, but the fragrance is softer. Traditionally, the resin has been an important ingredient in making incense, medicine, cosmetics and fragrances. The resin exudate of this plant has been used in indigenous folk remedies as an external antiinflammatory agent that heals various inflammatory symptoms in India. In the oriental medicine, it is said that the flavor is spicy and spicy, and the medicament is mild, and it has the effect of relieving the pain and eliminating the boil. It is also used for abdominal pain, dysmenorrhea, bruises, muscle spasms and malignant tumors. Uses are anti-arthritic and anti-inflammatory agents. Treating the resin by distillation yields a volatile essential oil of 3 to 10%, which contains anisaldehyde, alpha-pinene, alpha-phellandrene, and the like. Inhaling the incense helps to relieve asthma, cold, and cough, and helps with colds, rheumatism, respiratory diseases and nasal congestion. Alpha, beta-boswellic acids (alpha, beta-boswellic acids) are known to act as anti-inflammatory agents. Bosswell's acid is known to inhibit human leukocyte elastase (HLE), an inflammatory leukotriene-inducing pro-inflammatory enzymes. It is also known to inhibit TNF-α, COX-2 and the like, which are typical cytokines of inflammation induction.

Acacia Concinna is a soybean plant, a medicinal plant that grows in the Asian tropics. Shikka means fruit for hair. The leaf of the tree is dried and the wrinkled brown pod-shaped fruit is crushed and made into powder. It is put into the water and applied to scalp and hair, used as ointment, perfume, soap, etc. and used as dandruff and shampoo. It contains the ingredients of alkaloid, malicacid, acacic acid, acacnin AE, acacigenin B, acaciaside, julibroside A1, julibroside A3, albiziasaponin C and concinnosides AF to protect hair moisture, cleanse scalp and hair, promote hair growth and prevent dandruff , A large amount of saponins, palmitic acid, and linoleic acid, and is used as a natural surfactant. According to one embodiment of the present invention, the fruit of Sikakai is used for the production of the complex extract.

According to the present invention, the complex extract is prepared by mixing (A) washed and dried hyssop, tamarind, frankincense and sikakai at a weight ratio of 1: 3: 1 to 3: 1 to 3: 1 to 3, respectively, step; (B) an extraction solvent is extracted with at least one extraction solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol, Lt; / RTI > (C) Inoculating the extracted complex with Aspergillus kawachii and fermenting the mixture at 24 to 25 ° C for 3 to 5 days to prepare a fermented complex; (D) hydrolyzing the fermentation complex by adding? -Glucosidase; And (E) filtering and drying.

According to one embodiment of the present invention, the hyssop, tamarind, frankincense and shikakai are washed with purified water, dried, and mixed with each other at a weight ratio of 1: 3: 1 to 3: 1 to 3: To prepare a composite. The extracting compound is extracted with at least one extraction solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol as the extraction solvent . Preferably, 70% functional ethanol is used as the solvent.

In the present invention, it is also possible to prepare an extract composite by extracting each of hyssop, tamarind, frankincense, and sikakai washed and dried with the above-mentioned extraction solvent to prepare respective extracts and mixing them in the above ratio.

The extracted complex is inoculated with Aspergillus kawachii and fermented at 24 to 25 ° C for 3 to 5 days to produce a fermented complex. At this time, the white germ (Aspergillus kawachii) can be inoculated with 0.01-1.0% as compared with the weight of hysoposide, tamarind, frankincense and sikakai.

Subsequently, a hydrolytic enzyme, preferably? -Glucosidase, is added to the fermentation complex to react. After the reaction is completed by warming, the reaction product is filtered and dried to prepare a complex extract.

The hyssop, tamarind, frankincense, and sikakai complex extracts prepared by the above method exhibited excellent skin inflammation relief, antioxidation, moisturizing and skin regeneration effects due to synergistic action.

The cosmetic composition of the present invention can be manufactured into any of the commonly used formulations and examples thereof include lotion, cream, essence, cleansing foam, cleansing water, pack, body lotion, body oil, body gel, shampoo, Conditioner, hair gel, foundation, lipstick, mascara, make-up base and the like.

[Example]

Hereinafter, the present invention will be described in detail by way of the following examples and test examples, but the present invention is not limited to these examples.

Preparation Example 1: Preparation of hysos extract

The extract of Hissop was prepared by extracting 1 Kg of the dried Hissop outpoured with purified water and drying in the same manner as in Preparation Example 1 above.

Preparation Example 2: Preparation of tamarind extract

Tamarind extract was prepared by extracting 1 kg of tamarind fruit dried in purified water and dried in the same manner as in Preparation Example 1 above.

Production Example 3: Preparation of oriental extract

After extracting with purified water and drying, 1 kg of frankincense was extracted in the same manner as in Preparation Example 1 to prepare a frankincense extract.

Production Example 4: Preparation of Shikakai extract

1 Kg of the dried Shikakai fruit was extracted with purified water and extracted in the same manner as in Preparation Example 1 to prepare a Shikakai extract.

Production Examples 5 to 7: Preparation of hyssop, tamarind, frankincense, and Sikakai extract composite

(1 Kg in total), and 5% by weight of 70% aqueous ethanol was added as an extraction solvent. Then, an extractor (Cosmos-660, manufactured by Kyoritsu Machinery Co., ) And heated at 100 ° C for 3 hours.

The precipitate was filtered through 300 mesh filter paper, and the precipitate was filtered twice with filter paper of Edbentek No. 5 and Wattman GFC 150 mm filter paper. The mixture was concentrated at a temperature of 40 to 50 ° C using a vacuum condenser (Coolace CCA-1100, EYELA), and then dried at an inlet temperature of 180 ° C., an aspirator efficiency Dried under conditions of 100% (35 cm3 / hr), pump efficiency 25% (7.5 ml / min), Nozzle Cleaner 4 and 30 mm (357 liters / hour) To obtain an extracting composite powder of the title.

Weight ratio Hysop Tamarind frankincense Shikakai Production Example 5 One One One One Production Example 6 One 3 2 2 Production Example 7 3 2 One 3

Production Examples 8 to 10: Preparation of white germ-fungus fermentation complex

After the hyssop, tamarind, frankincense and sikakai extract complexes prepared in Preparation Examples 5 to 7 were sterilized, aspergillus kawachii was inoculated at a ratio of 1.0% based on the weight of the extracted composite material, Lt; 0 > C for 5 days to prepare a fermentation complex.

Examples 1 to 3: Production of hyssop, tamarind, frankincense and Shikakai complex extracts

500 ml of an acetate buffer (pH 4.0) and 25 ml of? -Glucosidase were added to the fermentation complexes prepared in Preparation Examples 8 to 10 and reacted at 55 ° C and 100 rpm for 4 hours. Next, the enzyme reaction was completed by heating at 90 DEG C for 5 minutes. The precipitate was filtered through a 300-mesh filter paper, and the precipitate was filtered twice using a filter paper of Edbentek No. 5 and a Wattman GFC 150 mm filter paper. The mixture was concentrated at 50 ° C using a vacuum concentrator (Coolace CCA-1100, EYELA), and the inlet temperature was 180 ° C and the aspirator efficiency was 100% using a spray dryer (B-290, BUCHI) (35 cm3 / hour), pump efficiency 25% (7.5 ml / min), nozzle cleaner 4 and flow meter Rotameter): 30 mm (357 liters / hour) .

Test Example 1: Confirmation of cytotoxicity

To confirm cytotoxicity, fibroblasts were inoculated into IMDM medium supplemented with 10% FBS at a cell concentration of 5 × 10 ⁵ cells and cultured in a 37 ° C. 5% CO ₂ incubator for 24 hours. After the culture, the culture medium was removed, and the extract prepared in the above Preparation Examples and Examples was diluted with dimethyl sulfoxide to give sample concentrations of 50, 100, 500 and 1000 μg / ml. The diluted solution was treated and cultured for 24 hours 100 ml of MTT (3- [4,5-dimethylthiazol-2yl] - 2,5-diphenyltetrazoliumboromide, Sigma, USA) solution was added to each well (3 mg / ml) and further cultured for 4 hours. After removing the supernatant, 150 μl of dimethylsulfoxide was added, and the resulting formazan was shaken by shaking for 30 minutes. Absorption was measured at 540 nm using a multimicroplate reader (Molecular device Spectra max 190). Cell viability was calculated according to the following equation and the results are shown in Table 2 below.

Cell survival rate (%) = absorbance of sample-added group / absorbance of control group 100

division Cell survival rate (%) 100 mu g / ml 500 [mu] g / ml 1000 mu g / ml Production Example 1 100 101 100 Production Example 2 100 101 100 Production Example 3 100 100 100 Production Example 4 101 100 100 Production Example 5 100 100 101 Production Example 6 100 101 100 Production Example 7 101 100 100 Production Example 8 100 100 101 Production Example 9 100 100 100 Production Example 10 100 100 100 Example 1 100 100 101 Example 2 100 101 100 Example 3 101 100 100

As shown in the results of Table 2, it was confirmed that the samples to which hsop, tamarind, frankincense, Shikakai extract, extracted complex, and complex extract did not affect cytotoxicity were confirmed, and it was confirmed that there was no problem in safety.

Test Example 2: Confirmation of inhibitory effect of inflammatory mediator

RAW264.7 cells were cultured in DMEM medium supplemented with 10% FBS at 5 × 10 ⁵ cells / well, inoculated on a 12-well plate and incubated for 18 hours. After incubation, starvation was maintained for 12 hours. LPS was treated with 10 ng / mL of LPS and incubated for 24 hours. RNA was extracted from the cultured cells and the inhibition rate of TNF-α expression was confirmed by reverse transcription polymerase chain reaction (RT-PCR). The inhibition rate of TNF-α expression was calculated by the following equation, and the inhibition rate of TNF-α expression was calculated by the following equation, and the results are shown in Table 3 below. Dexamethasone was used as a control.

TNF-α expression level (%) = [(control TNF-α expression level-sample TNF-α expression level) / control TNF-α expression level] × 100

division TNF-α expression inhibition rate (%) Treatment concentration (w / v%) 0.1 0.5 One Production Example 1 44.0 46.5 48.5 Production Example 2 41.2 43.2 49.6 Production Example 3 42.3 44.5 50.2 Production Example 4 39.6 45.2 51.2 Production Example 5 33.5 38.2 49.6 Production Example 6 38.5 41.5 51.2 Production Example 7 40.2 46.3 56.5 Production Example 8 50.2 52.3 58.6 Production Example 9 51.2 53.5 56.3 Production Example 10 52.2 54.5 55.6 Example 1 50.2 55.2 68.5 Example 2 52.3 58.2 75.8 Example 3 60.3 68.5 79.6 Dexamethason 68.5 75.6 81.2

As shown in Table 3, the compound extract of the present invention showed an excellent TNF-α inhibitory effect as compared with those of Examples 1 to 10, and the compound extract of Example 3 showed the most excellent effect.

Test Example 3: Confirmation of Increasing Expression of Hyaluronic Acid Synthase (HAS-3)

Human fibroblast NHDF was adjusted to 5 × 10 ⁵ cells / well using DMDM medium supplemented with 10% FBS, and then inoculated on a 12-well plate and cultured for 18 hours. After culturing, the samples were treated and incubated for 24 hours. RNA was extracted from the cultured cells and the expression of Hyaluronan Synthase-3 (HAS-3) was confirmed by reverse transcription polymerase chain reaction (RT-PCR). The expression level of HAS-3 was calculated by the following equation, and the results are shown in Table 4. As a control group, hyaluronic acid was used.

(%) = (Expression amount of sample HAS-3 / expression amount of control HAS-3) × 100

division HAS-3 Expression Growth Rate (%) Treatment concentration (w / v%) 0.1 0.5 One Production Example 1 40.2 55.2 58.2 Production Example 2 42.5 56.5 59.2 Production Example 3 43.5 57.8 60.2 Production Example 4 44.5 54.2 56.2 Production Example 5 50.2 61.0 62.5 Production Example 6 56.5 50.5 55.5 Production Example 7 60.2 61.2 63.5 Production Example 8 61.2 62.3 63.5 Production Example 9 60.2 63.5 64.5 Production Example 10 61.2 63.5 65.8 Example 1 58.5 59.5 62.4 Example 2 59.2 62.2 64.3 Example 3 75.5 78.0 80.2 Hyaluronic Acid 73.2 78.2 81.2

As shown in Table 4, the complex extract of the Example of the present invention prepared by hydrolytic enzyme treatment after white rot fermentation showed excellent HAS-3 expression increase rate as compared with that of Examples 1 to 10, The effect was as good as that of Lonic acid.

Test Example 4: Confirmation of hyaluronidase activity inhibitory effect

The inhibitory effect of hyaluronidase activity was confirmed by applying Morgan-Elson method as follows. The final enzyme activity of hyaluronidase was adjusted to 400 NF unit / ml and the final concentration of HA was 0.4 mg / ml. Using Compound 48/80 buffer (0.1 mg / ml) as an active agent, The activity of hyaluronidase was measured mainly on the inhibitory action of the activation step of the enzyme. The sample was dissolved in a buffer to prepare a sample solution. As a control, a buffer solution was used instead of the sample solution. As a control group, hyaluronic acid was used. The inhibitory activity (%) of hyaruronidase was calculated by the following equation, and the results are shown in Table 5.

Hyaluronidase activity inhibition rate (%) = [(A-B) / A] × 100

A: Enzyme activity of well without addition of sample

B: Enzyme activity of the well to which the sample was added

division Inhibitory effect of hyaluronidase activity (%) Treatment concentration (w / v%) 0.1 0.5 One Production Example 1 30.5 38.5 55.8 Production Example 2 29.7 33.5 49.5 Production Example 3 23.5 30.2 41.2 Production Example 4 33.5 36.5 55.8 Production Example 5 30.5 35.6 59.6 Production Example 6 32.5 33.5 58.8 Production Example 7 46.5 47.5 58.8 Production Example 8 52.6 56.6 59.5 Production Example 9 51.2 53.5 56.8 Production Example 10 52.4 54.6 55.6 Example 1 52.3 62.3 65.2 Example 2 55.3 58.9 62.3 Example 3 70.8 72.5 78.6 Hyaluronic Acid 73.2 73.2 75.6

As shown in Table 5, the complex extract of the Example of the present invention prepared by hydrolytic enzyme treatment after white rot fungi fermentation exhibited a higher inhibitory activity of hyaruronidase than those of Production Examples 1 to 10.

Test Example 5: Skin barrier strengthening test

Effect of transglutaminase-1 gene expression

Samples of Production Examples 1 to 10 and Examples 1 to 3 were treated and then cultured in DMED / 10 FBS for 24 hours at 5% CO ₂ and 37 ° C. After 24 hours, the RNA isolation from the cells, cDNA synthesis and RT-PCR were performed according to the method described by Komoroski et al. (Drug Metab. Dispos. 32: 512-518, 2004). Transglutaminase-1 expression was confirmed by RT-PCR. GAPDH was used as a house keeping gene to identify differences in gene expression. The primer sequences of the respective genes are shown in Table 6. The extracted RNA was subjected to reverse transcription of M-MLV (Moloney murine leukemia virus) after being denatured at 70 ° C for 10 minutes using a dT-adapter primer and DEPC water to a total volume of 15 μl CDNA was synthesized at 42 ° C for 60 minutes and at 70 ° C for 15 minutes. The synthesized cDNA was amplified by PCR reaction, and the total reaction solution was 25 μl. The final concentration of each reagent is a primer 100 pmol, 1.0μM, dNTP mixture 0.2mM, 5x green or colorless GoTaq 1x1.5mM Reaction buffer, MgCl ₂ (PCR buffer) and was GoTaq DNA polymerase 1.25units. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute, 72 ° C for 5 minutes, 30 to 40 cycles. After PCR, 10 mu l of the product was electrophoresed on 2% agarose gel. Gel Documentation system (Korea Raptec, Cat. No DGS-200D).

Name of the primer Base sequence GAPDH Froward: GGCATTGCTCTCAATGACAA Reverse: TGTGAGGGAGATGCTCAGTG TGase-1 Forward: TGATCGCATCACCCTTGAGT Reverse: GTAGATCTCATTGCGGGGGT

Expression increase rate was calculated by the following equation, and the results are shown in Table 7.

(%) = (Expression amount of sample TGase-1 / expression amount of control group TGase-1) × 100

division Increase rate of TGase-1 expression (%) Treatment concentration (w / v%) 0.1 0.5 One Production Example 1 29 33 45 Production Example 2 30 42 50 Production Example 3 31 36 47 Production Example 4 33 39 46 Production Example 5 35 48 53 Production Example 6 38 45 54 Production Example 7 34 46 46 Production Example 8 41 45 49 Production Example 9 40 43 49 Production Example 10 41 44 50 Example 1 42 49 70 Example 2 45 54 75 Example 3 50 69 78 Control 100 100 100

As shown in Table 7, the compound extract of the Example of the present invention shows an excellent TGase-1 expression increase rate, indicating that it has a skin regeneration effect.

Test Example 6: Measurement of scavenging activity of DPPH free radical

DPPH free radical scavenging activity was measured by the method of Nanjo et al. (1996). 30 μl of 60 μM DPPH (1,1-diphenyl-2-picrylhydrazyl) solution was added to 30 μl of the sample, and the reaction solution was transferred to a 100 μl quartz capillary tube. Electron spin resonance (ESR) spectrometer (JES- Ltd., Tokyo, Japan). The experimental conditions are as follows.

magnetic field, 336.5 ± 5 mT; power, 5 mW; modulation frequency, 9.41 GHz; amplitude, 1 x 1,000; sweep time, 30 s; temperature, 298 K.

The DPPH radical scavenging activity was calculated by the difference in the relative radical signal peak heights of H and H ₀ . The results are shown in Table 8 below. Ascorbic acid was used as a control.

division Radical scavenging activity (%) Treatment concentration (w / v%) 0.1 0.5 One Production Example 1 40 49 61 Production Example 2 43 52 62 Production Example 3 38 55 64 Production Example 4 37 59 68 Production Example 5 42 56 61 Production Example 6 43 58 65 Production Example 7 47 55 60 Production Example 8 50 53 62 Production Example 9 52 54 59 Production Example 10 51 53 58 Example 1 52 65 78 Example 2 59 78 81 Example 3 70 85 92 Ascorbic acid 95 97 98

As shown in Table 8, the complex extract of the Example of the present invention, which was produced by hydrolytic enzymatic treatment after white rot fungi fermentation, exhibited a higher antioxidative effect than those of Production Examples 1 to 10 and showed the best effect in the complex extract of Example 3 Respectively.

Example 4: Preparation of serums containing hysop, tamarind, frankincense and Shikakai complex extracts

A serum containing the complex extract of Example 3 was prepared according to a conventional method with the composition and content shown in Table 9 below.

Raw material Content (% by weight) Complex extract (Example 3) 1.0 Wax 1.0 Polysorbate 60 1.5 Sorbitan sesquioleate 0.5 Mineral oil 10.0 Sorbitan stearate 0.5 Pro-type glycerin monostearate 1.0 Stearic acid 1.5 Glyceryl stearate / FG-400 stearate 1.0 Propylene glycol 3.0 Carboxy polymer 0.1 Triethanolamine 0.1 Phenoxyethanol Suitable amount Purified water To 100

Example 5: Preparation of a cream containing hysop, tamarind, frankincense and Sikakai complex extracts

The cream containing the complex extract of Example 3 was prepared according to a conventional method with the composition and content shown in Table 10 below.

Raw material Content (% by weight) Complex extract (Example 3) 1.0 Shea Butter 2.0 Polysorbate 60 1.5 Sorbitan sesquioleate 0.8 Mineral oil 10.0 Dimethicone 3.0 Sorbitan stearate 0.5 Pro-type glycerin monostearate 1.0 Cetearyl alcohol 2.0 Glyceryl stearate / FG-400 stearate 1.0 Propylene glycol 3.0 Carboxy polymer 0.25 Triethanolamine 0.25 Phenoxyethanol Suitable amount Purified water To 100

Test Example 5: Confirmation of formulation stability

The formulations prepared in Examples 4 and 5 were stored in an opaque glass container in a room, a refrigerator and an incubator kept constant at room temperature (25 ° C), cold (4 ° C) and constant temperature (50 ° C) Observed (discolored, detached and separated), and the stability was confirmed. The results are shown in Table 11.

Temperature condition Stability verification (discoloration, removal and separation) Example 4 Example 5 Room temperature (25 캜) 0 0 Refrigerated (4 ℃) 0 0 Constant temperature (50 ° C) 0 0

<Formulation stability level>

0: No change 1: Minute change 2: Change 3: Extreme change

As shown in the above table, all of the formulations of Examples 4 and 5 were found to be stable without deterioration and separation phenomenon under the temperature conditions of 25 캜, 4 캜 and 0 캜.

Claims (8)

(1) to (3), ( 3 ), ( 3 ), ( 3 ) and ( 3 ) A cosmetic composition comprising hyssop, tamarind, frankincense, and a mixture of Shikakai complexes prepared by treating with shodai enzyme in an amount of 0.1 to 10% by weight based on the total weight of the cosmetic composition. delete delete The cosmetic composition according to claim 1, wherein the cosmetic composition is for improving skin inflammation. The cosmetic composition according to claim 1, wherein the cosmetic composition is for antioxidation.  The cosmetic composition according to claim 1, wherein the cosmetic composition is for skin moisturizing. The cosmetic composition according to claim 1, wherein the cosmetic composition is for skin regeneration. (A) mixing the washed and dried hyssop, tamarind, frankincense and sikakai at a weight ratio of 1: 3: 1 to 3: 1 to 3: 1 to 3, respectively, to prepare a composite;
(B) an extraction solvent is extracted with at least one extraction solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol and butylene glycol, Lt; / RTI &gt;
(C) Inoculating the extracted complex with Aspergillus kawachii and fermenting the mixture at 24 to 25 ° C for 3 to 5 days to prepare a fermented complex;
(D) hydrolyzing the fermentation complex by adding? -Glucosidase; And
(E) a step of filtration followed by drying, thereby producing a hosop, tamarind, frankincense and sikakai complex extract.