KR101259956B1 - Recombinant yeast by overexpression of SPT3 and SPT15 for improving productivity of bioethanol and Method for producing ethanol using the same - Google Patents

Abstract

The present invention is Saccharomyces engineered to use glycerol as a fermentation source ( Saccharomyces cerevisiae ) is a transformant having improved bioethanol production capacity through the overexpression of TATA binding protein SPT3 and 15 and ethanol production method using the transformant, and more specifically, a transformant manufactured to use glycerol as a fermentation source. My body saccharide to access three Levy jiae to the resistance increase of the ethanol-producing ability and the osmotic pressure of from (Saccharomyces cerevisiae ) and transformants with improved ethanol production capacity through overexpression of yeast RNA polymerase factors, such as TATA binding proteins SPT3 and SPT15, and a method for increasing ethanol production using them.

Description

Recombinant yeast by overexpression of SPT3 and SPT15 for improving productivity of bioethanol and Method for producing ethanol using the same}

The present invention provides a transformant having improved bioethanol production ability through overexpression of TATA binding protein SPT3 and 15 of Saccharomyces cerevisiae , which has been manipulated to use glycerol as a fermentation source, and ethanol using the transformant. relates to a production method, and more particularly, to a saccharide My process three Levy jiae (Saccharomyces to increase the resistance of the ethanol-producing ability and the osmotic pressure in the transformant been designed to use glycerol as a fermentation source cerevisiae ) and transformants with improved ethanol production capacity through overexpression of yeast RNA polymerase factors, such as TATA binding proteins SPT3 and SPT15, and a method for increasing ethanol production using them.

Ethanol is currently forming a huge market as an industrial solvent, and the possibility of using it as a transport fuel for automobiles is becoming a reality, and demand for continuous increase is expected.

Glycerol is a one-step reduced substance compared to glucose, which is C6H12O6 with C3H8O3, which can provide improved reducing power in metabolic processes of microorganisms. Since many substances produced through fermentation often require reducing power in their metabolism, if glycerol can be effectively used as a substrate, the yield and productivity of the desired fermentation product can be improved. As the production of biodiesel has increased, the production of glycerol has increased, leading to a sharp drop in prices. As described above, as the production of biodiesel increases rapidly, the production of glycerol as a by-product increases, which may cause a problem of effectively treating by-products containing glycerol. Therefore, if glycerol can be used to effectively produce a useful fermentation product by fermentation can bring a number of side effects.

The present invention achieves an increase in ethanol production capacity through overexpression of TATA binding protein of Saccharomyces cerevisiae in order to increase ethanol production capacity through improvement of a strain developed to efficiently use the existing glycerol.

It is now generally accepted that production inhibition by overproduction of metabolites is affected by many genes. However, most cellular and metabolic engineering approaches rely on deletion or overexpression of nearly single genes due to experimental limitations in vector constructs and transformation efficacy. These limitations make it impossible to simultaneously explore multiple genetic variants and limit genetic studies to limited sequential approaches in which a single gene is modified at one time. The widespread transcriptional machinery studied in this study is responsible for the control of transcripts in all cellular systems (prokaryotes and eukaryotes). Wide-area transcriptional mechanisms may be proteins that affect gene transcription by interacting with or regulating the activity of RNA polymerase molecules. Wide area transcriptional machinery can also be proteins that alter the ability of the genome of the cell to be transcribed (eg, methyltransferase, histone methyltransferase, histone acetylase and deacetylase).

In bacterial systems, sigma factors play an important role in modulating global transcription by focusing on the promoter preference of RNA polymerase holoenzymes (RR Burgess, L. Anthony, Curr. Opin.Microbiol 4, 126-131 (2001). )). The present invention has developed the ability to generate sigma factors while changing the preference for promoters at the genome-range level. Conventional strain improvement paradigms rely primarily on the generation of sequential, single-gene modifications, which often fail to reach wide area maximums. The reasons for this are complex metabolic pathways (H. Alper, K. Miyaoku, G. Stephanopoulos, Nat Biotechnol 23, 612-616 (2005); H. Alper, Y.-S. Jin, JF Moxley, G. Stephanopoulos, Metab Eng 7, 155-164 (2005)), because they encompass beneficial synthetic mutants only when mutations are introduced simultaneously. The inventors have developed a broad regulatory function of sigma factors to facilitate whole cell manipulation by introducing several simultaneous gene expression changes similarly by overexpressing a TATA conjugate protein.

It can be widely applied to fungi, and RNA polymerase II factors related to such eukaryotic cells, especially when related to ethanol production. Other eukaryotic cells and their corresponding counterparts for improving phenotypic properties, in particular resistance of glycerol (and other sugars) and / or ethanol in the culture medium, and / or improved ethanol production by cells from various feedstocks known in the art. It may include the use of a wide area transfer mechanism.

In the present invention, the expression of TATA binding protein (SPT3,15) was increased to increase the ethanol production in the transformants prepared to use glycerol as a carbon source in Saccharomyces cerevisiae.

The present invention solves the above problems, and the object of the present invention was devised by the necessity of the above is a strain that has been improved so that the production of bioethanol in yeast which is a production strain in the production of bioethanol when using glycerol as a fermentation source To provide.

Another object of the present invention is to provide a method for producing the transformant.

Still another object of the present invention is to provide a method for producing ethanol using the transformant.

Another object of the present invention to provide a composition for producing ethanol comprising the transformant.

In order to achieve the above object, the present invention is Saccharomyces Roman Isis three Levy jiae SPT (S u p pressor of T y) 3 and SPT (S u p pressor of T y) 15 ( hereinafter, each 'SPT 3', ' An expression vector pGupSpt3.15 containing the gene) is provided.

In one embodiment of the invention, the TATA binding protein SPT3 preferably has an amino acid sequence set forth in SEQ ID NO: 1, but one or more substitutions, deletions, additions, etc. mutations in the protein described in SEQ ID NO: 1 mutations having SPT3 activity Sieves are also included in SPT15 of the present invention.

In one embodiment of the present invention, the TATA binding protein SPT3 preferably has the nucleotide sequence of SEQ ID NO: 1, but considering the degeneracy of the genetic code of the base sequence of SEQ ID NO: 2 and 80% of the phase Genes with homology, preferably 85% homology, more preferably 90% homology, most preferably 95% homology, are also included in the SPT3 gene of the present invention.

In another embodiment of the present invention, the TATA binding protein SPT15 preferably has an amino acid sequence set forth in SEQ ID NO: 3, but one or more substitutions, deletions, additions, etc. mutations are caused to the protein described in SEQ ID NO: 3 Mutants having TATA binding protein SPT15 activity are also included in the TATA binding protein SPT15 of the present invention.

In another embodiment of the present invention, the TATA binding protein SPT15 preferably has the nucleotide sequence set forth in SEQ ID NO: 4, but 80% of the nucleotide sequence set forth in SEQ ID NO: 4 in consideration of the degeneracy of the genetic code Genes having homology, preferably 85% homology, more preferably 90% homology, and most preferably 95% homology, are included in the TATA binding protein SPT15 gene of the present invention.

In one embodiment of the present invention, the expression vector of the present invention preferably has a cleavage map described in Figure 3a, but is not limited thereto.

In another aspect, the present invention provides a transformant transformed with the expression vector of the present invention.

In one embodiment of the present invention, the TATA binding protein SPT3 and SPT15 gene is inserted into the transformant is preferably yeast, more preferably Saccharomyces ( Saccharomyces) cerevisiae ) is preferably derived from a microorganism, but is not limited thereto.

The present invention also provides a transformant prepared by introducing the expression vector of the present invention into a transformant comprising a glycerol dehydrogenase, a dihydroxyacetone kinase, and a glycerol uptake protein gene.

In one embodiment of the invention, the glycerol dehydrogenase (glycerol dehydrogenase) is preferably having an amino acid sequence of SEQ ID NO: 5, one or more mutations, deletions, additions, etc. to the protein of SEQ ID NO: 5 Mutants with glycerol dehydrogenase activity induced may also be included.

       In one embodiment of the present invention, the glycerol dehydrogenase gene is preferably one having the nucleotide sequence of SEQ ID NO: 6, the base of SEQ ID NO: 6 in consideration of the degeneracy of the genetic code It may also include genes having 80% homology with the sequence, preferably 85% homology, more preferably 90% homology, most preferably 95% homology.

       In another embodiment of the present invention, the dihydroxyacetone kinase (dihydroxyacetone kinase) preferably has an amino acid sequence of SEQ ID NO: 7, one or more substitutions, deletions, additions, etc. to the protein of SEQ ID NO: It may also include a mutant having dihydroxyacetone kinase activity induced by a mutation of.

       In another embodiment of the present invention, the dihydroxyacetone kinase gene preferably has the nucleotide sequence of SEQ ID NO: 8, but in consideration of the degeneracy of the genetic code base sequence of SEQ ID NO: 8 And genes having 80% homology, preferably 85% homology, more preferably 90% homology, and most preferably 95% homology.

       In another embodiment of the present invention, the glycerol uptake protein preferably has an amino acid sequence set forth in SEQ ID NO: 9, but one or more substitutions, deletions, additions, etc. mutations are caused to the protein described in SEQ ID NO: 9 Mutants with dihydroxyacetone kinase activity may also be included.

       In another embodiment of the present invention, the glycerol uptake protein gene preferably has a nucleotide sequence set forth in SEQ ID NO: 10, in consideration of the degeneracy of the genetic code and the base sequence described in SEQ ID NO: 10 and 80 It may also include genes having% homology, preferably 85% homology, more preferably 90% homology, most preferably 95% homology.

In another aspect, the present invention is a method for producing a transformant for producing ethanol comprising the step of introducing the expression vector of the present invention into a transformant comprising a glycerol dehydrogenase, dihydroxyacetone kinase, and glycerol uptake protein gene To provide.

In one embodiment of the method for producing a transformant of the present invention, the recombinant vectors pGupSpt3.15Cas and pGcyaDak preferably have a cleavage map described in FIGS. 3A and 3B, but are not limited thereto.

The present invention also provides a method for producing ethanol using glycerol comprising culturing the transformant of the present invention using glycerol as a substrate.

The present invention also provides a composition for producing ethanol comprising the transformant of the present invention. The ethanol product composition of the present invention is a polypeptide suitable for producing ethanol based on glycerol by culturing the transformant, for example. , Broths, cell lysates, purified or unpurified enzyme extracts or polypeptides, and the like.

In the case of using the yeast as a host in the present invention, as the expression vector, for example, YEp13, YCp50, pRS-based, pYEX-based vectors and the like can be used. As a promoter, a GAL promoter, an AOD promoter, etc. can be used, for example. Examples of methods for introducing the recombinant DNA into yeast include electroporation (Method Enzymol., 194, 182-187 (1990)), spearoflast method (Proc. Natl. Acad. Sci. 1929-1933 (1978)) and the lithium acetate method (J. Bacteriol., 153, 163-168 (1983)).

In the recombinant vector, fragments for suppressing expression having various functions for suppressing or amplifying or inducing expression, markers for selection of transformants, resistance genes against antibiotics, or secreted out of the cells It is also possible to have a gene for encoding a signal for the purpose of.

As a method of culturing the transformant of the present invention, a conventional method used for culturing a host may be used.

As the culture method, any method used for culturing ordinary microorganisms, such as batch type, flow batch type, continuous culture, and reactor type, can be used. Transformants obtained by using bacteria such as Escherichia coli as a host As a medium for culturing, medium or synthetic medium, for example, LB medium, NB medium and the like can be given. Incidentally, the incubation temperature is accumulated in the above-mentioned temperature range, and the SPT3 and SPT15 are accumulated in the cells and recovered.

The carbon source is required for the growth of microorganisms, and for example, sugars such as glucose, fructose, sucrose, maltose, galactose, and starch; Lower alcohols such as ethanol, propanol and butanol; Polyhydric alcohols such as glycerol; Organic acids such as acetic acid, citric acid, succinic acid, tartaric acid, lactic acid and gluconic acid; Fatty acids such as propionic acid, butanoic acid, pentanic acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid and dodecanoic acid can be used.

Examples of the nitrogen source include ammonium salts such as ammonia, ammonium chloride, ammonium sulfate and ammonium phosphate, as well as those derived from natural products such as peptone, meat juice, yeast extract, malt extract, caseinate and corn steep liquor. Moreover, as an inorganic substance, 1 potassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, etc. are mentioned, for example. You may add antibiotics, such as kanamycin, ampicillin, tetracycline, chloramphenicol, and streptomycin, to a culture liquid.

In addition, when the promoter cultures the microorganism transformed using an inducible expression vector, an inducer suitable for the type of promoter may be added to the medium. For example, isopropyl-D-thiogalactopyranoside (IPTG), tetracycline, indole acrylic acid (IAA), etc. are mentioned as an inducer.

Acquisition of SPT3 and SPT15 is carried out by centrifugation of the cells or supernatant from the culture obtained, followed by cell disruption, extraction, affinity chromatography, cation or anion exchange chromatography, gel filtration, or the like alone or as appropriately combined. Can be.

Confirmation that the obtained purified substance is the target enzyme can be performed by a conventional method, for example, SDS-polyacrylamide gel electrophoresis, western blotting or the like.

Hereinafter, the present invention will be described.

The present invention provides a transformant having improved bioethanol production ability through overexpression of SPT3 and SPT3, which are TATA binding proteins of Saccharomyces cerevisiae , which have been manipulated to use glycerol as a fermentation source, and using the transformant The present invention relates to a method for producing ethanol, and more particularly, to increase ethanol production capacity and resistance to osmotic pressure in transformants prepared to use glycerol as a fermentation source, Saccharomyces cerevisiae ) and transformants with improved ethanol production capacity through overexpression of yeast RNA polymerase factors, such as TATA binding proteins SPT3 and SPT15, and a method for increasing ethanol production using them.

Glycerol was added to this strain with increased ethanol production capacity by increasing the resistance to ethanol production and osmotic pressure through overexpression of the TATA binding proteins SPT3 and SPT15 encoding genes derived from Saccharomyces cerevisiae microorganism of the present invention. By transforming the gene to be used efficiently, it was confirmed that the ethanol production capacity is increased compared to the existing transformants. In addition, a yeast transformant that inhibits the production of glycerol produced from Saccharomyces cerevisiae microorganism prepared to use glycerol as a carbon source according to the present invention can be usefully used in the process. As a result of fermentation using glycerol as a substrate, the gene-inserted yeast transformant produced a greater amount of ethanol than the yeast strain that was not.

In the embodiment of the present invention, the PCR products of SPT3 and SPT15 were respectively obtained 1.0 kb and 0.7 kb by PCR using Saccharomyces cerevisiae as a template, and the TATA binding protein SPT3, SPT15 overexpressing strains were prepared. Thereafter, yeast host cells were transformed using a recombinant vector in which both Gcy and Dak were inserted. Subsequently, the yeast-integration vector was constructed for the gene insertion of Gup1, and the gene was inserted into Saccharomyces cerevisiae. Ethanol production using glycerol of the protein expressed from the gene was investigated.

As a result, it was confirmed that ethanol production was increased by the recombinant and transformed YPH499 (pGcyaDak, pGupSpt3.15Cas) according to the present invention.

Therefore, the yeast Saccharomyces Saccharomyces , a representative ethanol producing strain cerevisiae ) to improve the ethanol production using glycerol, the present inventors have transformed the transformant and its transformants with improved bioethanol production capacity through overexpression of SPT3 and SPT15, TATA binding proteins derived from Saccharomyces cerevisiae The present invention relates to a method for producing ethanol, and more particularly, to improve ethanol production ability and resistance to osmotic pressure in transformants prepared to use glycerol as a fermentation source, yeast in Saccharomyces cerevisiae . An yeast transformant was developed by introducing an RNA polymerase factor such as an overexpression vector of SPT3 and SPT15, a TATA binding protein, a recombinant vector transduced using the glycerol, and introducing a glycerol uptake protein (Gup1). Yurim Building, Hongje 1-dong, Seodaemun-gu, Seoul, Korea The Korea Culture Center of Microorganisms (KCCM) was deposited with Accession No. KCCM11153P December 17, 2010. In addition, the present invention was completed by confirming that the yeast transformant efficiently uses glycerol as a carbon source to increase ethanol production.

As described above, in the present invention, Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) is a transformant having improved bioethanol production ability through overexpression of SPT3 and SPT15, which are microorganisms derived from the microorganisms of the genus Microorganism, and ethanol production method using the transformant, and more specifically, fermentation of glycerol. Overexpression of yeast RNA polymerase factors, such as SPT3 and SPT15, in the Saccharomyces cerevisiae , such as TATA-binding proteins, for increased ethanol production and osmotic resistance in transformants designed to be used as raw materials Glycerol uptake protein was transformed into transformants with improved ethanol production capacity and glycerol dehydrogenase and dihydroxyacetone kinase genes. Inserted recombinant vector was introduced into yeast strain . Then, it was confirmed that the ethanol production yield is higher than the yeast strain. Yeast transformants produced by blocking glycerol production genes in strains engineered to use glycerol as a carbon source according to the present invention can produce a large amount of ethanol using glycerol produced as a by-product of biodiesel, which is very useful. It is expected to be an invention.

1 is a diagram showing a PCR product for identifying genes of the TATA binding proteins SPT3 and SPT15 by performing agarose gel electrophoresis in the present invention, Lane 1, 1kb DNA marker; Lane 2, SPT3, shows the picture identifying Lane 3, SPT15.
Figure 2 (A) is a figure confirming the PCR product of the glycerol dehydrogenase gene by performing agarose gel electrophoresis in the present invention, Lane 1, 1kb DNA marker; Lane 2, product of Gcy PCR,
Figure 2 (B) is a figure confirming the PCR product of the dihydroxyacetone kinase gene by performing agarose gel electrophoresis in the present invention, Lane 1, 1kb DNA marker; Lane 2, product of Dak PCR,
Figure 2 (C) is a figure confirming the PCR product of the glycerol uptake protein gene by performing agarose gel electrophoresis in the present invention, Lane 1, 1kb DNA marker; Lane 2, Gup PCR product.
Figure 3a is a schematic diagram showing the recombination process of the recombinant vector pGupSpt3.15Cas TATA binding proteins SPT3, SPT15 is glycerol uptake protein gene inserted into the construction recombinant vector pGup presented in the present invention,
Figure 3b is a schematic diagram showing the recombination process of the recombinant vector pGcyaDak inserted in both directions the glycerol dehydrogenase gene and dihydroxyacetone kinase gene presented in the present invention,
4 is a graph confirming that ethanol production is increased by transforming pGcyaDak into an overexpression vector of the TATA binding proteins SPT3 and SPT15 presented in the present invention using glycerol as a substrate. In Figure 4 the symbols are ◆, YPH499 (pESC-TRP); YPH499 (p GcyaDak , pGupCas ); ▲, YPH499 (p GcyaDak , pGupSpt3Cas ); X, YPH499 (p GcyaDak , pGupSpt3.15 Cas ).

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

<Example 1> Transformation of the yeast TATA binding protein SPT3, SPT15 gene

Example 1-1 Amplification of TATA binding Proteins SPT3 and SPT15 Genes in Yeast

Peptide portion from Saccharomyces cerevisiae genomic DNA (BY4741) to clone TATA binding proteins SPT3, SPT15 genes for increased ethanol resistance and osmotic resistance, which are inhibitors in ethanol production using glycerol as a substrate For cloning SPT3, Spe (5- actagtcccg ccgccaccaa ggagatgatg gacaagcata agta-3; SEQ ID NO: 11), Spe (5- actagtttac atgataattg gtttag-3; SEQ ID NO: 12), and SPT15 were identified as Bgl (5- Agatctcccg ccgccaccaa ggagatggcc gatgaggaac gttt-3; SEQ ID NO: 13) , Bgl (5- agatcttcac atttttctaa attcactta-3; SEQ ID NO: 14) was designed to synthesize the primers so that each recognition sequence is inserted. Then, PCR was performed using the synthesized primers. As a result, PCR bands of 1.5 kb and 0.7 kb, respectively, could be confirmed and are shown in FIG. 1.

Example 1-2 Cloning of TATA Binding Proteins SPT3 and SPT15 Genes in Yeast

The amplification product obtained in Example 1 was electrophoresed on a 0.8% agarose gel and DNA fragments on the agarose gel were recovered using a Biospin gel extraction kit (Bioflux).

Then, SPT3 was digested with Spe Dak with Bgl and then with restriction enzymes Spe1 and Bgl and then ligated to pGup1 into which the glycerol uptake protein was inserted.E. Coli DH5a (Invitrogen) The recombinant plasmid DNA ligated from the transformant was then isolated, and the recombinant vectors were named pGupSpt3 and pGupSpt3.15, respectively, and are shown in 3a.

In addition, a sense primer (5-ggatccatgt cagcattttaggtaaattccgtg-3; SEQ ID NO: 15) and an anti-sence primer (5-ggatccataatgtcgctgatcagcatcctg tct-3; SEQ ID NO: 16) were prepared to include a BamH 1 recognition sequence for gene insertion of pGupSpt3.15. It was cloned into a yeast gene insertion vector (Yeast integration vector) YIP-5 (ATCC) and named it pGupSpt3.15Cas and plotted on 3a and inserted into genomic DNA of Saccharomyces cerevisiae. Recombinant vector pGupSpt3.15Cas was transformed into yeast host cells according to the experimental method provided by Clontech's YEASTMAKER yeast transformation kit2 to wild type strain (YPH499, Clontech Laboratories Inc.). I was. Subsequently, the transformants were selected using tryptophan deficient SD medium (0.67% yeast nitrogen base, 2% glucose, 0.067% yeast nigrogen base w / o trp, 2% agar), which was then transformed into Saccharomyces cerevisiae YPH499. (pGcyaDak, pGupSpt3.Spt15Cas).

Example 2 Transformation of Glycerol Dehydrogenase, Dihydroxy Acetone Kinase, Glycerol Uptake Protein Gene

Example 2-1 Amplification of Glycerol Dehydrogenase, Dihydroxy Acetone Kinase, and Glycerol Uptake Protein Genes in Yeast

Sequencing of Peptides from Saccharomyces cerevisiae's Genomicdiene (BY4741) for Cloning the Glycerol Dehydrogenase and Dihydroxyacetone Kinase Genes for the Efficient Conversion of Glycerol to DHAP, an Intermediary in the Process BamH (5- ggatccatgcctgctactttacatga for cloning Gcy with reference to

ttct-3; SEQ ID NO: 17), Sal (5- gtcgacatacttgaatacttcgaaaggag-3; SEQ ID NO: 18), Dak is Spe (5- actagtatgtccgctaaatcgtttgaagtc-3; SEQ ID NO: 19) , Cla (5- atcgatatacaaggcgctttgaaccccct-3; SEQ ID NO: 20) and Gup1 includes EcoR (5- gaattcatgtcgctgatcagcatcctg-3; SEQ ID NO: 21) and Spe (5- actagtccagca

ttttaggtaaattccgtg-3; SEQ ID NO: 22) was designed and synthesized primers to insert each recognition sequence. Then, PCR was performed using the synthesized primers. As a result, PCR bands of 936bp, 1755bp and 1683bp could be confirmed, respectively, and are shown in FIG. 2.

Example 2-2 Cloning of Glycerol Dehydrogenase, Dihydroxy Acetone Kinase, and Glycerol Uptake Protein Genes

The amplification product obtained in Example 1 was electrophoresed on a 0.8% agarose gel and DNA fragments on the agarose gel were recovered using a Biospin gel extraction kit (Bioflux).

After that, the BamH Gcy, Sal, Dak are Spe, and Cla Gup1 is EcoR, was cut with Spe yeast-in pESC-trp (Clontech) in E. coli shuttle vectors (yeast- E. coli shuttle vector) ligation (ligation E. coli ( E. coli ) DH5a was transformed. The ligation of recombinant plasmid DNA was then isolated from the transformants. The recombinant vectors were named pESC-Gcy, pESC-Dak, and pESC-Gup, respectively. Then, Dak was cloned using pESC-Gcy as a vector to transform Escherichia coli DH5a (Invitrogen). Then, the recombinant plasmid DNA ligated from the transformant was isolated. The recombinant vector was pGcyaDak. It is named as shown in Fig. 3b and also the sense primer (5-ggatccatgt cagcattttaggtaaattccgtg-3; SEQ ID NO: 15) and the anti-sence primer (5-ggatccataatgtcgctgatcagcatcctg tct-) to include the BamH 1 recognition sequence for gene insertion of pESC-Gup1. 3; SEQ ID NO: 16) was constructed and cloned into a yeast gene insertion vector (yeast integration vector) YIP-5 and inserted into the genomic DNA of Saccharomyces cerevisiae.

< Example  3> Yeast trait Conversion  Bioethanol Production

YPH499 (pGcyaDak, pGupCas) and YPH499 (pGcyaDak, pGupSpt3.15Cas) were absorbed at 600 nm in fermentation broth supplemented with 2% glycerol as a substrate for 48 hours by preculture for 24 hours in SG medium induced with galactose. When is measured, let each be 1. The fermentation broth was incubated at 30 ° C. and 100 rpm, and the ethanol produced was measured by performing gas chromatography by taking a culture solution at a predetermined time. As a result of the above method, the yield of ethanol was higher than that of YPH499 (pGcyaDak, pGupCas). This result is shown in FIG.

Korea Microorganism Conservation Center (overseas) KCCM11153P 20101217

<110> KOREAN UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> Recombinant yeast by overexpression of SPT3 and SPT15 for          improving productivity of bioethanol and Method for producing          ethanol using the same <160> 22 <170> Kopatentin 1.71 <210> 1 <211> 336 <212> PRT <213> Saccharomyces cerevisiae <400> 1 Met Met Asp Lys His Lys Tyr Arg Val Glu Ile Gln Gln Met Met Phe   1 5 10 15 Val Ser Gly Glu Ile Asn Asp Pro Pro Val Glu Thr Thr Ser Leu Ile              20 25 30 Glu Asp Ile Val Arg Gly Gln Val Ile Glu Ile Leu Leu Gln Ser Asn          35 40 45 Lys Thr Ala His Leu Arg Gly Ser Arg Ser Ile Leu Pro Glu Asp Val      50 55 60 Ile Phe Leu Ile Arg His Asp Lys Ala Lys Val Asn Arg Leu Arg Thr  65 70 75 80 Tyr Leu Ser Trp Lys Asp Leu Arg Lys Asn Ala Lys Asp Gln Asp Ala                  85 90 95 Ser Ala Gly Val Ala Ser Gly Thr Gly Asn Pro Gly Ala Gly Gly Glu             100 105 110 Asp Asp Leu Lys Lys Ala Gly Gly Gly Glu Lys Asp Glu Lys Asp Gly         115 120 125 Gly Asn Met Met Lys Val Lys Lys Ser Gln Ile Lys Leu Pro Trp Glu     130 135 140 Leu Gln Phe Met Phe Asn Glu His Pro Leu Glu Asn Asn Asp Asp Asn 145 150 155 160 Asp Asp Met Asp Glu Asp Glu Arg Glu Ala Asn Ile Val Thr Leu Lys                 165 170 175 Arg Leu Lys Met Ala Asp Asp Arg Thr Arg Asn Met Thr Lys Glu Glu             180 185 190 Tyr Val His Trp Ser Asp Cys Arg Gln Ala Ser Phe Thr Phe Arg Lys         195 200 205 Asn Lys Arg Phe Lys Asp Trp Ser Gly Ile Ser Gln Leu Thr Glu Gly     210 215 220 Lys Pro His Asp Asp Val Ile Asp Ile Leu Gly Phe Leu Thr Phe Glu 225 230 235 240 Ile Val Cys Ser Leu Thr Glu Thr Ala Leu Lys Ile Lys Gln Arg Glu                 245 250 255 Gln Val Leu Gln Thr Gln Lys Asp Lys Ser Gln Gln Ser Ser Gln Asp             260 265 270 Asn Thr Asn Phe Glu Phe Ala Ser Ser Thr Leu His Arg Lys Lys Arg         275 280 285 Leu Phe Asp Gly Pro Glu Asn Val Ile Asn Pro Leu Lys Pro Arg His     290 295 300 Ile Glu Glu Ala Trp Arg Val Leu Gln Thr Ile Asp Met Arg His Arg 305 310 315 320 Ala Leu Thr Asn Phe Lys Gly Gly Arg Leu Ser Ser Lys Pro Ile Ile                 325 330 335 <210> 2 <211> 1014 <212> DNA <213> Saccharomyces cerevisiae <400> 2 atgatggaca agcataagta tcgtgtggag attcaacaga tgatgtttgt ctctggtgaa 60 attaacgacc cacccgtaga aaccacatca ctgatagaag atatagtgag gggtcaagtg 120 atagaaattc ttttacagtc aaacaaaacg gcgcatctta ggggaagtag gagcattctc 180 cctgaagacg tcattttctt gatcagacac gacaaggcca aagtcaatcg tttgagaaca 240 tatctgtcat ggaaggattt gcgtaaaaac gccaaggacc aagatgctag tgccggtgta 300 gcgagtggca ctggaaatcc tggggcaggt ggtgaagatg atttgaaaaa agcaggtggt 360 ggcgagaaag acgaaaaaga tggtggaaac atgatgaagg tcaagaaatc ccaaattaag 420 ctgccatggg aattgcagtt tatgttcaat gaacatcctt tagaaaataa tgacgacaat 480 gatgatatgg atgaggatga acgagaagct aatatagtca ctttgaaaag gctgaaaatg 540 gctgacgata gaacacgaaa catgactaaa gaggagtacg tgcattggtc cgattgtcga 600 caggcaagtt ttacatttag gaagaataaa aggttcaagg actggtctgg aatttcgcaa 660 ttaactgagg ggaaacccca tgatgatgtg attgatatac tggggtttct aacttttgag 720 attgtctgtt ctttgacgga aacagctctg aaaatcaaac aaagagaaca ggtattacag 780 actcaaaagg acaaatccca gcaatctagc caagataata ctaactttga atttgcatca 840 tccacattac atagaaagaa aagattattt gatggacctg aaaatgttat aaacccgctc 900 aaaccaaggc atatagagga agcctggaga gtactacaaa caattgacat gaggcatagg 960 gctttgacca actttaaagg tggtagactc agttctaaac caattatcat gtaa 1014 <210> 3 <211> 240 <212> PRT <213> Saccharomyces cerevisiae <400> 3 Met Ala Asp Glu Glu Arg Leu Lys Glu Phe Lys Glu Ala Asn Lys Ile   1 5 10 15 Val Phe Asp Pro Asn Thr Arg Gln Val Trp Glu Asn Gln Asn Arg Asp              20 25 30 Gly Thr Lys Pro Ala Thr Thr Phe Gln Ser Glu Glu Asp Ile Lys Arg          35 40 45 Ala Ala Pro Glu Ser Glu Lys Asp Thr Ser Ala Thr Ser Gly Ile Val      50 55 60 Pro Thr Leu Gln Asn Ile Val Ala Thr Val Thr Leu Gly Cys Arg Leu  65 70 75 80 Asp Leu Lys Thr Val Ala Leu His Ala Arg Asn Ala Glu Tyr Asn Pro                  85 90 95 Lys Arg Phe Ala Ala Val Ile Met Arg Ile Arg Glu Pro Lys Thr Thr             100 105 110 Ala Leu Ile Phe Ala Ser Gly Lys Met Val Val Thr Gly Ala Lys Ser         115 120 125 Glu Asp Asp Ser Lys Leu Ala Ser Arg Lys Tyr Ala Arg Ile Ile Gln     130 135 140 Lys Ile Gly Phe Ala Ala Lys Phe Thr Asp Phe Lys Ile Gln Asn Ile 145 150 155 160 Val Gly Ser Cys Asp Val Lys Phe Pro Ile Arg Leu Glu Gly Leu Ala                 165 170 175 Phe Ser His Gly Thr Phe Ser Ser Tyr Glu Pro Glu Leu Phe Pro Gly             180 185 190 Leu Ile Tyr Arg Met Val Lys Pro Lys Ile Val Leu Leu Ile Phe Val         195 200 205 Ser Gly Lys Ile Val Leu Thr Gly Ala Lys Gln Arg Glu Glu Ile Tyr     210 215 220 Gln Ala Phe Glu Ala Ile Tyr Pro Val Leu Ser Glu Phe Arg Lys Met 225 230 235 240 <210> 4 <211> 723 <212> DNA <213> Saccharomyces cerevisiae <400> 4 atggccgatg aggaacgttt aaaggagttt aaagaggcaa acaagatagt gtttgatcca 60 aataccagac aagtatggga aaaccagaat cgagatggta caaaaccagc aactactttc 120 cagagtgaag aggacataaa aagagctgcc ccagaatctg aaaaagacac ctccgccaca 180 tcaggtattg ttccaacact acaaaacatt gtggcaactg tgactttggg gtgcaggtta 240 gatctgaaaa cagttgcgct acatgcccgt aatgcagaat ataaccccaa gcgttttgct 300 gctgtcatca tgcgtattag agagccaaaa actacagctt taatttttgc ctcagggaaa 360 atggttgtta ccggtgcaaa aagtgaggat gactcaaagc tggccagtag aaaatatgca 420 agaattatcc aaaaaatcgg gtttgctgct aaattcacag acttcaaaat acaaaatatt 480 gtcggttcgt gtgacgttaa attccctata cgtctagaag ggttagcatt cagtcatggt 540 actttctcct cctatgagcc agaattgttt cctggtttga tctatagaat ggtgaagccg 600 aaaattgtgt tgttaatttt tgtttcagga aagattgttc ttactggtgc aaagcaaagg 660 gaagaaattt accaagcttt tgaagctata taccctgtgc taagtgaatt tagaaaaatg 720 tga 723 <210> 5 <211> 312 <212> PRT <213> Saccharomyces cerevisiae <400> 5 Met Pro Ala Thr Leu His Asp Ser Thr Lys Ile Leu Ser Leu Asn Thr   1 5 10 15 Gly Ala Gln Ile Pro Gln Ile Gly Leu Gly Thr Trp Gln Ser Lys Glu              20 25 30 Asn Asp Ala Tyr Lys Ala Val Leu Thr Ala Leu Lys Asp Gly Tyr Arg          35 40 45 His Ile Asp Thr Ala Ala Ile Tyr Arg Asn Glu Asp Gln Val Gly Gln      50 55 60 Ala Ile Lys Asp Ser Gly Val Pro Arg Glu Glu Ile Phe Val Thr Thr  65 70 75 80 Lys Leu Trp Cys Thr Gln His His Glu Pro Glu Val Ala Leu Asp Gln                  85 90 95 Ser Leu Lys Arg Leu Gly Leu Asp Tyr Val Asp Leu Tyr Leu Met His             100 105 110 Trp Pro Ala Arg Leu Asp Pro Ala Tyr Ile Lys Asn Glu Asp Ile Leu         115 120 125 Ser Val Pro Thr Lys Lys Asp Gly Ser Arg Ala Val Asp Ile Thr Asn     130 135 140 Trp Asn Phe Ile Lys Thr Trp Glu Leu Met Gln Glu Leu Pro Lys Thr 145 150 155 160 Gly Lys Thr Lys Ala Val Gly Val Ser Asn Phe Ser Ile Asn Asn Leu                 165 170 175 Lys Asp Leu Leu Ala Ser Gln Gly Asn Lys Leu Thr Pro Ala Ala Asn             180 185 190 Gln Val Glu Ile His Pro Leu Leu Pro Gln Asp Glu Leu Ile Asn Phe         195 200 205 Cys Lys Ser Lys Gly Ile Val Val Glu Ala Tyr Ser Pro Leu Gly Ser     210 215 220 Thr Asp Ala Pro Leu Leu Lys Glu Pro Val Ile Leu Glu Ile Ala Lys 225 230 235 240 Lys Asn Asn Val Gln Pro Gly His Val Val Ile Ser Trp His Val Gln                 245 250 255 Arg Gly Tyr Val Val Leu Pro Lys Ser Val Asn Pro Asp Arg Ile Lys             260 265 270 Thr Asn Arg Lys Ile Phe Thr Leu Ser Thr Glu Asp Phe Glu Ala Ile         275 280 285 Asn Asn Ile Ser Lys Glu Lys Gly Glu Lys Arg Val Val His Pro Asn     290 295 300 Trp Ser Pro Phe Glu Val Phe Lys 305 310 <210> 6 <211> 939 <212> DNA <213> Saccharomyces cerevisiae <400> 6 atgcctgcta ctttacatga ttctacgaaa atcctttctc taaatactgg agcccaaatc 60 cctcaaatag gtttaggtac gtggcagtcg aaagagaacg atgcttataa ggctgtttta 120 accgctttga aagatggcta ccgacacatt gatactgctg ctatttaccg taatgaagac 180 caagtcggtc aagccatcaa ggattcaggt gttcctcggg aagaaatctt tgttactaca 240 aagttatggt gtacacaaca ccacgaacct gaagtagcgc tggatcaatc actaaagagg 300 ttaggattgg actacgtaga cttatatttg atgcattggc ctgccagatt agatccagcc 360 tacatcaaaa atgaagacat cttgagtgtg ccaacaaaga aggatggttc tcgtgcagtg 420 gatatcacca attggaattt catcaaaacc tgggaattaa tgcaggaact accaaagact 480 ggtaaaacta aggccgttgg agtctccaac ttttctataa ataacctgaa agatctatta 540 gcatctcaag gtaataagct tacgccagct gctaaccaag tcgaaataca tccattacta 600 cctcaagacg aattgattaa tttttgtaaa agtaaaggca ttgtggttga agcttattct 660 ccgttaggta gtaccgatgc tccactattg aaggaaccgg ttatccttga aattgcgaag 720 aaaaataacg ttcaacccgg acacgttgtt attagctggc acgtccaaag aggttatgtt 780 gtcttgccaa aatctgtgaa tcccgatcga atcaaaacga acaggaaaat atttactttg 840 tctactgagg actttgaagc tatcaataac atatcgaagg aaaagggcga aaaaagggtt 900 gtacatccaa attggtctcc tttcgaagta ttcaagtaa 939 <210> 7 <211> 584 <212> PRT <213> Saccharomyces cerevisiae <400> 7 Met Ser Ala Lys Ser Phe Glu Val Thr Asp Pro Val Asn Ser Ser Leu   1 5 10 15 Lys Gly Phe Ala Leu Ala Asn Pro Ser Ile Thr Leu Val Pro Glu Glu              20 25 30 Lys Ile Leu Phe Arg Lys Thr Asp Ser Asp Lys Ile Ala Leu Ile Ser          35 40 45 Gly Gly Gly Ser Gly His Glu Pro Thr His Ala Gly Phe Ile Gly Lys      50 55 60 Gly Met Leu Ser Gly Ala Val Val Gly Glu Ile Phe Ala Ser Ser Ser  65 70 75 80 Thr Lys Gln Ile Leu Asn Ale Ile Arg Leu Val Asn Glu Asn Ala Ser                  85 90 95 Gly Val Leu Leu Ile Val Lys Asn Tyr Thr Gly Asp Val Leu His Phe             100 105 110 Gly Leu Ser Ala Glu Arg Ala Arg Ala Leu Gly Ile Asn Cys Arg Val         115 120 125 Ala Val Ile Gly Asp Asp Val Ala Val Gly Arg Glu Lys Gly Gly Met     130 135 140 Val Gly Arg Arg Ala Leu Ala Gly Thr Val Leu Val His Lys Ile Val 145 150 155 160 Gly Ala Phe Ala Glu Glu Tyr Ser Ser Lys Tyr Gly Leu Asp Gly Thr                 165 170 175 Ala Lys Val Ala Lys Ile Ile Asn Asp Asn Leu Val Thr Ile Gly Ser             180 185 190 Ser Leu Asp His Cys Lys Val Pro Gly Arg Lys Phe Glu Ser Glu Leu         195 200 205 Asn Glu Lys Gln Met Glu Leu Gly Met Gly Ile His Asn Glu Pro Gly     210 215 220 Val Lys Val Leu Asp Pro Ile Pro Ser Thr Glu Asp Leu Ile Ser Lys 225 230 235 240 Tyr Met Leu Pro Lys Leu Leu Asp Pro Asn Asp Lys Asp Arg Ala Phe                 245 250 255 Val Lys Phe Asp Glu Asp Asp Glu Val Val Leu Leu Val Asn Asn Leu             260 265 270 Gly Gly Val Ser Asn Phe Val Ile Ser Ser Ile Thr Ser Lys Thr Thr         275 280 285 Asp Phe Leu Lys Glu Asn Tyr Asn Ile Thr Pro Val Gln Thr Ile Ala     290 295 300 Gly Thr Leu Met Thr Ser Phe Asn Gly Asn Gly Phe Ser Ile Thr Leu 305 310 315 320 Leu Asn Ala Thr Lys Ala Thr Lys Ala Leu Gln Ser Asp Phe Glu Glu                 325 330 335 Ile Lys Ser Val Leu Asp Leu Leu Asn Ala Phe Thr Asn Ala Pro Gly             340 345 350 Trp Pro Ile Ala Asp Phe Glu Lys Thr Ser Ala Pro Ser Val Asn Asp         355 360 365 Asp Leu Leu His Asn Glu Val Thr Ala Lys Ala Val Gly Thr Tyr Asp     370 375 380 Phe Asp Lys Phe Ala Glu Trp Met Lys Ser Gly Ala Glu Gln Val Ile 385 390 395 400 Lys Ser Glu Pro His Ile Thr Glu Leu Asp Asn Gln Val Gly Asp Gly                 405 410 415 Asp Cys Gly Tyr Thr Leu Val Ala Gly Val Lys Gly Ile Thr Glu Asn             420 425 430 Leu Asp Lys Leu Ser Lys Asp Ser Leu Ser Gln Ala Val Ala Gln Ile         435 440 445 Ser Asp Phe Ile Glu Gly Ser Met Gly Gly Thr Ser Gly Gly Leu Tyr     450 455 460 Ser Ile Leu Leu Ser Gly Phe Ser His Gly Leu Ile Gln Val Cys Lys 465 470 475 480 Ser Lys Asp Glu Pro Val Thr Lys Glu Ile Val Ala Lys Ser Leu Gly                 485 490 495 Ile Ala Leu Asp Thr Leu Tyr Lys Tyr Thr Lys Ala Arg Lys Gly Ser             500 505 510 Ser Thr Met Ile Asp Ala Leu Glu Pro Phe Val Lys Glu Phe Thr Ala         515 520 525 Ser Lys Asp Phe Asn Lys Ala Val Lys Ala Ala Glu Glu Gly Ala Lys     530 535 540 Ser Thr Ala Thr Phe Glu Ala Lys Phe Gly Arg Ala Ser Tyr Val Gly 545 550 555 560 Asp Ser Ser Gln Val Glu Asp Pro Gly Ala Val Gly Leu Cys Glu Phe                 565 570 575 Leu Lys Gly Val Gln Ser Ala Leu             580 <210> 8 <211> 1755 <212> DNA <213> Saccharomyces cerevisiae <400> 8 atgtccgcta aatcgtttga agtcacagat ccagtcaatt caagtctcaa agggtttgcc 60 cttgctaacc cctccattac gctggtccct gaagaaaaaa ttctcttcag aaagaccgat 120 tccgacaaga tcgcattaat ttctggtggt ggtagtggac atgaacctac acacgccggt 180 ttcattggta agggtatgtt gagtggcgcc gtggttggcg aaatttttgc atccccttca 240 acaaaacaga ttttaaatgc aatccgttta gtcaatgaaa atgcgtctgg cgttttattg 300 attgtgaaga actacacagg tgatgttttg cattttggtc tgtccgctga gagagcaaga 360 gccttgggta ttaactgccg cgttgctgtc ataggtgatg atgttgcagt tggcagagaa 420 aagggtggta tggttggtag aagagcattg gcaggtaccg ttttggttca taagattgta 480 ggtgccttcg cagaagaata ttctagtaag tatggcttag acggtacagc taaagtggct 540 aaaattatca acgacaattt ggtgaccatt ggatcttctt tagaccattg taaagttcct 600 ggcaggaaat tcgaaagtga attaaacgaa aaacaaatgg aattgggtat gggtattcat 660 aacgaacctg gtgtgaaagt tttagaccct attccttcta ccgaagactt gatctccaag 720 tatatgctac caaaactatt ggatccaaac gataaggata gagcttttgt aaagtttgat 780 gaagatgatg aagttgtctt gttagttaac aatctcggcg gtgtttctaa ttttgttatt 840 agttctatca cttccaaaac tacggatttc ttaaaggaaa attacaacat aaccccggtt 900 caaacaattg ctggcacatt gatgacctcc ttcaatggta atgggttcag tatcacatta 960 ctaaacgcca ctaaggctac aaaggctttg caatctgatt ttgaggagat caaatcagta 1020 ctagacttgt tgaacgcatt tacgaacgca ccgggctggc caattgcaga ttttgaaaag 1080 acttctgccc catctgttaa cgatgacttg ttacataatg aagtaacagc aaaggccgtc 1140 ggtacctatg actttgacaa gtttgctgag tggatgaaga gtggtgctga acaagttatc 1200 aagagcgaac cgcacattac ggaactagac aatcaagttg gtgatggtga ttgtggttac 1260 actttagtgg caggagttaa aggcatcacc gaaaaccttg acaagctgtc gaaggactca 1320 ttatctcagg cggttgccca aatttcagat ttcattgaag gctcaatggg aggtacttct 1380 ggtggtttat attctattct tttgtcgggt ttttcacacg gattaattca ggtttgtaaa 1440 tcaaaggatg aacccgtcac taaggaaatt gtggctaagt cactcggaat tgcattggat 1500 actttataca aatatacaaa ggcaaggaag ggatcatcca ccatgattga tgctttagaa 1560 ccattcgtta aagaatttac tgcatctaag gatttcaata aggcggtaaa agctgcagag 1620 gaaggtgcta aatccactgc tacattcgag gccaaatttg gcagagcttc gtatgtcggc 1680 gattcatctc aagtagaaga tcctggtgca gtaggcctat gtgagttttt gaagggggtt 1740 caaagcgcct tgtaa 1755 <210> 9 <211> 560 <212> PRT <213> Saccharomyces cerevisiae <400> 9 Met Ser Leu Ile Ser Ile Leu Ser Pro Leu Ile Thr Ser Glu Gly Leu   1 5 10 15 Asp Ser Arg Ile Lys Pro Ser Pro Lys Lys Asp Ala Ser Thr Thr Thr              20 25 30 Lys Pro Ser Leu Trp Lys Thr Thr Glu Phe Lys Phe Tyr Tyr Ile Ala          35 40 45 Phe Leu Val Val Val Pro Leu Met Phe Tyr Ala Gly Leu Gln Ala Ser      50 55 60 Ser Pro Glu Asn Pro Asn Tyr Ala Arg Tyr Glu Arg Leu Leu Ser Gln  65 70 75 80 Gly Trp Leu Phe Gly Arg Lys Val Asp Asn Ser Asp Ser Gln Tyr Arg                  85 90 95 Phe Phe Arg Asp Asn Phe Ala Leu Leu Ser Val Leu Met Leu Val His             100 105 110 Thr Ser Ile Lys Arg Ile Val Leu Tyr Ser Thr Asn Ile Thr Lys Leu         115 120 125 Arg Phe Asp Leu Ile Phe Gly Leu Ile Phe Leu Val Ala Ala His Gly     130 135 140 Val Asn Ser Ile Arg Ile Leu Ala His Met Leu Ile Leu Tyr Ala Ile 145 150 155 160 Ala His Val Leu Lys Asn Phe Arg Arg Ile Ala Thr Ile Ser Ile Trp                 165 170 175 Ile Tyr Gly Ile Ser Thr Leu Phe Ile Asn Asp Asn Phe Arg Ala Tyr             180 185 190 Pro Phe Gly Asn Ile Cys Ser Phe Leu Ser Pro Leu Asp His Trp Tyr         195 200 205 Arg Gly Ile Ile Pro Arg Trp Asp Val Phe Phe Asn Phe Thr Leu Leu     210 215 220 Arg Val Leu Ser Tyr Asn Leu Asp Phe Leu Glu Arg Trp Glu Asn Leu 225 230 235 240 Gln Lys Lys Lys Ser Ser Ser Tyr Glu Ser Lys Glu Ala Lys Ser Ala                 245 250 255 Ile Leu Leu Asn Glu Arg Ala Arg Leu Thr Ala Ala His Pro Ile Gln             260 265 270 Asp Tyr Ser Leu Met Asn Tyr Ile Ala Tyr Val Thr Tyr Thr Pro Leu         275 280 285 Phe Ile Ala Gly Pro Ile Ile Thr Phe Asn Asp Tyr Val Tyr Gln Ser     290 295 300 Lys His Thr Leu Pro Ser Ile Asn Phe Lys Phe Ile Phe Tyr Tyr Ala 305 310 315 320 Val Arg Phe Val Ile Ala Leu Leu Ser Met Glu Phe Ile Leu His Phe                 325 330 335 Leu His Val Val Ala Ile Ser Lys Thr Lys Ala Trp Glu Asn Asp Thr             340 345 350 Pro Phe Gln Ile Ser Met Ile Gly Leu Phe Asn Leu Asn Ile Ile Trp         355 360 365 Leu Lys Leu Leu Ile Pro Trp Arg Leu Phe Arg Leu Trp Ala Leu Leu     370 375 380 Asp Gly Ile Asp Thr Pro Glu Asn Met Ile Arg Cys Val Asp Asn Asn 385 390 395 400 Tyr Ser Ser Leu Ala Phe Trp Arg Ala Trp His Arg Ser Tyr Asn Lys                 405 410 415 Trp Val Val Arg Tyr Ile Tyr Ile Pro Leu Gly Gly Ser Lys Asn Arg             420 425 430 Val Leu Thr Ser Leu Ala Val Phe Ser Phe Val Ala Ile Trp His Asp         435 440 445 Ile Glu Leu Lys Leu Leu Leu Trp Gly Trp Leu Ile Val Leu Phe Leu     450 455 460 Leu Pro Glu Ile Phe Ala Thr Gln Ile Phe Ser His Tyr Thr Asp Ala 465 470 475 480 Val Trp Tyr Arg His Val Cys Ala Val Gly Ala Val Phe Asn Ile Trp                 485 490 495 Val Met Met Ile Ala Asn Leu Phe Gly Phe Cys Leu Gly Ser Asp Gly             500 505 510 Thr Lys Lys Leu Leu Ser Asp Met Phe Cys Thr Val Ser Gly Phe Lys         515 520 525 Phe Val Ile Leu Ala Val Val Ser Leu Phe Ile Ala Val Gln Ile Met     530 535 540 Phe Glu Ile Arg Glu Glu Glu Lys Arg His Gly Ile Tyr Leu Lys Cys 545 550 555 560 <210> 10 <211> 1683 <212> DNA <213> Saccharomyces cerevisiae <400> 10 atgtcgctga tcagcatcct gtctccccta attacttccg agggcttaga ttcaagaatc 60 aaaccttcac caaaaaagga tgcctctact accactaagc catcactatg gaaaactact 120 gagttcaaat tctactacat tgcatttctg gtcgtggttc ccttgatgtt ctatgctggg 180 ttacaagcta gttcgcccga aaatccaaac tatgcaagat acgaacgtct cctatctcaa 240 ggttggttat ttggcagaaa agtagacaat agtgattctc aatataggtt tttcagggac 300 aattttgcgc tattgtcagt tttaatgcta gtccacactt ctataaaacg cattgtactt 360 tattcaacaa atatcactaa attgaggttt gatctgatat ttggtttgat ctttttagtg 420 gccgctcatg gtgtcaattc gataagaatt ttagcccata tgctaatttt atatgccatc 480 gcccatgtac taaagaactt tagaagaata gccaccatca gcatttggat ttatggtatt 540 tctacgcttt ttattaacga caacttcaga gcatatccat ttggtaatat ttgctctttt 600 ttaagcccat tggaccattg gtatagaggt atcattccaa gatgggatgt ctttttcaat 660 tttactcttt tgagagtctt aagttacaac ttggacttct tagagaggtg ggagaattta 720 caaaagaaga aaagtccatc ctatgaatca aaagaagcta aatcagccat tttgctcaat 780 gaacgtgcta gattaactgc tgcacacccc atacaggact acagcttaat gaattatatt 840 gcatatgtta cttacacgcc acttttcatt gccggcccca ttataacatt caatgattat 900 gtttaccaat cgaaacatac cttgccatca ataaatttca aattcatttt ttactatgcg 960 gtgagattcg ttattgctct cttatctatg gagttcattt tacactttct ccacgttgtg 1020 gcaatctcaa aaaccaaagc gtgggaaaat gacacacctt tccagatttc catgattggc 1080 ttatttaatt tgaatattat ttggctaaaa ctactgattc cgtggaggct gtttaggctg 1140 tgggctttgc tagacggaat cgatacacct gaaaatatga tcaggtgtgt tgataacaat 1200 tacagttcac tagcattctg gagagcttgg catagaagct acaataagtg ggttgtccgt 1260 tacatatata ttcctctagg tggttcaaaa aatagagttt tgacatcact agcagtcttt 1320 tccttcgtag ctatatggca tgacatcgaa ctaaagttat tattatgggg ttggctaata 1380 gttttgttcc tcttaccaga aatttttgct acccaaattt tctctcatta taccgacgca 1440 gtctggtaca gacacgtttg cgctgtcggt gctgttttca acatatgggt tatgatgatc 1500 gctaatcttt ttggattctg cttgggctct gacggtacta aaaaattact aagcgatatg 1560 ttctgtaccg tatctggttt caaatttgta attttggcaa gcgttagttt attcatcgca 1620 gtacaaataa tgtttgaaat cagagaagaa gaaaagaggc acggaattta cctaaaatgc 1680 tga 1683 <210> 11 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 actagtcccg ccgccaccaa ggagatgatg gacaagcata agta 44 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 actagtttac atgataattg gtttag 26 <210> 13 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 agatctcccg ccgccaccaa ggagatggcc gatgaggaac gttt 44 <210> 14 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 agatcttcac atttttctaa attcactta 29 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ggatccatgt cagcatttta ggtaaattcc gtg 33 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ggatccataa tgtcgctgat cagcatcctg tct 33 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ggatccatgc ctgctacttt acatgattct 30 <210> 18 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gtcgacatac ttgaatactt cgaaaggag 29 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 actagtatgt ccgctaaatc gtttgaagtc 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 atcgatatac aaggcgcttt gaaccccctt 30 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 gaattcatgt cgctgatcag catcctg 27 <210> 22 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 actagtccag cattttaggt aaattccgtg 30

Claims (14)

delete delete delete delete delete delete delete delete Encoding SPT3 (Suppressot of Ty 3) to yeast containing a gene encoding a glycerol dehydrogenase, a gene encoding a dihydroxyacetone kinase and a gene encoding a glycerol uptake protein gene, and having ethanol production from glycerol Recombinant yeast Saccharomyces cerevisiae YPH499 (pGcyaDak, pGupSpt3.15Cas, KCCM 1153) into which a gene encoding the above gene and a gene encoding SPT15 (Suppressot of Ty 15) were introduced.
delete delete delete A method for producing ethanol comprising culturing the recombinant yeast of claim 9 using glycerol as a carbon source to produce ethanol and obtaining the produced ethanol.
delete

Images