KR101942538B1 - Pharmaceutical composition and functional food containing the dipeptide Glu-phe to improve metabolic diseases - Google Patents

Abstract

The present invention relates to a pharmaceutical composition capable of improving metabolic diseases, and more particularly, to a pharmaceutical composition for improving metabolic diseases using a novel use of a dipeptide Glu-Phe having the ability to inhibit hepatic cell fat accumulation.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a pharmaceutical composition for improving metabolic diseases using dipeptide Glu-Phe and a pharmaceutical composition and functional food containing the dipeptide Glu-phe to improve metabolic diseases.

The present invention relates to a pharmaceutical composition capable of improving metabolic diseases, and more particularly, to a pharmaceutical composition for improving metabolic diseases using a novel use of a dipeptide Glu-Phe having the ability to inhibit hepatic cell fat accumulation.

Recently, due to westernization of eating habits and lack of exercise, the mortality due to metabolic diseases such as obesity and diabetes is continuously increasing. In particular, nonalcoholic fatty liver disease (NAFLD) is caused by hepatic metabolic disorders and is accompanied by metabolic diseases such as obesity, diabetes and hyperlipidemia. Non-alcoholic fatty liver disease is caused by the accumulation of excessive fat in hepatocytes due to the inability of the hepatocytes to smoothly synthesize, oxidize and decompose the lipid bilayers (Adam et al., Canadian Medical Associa- tion Journal, 172, 899 -905, 2005; Dixon et al., Gastroenterology, 121, 91-100, 2001).

Excessive fat accumulation in hepatocytes is thought to be a major cause of excessive lipid synthesis and is regulated by the expression and activity of various genes. In particular, it is known to be regulated by sterol regulatory element binding proteins (SREBPs), a transcription factor. SREBPs exist in three isoforms, SREBP-1a, -1c and -2. Both SREBP-1a and -1c regulate genes involved in fatty acid and glucose metabolism, and SREBP-2 is known to be involved mainly in the metabolism of cholesterol. SREBP, which is present in the endoplasmic reticulum membrane, is activated through protein hydrolysis by metabolic signals (insulin and cholesterol), and acetyl-CoA carboxylase (ACC1) and fatty acid synthase (FASN) (Jeon & Osborne, Trend in Endocrinology & Metabolism, 23, 65-72, 2012), which is known to increase the amount of fatty acid and triacylglycerol in hepatocytes by expressing genes such as hepatocytes.

In addition, adenosine monophosphate activated protein kinase (AMPK) is a key regulator of energy status in hepatocytes and is known to be rapidly activated when glucose is deficient. It has been reported that metabolic diseases such as diabetes, obesity and non-alcoholic fatty liver can be induced when such AMPK does not function smoothly (Zou et al., Journal of Clinical Investigation, 108, 1167-1174, 2001) . In particular, such activation of AMPK has been reported to inhibit the lipid synthesis of hepatocytes by inhibiting the expression of SREBP-1c (Zhang et al., Cell Metabolism, 9, 407-416, 2009).

Dipeptides are generically referred to as compounds in which two different amino acids are linked in the form of peptide bonds, and they have been actively studied for their functionality in the food and pharmaceutical industry market. Recent studies have reported that dipeptides such as Ile-Tyr, Ile-Trp, and Lys-Trp exhibit excellent activity in the prevention of hypertension (Santos et al., Peptide Science, 98, 288-293, 2012) Leu-Ile is known to inhibit neuronal apoptosis (Nitta et al., Journal of Neuroscience Research, 78. 250-258, 2004). It has been reported that Trp-Glu, one of the dipeptides containing glutamic acid, inhibits the accumulation of cholesterol and triglyceride in hepatocytes (Jia et al., Bioorganic & Medicinal Chemistry Letters, 24, 2957 -2962, 2014). However, studies on the physiological activities of di-peptides have not yet been conducted in depth, and various experimental approaches at the molecular level will be needed in the future.

Onion is one of the most commonly consumed vegetables in the world and has unique flavors and flavors and is used as a main ingredient and seasoning for a variety of foods (Chang et al., Korean Journal of Food and Cookery Science, 26, 649-654, 2010). It is well known that onions contain a large amount of sulfur and phenolic compounds and thus exhibit excellent antioxidant, antibacterial and anti-inflammatory activities (Murota et al., Journal of Medical Investigation, 54, 2007; Nithyameenakshi et al , Asian Journal of Cell Biology, 1, 65-80, 2006; Takahashi & Shibamoto, Journal of Agricultural Food Chemistry, 56, 10462-40467, 2008).

Recently, onion intake has been known to prevent metabolic diseases such as anti-obesity and anti-diabetic drugs, and thus the interest of consumers is continuously increasing (Yoshinari et al., Nutrients, 4, 1518-1526, 2012; Jung et al , Nutrition & Metabolism, 8, 2011). These onion effects are believed to be due to the phenolic compounds contained in the onion largely, but the precise elucidation at the molecular level of active substances has not yet been made.

The inventors of the present invention have completed the present invention by searching for and identifying the precursor of the active ingredient of the onion which is effective in improving the metabolism disorder of the glycolipid.

Accordingly, it is an object of the present invention to provide a novel use of the dipeptide Glu-Phe, which has not yet been known before, as well as confirming the precise active substance of the onion which has an effect on the improvement of the glycolipid metabolic disorder, To provide a new use.

It is another object of the present invention to provide a purification method for purifying di-peptide Glu-Phe from onion.

Still another object of the present invention is to provide a pharmaceutical composition and a health functional food having an activity of inhibiting hepatic cell fat accumulation comprising di-peptide Glu-Phe as an active ingredient.

The objects of the present invention are not limited to the above-mentioned objects, and other objects not mentioned can be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention described above, the present invention provides a method for producing an onion extract, Concentrating the onion extracts under reduced pressure; Obtaining a butanol fraction through the solvent fraction of the concentrate; And purifying the butanol fraction by digesting the di-peptide Glu-Phe having the following formula (1) by ODS column chromatography and HPLC.

[Chemical Formula 1]

In a preferred embodiment, the step of obtaining the onion extract is carried out by extracting onions by adding the methanol and homogenizing the onions.

In a preferred embodiment, the butanol fraction is obtained by separating the suspension of the concentrate from a normal-butanol layer obtained by sequential solvent fractionation using normal-hexane, chloroform, ethyl acetate and n-butanol.

The present invention also provides a pharmaceutical composition for improving metabolic diseases, comprising as an active ingredient at least one of a di-peptide Glu-Phe having the following formula (1) and a pharmacologically acceptable salt thereof.

[Chemical Formula 1]

In a preferred embodiment, the dipeptide Glu-Phe is separated from the onion.

In a preferred embodiment, the dipeptide Glu-Phe inhibits the expression of SREBP-1c by modulating AMPK activation.

In a preferred embodiment, the dipeptide Glu-Phe inhibits expression of one or more of each gene that synthesizes SCD-1, FASN, and ACC1.

In a preferred embodiment, the metabolic disorder is one or more of obesity, non-alcoholic fatty liver, diabetes and hyperlipidemia due to excessive fat accumulation in hepatocytes.

The present invention also provides a health functional food for metabolic disease improvement comprising as an active ingredient at least one of a di-peptide Glu-Phe having the following formula (1) and a pharmacologically acceptable salt thereof.

[Chemical Formula 1]

In a preferred embodiment, the compound is isolated from an onion.

In a preferred embodiment, it is a powder, a granule, a tablet, a capsule or a drink.

In a preferred embodiment, the metabolic disorder is one or more of obesity, non-alcoholic fatty liver, diabetes and hyperlipidemia due to excessive fat accumulation in hepatocytes.

The present invention has the following excellent effects.

First, the dipeptide Glu-Phe of the present invention is an accurate active substance of onion which has an effect on the improvement of the glycolipid metabolic disorder, and has an activity of inhibiting hepatic cell fat accumulation.

In addition, the pharmaceutical composition and the health functional food of the present invention contain the dipeptide Glu-Phe, which is separated and structurally determined from onion, as an active ingredient, and has hepatocyte fat accumulation inhibitory activity. Therefore, Alcoholic fatty liver disease, diabetes, and hyperlipemia.

Brief Description of the Drawings Fig. 1 is a process diagram of separation and purification of Compound 1 (Glu-Phe) obtained according to an embodiment of the present invention.
2 is a structural diagram and HMBC correlation (arrow) of Glu-Phe [L-glutamine-L-phenylalanine] obtained in the example of the present invention.
FIG. 3 is a graph showing a toxicity evaluation result for hepatocytes according to the treatment concentration of Glu-Phe obtained in the example of the present invention. FIG.
FIG. 4 is a graph showing the degree of inhibition of hepatic cell fat accumulation of Glu-Phe obtained in the example of the present invention (Oil Red O staining) (significant difference test by Turkey's test (* P <0.05)).
Fig. 5 is a micrograph showing the inhibitory effect of Glu-Phe on hepatocyte fat accumulation obtained in the example of the present invention. Fig.
FIG. 6 is a graph (mRNA level) showing the degree of suppression of hepatocyte lipid synthesis factor of Glu-Phe obtained in the example of the present invention (significant difference test by Turkey's test (* P <0.05)).
FIG. 7 is a photograph (protein level) showing the degree of suppression of hepatocyte lipid synthesis factor of Glu-Phe obtained in the example of the present invention.

The term used in the present invention is a general term that is widely used at present. However, in some cases, there is a term arbitrarily selected by the applicant. In this case, the term used in the description of the invention, And the meaning should be grasped.

Hereinafter, the technical structure of the present invention will be described in detail with reference to the accompanying drawings and preferred embodiments.

However, the present invention is not limited to the embodiments described herein but may be embodied in other forms. Like reference numerals used to describe the present invention throughout the specification denote like elements.

The technical feature of the present invention is to isolate the dipeptide Glu-Phe having an inhibitory activity on hepatic cell fat accumulation from components not previously known to be contained in the onion, from the onion, to confirm its structure, and to confirm its precise activity.

That is, the present invention not only isolates di-peptides having previously unknown functionality from onions and confirm their activity but also inhibits the hepatic cell fat accumulation of the present compounds. Therefore, the present invention provides a pharmaceutical composition And health functional foods.

Accordingly, the pharmaceutical composition for improving metabolic diseases and the health-functional food of the present invention comprise at least one of dipeptide Glu-Phe having the following formula (1) and a pharmacologically acceptable salt thereof as an active ingredient.

[Chemical Formula 1]

Herein, the dipeptide having the structure of Formula 1 may be Glu-Phe, especially L-glutamine-L-phenylalanine (Glu-Phe). Dipeptide Glu-Phe is a substance having inhibitory activity on hepatic cell fat accumulation, which is a substance whose function is not known at all before being disclosed in the present invention, and its presence was first confirmed from onion.

That is, the dipeptide Glu-Phe inhibits the expression of SREBP-1c and related lipid synthesis genes by regulating AMPK activation in hepatocytes, as shown in the following Experimental Examples, and has an activity of inhibiting hepatic cell fat accumulation. Thus, the pharmaceutical composition of the present invention comprising the di-peptide Glu-Phe can be used to treat and treat metabolic diseases of one or more of obesity, non-alcoholic fatty liver, diabetes and hyperlipidemia which are caused by excessive fat accumulation in hepatocytes.

Although the chemically synthesized dipeptide Glu-Phe of Formula 1 of the present invention can be used, it is expected that toxicity will be reduced when Glu-Phe, which is a natural substance separated from edible onion, is used.

The pharmaceutical composition for improving metabolic diseases according to the present invention may contain at least one of dipeptide Glu-Phe and pharmaceutically acceptable salts thereof, and may be used alone or in combination with a pharmacologically acceptable carrier Or an excipient. When provided as a mixture, the active ingredient dipeptide Glu-Phe and / or a pharmaceutically acceptable salt thereof may be included in the pharmaceutical composition in an amount of 0.01 to 99% by weight.

Examples of the carrier or excipient include water, dextrin, calcium carbonate, lactose, propylene glycol, liquid paraffin, physiological saline, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, polyvinylpyrrolidone, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. These may be used alone or in combination, but not limited thereto, All excipients are available.

In addition, when the pharmaceutical composition for improving metabolic diseases of the present invention is formulated for pharmaceutical use, it may further contain conventional fillers, extenders, binders, disintegrators, surfactants, anti-coagulants, lubricants, wetting agents, flavors, emulsifiers or preservatives.

The content of the active ingredient dipeptide Glu-Phe and / or its pharmaceutically acceptable salt in the form of the individual dosage forms may be in the amount administered in a single dose, for example, the total daily dose, It can be 1/4 times.

The dose of the pharmaceutical composition for metabolic disease improvement of the present invention is preferably determined in consideration of the age, sex, condition, absorption of the active ingredient, inactivity of the active ingredient, and the drug to be used in combination. For example, , The dose may be 0.1 to 1 M and administered 1 to 5 times a day.

Next, the health-functional food for improving metabolic diseases of the present invention contains the di-peptide Glu-Phe and / or a pharmaceutically acceptable salt thereof contained in the above-mentioned pharmaceutical composition as an active ingredient, Therefore, it can be used for the purpose of improving metabolic diseases of at least one of obesity, non-alcoholic fatty liver, diabetes and hyperlipidemia caused by excessive accumulation of fat in hepatocytes.

In the present invention, the term 'health functional food' means a natural product or a processed product containing one or more nutrients. Preferably, the function of the food is determined by physical, biochemical, biotechnological, Means a food group that has been imparted with added value to function and express, and a food which is designed and manufactured so that the body control function related to regulation of bio-defense rhythm of food composition, prevention and recovery of disease, etc. is sufficiently expressed in living body. The health functional food may include a pharmaceutically acceptable food supplementary additive and may further comprise suitable carriers, excipients and diluents conventionally used in the manufacture of health functional foods.

Examples of the health functional food to which the dipeptide Glu-Phe and / or the pharmaceutically acceptable salt thereof of the present invention can be added include various foods, beverages, gums, tea, and vitamin complexes. In addition, it is also possible to use special nutritional foods (eg crude oil, baby food, etc.), health supplements, confectionery (eg snacks), dairy products (eg fermented milk, cheese, etc.) Beverages, two-oil, fermented beverages, etc.), but are not limited thereto. The food, beverage or food additives described above can be produced by a conventional production method.

The health functional food of the present invention can be used as a nutritional supplement, a vitamin, a mineral (electrolyte), a flavoring agent such as a synthetic flavor agent and a natural flavor agent, a colorant and an aging agent (cheese, chocolate etc.), a pectic acid and its salt, Salts, organic acids, protective colloid thickening agents, pH adjusting agents, stabilizers, preservatives, glycerin, water, carbonating agents used in carbonated beverages and the like. These components can be used independently or in combination.

Thus, the health functional food of the present invention has various formulations as described above, and may have any one of powder, granule, tablet, capsule and beverage.

In one embodiment, when the health-functional food of the present invention is implemented as a beverage, there are no particular restrictions on other components other than those containing the dipeptide Glu-Phe and / or a pharmaceutically acceptable salt thereof of the present invention as an essential ingredient, And may contain various flavors or natural carbohydrates as an additional ingredient. Examples of natural carbohydrates include monosaccharides such as disaccharides such as glucose and fructose such as maltose, sucrose and the like and polysaccharides such as dextrins, cyclodextrins and the like, and xylitol, Sorbitol, and erythritol. Natural flavors (tau martin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavors (saccharin, aspartame, etc.) can be advantageously used as flavors other than those described above .

In addition, in the health functional food for the purpose of inhibiting the fat accumulation in hepatocytes for the improvement of metabolic diseases, the content of the active ingredient, the dipeptide Glu-Phe and / or its pharmaceutically acceptable salt may be included in a ratio of 0.1 μM to 1 M There will be.

Next, the dipeptide having the structure of the above-mentioned formula (1) of the present invention has the steps of: obtaining an onion extract solution of Glu-Phe; Concentrating the onion extracts under reduced pressure; Obtaining a butanol fraction through the solvent fraction of the concentrate; And purifying the butanol fraction by ODS column chromatography and HPLC. At this time, the step of obtaining the onion extract is performed by adding the methanol to the onion and extracting it by homogenizing. Also, the butanol fraction is obtained by separating the suspension of the concentrate from the normal-butanol layer obtained by sequential solvent fractionation using n-hexane, chloroform, ethyl acetate and n-butanol.

Example

1. Onion extraction and solvent fraction

Onion ( Allium cepa L. Sunpower) was collected in June 2013 from Muan County, South Jeolla Province. The onions were cut into 1 x 1 cm size and then lyophilized. 4 L of methanol was added to 100 g of onion freeze-dried powder (onion 1.2 kg fresh weight), homogenized with a homogenizer (T50 digital ULTRA-TURRAX, IKA, Staufen, Germany) and extracted for 18 hours under room temperature and dark conditions. After suction filtration (No. 2, Whatman) was performed, 2.5 L of methanol was added to the obtained residue, followed by further extraction and filtration by the same method. The extracted filtrate was concentrated under reduced pressure at 37 ° C using a vacuum concentrator (A-3S, Eyela, Tokyo, Japan) equipped with an aspirator (CCA-1110, Eyela, Tokyo, Japan). A water suspension (300 mL) of the obtained concentrate (76.6 g) was repeatedly subjected to solvent fractionation by repeating three times with 300 mL each of hexane, ethyl acetate and water-saturated butanol.

2. Isolation of Glu-Phe from the butanol layer of onion methanol extract

Octadecylsilane (ODS) column chromatography was performed on 5.2 g of the butanol layer obtained by solvent fractionation of an onion methanol extract as shown in Fig. 1 (equivalent to 1.2 kg of fresh weight). After concentration, the sample was dissolved using the first eluting solvent, and charged to a column (4.6 × 30 cm) filled with ODS corresponding to about 40 times of the sample. The elution solvent was H ₂ O / MeOH (0: 0, 2: 8, v / v, 300 mL) and H ₂ O / MeOH (6/4, 2/8, 3/7, 0:10, , 450 mL) were used. After elution, total 5 fractions (B1-B5) were grouped. The fraction B3 (312 mg) was dissolved in a 10% acetonitrile solution adjusted to pH 2.65 with trifluoroacetic acid using a prep-ODS column (shim-pack-prep-ODS (H) Kit 20 x 250 mm) The gradient was applied between the nitriles (40 min) and elution (9.9 mL / min). As a result, a compound having an unknown peak ( t _R 24.3 min, 3.1 mg, purity > 98%) was isolated.

Experimental Example 1

Structural analysis of isolated compounds.

Example Compound HR-ESI-MS (negative) a m / z molecular weight peaks from the spectrum 293.1137 [MH] of isolated in ^- this was observed, the molecular formula for this compound is _{C 14 H 18 N 2 O 15} (m / z 294 ). The nonlinearity analysis was confirmed by [α] _D ²⁵ +44.2 (c 0.023, CH ₃ OH). ¹ H- and &lt; ¹³ &gt; C-NMR data of the isolated compound are shown in Table 1.

^{1 H-NMR (500 MHz,} CD 3 OD) of the proton signal assignable to a mono- substituted benzene ring, from the spectrum [δ 7.28 (1H, t, J = 8.5 Hz, H-3, 5), 7.23 (1H, br (d, J = 8.5 Hz, H-4) and 7.22 (2H, t, J = 8.5 Hz, H-2, 6). sp ³ Proton signal of the division pattern and the ^{1 H- 1 H correlation spectroscopy (COSY} ) ethane moiety of one kind from the spectrum [δ 4.67 (1H, dd, J = 9.0, 5.0 Hz, H-8) 3.23 (1H, dd, J = 14.0, 5.0 Hz, H -7a), and 2.95 (1H, dd, J = 14.0, 9.0 Hz, H-7b)] and the propane moiety [δ 3.93 (1H, br. t, J = 8.0 Hz, H -2 '), 2.45 (2H, t, J = 8.0, H-4'), 2.13 (1H, dd, J = 14.5, 8.0 Hz, H-3'a), and 2.03 (1H, dd, J = 14.5, 8.0 Hz, H-3'b)]. From the ¹³ C-NMR (125 MHz, CD ₃ OD) spectra, a total of 14 species of carbon, including four quaternary carbon signals (δ 174.8-138.6) and five sp ³ carbon signals (δ 55.3-27.3) Signals were observed to support the reliability of the analyzed partial structure from ¹ H-NMR data.

Position δ _H ( int. , mult. , J in Hz) δ _C One - 138.6 2, 6 7.22 (2H, t, 8.5) 130.4 3, 5 7.28 (2H, t, 8.5) 129.6 4 7.23 (1H, br.d, 8.5) 128.0 7a
7b 3.23 (1H, dd, 14.0, 5.0)
2.95 (1H, dd, 14.0, 9.0) 38.4 8 4.67 (1H, dd, 9.0, 5.0) 55.3 9 - 174.8 One' - 171.7 2' 3.93 (1H, broad t, 8.0) 53.7 3'a
3'b 2.13 (1H, dd, 14.5, 8.0)
2.03 (1H, dd, 14.5, 8.0) 27.3 4' 2.45 (2H, t, 8.0) 32.9 5 ' - 174.3

The results show that the isolated compounds are composed of three kinds of carbonyl carbons [δ 171.7 (C-1 '), 174.3 (C-5'), and 174.8 ([Delta] 55.3 (C-8) and 53.7 (C-2 ')], and in particular the present compounds were found to contain 8-amino-phenylpropanoic acid It was suggested that 2-amino-pentanedioic acid, glutamic acid, is present in a combined form.

Heteronuclear single quantum correlation (HSQC) and heteronuclear multiple bond correlation (HMBC) analyzes were performed for more accurate structural analysis of isolated compounds. As a result, the presence of a partial structure of phenylalanine and glutamic acid was confirmed again. H-8 / C-1 ', H-7 / C-9, H-2' / C-4 ', and H- And H-3 / C-5 '), it was confirmed that the carbonyl group on C-1 of glutamic acid and the amine group on C-8 of phenylalanine were linked by an amide bond. In order to confirm the exact steric structure of the present compound, a synthesis product of L-glutamine-L-phenylalanine (Peptron, Daejeon, Korea) was subjected to ¹ H- and ¹³ C- Were compared with those of the present compounds. As a result, it was confirmed that the NMR spectra and the nonlinearity values of the two compounds coincided with each other. Thus, the structure of the isolated compound was interpreted as L-glutamine-L-phenylalanine (Glu-Phe) and the compound was first isolated from the onion.

In addition, the HMBC correlation (arrow) and structure of Glu-Phe are as shown in FIG.

Experimental Example 2

Determination of the effect of cell culture and Glu-Phe on survival of liver cell lines.

(3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide [3- (4-tert-butylpyridazinone)] was used in order to evaluate the ability of Glu- , 5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide, MTT]. For the experiment, rat hepatocyte AML-12 cells were used. Ferritic acid (FA), which is known to inhibit hepatocellular fat accumulation, and onion (FBS), which are known to inhibit hepatic cell fat accumulation, were cultured at 37 ° C and 5% carbon dioxide supplemented with 10% fetal bovine serum (FBS) and 1% penicillin- Quercetin 4'- O- beta-D-glucopyranoside (Q4'G), a major flavonoid, was used as a comparative group.

Treatment of the compounds in hepatocytes was performed 24 hours after inoculation. After 24 hours of incubation, the cells were replaced with glucose-free DMEM (0.5% FBS) solution and incubated for 24 hours. Then, 10 mM glucose and 100 nM insulin were treated with hepatocytes to induce fatty acid biosynthesis and then cultured for 6 hours.

More specifically, the AML-12 cell line was first inoculated into a 96-well plate and treated with the comparative groups (Q4'G and FA) and Glu-Phe at a concentration of 0-60 μM for 48 hours, respectively. MTT was added at a concentration of 0.5 mg / mL after the sample treatment and incubated for 2 hours at 37 ° C and 5% carbon dioxide. After the completion of the incubation, the supernatant was removed and washed with phosphate buffered saline (PBS). Then, 100 μL of dimethylsulfoxide (DMSO) was added to each well, and the resultant was analyzed with an absorbance analyzer (Biotek, Wknooski, VT , USA) was used to measure the absorbance at a wavelength of 540 nm. The cell viability was calculated as a percentage using a control cell line in which the compound was not treated, and the results are shown in FIG.

As shown in Fig. 3, Glu-Phe and the comparative groups (Q4'G and FA) showed no toxicity to hepatocytes according to the respective treatment concentrations

Experimental Example 3

Identification of the inhibitory effect of Glu-Phe on liver fat accumulation in liver cells.

To confirm the inhibitory effect of Glu-Phe on hepatic cell fat accumulation obtained in the examples, hepatic cells were treated with oleic acid to induce hepatic cell hyperfiltration. That is, the AML-12 cell line was inoculated into a 6-well plate, and treated with Glu-Phe and the comparative groups (Q4'G and FA) to 50 μM, respectively. After culturing for 24 hours, the culture solution was removed, the cell line was washed with PBS, and the cells were fixed with 4% formalin for 1 hour. Then, a solution of Oil Red O (Sigma-Aldrich; 0.05 g in 60% isopropanol) was added and the cells were stained at room temperature for 1 hour. The stained cells were photographed with a microscope (inverted microscope) and the degree of accumulation of fat in the cells was photographed. After staining, the stained cells were extracted with 100% isopropanol and the amount of fat accumulated in the whole hepatocytes was measured at 500 nm wavelength The absorbance was compared and evaluated, and the results are shown in Fig. 4 and Fig.

4 and 5, it was confirmed that fat was excessively accumulated in the control group treated with oleic acid, compared with the control group treated with no oleic acid. On the other hand, in hepatocytes treated with Glu-Phe, the accumulation of fat was markedly decreased. These activities were similar to the comparative groups Q4'G and FA. Then, the stained hepatocytes were extracted with isopropanol, and the fat accumulation of the whole hepatocytes was examined. As shown in FIG. 4, when the control group treated with oleic acid was taken as 100, Glu-Phe showed about 20% It was confirmed that accumulation was suppressed.

Experimental Example 4

Effect of Glu-Phe on the Expression and Activity of Regulators of Lipid Synthesis in Hepatocytes at the mRNA Level.

The effect of Glu-Phe obtained in the examples on the expression and activity of the lipogenesis regulatory factor in hepatocytes was confirmed at the mRNA level as follows, and the results are shown in FIG.

Total RNA was isolated from hepatocytes using a triazole (Trizol, Invitrogen Corp., Carlsbad, CA, USA) and cDNA was synthesized using iscript cDNA synthesis kit (Bio-Rad) Real-time PCR was performed using primers. The amount of mRNA expression was calculated by a comparative threshold cycle method, and normalized by the control gene Large, P0 (RPLP0). The primer sequences used in the present invention are shown in Table 2 below.

Gene Real time quantitative polymerase chain reaction (RT-qPCR) primers Forward Reverse SREBP-1c TGGATTGCACATTTGAAGACAT GCCAGAGAAGCAGAAGAG SCD1 CCGGAGACCCCTTAGATCGA TAGCCTGTAAAAGATTTCTGCAAACC FASN GCTGCGGAAACTTCAGGAAAT AGAGACGTGTCACTCCTGGACTT ACC1 GACGTTCGCCATAACCAAGT CTGTTTAGCGTGGGGATGTT RPLP0 GTGCTGATGGGCAAGAAC AGGTCCTCCTTGGTGAAC

The abbreviations used in the following Table 2 are as follows. ACC1, acetyl-CoA carboxylase 1; FASN, fatty acid synthase; RPLPO, ribosomal protein, Large, P0; SCD1, stearoyl-CoA desaturase-1; SREBP-1c, sterol regulatory element binding protein-1c.

As a result, the expression of SREBP-1c was significantly increased in the control group treated with insulin and glucose at the mRNA level, whereas the expression of SREBP-1c was significantly decreased in the hepatic cells treated with Glu-Phe. As shown in FIG. 6, it was confirmed that SCD-1, FASN, and ACC1, which are lipogenic enzymes regulated by SREBP-1c, were significantly reduced in comparison with the control group.

Experimental Example 5

Effect of Glu-Phe on the Expression and Activity of Regulators of Fatty Synthesis in Hepatocytes at Protein Level.

The effect of Glu-Phe obtained in the examples on the expression and activity of the lipogenesis regulatory factor in hepatocytes was confirmed at the protein level as follows, and the results are shown in FIG.

To extract proteins from hepatocytes, the cells were washed twice with cold PBS and centrifuged (1,000 × g , 4 ° C, 8 minutes) to separate the pellet. The pellet was resuspended in extraction buffer (radioimmunoprecipitation assay buffer with protease and ptoteasome inhibitors) and reacted at 4 ° C for 15 minutes. The reaction solution was subjected to centrifugation (20,000 × g , 4 ° C., 10 minutes), and the obtained supernatant (protein) was used for immunoblotting. Proteins were separated by 8% or 10% (v / v) sodium dodecylsulfate polyacrylamide gell electrophoresis (SDS-PAGE) and gels were transferred to PVDF membrane. The membranes were blocked with blocking buffer (5% skim milk in TBS-T) for 1 h at room temperature, and then the membranes were incubated with anti-SREBP-1c (2A4, Santa Cruz Biotechnology, AMPK (Cell Signaling Technology, Beverly, MA, USA), anti-AMPK (Cell Signaling Technology), anti-phospho ACC (Cell Signaling Technology), anti FASN (Cell Signaling Technology), and β-actin antibody solution at 4 ° C for at least 12 hours. After incubation with secondary antibody solution (Santa Cruz Biotechnology) for 1 hour at room temperature, the protein was reacted with ECL detection reagent.

As a result, it was observed that Glu-Phe suppresses the expression of FASN and SREBP1 even at the protein level as shown in Fig. From these results, it was confirmed that Glu-Phe inhibited the lipid synthesis of hepatocytes by regulating the expression of SREBP-1c.

In order to investigate the mechanism by which Glu-Phe regulates SREBP-1c, we examined the activity of Glu-Phe against AMPK, which is known to be an upstream regulator of SREBP-1c. As a result, it was confirmed that Glu-Phe significantly activated AMPK as shown in Fig. In other words, AMPK is known to be a negative regulator of SREBP-1c, thus confirming that Glu-Phe regulates SREBP-1c through activation of AMPK.

Thus, since the compound Glu-Phe having the formula 1 of the present invention suppresses the expression of SREBP-1c and related liposome synthesis genes by regulating the activation of AMPK in the hepatocyte and thus inhibits hepatocellular fat accumulation, the Glu- A pharmaceutical composition or a functional food for improving metabolic diseases caused by the accumulation of hepatocyte fat can be produced since the pharmaceutical or food preparation containing the pharmacologically acceptable salt thereof as an active ingredient has the hepatocyte fat accumulation inhibitory activity .

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, Various changes and modifications will be possible.

Claims (12)

delete delete delete A pharmaceutical composition for inhibiting hepatic cell fat accumulation comprising at least one of a di-peptide Glu-Phe having the following formula (1) and a pharmacologically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]

5. The method of claim 4,
Wherein the di-peptide Glu-Phe is separated from an onion.
5. The method of claim 4,
Wherein said di-peptide Glu-Phe inhibits the expression of SREBP-1c by modulating AMPK activation.
5. The method of claim 4,
Wherein said dipeptide Glu-Phe inhibits the expression of one or more of each of the genes synthesizing SCD-1, FASN, and ACC1.
8. The method according to any one of claims 4 to 7,
The di-peptide Glu-Phe inhibits lipid synthesis in hepatocytes, thereby improving at least one of obesity, non-alcoholic fatty liver, diabetes and hyperlipemia caused by excessive accumulation of fat in the hepatocyte. &Lt; / RTI &gt;
A health functional food for inhibiting hepatic cell fat accumulation comprising as an active ingredient at least one of a di-peptide Glu-Phe having the following formula (1) and a pharmacologically acceptable salt thereof.
[Chemical Formula 1]

10. The method of claim 9,
Wherein the di-peptide Glu-Phe is separated from an onion.
10. The method of claim 9,
Wherein the composition is a powder, a granule, a tablet, a capsule or a beverage.
12. The method according to any one of claims 9 to 11,
Wherein said di-peptide Glu-Phe inhibits lipid synthesis in hepatocytes and improves at least one of obesity, non-alcoholic fatty liver, diabetes and hyperlipidemia caused by excessive accumulation of fat in said hepatocytes. Suppressive health functional food.

Images