KR101974802B1 - A gene responsible for rendering tolerance to microorganisms against abiotic stress and use therof - Google Patents

Abstract

The present invention relates to a gene enhancing tolerance to a non-biological stress in microbes and a use thereof. An additional process for removing the non-biological stress factor and the like is not needed in a biofuel production process using microbes, thereby bringing about the effect of reducing the production cost of bio-based fuels and enabling the mass production of fermented products.

Description

[0001] The present invention relates to genes that are resistant to abiotic stress of microorganisms and their use,

The present invention relates to genes and their applications for enhancing resistance to abiotic stress of microorganisms.

As environmental issues such as warming climate caused by excessive use of fossil fuel resources are emerging as global issues, expectations for biofuel and chemical production using renewable energy resources are rising. Carbon dioxide from fossil fuels will take millions of years to stabilize in the soil, while carbon dioxide from biofuels will likely be recovered to plant resources by photosynthesis, usually within a year, thus addressing a variety of environmental issues .

The production of bio-based fuels requires pre-processing at high temperature and high pressure of herbaceous biomass lignocellulose, enzymatic saccharification process to obtain fermentation sugar, and microbial fermentation process to obtain final product. However, microbial inhibitors and biofuels (eg, ethanol, butanol, etc.) that are produced during the pretreatment process generally inhibit microbial growth and fermentation. Thus, increasing resistance to inhibitors of fermenting microorganisms (eg, E. coli, yeast, etc.) is essential for the production of high-concentration fermentation products. Representative microbial inhibitors to date include furan (furfural, 5-HMF), weak acids (acetic acid, formic acid, levulinic acid), and phenolic compounds.

Methods for the development of resistant strains using biotechnology include the production of mutant libraries by transcriptional mutation, whole genome shuffling, and random gene deletion mutation. Resistant bacteria such as chaperon, heat shock protein, efflux pump, membrane protein and the like in a heterogeneous or homogeneous microorganism to isolate the resistant microorganism There is a way to introduce. However, most studies on resistant strains have been limited to the development of multi-resistant fermentation strains based on studies of cell-wide responses to specific microbial inhibitors.

In the present invention, Zymomonas mobilis ATCC 31821, which is a representative bioethanol-producing bacterium, is deficient in nutrition and is overexpressed in a stationary phase state in which environmental stress is accumulated in which ethanol is accumulated, The genes encoding the genes were identified and the genes were introduced into E. coli to determine whether they were resistant to various abiotic stresses including ethanol and a fermenting microorganism inhibitor generated during the pretreatment.

As a result, the present inventors have completed the present invention by confirming that the E. coli into which the gene has been introduced has multiple resistance to various non-biological stresses.

Korean Patent No. 10-1259956

It is an object of the present invention to provide a recombinant vector comprising a gene that promotes abiotic stress tolerance to a microorganism, a recombinant microorganism transformed with the recombinant vector, and a method for promoting abiotic stress tolerance of the microorganism with the recombinant vector.

The present invention provides a recombinant vector for promoting abiotic stress tolerance comprising the gene represented by SEQ ID NO: 1.

The present invention also provides a microorganism transformed with a recombinant vector for promoting non-biological stress tolerance comprising the gene represented by SEQ ID NO: 1.

The present invention also provides a composition for promoting abiotic stress tolerance comprising a recombinant vector comprising the gene represented by SEQ ID NO: 1.

The present invention also provides a method for transforming a recombinant vector comprising a gene represented by SEQ ID NO: 1 into a microorganism, thereby resolving abiotic stress tolerance of the microorganism.

Since the recombinant vector comprising the gene of SEQ ID NO: 1 of the present invention can be applied to fermenting microorganisms, resistance to various non-biological stresses including a fermentation inhibitor such as ethanol can be enhanced, It is possible to reduce the production cost of bio-based fuel and mass production of fermentation products.

Figure 1 shows the Zymomonas The expression level of ZMO0994 protein in ethanol fermentation of mobilis was measured: (a) Zymomonas mobilis fermentation of ethanol, (b) the sample and the electrophoresis (SDS-PAGE) of the expressed protein in ZMO0994 for 24 hours, pictures, (c) 6% (v / v) Zymomonas with time after the ethanol treatment Expression of genes in ZMO0994 mobilis.
Figure 2 shows the results of cloning the ZMO0994 gene and testing its resistance and viability against various stress factors: (a) acquisition of ZMO0994 gene and transformation of E. coli, (b) transformation of E. coli at various stresses (C) Survival capacity (%) at various stresses expressed as relative cell concentration after 12-24 hours relative to the initial cell concentration.
Figure 3 shows the expression changes and resistance levels of the ZMO0994 protein according to the various 5'-UTRs designed: (a) a schematic diagram of the UTR design to control the expression of ZMO0994, (b) the ZMO0994 protein according to the designed UTR (C) Immunity test results of E. coli with the inserted UTR.

Hereinafter, the configuration of the present invention will be described in detail.

The present invention relates to a recombinant vector for promoting abiotic stress tolerance comprising a gene represented by SEQ ID NO: 1.

The term " recombinant vector " as used herein refers to a gene construct containing an essential regulatory element operatively linked to the expression of a gene insert, which is capable of expressing a desired protein in a suitable host cell. Such vectors include, but are not limited to, a plasmid vector, a cosmid vector, a bacteriophage vector or a viral vector. Suitable expression vectors include signal sequence or leader sequences for membrane targeting or secretion in addition to expression control elements such as promoter, operator, initiation codon, termination codon, polyadenylation signal and enhancer, and may be prepared in various ways depending on the purpose. The promoter of the vector may be constitutive or inducible. Further, the expression vector includes a selection marker for selecting a host cell containing the vector, and includes a replication origin in the case of a replicable expression vector.

The recombinant vector of the present invention can be preferably prepared by inserting the gene described above into a vector for expression in a general E. coli strain. The Escherichia coli strain expression vector may be any commonly used Escherichia coli vector for expression.

The gene may be derived from an ethanol fermentation microorganisms, and specifically Xi thigh eggplant Mobilis (Zymomonas mobilis ). < / RTI > More specifically, the gene may be a gene Xi thigh eggplant Mobilis is generated ethanol encoding a selected protein from one of the protein which is the expression in the course of. In the present invention, the gene can be named " ZMO0994 ".

In the present invention, abiotic stress is a non-biological factor that can inhibit the growth of microorganisms and may include environmental factors such as salinity, temperature, and drying, and may include heavy metals, ethanol, hydrogen peroxide, furfural -HMF), weak acids (acetic acid, formic acid, levulic acid), phenolic compounds, and the like. Specifically, in the present invention, the abiotic stress may be a microbial inhibitor that occurs in the course of biofuel production such as bioethanol using microorganisms, and more specifically, ethanol, high temperature, furfural, and 5-hydroxymethylfurfural -HMF). ≪ / RTI >

The recombinant vector may include a modified 5'-UTR (untranslated region), and specifically, the modified 5'-UTR may be one of the nucleotide sequences shown in SEQ ID NOs: 2 to 4. In one embodiment of the present invention, in accordance with the change of the base sequence of the 5'-UTR contained in the recombinant vector, the ZMO0994 And the optimal 5'-UTR sequence for overexpression of the gene was selected.

The present invention also relates to a microorganism transformed with a recombinant vector for promoting non-biological stress tolerance comprising the gene represented by SEQ ID NO: 1.

Such transformation includes any method of introducing the nucleic acid into an organism, cell, tissue or organ, and can be carried out by selecting a suitable standard technique depending on the host cell, as is known in the art. Such methods include electroporation, protoplast fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, agitation with silicon carbide fibers, Agrobacterium mediated transformation, PEG, dextran sulfate, lipofectamine But are not limited to.

In addition, since the expression amount of the protein and the expression are different depending on the host cell, the host cell most suitable for the purpose may be selected and used.

Examples of host cells include Escherichia coli), Eisai thigh eggplant Mobilis (Zymomonas mobilis), Bacillus subtilis (Bacillus subtilis), Streptomyces (Streptomyces), Pseudomonas (Pseudomonas), Proteus Mira Billy's (Proteus mirabilis) or Staphylococcus (Staphylococcus) , But are not limited thereto. In addition, fungi (e.g., Aspergillus ), yeast (e.g., Pichia pastoris), Saccharomyces access to my kids Vichy Auxerre (Saccharomyces cerevisiae), investigating car break in Rome Seth (Schizosaccharomyces), Castello La Neuro Chrysler Corporation (Neurospora crassa ) may be used, but the present invention is not limited thereto. The transformant can be easily prepared by introducing a recombinant vector containing the genes into an arbitrary host cell.

Specifically, the transformed microorganism in the present invention is a bacterial strain to produce ethanol, more specifically Escherichia coli or Xi thigh eggplant Mobilis (Zymomonas mobilis ) .

The present invention also relates to a composition for promoting abiotic stress tolerance comprising a recombinant vector comprising the gene represented by SEQ ID NO: 1.

The composition of the present invention comprises a recombinant vector comprising the ZMO0994 gene consisting of the nucleotide sequence of SEQ ID NO: 1 as an active ingredient, and the recombinant vector containing the gene is transformed into a microorganism, thereby enhancing resistance to the biotic stress of the microorganism .

The present invention also relates to a method for enhancing the abiotic stress tolerance of a microorganism by introducing a recombinant vector comprising the gene represented by SEQ ID NO: 1 into the microorganism.

Specifically, ZMO0994 represented by SEQ ID NO: 1 Gina E. coli or recombinant vector containing the gene Momo eggplant Mobilis (Zymomonas mobilis ) to over- express the gene, thereby enhancing resistance of the strain to abiotic stress.

 Specific descriptions of the recombinant vector and abiotic stress are omitted by citing the above description.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

[Example 1] Extraction of ZMO0994 protein, identification and expression in ethanol stress

[Table 1] Bacteria, plasmids and primers used in the present invention

Glucose (glucose), and ethanol (ethanol) of the experiment 1-1) fermentation of Z. mobilis is high performance liquid chromatography (HPLC) equipped with aminex HPX-87H column (BioRad, Hercules, CA, USA) and gas chromatography (GC) equipped a HP-INNOWaX 19091N-133 column (Agilent 6980N; Wilmington, DE, USA).

Experimental method 1-2) Reverse transcriptase polymerase chain reaction (RT-PCR) for confirmation of expression of ZMO0994 gene was performed by treating 6% (v / v) ethanol with Z. mobilis at a cell concentration of A ₆₀₀ = 1.0 Total RNA was extracted with RNeasy Mini Kit (QIAGEN, Valencia, CA, USA) after 0, 1, 2, and 4 hours. CDNA was synthesized from the extracted RNA using RevertAid H Minus First Strand cDNA Synthesis Kit (ThermoFisher Sicentific, Bartlesville, OK, USA). From the synthesized cDNA, ZMO0994_RT_For (SEQ ID NO: 5) and ZMO0994_RT_Rev ) Were used for polymerase chain reaction (PCR). The gene of ZMO0994 was confirmed to be overexpressed through the thickness of the band on DNA electrophoresis (188 bp), and the 16s ribosomal DNA, which is always constantly expressed, was synthesized to use the housekeeping gene as a control The cDNA was subjected to PCR (129 bp) using ZM_16s_Forward primer (SEQ ID NO: 7) and ZM_16s_Reverse primer (SEQ ID NO: 8) in Table 1.

Jai Nath Momo Mobilis (Zymomonas In the ethanol fermentation process (FIG. 1A ) of the ethanol fermentation process (FIG. 1A), the sample is estimated to have the highest ethanol concentration and the cell growth is completely stopped due to the nutritional deficiency. SDS-PAGE (Fig. 1B). And mass spectrometry sequencing of tryptic-fragments of the resulting protein, ZMO0994, a novel protein whose function is not known. (http://www.matrixscience.com/cgi/master_results.pl?file=../data/20050721/FsnorzsS.dat)

Protein sequence analysis revealed that ZMO0994 protein produced by over-production of Z. mobilis under the stress condition of 24 hours was a response to ethanol stress of Z. mobilis . in mobilis were tested whether ZMO0994 mRNA over-expression (overexpression). As a result, in the experimental group treated with 6% (v / v) ethanol, the expression level of ZMO0994 mRNA was over-expressed after 2 hours of treatment compared to the control group without addition of RT-PCR 1c). Thus, it was hypothesized that the novel protein ZMO0994 might be related to stress tolerance such as ethanol.

Example 2: Multiple resistance characterization of ZMO0994 under various stress conditions.

Experimental Method 2-1) For cloning of ZMO0094 gene, PCR was performed using a template of Z. mobilis gDNA using ZMO0994_Forward primer (SEQ ID NO: 9) and Reverse primer (SEQ ID NO: 10) Respectively. Then, the ZMO0994 gene and the pET21a vector were digested with restriction enzymes of BamHI and HindIId, and the two fragments were cloned using T4 ligase . and transformed into E. coli strain BL21 (DE3). Meanwhile, an empty vector in which the ZMO0994 gene was not inserted was also inserted into E. coli BL21 (DE3) and used as a control.

Experimental method 2-2) For the spot assay, overnight E. coli BL21 (DE3) was grown again in fresh LB medium to an OD ₆₀₀ of 0.5, diluted 10 times from the stock solution, and then 0.5 mM IPTG and each stress Lt; RTI ID = 0.0 > LB < / RTI > agar medium.

Experimental method 2-3) The viability test was performed by exposing E. coli strains to 0.5, 0.1 mM IPTG and 0, 12, and 24 hours of ODT ₆₀₀ , respectively, and diluting them with LB agar for CFU forming unit was measured to express the cell concentration relative to the initial (0 hour) cell concentration as a percentage. All experiments were repeated more than 4 times and expressed as mean value and standard deviation.

Based on the above hypothesis, ZMO0994 Immunity tests were performed under various stress conditions using Escherichia coli with the introduced genes. To this end, first, and then cloning a gene ZMO0994 (Fig. 2a) in pET21 vector E. coli BL21 (DE3). ≪ / RTI > From the spot assay, it was confirmed that the strain was grown well in both stress-free medium and E. coli strains inserted with ZMO0994 gene (FIG. 2b). However, at high temperature growth conditions of 4-6% (v / v) ethanol, 10-30 mM furfural, 5-HMF and 44-48 ° C, the strain in which ZMO0994 gene was inserted was empty (Fig. 2B). As shown in Fig. Thus, it was confirmed that the function of ZMO0994, a new protein discovered in this study, is tolerance to various stress conditions.

In addition, a viability test was conducted to determine whether the E. coli strain into which the ZMO0994 gene was inserted actually survived in various stress situations (FIG. 2C). As a result, it was confirmed that strains inserted empty in various stress conditions died after 12-24 hours, whereas strains containing 10-30% of strains inserted with ZMO0994 gene still survived .

[Example 3] The resistance of ethanol increased as the expression of ZMO0994 protein increased.

Experimental Method 3-1) In order to control the expression of ZMO0094 protein, ZMO0994_WpET (containing 5'-UTR consisting of the nucleotide sequence shown in SEQ ID NO: 2), which is a vector of pET21 :: ZMO0994 into which ZMO0994 gene was inserted, was expressed as a backbone The backbone vector was synthesized by PCR using ZM_UTR1 Forward primer (SEQ ID NO: 11), ZM_UTR2 Forward primer (SEQ ID NO: 12) and ZM_UTR_reverse primer (SEQ ID NO: 13) (including the 5'-UTR consisting of the nucleotide sequence shown in SEQ ID NO: 3) and the U2pET vector (including the 5'-UTR consisting of the nucleotide sequence shown in SEQ ID NO: 4) by self-ligation , And E. coli BL21 (DE3), a protein expressing E. coli .

Experimental method 3-2) The transformed E. coli strains were grown in a shaking incubator for 16 hours at a temperature of 37 ° C. and 200 rpm in a 5 mL LB medium, and then diluted (OD = 0.1) in 300 mL of LB medium at 37 ° C. and 200 rpm And raised to 0.5 at OD ₆₀₀ . Then, IPTG was added to a concentration of 0.1 mM, and the cells were sampled at 0, 2, and 4 hours at 50 mL, centrifuged to obtain cells, and 200 μL of EQ buffer and glass beads (Sigma Glass beads, And the protein was obtained. The protein was quantitated by BCA assay and the protein sampled at 0, 2, and 4 hours was equally diluted to a concentration of 5 μg protein per 16 μl. The diluted proteins were mixed with SDS-PAGE buffer and gel electrophoresis was performed. Proteins classified by size were transferred to PVDF membrane at 120V for 1 hour. The transferred PVDF membrane was washed three times with TBST buffer for 10 minutes, then immersed in 5% skim milk diluted in TBST buffer and blocked for 1 hour at room temperature. After washing three times for 10 minutes with TBST buffer, the primary antibody (cell signaling His-Tag (27E8) mouse mAb), which binds to the histidine residue of ZMO0994 protein, was diluted 1000 times in 5% skim milk, And then washed three times with TBST buffer for 10 minutes. Then, the secondary antibody (cell signaling anti-mouse IgG, HRP-linked antibody) was diluted 1500 times with 5% skim milk, reacted for 1 hour at room temperature, and washed three times for 10 minutes with TBST buffer Respectively. Then, peroxide solution reacted with HRP (horse radish peroxidase) of the secondary antibody and luminol solution (Thermo scientific Supersignal West Pico Chemiluminescent Substrate) were mixed 1: 1 and treated. The amount of ZMO0994 protein expression was confirmed by the thickness of the band obtained by sensitizing the luminol reaction caused by interaction of horse radish peroxidase (HRP) with peroxide using an X-ray film (AGFA Medical X-ray Film Blue).

Experimental method 3-3) The transformed E. coli strains were grown in a shaking incubator for 16 hours at a temperature of 37 ° C. and 200 rpm in 5 mL of LB medium, diluted (OD = 0.1) in 100 mL of LB medium and incubated at 37 ° C. and 200 rpm And raised to 0.5 at OD ₆₀₀ . Then, IPTG concentration was adjusted to 0.1 mM and ethanol was adjusted to 0-6% (v / v), and the cell concentration was measured at OD ₆₀₀ for 8 hours.

In order to confirm that the function of the novel protein ZMO099 contributes to resistance enhancement, changes in the ZMO0994 protein expression level and tolerance were examined. However, we used ethanol stress during the various stress tests. To this end, the 5'-UTR (5 ') located in the upstream region (-25 base pair) of the start codon, which regulates the translation level of the protein by attaching a ribosome in the gene, '-untranslated region, UTR) was designed using a web server-based program (http://sbi.postech.ac.kr/utr_designer). Then, ZMO0994_WpET, ZMO0994_U1pET and ZMO0994_U2pET vectors each containing the 5'-UTR sequence of the designed three (CTGGTGGACAGCAAATGGGTCGGTC (SEQ ID NO: 2), GGTAGCTCCGAAAGGAGCATCGGTC (SEQ ID NO: 3) and GGCTGTTCTGAAAGGAGCATCTGTC 3a).

As a result, ZMO0994 protein was not detected at 0, 2, and 4 hours of sampling in the empty vector in which ZMO0994 gene was not cloned. In the experimental groups WpET, U1pET, and U2pET, expression pattern of ZMO0994 protein at 2 and 4 hours Similar to the predicted values, U2pET was the highest, followed by U1pET and WpET. (Fig. 3a, b). Finally, in order to compare the expression pattern of the protein and the degree of resistance, an ethanol tolerance test was performed using E. coli strain BL21 (DE3) transformed with empty, WpET, U1pET and U2pET vectors (FIG. As a result, it was confirmed that all the strains were well grown in stress-free 0% (v / v) ethanol, and the expression level of E. coli strains containing ZMO0994 was higher than that of empty E. coli in 4% I was able to confirm that it grew well regardless. This is probably because the 4% ethanol condition is a relatively weak stress condition, so it can be explained that ZMO0994 alone can be grown regardless of its expression. On the other hand, in the case of 6% ethanol, which is a slightly stronger stress condition, in the case of the empty vector, the cell concentration value sharply decreased due to destruction of cell membrane after 2 hours. In addition, as shown in FIG. 3B, E. coli strains transformed with U2pET were best grown in proportion to the expression level of ZMO0994, followed by U1pET and WpET (FIG. 3c). Finally, as the degree of ethanol resistance increases in proportion to the expression level of ZMO0994, it was confirmed that the function of ZMO0994 is a resistance inducing protein.

<110> Korea University Research and Business Foundation <120> A gene responsible for rendering tolerance to microorganisms          against abiotic stress and use therof <130> P17U13C0590 <160> 13 <170> KoPatentin 3.0 <210> 1 <211> 519 <212> DNA <213> Artificial Sequence <220> <223> ZMO0994 <400> 1 atgtccagca accgactgac taaacctgtt cttggttttc ttctgggcgc aacggcggcc 60 tttggccttt ctccggttat tgcgggtgct gcttacgctg ccgagcaggg tgtcttccaa 120 aaggctggca acagcattca gaatacagca gataatgctg gcaaagctgt aagtgatacg 180 gctgaagatg cacatgacgg tgccaagaat gtgacgaata aggctcgcca ttctgccaaa 240 agaagctgga acaaaaccaa atccacggcc aagaaaacca cggataagag cggtgatgcg 300 ctcgataaat cttgggataa aaccaaaagc agcgccgaaa ccgctaccga taatgccggt 360 cacacgatcg caagatccgc tgacaaagca ggcgatgcta ttgaaaacac cacggacaaa 420 gccggcaccg gcatcaaaaa aggggctaat acagtcggta aagccttctc tggtgcatgg 480 aaagatgtca cgggtggtaa caagtccaag ggcaagtaa 519 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ZMO0994_WpET 5'-UTR <400> 2 actggtggac agcaaatggg tcggtc 26 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ZMO0994_U1pET 5'-UTR <400> 3 ggtagctccg aaaggagcat cggtc 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ZMO0994_U2pET 5'-UTR <400> 4 ggctgttctg aaaggagcat ctgtc 25 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ZMO0994_RT_For <400> 5 ctgccaaaag aagctggaac a 21 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ZMO0994_RT_Rev <400> 6 tttgtccgtg gtgttttcaa tag 23 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ZM_16s_Forward <400> 7 cggcagttcc tctaaagtgc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ZM_16s_Reverse <400> 8 tggatcagag acaggtgctg 20 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ZMO0994_Forward <400> 9 cccggatcca tgtccagcaa ccgactga 28 <210> 10 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ZMO0994_Reverse <400> 10 gggaagcttc ttgcccttgg cttgttacc 29 <210> 11 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> ZM_UTR1_Forward <400> 11 tttggtaccg gtagctccga aaggagcatc ggtcatgtcc agcaaccgac tgactaaa 58 <210> 12 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> ZM_UTR2_Forward <400> 12 tttggtaccg gctgttctga aaggagcatc tgtcatgtcc agcaaccgac tgactaaa 58 <210> 13 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> ZM_UTR_ Reverse <400> 13 gcgacgcgac gctgcggtac caacaaaatt atttctagag gggaattgtt atccgc 56

Claims (12)

1. A composition for promoting abiotic stress tolerance comprising a recombinant vector comprising a gene represented by SEQ ID NO: 1.
The method according to claim 1,
Wherein the recombinant vector comprises a 5'-UTR represented by the nucleotide sequence of any one of SEQ ID NOS: 2-4.
3. The method according to claim 1 or 2,
Wherein said abiotic stress is at least one of ethanol, high temperature, furfural, and 5-hydroxymethylpurfural (5-HMF).
A microorganism transformed by the composition of claim 1 or 2.
5. The method of claim 4,
Wherein said microorganism is a bacterium.
6. The method of claim 5,
The bacteria may be selected from the group consisting of Zymomonas mobilis )
Or a microorganism which is Escherichia coli.
delete delete A method for enhancing the abiotic stress tolerance of a microorganism comprising the step of introducing the composition of claim 1 or 2 into the microorganism.
10. The method of claim 9,
Wherein said abiotic stress is one or more of ethanol, high temperature, furfural, and 5-hydroxymethyl furfural (5-HMF).
10. The method of claim 9,
Wherein said microorganism is a bacterial, enhancing abiotic stress tolerance.
12. The method of claim 11,
Wherein the bacterium is Zymomonas mobilis or Escherichia coli.

Images