KR102565433B1 - A composition for treating, preventing and improving bone associated diseases containing an ulmus extracts or an effective single compound isolated therefrom - Google Patents

Abstract

The present invention relates to a eugenpi extract or a compound isolated therefrom, and uses thereof.
According to one aspect, it was confirmed that the yogeunpi extract of the present invention or an effective substance isolated therefrom has excellent osteoclast differentiation inhibitory activity and anti-inflammatory effect, and thus it can be used for the treatment or prevention of bone-related diseases.

Description

A composition for treating, preventing and improving bone associated diseases containing an ulmus extracts or an effective single compound isolated therefrom}

The present invention relates to the treatment, improvement and prevention of bone-related diseases of a yogeunpi extract or a fraction thereof, or a compound isolated therefrom.

According to a survey by the Ministry of Food and Drug Safety, the rate of aging in Korea showed a steep increase from 10.5% in 2010 to 14.9% in 2019. (KRW 3,725.7 billion) showing an increasing trend. In addition, according to the population analysis by the National Statistical Office, the proportion of the elderly aged 65 or older currently accounts for 13.5% of the total population, making it an aging society. above) is expected. Based on these social backgrounds and trends, it is estimated that the bone/joint functional market will continue to expand in the future.

Yugeunpi generally refers to the root bark of a plant of the genus Elm, and in the private sector, it is also called a nose tree because it exudes juice like a nose when it touches water, and has been used for sinusitis, gastritis, stomach cancer and pressure ulcers. Yugeunpi is difficult to distinguish plants of the same elm tree as the original material itself, so it is distributed and researched as a common elm tree, not a royal elm tree prescribed in the Food Codex and Korean Pharmacopoeia and other herbal medicine (herbal medicine) specifications, causing confusion even in the research field. are doing

Under this background, an effective single compound was isolated from the Yugeunpi extract, and the present invention was completed by confirming the excellent efficacy of the Yugeunpi extract and the single compound.

Republic of Korea Patent No. 10-2334305

One aspect provides a pharmaceutical composition for the prevention or treatment of bone-related diseases, comprising a eugenpi extract or a fraction thereof as an active ingredient.

Another aspect provides a food composition for preventing or improving bone-related diseases, comprising a yogeunpi extract or a fraction thereof as an active ingredient.

Another aspect provides a feed composition for preventing or improving bone-related diseases, comprising a yogeunpi extract or a fraction thereof as an active ingredient.

Another aspect provides a pharmaceutical composition for preventing or treating bone-related diseases, including a compound represented by Formula 10, a derivative thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof.

Another aspect provides a food composition for preventing or improving bone-related diseases, including a compound represented by Formula 10, a derivative thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof.

Another aspect provides a feed composition for preventing or improving bone-related diseases, including a compound represented by Formula 10, a derivative thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof.

One aspect is to provide a pharmaceutical composition for the prevention or treatment of bone-related diseases, comprising a eugenpi extract or a fraction thereof as an active ingredient.

The term "yugeunpi" in the present specification means the bark or root bark of the elm tree belonging to the elm family (Ulmaceae) peeled off the cork layer. In general, root bark is used, but stem bark is known to have the same components, and is known to contain flavonoids, saponins, tannins and mucilage. Specifically, the yugenpi may mean the bark (bark or root) of Ulmus macrocarpa.

As used herein, the term "extract" refers to a product such as a liquid component obtained by immersing a target material in various solvents and then extracting at room temperature or a warm state for a certain period of time, and a solid component obtained by removing the solvent from the liquid component. can mean In addition, in addition to the above results, it can be comprehensively interpreted as including extracts of all formulations that can be formed using the extracts themselves and extracts such as dilutions of the results, concentrates thereof, adjusted products, purified products, or mixtures thereof, in addition to the above results. can

The extract may be extracted from natural, hybrid or mutant plants of the corresponding plant, and may also be extracted from plant tissue culture.

The extraction solvent of the extract may be a protic polar solvent or an aprotic polar and non-polar solvent. The protic polar solvent may be water, methanol, ethanol, propanol, isopropanol, or butanol. The aprotic polar solvent may be dichloromethane, tetrahydrofuran, ethyl acetate, acetonitrile, dimethylformamide, dimethylsulfoxide, acetone, 2-butanone, or hexamethylphosphoramide. The non-polar solvent may be pentane, hexane, chloroform, or diethyl ether. The non-polar solvent excludes benzene. The solvent is a C1-C6 alcohol, a C3-C10 ester, such as a C3-C10 acetate, a C3-C10 ketone, a C1-C6 unsubstituted or halogenated hydrocarbon, a C2-C10 ring ether, a mixture thereof or a mixture of one or more of the above solvents and water. The solvent may be ethanol, propanol, acetonitrile, ethyl acetate, acetone, 2-butanone, chloroform, dichloromethane, hexane, a mixture thereof, or a mixture of one or more of the above solvents and water. The hydrocarbon may be an alkane, alkene, or alkyne.

The extract is water; C1 to C4 lower alcohols such as methanol, ethanol, propanol, and butanol; polyhydric alcohols such as glycerine, butylene glycol, and propylene glycol; and hydrocarbon solvents such as methyl acetate, ethyl acetate, acetone, benzene, hexane, diethyl ether, and dichloromethane. It may be extracted with one or more solvents selected from the group. Specifically, the extract may be extracted with water and/or ethanol as a solvent, and more specifically, extracted with water as a solvent.

According to one embodiment, the yugeunpi extract was extracted using water, ethanol or a mixture of ethanol and water (70% ethanol) as a solvent.

The extract may be extracted by one or more methods selected from the group consisting of reduced pressure and high temperature extraction, hot water extraction, reflux extraction, hot water extraction, cold needle extraction, room temperature extraction, ultrasonic extraction, steam extraction and fractional extraction.

The term "fraction" in this specification refers to a product obtained by performing fractionation to separate a specific component or a specific component group from a mixture containing various components.

A fractionation method for obtaining the fraction is not particularly limited, and may be performed according to a method commonly used in the art. Non-limiting examples of the fractionation method include a fractionation method performed by treating various solvents, an ultrafiltration fractionation method performed by passing an ultrafiltration membrane having a constant molecular weight cut-off value, and various chromatography (size, charge, hydrophobicity or a chromatographic fractionation method that performs separation by affinity), a combination thereof, and the like.

The type of fractionation solvent used to obtain the fraction is not particularly limited, and any solvent known in the art may be used. Non-limiting examples of the fractionation solvent include polar solvents such as water and alcohol having 1 to 4 carbon atoms; non-polar solvents such as hexane, ethyl acetate, chloroform, and dichloromethane; or mixed solvents thereof. These may be used alone or in combination of one or more, but are not limited thereto.

According to one embodiment, the fraction may be fractionated with alcohol having 1 to 4 carbon atoms, and specifically fractionated with butanol.

The extract or fraction thereof comprises at least one compound selected from the group consisting of compounds represented by Formulas 1 to 9 below, a derivative thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof. it could be

[Formula 1]

[Formula 2]

[Formula 3]

[Formula 4]

[Formula 5]

[Formula 6]

[Formula 7]

[Formula 8]

[Formula 9]

The term "pharmaceutically acceptable salt" as used herein means a salt in a form that can be used pharmaceutically among salts in which cations and anions are bonded by electrostatic attraction, usually metal salts and organic bases. It may be a salt with, a salt with an inorganic acid, a salt with an organic acid, a salt with a basic or acidic amino acid, and the like. For example, the metal salt may be an alkali metal salt (sodium salt, potassium salt, etc.), an alkaline earth metal salt (calcium salt, magnesium salt, barium salt, etc.), aluminum salt and the like; Salts with organic bases include triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N,N-dibenzylethylenediamine It can be a salt with; Salts with inorganic acids may be salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like; Salts with organic acids include formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, and the like; A salt with a basic amino acid may be a salt with arginine, lysine, ornithine, and the like; A salt with an acidic amino acid may be a salt with aspartic acid or glutamic acid. Particularly preferred salts include, when the compound has an acidic functional group therein, inorganic salts such as alkali metal salts (eg, sodium salt, potassium salt, etc.), alkaline earth metal salts (eg, calcium salt, magnesium salt, barium salt, etc.); and organic salts such as ammonium salts, where the compound has a basic functional group therein, salts with inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, etc., acetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, There are salts with organic acids such as succinic acid, methanesulfonic acid, p-toluenesulfonic acid and the like.

The term "bone-related disease" in the present specification refers to a disease that is caused by an imbalance of osteoblasts and osteoclasts, resulting in bone tissue disorder or destruction of bone tissue, but the bone-related disease is not particularly limited thereto.

The bone-related diseases include osteoporosis, osteomalacia, osteopenia, bone defect, bone atrophy, osteonecrosis, fibrous dysplasia, fibrous osteitis, Paget's disease , Metabolic bone disease such as calcium dysregulation, bone dissolution caused by bone metastasis of cancer cells or wear debris of artificial joints, cancer-related bone resorption disease, neoplastic destruction of bone, Fracture, osteolysis, osteoarthritis, osteogenesis imperfecta, rickets, bone loss secondary to endocrine disorders or drugs, alveolar bone defect due to periodontitis and rheumatoid arthritis ) may be selected from the group consisting of.

The bone-related disease may be a bone disease associated with osteoclast expression/activation or osteoclast differentiation, and specifically may be caused by osteoclast overexpression or hyperdifferentiation.

The composition, extract or fraction thereof may have an effect of inhibiting osteoclast differentiation or inhibiting osteoclast expression/activity.

As used herein, the term "osteoclast" refers to cells differentiated from osteoclast precursors, and osteoclast precursor cells are differentiated into osteoclasts in the presence of M-CSF and RANKL, and multinucleated osteoclasts through fusion (multinucleated osteoclast) is formed. Osteoclasts bind to bone through αvβ3 integrin, etc., create an acidic environment, and secrete various collagenases and proteases to cause bone resorption. Osteoclasts do not proliferate as fully differentiated cells and cause apoptosis at the end of their lifespan of about 2 weeks.

The composition, extract or fraction thereof may inhibit the expression level of markers related to osteoclast differentiation or expression, and specifically, inhibit the expression level of one or more selected from the group consisting of NFATc1, OSCAR, DC-STAMP and CTSK. there is.

According to an embodiment, in the case of Yugeunpi water (hot water) extract, Yugeunpi 70% ethanol extract, and Yugeunpi ethanol extract (100% ethanol) extract, it was confirmed that the osteoclast differentiation inhibitory effect was excellent, and the hot water extract showed better efficacy. did Therefore, a composition containing the hot water extract and the ethanol extract as active ingredients can be used as a treatment for bone-related diseases.

The extract or a fraction thereof may have anti-inflammatory activity.

As used herein, the term "anti-inflammatory" refers to the process of inflammation or the property or efficacy of inhibiting it, and the anti-inflammatory means improvement (relief of symptoms), treatment, prevention of inflammatory diseases, inhibition or delay of the onset of such diseases. It may contain.

The term "inflammatory disease" in the present specification refers to diseases whose main lesion is inflammation. The inflammatory diseases include asthma, conjunctivitis, iritis, scleritis, uveitis, periodontitis, dermatitis, arthritis, degenerative arthritis, inflammatory bowel disease, ankylosing spondylitis, rhinitis, otitis media, sore throat, tonsillitis, pneumonia, gastritis, nephritis, pancreatitis, hepatitis, tendinitis, and It could be one or more of the tenosynovitis. In addition, the inflammatory bowel disease is a serious chronic inflammation caused by an inflammatory substance occurring in the digestive tract, specifically, at least one selected from the group consisting of Crohn's disease, ulcerative colitis, intestinal Behcet's disease, simple ulcer, radiation enteritis and ischemic enteritis It may contain.

As used herein, the term "treatment" refers to any activity that improves or beneficially changes the symptoms of a bone-related disease by administration of the composition of the present invention.

As used herein, the term "prevention" refers to any activity in which the possibility of developing a bone-related disease or disease is suppressed or delayed by administration of the composition of the present invention.

The pharmaceutical composition may include a pharmaceutically acceptable carrier. The "pharmaceutically acceptable carrier" may refer to a carrier or diluent that does not inhibit the biological activity and properties of the compound to be injected without irritating living organisms. Here, the meaning of "pharmaceutically acceptable" means that the application (prescription) does not have toxicity more than is adaptable without inhibiting the activity of the active ingredient. Any type of carrier that can be used in the pharmaceutical composition may be used as long as it is commonly used in the art and is pharmaceutically acceptable. Non-limiting examples of the carrier include lactose, dextrose, maltodextrin, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, glycerol, ethanol, starch, gum acacia, alginates, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or Mineral oil etc. are mentioned. These may be used alone or in combination of two or more. The pharmaceutical composition may be prepared as an oral formulation or parenteral formulation according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient. The pharmaceutical composition may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories or sterile injection solutions according to conventional methods.

When formulating the pharmaceutical composition, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, or surfactants, but may not be limited thereto.

When the pharmaceutical composition is prepared as an oral dosage form, powders, granules, tablets, pills, dragees, capsules, liquids, gels, syrups, suspensions, wafers, etc. It can be made into a formulation. Examples of suitable pharmaceutically acceptable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol, starches such as corn starch, potato starch, and wheat starch, cellulose, methylcellulose, ethylcellulose, Celluloses such as sodium carboxymethylcellulose and hydroxypropylmethylcellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, mineral oil, malt, gelatin, talc, polyol, vegetable oil etc. are mentioned. In the case of formulation, if necessary, diluents and/or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants may be included.

When the pharmaceutical composition is prepared as a parenteral formulation, it may be formulated in the form of injection, transdermal administration, nasal inhalation, and suppository along with a suitable carrier according to a method known in the art. In the case of formulation as an injection, suitable carriers include sterile water, ethanol, polyols such as glycerol or propylene glycol, or mixtures thereof, preferably Ringer's solution, PBS (phosphate buffered saline) containing triethanolamine or sterilization for injection water, isotonic solutions such as 5% dextrose, and the like can be used. When formulated as a transdermal formulation, it may be formulated in the form of ointments, creams, lotions, gels, external solutions, pastas, liniments, air rolls, and the like. In the case of nasal inhalation, it can be formulated in the form of an aerosol spray using a suitable propellant such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, etc., and when formulated into suppositories, the base is Witepsol ( witepsol), tween 61, polyethylene glycols, cacao fat, laurin fat, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearates, sorbitan fatty acid esters, and the like may be used.

The pharmaceutical composition may be administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat or prevent a disease with a reasonable benefit/risk ratio applicable to medical treatment or prevention, and the effective dose level is dependent on the severity of the disease, the activity of the drug, and the patient's Age, weight, health, sex, sensitivity to the drug of the patient, administration time of the composition of the present invention used, route of administration and excretion rate, treatment period, factors including drugs used in combination or simultaneous use with the composition of the present invention used, and others It can be determined according to factors well known in the medical field. The pharmaceutical composition of the present invention may be administered alone or in combination with components known to exhibit therapeutic effects on known bone-related diseases. It is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors.

The dose of the pharmaceutical composition can be determined by those skilled in the art in consideration of the purpose of use, the degree of addiction of the disease, the patient's age, weight, sex, history, or the type of substance used as an active ingredient. For example, the pharmaceutical composition of the present invention can be administered at about 0.1 ng to about 1,000 mg/kg, preferably 1 ng to about 100 mg/kg per adult, and the frequency of administration of the composition herein is particularly Although not limited, it may be administered once a day or administered several times by dividing the dose. The dosage or frequency of administration is not intended to limit the scope of the present application in any way.

Another aspect is to provide a method for treating or preventing a bone-related disease comprising administering the pharmaceutical composition for treating or preventing a bone-related disease to a subject. The same parts as described above are also applied to the method.

As used herein, the term "subject" may include, without limitation, mammals, birds, reptiles, farmed fish, etc., including dogs, cats, mice, livestock, humans, etc. that have or are at risk of developing bone-related diseases. And, the subject may be excluding humans.

The pharmaceutical composition may be administered singly or in multiple doses in a pharmaceutically effective amount. At this time, the composition may be formulated and administered in the form of a liquid, powder, aerosol, injection, infusion (intravenous gel), capsule, pill, tablet, suppository or patch. The administration route of the pharmaceutical composition for preventing or treating bone-related diseases may be administered through any general route as long as it can reach the target tissue.

The pharmaceutical composition is not particularly limited thereto, but as desired, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, transdermal patch administration, oral administration, intranasal administration, intrapulmonary administration, intrarectal administration, etc. It can be administered through the route of However, oral administration can be administered in an unformulated form, and since the active ingredients of the pharmaceutical composition can be denatured or decomposed by gastric acid, the oral composition is formulated to coat the active agent or protect it from degradation in the stomach. It can also be administered orally in the form of a localized form or an oral patch. In addition, the composition may be administered by any device capable of transporting active substances to target cells.

Another aspect is to provide a food composition for preventing or improving bone-related diseases, comprising a yogeunpi extract or a fraction thereof as an active ingredient. The same parts as described above also apply to the composition.

As used herein, the term "improvement" refers to all activities that improve or beneficially change symptoms of bone-related diseases by administration of the composition of the present invention.

The term "food" in this specification refers to meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, and alcoholic beverages. , vitamin complexes, health functional foods and health foods, etc., and include all foods in the conventional sense.

The food can be prepared by a method commonly used in the art, and can be prepared by adding raw materials and ingredients commonly added in the art during the manufacture. In addition, the formulation of the food may also be prepared without limitation as long as the formulation is recognized as a food. The food composition can be prepared in various types of dosage forms, and, unlike general drugs, has the advantage of using food as a raw material and has no side effects that may occur when taking drugs for a long time and has excellent portability, so the food composition of the present invention It can be taken as an adjuvant to enhance the effect of improving bone-related diseases.

The food composition may be a health functional food composition.

In this specification, the term "health functional food" refers to food manufactured and processed using raw materials or ingredients having useful functionalities for the human body in accordance with the Health Functional Food Act No. 6727, and 'functional' refers to the human body. It means to obtain useful effects for health purposes such as regulating nutrients for the structure and function of food or physiological functions.

The health food (health food) means food that has an active health maintenance or promotion effect compared to general food, and health supplement food (health supplement food) means food for the purpose of health supplement. In some cases, the terms health functional food, health food, and dietary supplement may be used interchangeably. Specifically, the health functional food is a food prepared by adding the composition to food materials such as beverages, teas, spices, gum, confectionery, etc., or encapsulated, powdered, suspended, etc., and when ingested, it has a specific effect on health It means coming, but unlike general drugs, it has the advantage of not having side effects that can occur when taking drugs for a long time by using food as a raw material.

Since the food composition can be consumed on a daily basis, a high effect on the improvement of bone-related diseases can be expected, so it can be used very usefully.

The food composition may further include a physiologically acceptable carrier. The type of carrier is not particularly limited, and any carrier commonly used in the art may be used. Specifically, the food composition may include additional ingredients that are commonly used in food compositions and can improve smell, taste, and vision. For example, vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, panthotenic acid, and the like may be included. In addition, minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu), and chrome (Cr) may be included. In addition, amino acids such as lysine, tryptophan, cysteine, and valine may be included.

In addition, the food composition may include preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), bactericides (bleaching powder and high bleaching powder, sodium hypochlorite, etc.), antioxidants (butylhydroxyanisole (BHA), butyl hydroxy Loxytoluene (BHT), etc.), coloring agent (tar colorant, etc.), coloring agent (sodium nitrite, sodium nitrite, etc.), bleach (sodium sulfite), seasoning (MSG sodium glutamate, etc.), sweetener (dulcin, cyclemate, saccharin) , sodium, etc.), flavoring (vanillin, lactones, etc.), expanding agent (alum, D-potassium hydrogen tartrate, etc.), strengthening agent, emulsifier, thickener (thickener), coating agent, gum base agent, foam inhibitor, solvent, improver, etc. food May contain food additives. The additive may be selected according to the type of food and used in an appropriate amount.

The food composition may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to conventional methods. The mixing amount of the active ingredient may be appropriately determined depending on the purpose of use (prevention, health or therapeutic treatment). In general, the food composition of the present invention may be added in an amount of 50 parts by weight or less, specifically 20 parts by weight or less, based on the food or beverage when preparing food or beverage. However, when ingested for a long period of time for health and hygiene purposes, the amount below the above range may be included, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

An example of the food composition may be used as a health beverage composition, and in this case, as in conventional beverages, various flavoring agents or natural carbohydrates may be included as additional ingredients. The aforementioned natural carbohydrates include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrins and cyclodextrins; It may be a sugar alcohol such as xylitol, sorbitol, or erythritol. Sweeteners include natural sweeteners such as thaumatin and stevia extract; Synthetic sweeteners such as saccharin and aspartame may be used. The ratio of the natural carbohydrates may be generally about 0.01 to 0.04 g, specifically about 0.02 to 0.03 g per 100 mL of the health drink composition of the present invention.

In addition to the above, the health beverage composition includes various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, It may contain alcohol or a carbonating agent, and the like. In addition, it may contain fruit flesh for the manufacture of natural fruit juice, fruit juice beverages, or vegetable beverages. These components may be used independently or in combination. The ratio of these additives is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health beverage composition of the present invention.

The food composition may contain the extract of the present invention in various weight% if it can exhibit an improvement or preventive effect on bone-related diseases. It may include by weight %, but is not limited thereto.

Another aspect is to provide a feed composition for the prevention or improvement of bone-related diseases, containing the extract or a fraction thereof as an active ingredient. The same parts as described above also apply to the composition.

The term "feed" in this specification may mean any natural or artificial diet, meal, etc., or a component of said meal, for or suitable for eating, ingesting, and digesting by an animal.

The type of feed is not particularly limited, and feeds commonly used in the art may be used. Non-limiting examples of the feed include vegetable feeds such as grains, root fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal or grain by-products; Animal feed such as proteins, inorganic materials, oils, mineral oils, oils, single cell proteins, zooplankton, or food may be mentioned. These may be used alone or in combination of two or more.

The feed composition may further include known additives that can be added to improve or prevent bone-related diseases depending on the formulation. The feed composition may be in the form of a highly concentrated solution, powder or granules. The feed composition may further include any protein-containing organic flour commonly used to meet the dietary needs of animals. The feed composition may be added to animal feed by dipping, spraying, or mixing.

The feed composition may further include substances exhibiting various effects such as supplementation of nutrients and prevention of weight loss, enhancement of digestibility of fiber in feed, improvement of oil quality, prevention of reproductive disorders and improvement of conception rate, and prevention of high temperature stress in summer. For example, mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals, trace mineral preparations such as zinc, copper, cobalt, and selenium, kerotene, vitamin E, vitamins A, D, E, and nicotinic acid. , Vitamins such as vitamin B complex, protected amino acids such as methionine and lysic acid, protected fatty acids such as fatty acid calcium salts, probiotics (lactic acid bacteria), yeast cultures, live bacteria such as mold fermented products, yeasts, etc. can be included

The feed composition can be applied to a number of animal diets including mammals and poultry, that is, feed and drinking water.

The feed composition may include all substances added to feed (ie, feed additives), feed raw materials, or feed itself fed to the individual.

Another aspect is to provide a pharmaceutical composition for preventing or treating bone-related diseases comprising a compound represented by Formula 10, a derivative thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof will be:

[Formula 10]

R ₁ to R ₃ are each independently H or OH;

R ₄ is H or ego,

R ₅ is OH; or ego,

X is above is H when it is a single bond, is O when is a double bond,

A-B is a hydrocarbon with a single bond (CH-CH) or a double bond (C=C).

The same parts as described above also apply to the composition.

The compound of Formula 10 may include one or more compounds selected from the group consisting of compounds represented by Formulas 1 to 9.

The compound, a derivative thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof may be derived from an extract or a fraction thereof.

The composition may include a compound of Formula 10, specifically, may include one or more compounds selected from the group consisting of compounds represented by Formulas 1, 3, 7, 8, and 9, and more specifically, Compound 8 And it may include one or more compounds selected from the group consisting of compounds represented by 9.

According to one embodiment, it was confirmed that compounds 1 to 9 derived from the extract of Eugenia radiata had excellent osteoclast differentiation inhibitory efficacy, and in particular, compounds 2, 3, 7, 8 and 9 exhibited more excellent efficacy. Therefore, a composition containing the compounds as active ingredients can be used as a therapeutic agent for bone-related diseases.

The compound of Formula 10 may have an effect of inhibiting osteoclast differentiation or osteoclast expression/activity, and may inhibit the expression level of markers related to osteoclast differentiation or expression. Specifically, it may be to suppress the expression level of one or more selected from the group consisting of NFATc1, OSCAR, DC-STAMP and CTSK.

The compound of Formula 10 may have anti-inflammatory activity.

Another aspect is to provide a food composition for preventing or improving bone-related diseases, including a compound represented by Formula 10, a derivative thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof. . The same parts as described above also apply to the composition.

Another aspect is to provide a feed composition for preventing or improving bone-related diseases, including a compound represented by Formula 10, a derivative thereof, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof. . The same parts as described above also apply to the composition.

According to one aspect, it has been confirmed that the yugeunpi extract of the present invention or an effective substance isolated therefrom has an excellent ability to inhibit osteoclast differentiation, and thus can be used for the treatment or prevention of bone-related diseases.

1 is a view showing a process for preparing yugeunpi extract and active substances separated therefrom.
2 is a diagram showing the separation/identification results of Compound 1.
3 is a diagram showing the separation/identification results of Compound 2.
4 is a diagram showing the separation/identification results of compound 3.
5 is a diagram showing the separation/identification results of compound 4.
6 is a diagram showing the separation/identification results of compound 5.
7 is a diagram showing the separation/identification results of compound 6.
8 is a diagram showing the separation/identification results of compound 7.
9 is a diagram showing the separation/identification results of compound 8.
10 is a diagram showing the separation/identification results of compound 9.
11 is a view showing the results of analysis of the osteoclast differentiation inhibitory activity of Yugeunpi extract.
Figure 12 is a view showing the results of analysis of the osteoclast differentiation inhibitory ability of a single compound isolated from Yugeunpi extract.
13 is a diagram showing the expression level of osteoclast differentiation markers according to Compound 8 treatment (Control: DMSO, *P <0.05; **P <0.01; ***P < 0.001).
14 is a view showing the cytotoxicity evaluation results of Yugeunpi extract.
Figure 15 is a view showing the results of the cytotoxicity evaluation of a single compound isolated from Yugeunpi extract.
Figure 16 is a view showing the NO assay results of a single compound isolated from the yugeunpi extract.

It will be described in more detail through the following examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1: Preparation of Yugeunpi extract

In the present invention, in order to obtain the eugenpi extract and fractions thereof, the following experiments were performed.

First, 10 kg of the bark of the king elm (Ulmus macrocarpa) was extracted in distilled water for 1 day, dried under reduced pressure, and then fractionated into H ₂ O (water) and DCM (dichloromethane) layers. Next, the H ₂ O layer was again fractionated into an H ₂ O layer and an ethyl acetate (EA) layer. Thereafter, the fractionated water layer was re-fractionated by adding BuOH, and the BuOH layer was subjected to size exclusion chromatography in shepadex LH-20 with MeOH as a solvent to obtain fractions 1-46. Among the resulting fractions, fractions 7-8 and 9-12 were collected again, further fractionated using C-18 culomn chromatography, and then separated to single substance units using HPLC. Among the separated compounds, a list of compounds present in an amount sufficient to be selected as an active ingredient and an indicator ingredient was selected, and a total of 9 materials were identified and structured (FIG. 1).

Example 2: Isolation and identification of compounds

2-1: (2S)-naringenin-6-C-β-D-glucopyranoside (Compound 1)

Among the fractions 1-46 of the Eugenippi extract prepared by the method of Example 1, fractions 7-8 were subjected to a concentration gradient of MeOH and H ₂ O through silica column chromatography, starting with MeOH 100% and then 5% The concentration of was separated by proceeding by 1L. Fractions obtained from column chromatography using MeOH 30% solvent were analyzed by HPLC equipped with a Phenomenex Luna C18 column (5 μm, 100 Α, 250 × 100 mm, UV = 280 nm, 2.0 mL/min, solvent: 40% MeOH) was separated into a single compound (17.2 min peak). Subsequently, a molecular weight of 434 MW was confirmed through MS, and a single substance of compound 1 was identified through CD, H-NMR, C-NMR, and MS. As a result of the identification, (2S)-naringenin-6-C-β-D-glucopyranoside was confirmed as shown in FIG. 2 . Compound 1 is represented by Formula 1 herein.

(2S)-naringenin-6-C-β-D-glucopyranoside (1): white amorphous powder; [α] 20 D +18.6 (c 0.20, MeOH); UV (MeOH) λmax (log ε) 220, 291, 330; ECD (1.2 × 10-3 M, MeOH) λmax (Δε) 289 nm (−6.09), 217 nm (+6.92); 1H NMR (methanol-d4, 700 MHz) δ 7.30 (d, J = 8.5 Hz, H-2'/6'), 6.81 (d, J = 8.5 Hz, H-3'/5'), 5.94 (s , H-8), 5.34 (dd, J = 12.6, 2.9 Hz, H-2), 4.79 (d, J = 9.9 Hz, H-1″), 4.14 (t, J = 9.9 Hz, H-2) ''), 3.85 (dd, J = 12.1, 2.2 Hz, H-6''a), 3.71 (dd, J = 12.1, 5.5 Hz, H-6''b), 3.44 (m, H-4''), 3.43 (m, H-3''), 3.37 (m, H-5''), 3.11 (dd, J = 17.1, 12.6 Hz, H-3a), 2.73 (dd, J = 17.1, 3.1 Hz, H-3a); 13C NMR (methanol-d4, 175 MHz) δ 197.7 (C-4), 168.6 (C-7), 164.4 (C-5), 164.2 (C-9), 159.0 (C-4'), 131.0 (C -1'), 129.0 (C-2'/6'), 116.3 (C-3'/5'), 106.1 (C-6), 103.0 (C-10), 96.7 (C-8), 82.5 ( C-5''), 80.4 (C-2), 80.3 (C-3''), 75.3 (C-1''), 72.6 (C-2''), 71.8 (C-4''), 62.9 (C-6″), 43.9 (C-3); ESIMS m/z 435 [M+H]+, 433 [M-H]-; HRESIMS m/z 435.1295 [M + H]+ (calcd for C ₂₁ H ₂₃ O ₁₀ , 435.1291).

2-2: (2R)-naringenin-6-C-β-D-glucopyranoside (Compound 2)

Among the fractions 1-46 of the Eugenippi extract prepared by the method of Example 1, fractions 7-8 were subjected to a concentration gradient of MeOH and H2O through silica column chromatography, starting at 100% MeOH and then at a concentration of 5% The reduction proceeded by 1 L and separated. Fractions obtained from column chromatography using MeOH 30% solvent were analyzed as a single compound (17.8min. peak) was separated. Subsequently, a molecular weight of 434 M.W was confirmed through MS, and a single substance of compound 2 was identified through CD, H-NMR, C-NMR, and MS. As a result of the identification, (2R)-naringenin-6-C-β-D-glucopyranoside was confirmed as shown in FIG. 3 . Compound 2 is represented by Formula 2 herein.

(2R)-naringenin-6-C-β-D-glucopyranoside (2): white amorphous powder; [α] 20 D +13.8 (c 0.50, MeOH); UV (MeOH) λmax (log ε) 220, 291, 330; ECD (0.9 × 10-3 M, MeOH) λmax (Δε) 290 nm (+5.48), 216 nm (-6.91); 1H NMR (methanol-d4, 700 MHz) δ 7.30 (d, J = 8.6 Hz, H-2'/6'), 6.81 (d, J = 8.6 Hz, H-3'/5'), 5.89 (s , H-8), 5.33 (dd, J = 12.6, 3.0 Hz, H-2), 4.78 (d, J = 9.9 Hz, H-1″), 4.19 (t, J = 9.9 Hz, H-2) ''), 3.84 (dd, J = 12.1, 2.0 Hz, H-6''a), 3.71 (dd, J = 12.1, 5.7 Hz, H-6''b), 3.46 (m, H-4''), 3.43 (m, H-3''), 3.37 (m, H-5''), 3.08 (dd, J = 17.1, 12.6 Hz, H-3a), 2.71 (dd, J = 17.1, 3.1 Hz, H-3a); 13C NMR (methanol-d4, 175 MHz) δ 196.8 (C-4), 170.9 (C-7), 164.5 (C-5), 164.1 (C-9), 159.0 (C-4'), 131.2 (C -1'), 129.0 (C-2'/6'), 116.3 (C-3'/5'), 106.4 (C-6), 102.3 (C-10), 97.5 (C-8), 82.4 ( C-5''), 80.4 (C-3''), 80.1 (C-2), 75.4 (C-1''), 72.3 (C-2''), 71.8 (C-4''), 62.9 (C-6″), 43.8 (C-3); ESIMS m/z 435 [M + H]+, 433 [M - H] -; HRESIMS m/z 435.1288 [M + H]+ (calcd for C ₂₀ H ₂₃ O ₁₀ , 423.1291).

2-3: (2R,3S)-catechin-7-O-β-D-xylopyranoside (Compound 3)

Among the fractions 1-46 of the Eugenippi extract prepared by the method of Example 1, fractions 7-8 were subjected to a concentration gradient of MeOH and H ₂ O through silica column chromatography, starting with MeOH 100% and then 5% The concentration of was separated by proceeding by 1L. Fractions obtained from column chromatography using MeOH 15% solvent were analyzed as a single compound (12min peak) using HPLC (5 μm, 100 Α, 250 × 100 mm, UV = 280 nm, 2.0 mL/min, solvent: 20% MeOH) ) was separated. Subsequently, a molecular weight of 422 MW was confirmed through LC/MS, and a single substance of compound 3 was identified through CD, H-NMR, C-NMR, and MS. As a result of the identification, catechin-7-ObD-xylopyranoside was confirmed as shown in FIG. 4 . The compound 3 is represented by Formula 3 herein.

(2R,3S)-catechin-7-ObD-xylopyranoside (3): white amorphous powder; [α]20D-15.6 (c 0.50, MeOH); UV (MeOH) λmax (log ε) 203, 279; ECD (2.6 × 10-3 M, MeOH) λmax (Δε) 276 nm (-1.33), 215 nm (-5.06); 1H NMR (methanol-d4, 700 MHz) δ 6.83 (d, J = 1.8 Hz, H-2'), 6.76 (d, J = 8.1 Hz, H-5'), 6.72 (dd, J = 8.1, 1.8 Hz, H-6'), 6.17 (d, J = 2.2 Hz, H-6), 6.11 (d, J = 2.2 Hz, H-8), 4.76 (d, J = 7.1 Hz, H-1'' ), 4.60 (d, J = 7.4 Hz, H-2), 4.00 (m, H-3), 3.90 (dd, J = 11.5, 5.4 Hz, H-5′a), 3.54 (m, H-3). 4''), 3.39 (m, H-3''), 3.38 (m, H-2''), 3.32 (overlapped with solvent peaks, H-5''b), 2.86 (dd, J = 16.3, 5.4 Hz, H-3a), 2.54 (dd, J = 16.3, 8.0 Hz, H-3b); 13C NMR (methanol-d4, 175 MHz) δ 158.5 (C-7), 157.6 (C-5), 156.8 (C-9), 146.29 (C-4'), 146.26 (C-3'), 132.1 ( C-1'), 120.0 (C-6'), 116.1 (C-5'), 115.2 (C-2'), 103.7 (C-10), 102.9 (C-1''), 97.4 (C-1'') 6), 97.0 (C-8), 82.9 (C-2), 77.8 (C-3''), 74.7 (C-2''), 71.0 (C-4''), 68.6 (C-3) , 66.9 (C-5″), 28.5 (C-4); ESIMS m/z 423 [M+H]+, 421 [M-H]-; HRESIMS m/z 423.1289 [M + H]+ (calcd for C ₂₁ H ₂₃ O ₁₀ , 423.1291).

2-4: (2R, 3R)-Aromadrin-6-C-β-D-glucopyranoside (Compound 4)

Of the fractions 1-46 of the Eugenippi extract prepared by the method of Example 1, fraction 6 was analyzed by HPLC (5 μm, 100 Α, 250 × 100 mm, UV = 280 nm, 2.0 mL/min, solvent: 35% MeOH) was used to separate them into a single compound (12.5 min peak). Subsequently, a molecular weight of 450 M.W was confirmed through LC/MS, and a single substance of compound 4 was identified through CD, H-NMR, C-NMR, and MS. As a result of the identification, (2R, 3R) -Aromadendrin-6-C-β-D-glucopyranoside was confirmed as shown in FIG. 5 . The compound 4 is represented by Formula 4 herein.

(2R,3R)-aromadendrin-6-C-β-D-glucopyranoside (4): white amorphous powder; [α] 20 D +34.1 (c 0.50, MeOH); UV (MeOH) λmax (log ε) 197, 226, 294, 330; ECD (1.2 × 10-3 M, MeOH) λmax (Δε) 293 nm (-7.45), 256 nm (+1.25),, 235 nm (+2.85), 217 nm (+9.62); 1H NMR (methanol-d4, 700 MHz) δ 7.34 (d, J = 8.5 Hz, H-2'/6'), 6.83 (d, J = 8.5 Hz, H-3'/5'), 5.92 (s , H-8), 4.97 (d, J = 11.4 Hz, H-2), 4.79 (d, J = 9.9 Hz, H-1″), 4.53 (d, J = 11.4 Hz, H-3), 4.14 (t, J = 9.1 Hz, H-2''), 3.85 (dd, J = 12.1, 2.2 Hz, H-6''a), 3.71 (dd, J = 12.1, 5.5 Hz, H-6''a) 'b), 3.45 (m, H-4''), 3.44 (m, H-3''), 3.37 (m, H-5''); 13C NMR (methanol-d4, 175 MHz) δ 198.3 (C-4), 169.3 (C-7), 164.2 (C-5), 163.8 (C-9), 159.0 (C-4'), 130.3 (C -1'), 129.3 (C-2'/6'), 116.2 (C-3'/5'), 106.5 (C-6), 101.3 (C-10), 96.9 (C-8), 84.9 ( C-2), 82.5 (C-5''), 80.3 (C-3''), 75.2 (C-1''), 73.6 (C-3), 72.5 (C-2''), 71.8 ( C-4″), 62.9 (C-6″); ESIMS m/z 451 [M+H]+, 449 [M-H]-; HRESIMS m/z 451.1235 [M + H]+ (calcd for C ₂₁ H ₂₃ O ₁₁ , 451.1240).

2-5: Kaempferol 6-C-glucoside (Kaempferol 6-C β-D-glucopyranoside) (Compound 5)

Among the fractions 1-46 of the Eugenippi extract prepared by the method of Example 1, fractions 9-12 were subjected to a concentration gradient of MeOH and H ₂ O through silica column chromatography, starting with MeOH 100% and then 5% The concentration of was separated by proceeding by 1L. Fractions obtained from column chromatography using MeOH 40% solvent were analyzed as a single compound (26min peak) using HPLC (5 μm, 100 Α, 250 × 100 mm, UV = 280 nm, 2.0 mL/min, solvent: 25% MeOH) ) was separated. Subsequently, a molecular weight of 448 MW was confirmed through MS, and a single substance of compound 5 was identified through C-NMR. As a result of the identification, Kaempferol 6-C-glucoside was confirmed as shown in FIG. 6 . The compound 5 is represented by Formula 5 herein.

Kaempferol 6-C β-D-glucopyranoside (5): white amorphous powder; UV (MeOH) λmax (log ε) 198, 269, 368; 1H NMR (methanol-d4, 700 MHz) δ 8.08 (d, J = 8.5 Hz, H-2'/6'), 6.90 (d, J = 8.5 Hz, H-3'/5'), 6.45 (s , H-8), 4.91 (d, J = 9.9 Hz, H-1″), 4.19 (t, J = 9.9 Hz, H-2″), 3.88 (dd, J = 12.2, 2.2 Hz, H -6''a), 3.74 (dd, J = 12.2, 5.4 Hz, H-6''b), 3.48 (m, H-4''), 3.48 (m, H-3''), 3.42 ( m, H-5″); 13C NMR (methanol-d4, 175 MHz) δ 177.5 (C-4), 164.9 (C-7), 161.3 (C-5), 160.6 (C-4'), 157.6 (C-9), 148.0 (C -2), 137.2 (C-3), 130.2 (C-2'/6'), 123.6 (C-1'), 116.0 (C-3'/5'), 108.4 (C-6), 104.4 ( C-10), 95.3 (C-8), 83.0 (C-5''), 80.6 (C-3''), 75.7 (C-1''), 72.9 (C-2''), 72.2 ( C-4″), 62.9 (C-6″); ESIMS m/z 435 [M + H]+, 433 [M - H] -; HRESIMS m/z 435.1288 [M + H]+ (calcd for C ₂₀ H ₂₃ O ₁₀ , 423.1291)

2.6: (2R,3S)-catechin-7-O-β-D-apiofuranoside (Compound 6)

Among the fractions 1-46 of the Eugenippi extract prepared by the method of Example 1, fractions 9-12 were subjected to a concentration gradient of MeOH and H2O through silica column chromatography, starting at 100% MeOH and then at a concentration of 5% The reduction proceeded by 1 L and separated. Fractions obtained from column chromatography using MeOH 25% solvent were analyzed as a single compound (30min peak ) was separated. Subsequently, a molecular weight of 422 M.W was confirmed through LC/MS, and a single substance of compound 6 was identified through CD, H-NMR, C-NMR, and MS. As a result of the identification, catechin-7-O-b-D-apiofuranoside was confirmed as shown in FIG. 7 . The compound 6 is represented by Formula 6 herein.

(2R,3S)-catechin-7-ObD-apiofuranoside (6): white amorphous powder; [α]20D-90.7 (c 0.50, MeOH); UV (MeOH) λmax (log ε) 203, 280; ECD (1.9 × 10-3 M, MeOH) λmax (Δε) 276 nm (-1.16), 212 nm (-5.95); 1H NMR (methanol-d4, 700 MHz) δ 6.83 (d, J = 1.9 Hz, H-2'), 6.76 (d, J = 8.1 Hz, H-5'), 6.71 (dd, J = 8.1, 1.9 Hz, H-6'), 6.13 (d, J = 2.3 Hz, H-6), 6.07 (d, J = 2.3 Hz, H-8), 5.48 (d, J = 2.9 Hz, H-1'' ), 4.60 (d, J = 7.4 Hz, H-2), 4.13 (d, J = 2.9 Hz, H-2''), 4.08 (d, J = 9.7 Hz, H-4''a), 3.99 (m, H-3), 3.84 (d, J = 9.7 Hz, H-4''b), 3.62 (d, J = 11.4 Hz, H-5''a), 3.59 (d, J = 11.4 Hz , H-5′b), 2.85 (dd, J = 16.3, 5.5 Hz, H-3a), 2.54 (dd, J = 16.3, 8.0 Hz, H-3b); 13C NMR (methanol-d4, 175 MHz) δ 158.2 (C-7), 157.6 (C-5), 156.9 (C-9), 146.27 (C-4'), 146.25 (C-3'), 132.1 ( C-1'), 120.0 (C-6'), 116.1 (C-5'), 115.2 (C-2'), 108.7 (C-1''), 103.2 (C-10), 97.3 (C-10) 6), 96.9 (C-8), 82.9 (C-2), 80.3 (C-3''), 78.3 (C-2''), 75.4 (C-4''), 68.6 (C-3) , 64.9 (C-5″), 28.4 (C-4); ESIMS m/z 423 [M+H]+, 421 [M-H]-; HRESIMS m/z 423.1285 [M + H]+ (calcd for C ₂₁ H ₂₃ O ₁₀ , 423.1291).

2.7: (2R,3R)-Taxifolin-6-C-β-D-glucopyranoside (Compound 7)

Among the fractions 1-46 of the Eugenippi extract prepared by the method of Example 1, fractions 7-8 were subjected to a concentration gradient of MeOH and H2O through silica column chromatography, starting at 100% MeOH and then at a concentration of 5% The reduction proceeded by 1 L and separated. Fractions obtained from column chromatography using MeOH 15% solvent were subjected to HPLC (5 μm, 100 Α, 250 × 100 mm, UV = 280 nm, 2.0 mL/min, solvent: 20% MeOH) using a single compound (10.5 min. peak) was separated. Subsequently, a molecular weight of 466 M.W was confirmed through LC/MS, and a single substance of compound 7 was identified through CD, H-NMR, C-NMR, and MS. As a result of the identification, (2R,3R)-Taxifolin-6-C-β-D-glucopyranoside was confirmed as shown in FIG. 8. The compound 7 is represented by Formula 7 herein.

(2R,3R)-taxifolin-6-C-β-D-glucopyranoside (7): white amorphous powder; [α] 20 D +17.3 (c 0.50, MeOH); UV (MeOH) λmax (log ε) 200, 221, 290, 332; ECD (2.8 × 10-3 M, MeOH) λmax (Δε) 333 nm (+2.20), 297 nm (-6.98), 218 nm (+7.99); 1H NMR (methanol-d4, 700 MHz) δ 6.95 (d, J = 1.9 Hz, H-2'), 6.84 (d, J = 8.1 Hz, H-5'), 6.80 (dd, J = 8.1, 1.9 Hz, H-6'), 5.93 (s, H-8), 4.92 (d, J = 11.3 Hz, H-2), 4.80 (d, J = 9.9 Hz, H-1''), 4.50 (d , J = 11.3 Hz, H-3), 4.14 (t, J = 8.8 Hz, H-2″), 3.86 (dd, J = 12.1, 2.2 Hz, H-6″a), 3.71 (dd, J = 12.1, 5.5 Hz, H-6''b), 3.44 (m, H-4''), 3.43 (m, H-3''), 3.38 (m, H-5''); 13C NMR (methanol-d4, 175 MHz) δ 198.4 (C-4), 168.6 (C-7), 164.2 (C-5), 163.8 (C-9), 147.2 (C-4'), 146.3 (C -3'), 129.8 (C-1'), 120.4 (C-6'), 116.1 (C-5'), 115.8 (C-2'), 106.4 (C-6), 101.5 (C-10) , 96.7 (C-8), 85.1 (C-2), 82.5 (C-5''), 80.2 (C-3''), 75.2 (C-1''), 73.6 (C-3), 72.6 (C-2''), 71.8 (C-4''), 62.9 (C-6''); ESIMS m/z 467 [M+H]+, 465 [M-H]-; HRESIMS m/z 467.1182 [M + H]+ (calcd for C ₂₁ H ₂₃ O ₁₂ , 467.1190).

2.8: Ulmoside A [(2S,3S)-taxifolin-6-C-β-D-glucopyranoside] (Compound 8)

Among the fractions 1-46 of the Eugenippi extract prepared by the method of Example 1, fractions 7-8 were subjected to a concentration gradient of MeOH and H2O through silica column chromatography, starting at 100% MeOH and then at a concentration of 5% The reduction proceeded by 1 L and separated. Fractions from column chromatography using MeOH 15% solvent were analyzed as a single compound (11min peak) using HPLC (5 μm, 100 Α, 250 × 100 mm, UV = 280 nm, 2.0 mL/min, solvent: 20% MeOH) ) was separated. Subsequently, a molecular weight of 466 M.W was confirmed through LC/MS, and a single substance of compound 8 was identified through CD, H-NMR, C-NMR, and MS. As a result of the identification, Ulmoside A ((2S,3S)-taxifolin-6-C-β-D-glucopyranoside) was confirmed as shown in FIG. 9 . The compound 8 is represented by Formula 8 herein.

(2S,3S)-taxifolin-6-C-β-D-glucopyranoside (8): white amorphous powder; [α]20D-7.3 (c 0.50, MeOH); UV (MeOH) λmax (log ε) 200, 221, 290, 332; ECD (2.1 × 10-3 M, MeOH) λmax (Δε) 331 nm (-0.67), 297 nm (+4.65), 227 nm (-6.82), 206 nm (-6.23); 1H NMR (methanol-d4, 700 MHz) δ 6.95 (d, J = 1.9 Hz, H-2'), 6.84 (d, J = 8.1 Hz, H-5'), 6.80 (dd, J = 8.1, 1.9 Hz, H-6'), 5.95 (s, H-8), 4.93 (d, J = 11.3 Hz, H-2), 4.80 (d, J = 9.9 Hz, H-1''), 4.50 (d , J = 11.3 Hz, H-3), 4.13 (t, J = 8.8 Hz, H-2″), 3.86 (dd, J = 12.1, 2.2 Hz, H-6″a), 3.71 (dd, J = 12.1, 5.5 Hz, H-6''b), 3.44 (m, H-4''), 3.43 (m, H-3''), 3.38 (m, H-5''); 13C NMR (methanol-d4, 175 MHz) δ 198.7 (C-4), 167.9 (C-7), 164.1 (C-5), 163.8 (C-9), 147.2 (C-4'), 146.3 (C -3'), 129.7 (C-1'), 120.8 (C-6'), 116.1 (C-5'), 115.9 (C-2'), 106.3 (C-6), 101.7 (C-10) , 96.5 (C-8), 85.0 (C-2), 82.5 (C-5''), 80.2 (C-3''), 75.2 (C-1''), 73.6 (C-3), 72.5 (C-2''), 71.8 (C-4''), 62.9 (C-6''); ESIMS m/z 467 [M+H]+, 465 [M-H]-; HRESIMS m/z 467.1196 [M + H]+ (calcd for C ₂₁ H ₂₃ O ₁₂ , 467.1190).

2.9: (2R,3R)-Epicatechin-7-O-β-D-apiofuranoside (Compound 9)

Of the fractions 1-46 of the Eugenippi extract prepared by the method of Example 1, fractions 13-46 were HPLC (5 μm, 100 Α, 250 × 100 mm, UV = 280 nm, 2.0 mL/min, It was separated as a single compound (11 min peak) using solvent: 35% MeOH). Subsequently, a molecular weight of 422 M.W was confirmed through LC/MS, and a single substance of compound 9 was identified through CD, H-NMR, C-NMR, and MS. As a result of the identification, (2R, 3R) -epicatechin-7-O-beta-D-apiofuranoside was confirmed as shown in FIG. 10 . The compound 9 is represented by Formula 9 herein.

(2R,3R)-epicatechin-7-O-beta-D-apiofuranoside (9): white amorphous powder; [α]20D-19.6 (c 0.52, MeOH); UV (MeOH) λmax (log ε) 203, 278; 1H NMR (methanol-d4, 700 MHz) δ 6.98 (d,J = 1.7 Hz, H-2'), 6.80 (dd, J = 8.1, 1.7 Hz, H-6'), 6.76 (d,J = 8.1 Hz, H-5'), 6.14 (d, J = 3.8 Hz, 1H, H6), 6.14 (d, J = 3.8 Hz, 1H, H8), 4.82 (br s, H-2), 4.19 (m, H-3), 2.88 (dd, J = 16.8, 4.4 Hz, H-4a), 2.74 (dd, J = 16.8,2.6 Hz, H-4b), 2.88 (H-4a), 2.74 (H-4b) , 2.86 (H-4a), 2.54 (H-4b), 5.49 (d, J = 2.9 Hz, H-1"), 4.14 (d, J = 2.9 Hz, H-2"), 4.09 (m, H -4"a), 3.85 (d, J = 9.7 Hz, H4"b), 3.62 (m, H-5"), 5.49 (d, J = 2.9 Hz, H-1") ; 13C NMR (methanol-d4, 175 MHz) δ 108.72 (C-1"), 79.94 (C-3"), 78.27 (C-2"), 75.40 (C-4"), 64.96 (C-5") , 158.01 (C-7), 157.95 (C-9), 157.31 (C-5), 145.95 (C-4'), 145.83 (C3'),132.15 (C-1'), 119.36 (C-6') ), 115.90 (C-5'), 115.28 (C-2'), 102.51 (C-10), 97.40 (C-6), 97.17 (C-8), 80.29 (C-2), 67.29 (C- 3), 29.27 (C4): ESIMS m/z 423 [M+H]+, 421 [M-H]-.

Example 3: Confirmation of the osteoclast inhibitory ability of the yugeunpi extract

In order to confirm the osteoclast inhibitory efficacy of the yugeunpi extract, the following experiments were performed.

First, extracts of hot water, 70% EtOH, and 100% alcohol were prepared using 10 g of dry skin of Ulmus macrocarpa.

Next, in order to confirm the osteoclast inhibitory effect, osteoclast differentiation and TRAP staining techniques were used. Specifically, bone marrow cells (BMCs) were isolated from the femur and tibia of 5-week-old ICR mice. The isolated BMCs were cultured in a cell incubator at 7 °C and 5% CO ₂ for one day using α-MEM containing 10 ng/mL M-CSF (R&D Systems) and 10% fetal bovine serum (Invitrogen Life Technologies). . In order to remove floating cells after culture and induce BMC differentiation, 1Х10 ⁴ cells/well of cells were cultured with M-CSF (30ng/mL) and RANKL (10ng/mL, R&D Systems) for 3 days to obtain preosteocytes ( preosteoclasts). After stimulating the preosteocytes by treating them with M-CSF (30 ng/mL) for 30 minutes, they were treated with the above-prepared radishes root extract (hot water, 70% EtOH, 100% alcohol) or vehicle for 30 minutes. Then, they were cultured with RANKL (10 ng/mL) to differentiate into mature TRAP ⁺ -MNC (tartrate-resistant acid phosphatase-positive multinucleated cells). After 1 day, the cells were fixed with 3.7% formaldehyde for 5 minutes, permeabilized with 0.1% Triton X-100 for 5 minutes, and stained using leukocyte acid phosphatase kit 387-A to confirm the degree of differentiation.

As a result, it was confirmed that all of the hot water, 70% EtOH, and 100% alcohol extracts of Yugeunpi had excellent osteoclast differentiation inhibitory activity, and in particular, the hot water extract had excellent efficacy (FIG. 11).

Example 4: Confirmation of osteoclast inhibitory ability of a single compound isolated from Yugeunpi extract

4.1: Tartrate-Resistant Acid Phosphatase (TRAP) staining method

In order to confirm the osteoclast inhibitory efficacy of the compound isolated from the Eugene bark extract, the following experiment was performed.

Specifically, the single compound derived from the extract of Eugenia root isolated and identified in Example 2 was mixed with M-CSF (30 ng/mL) and RANKL (10 ng/mL; R&D Systems) at each concentration in the same manner as in Example 3 above. By treating the osteoclasts (mouse macrophage) induced by the, the ability to inhibit the differentiation of osteoclasts was measured.

As a result, it was confirmed that all of the single compounds exhibited an osteoclast differentiation inhibitory effect, and in particular, it was confirmed that compounds 2, 3, 7, 8, and 9 were excellent in efficacy (FIG. 12).

4.2: Analysis of osteoclast differentiation marker expression level

In order to confirm the osteoclast inhibitory efficacy of the compound isolated from the Eugene bark extract by molecular biological techniques, the following experiments were performed.

Specifically, compound 8 was selected as a representative example among the compounds showing excellent efficacy in Example 4.1, and inhibition of compound 8 on the transcription factor NFATc1 and osteoclast-specific factor/gene (OSCAR, DC-STAMP and CTSK) The effect was confirmed through real-time PCR analysis. NFATc1 is the master regulator of osteoclast formation, OSCAR (osteoclast-associated receptor) is an important osteoimmunological mediator, and DC-STAMP (dendritic cell-specific transmembrane protein) and CTSK (cathepsin K) are fused respectively And it is known to be involved in bone resorption activity.

First, ⁴ cells/well of 1Х10 were cultured in the presence of compound 8 together with M-CSF (30 ng/mL) and RANKL (10 ng/mL, R&D Systems) for 1, 2, or 3 days to induce BMC differentiation. cultured for a while to differentiate into osteoclasts. Total RNA was isolated from the differentiated cells using TRIzol reagent (Thermo Fisher Scientific Inc., Waltham, MA), and cDNA was synthesized using the M-MLV cDNA synthesis kit (Enzynomics, Daejeon, Korea). PCR was performed using TOPreal qPCR 2x PreMIX (Bio-Rad, Hercules, CA) on a real-time PCR detection system (Bio-Rad). mRNA levels of genes were determined using the 2 ^-ΔΔCT method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal standard, and information on the primers used above is shown in Table 1 below.

gene Primer Sequence (5'-3') sequence number NFATc1 (forward direction) GGGTCAGTGTGACCGAAGAT One (reverse) GGAAGTCAGAAGTGGGTGGA 2 CTSK (forward direction) GGCCAACTCAAGAAGAAAAC 3 (reverse) GTGCTTGCTTCCCCTTCTGG 4 OSCAR (forward direction) CTGCTGGTAACGGATCAGCTC 5 (reverse) CCAAGGAGCCAGAACCTT 6 DC-STAMP (forward direction) CCAAGGAGTCGTCCATGATT 7 (reverse) GGCTGCTTTGATCGTTTCTC 8 GAPDH (forward direction) AACTTTGGCATTGTGGAAGG 9 (reverse) ACACATTGGGGGTAGGAACA 10

As a result, it was confirmed that the mRNA expression level of NFATc1 was activated in the control group for 3 days of RANKL treatment, and the expression level of NFATc1 was decreased in the case of the Compound 8 treatment group. In addition, it was confirmed that the mRNA expression levels of OSCAR, DC-STAMP and CTSK were also significantly reduced in the Compound 8 treatment group (FIG. 13).

Based on the above results, it can be seen that in the case of the yogeunpi extract or a compound isolated therefrom, it inhibits osteoclast differentiation through down-regulation of NFATc1 expression.

Example 5: Evaluation of Cytotoxicity of Eugene Bark Extract and Single Compound Isolated Therefrom

In order to evaluate the cytotoxicity of the Yugeunpi extract and the single compound isolated therefrom, which were tested in Examples 3 and 4, 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide (MTT) assay was performed.

Specifically, the cell viability was measured by WST-8 [2-(2-methoxy-4-nitrophenyl)-3- (4-nitrophenyl)-5-( 2,4-disulfophenyl) -2H-tetrazolium, monosodium salt] was evaluated through formazan conversion. To this end, 100 μL of RAW 264.7 cells were dispensed into a 96-well plate at 5 Х10 ⁵ per 1 mL of DMEM medium, and cultured for 24 hours to allow the cells to adhere. Next, 180 μL of 1 μg/mL of LPS was added and various concentrations of Euphorbia extract or single compounds were treated. After incubation for 24 hours, MTT was added to a final concentration of 0.5 mg/mL, followed by incubation for 4 hours to dissolve purple-colored formazan by adding 100 μL of dimethylsulfoxide (DMSO), and then using a microplate reader (Thermo, Varioskan Flash, UK) was used to measure the absorbance at 540 nm. Cell viability was expressed as a percentage (%) compared to the control group not treated with LPS.

As a result, the extracts under all conditions showed no toxicity up to 20 ug/mL (FIG. 14). In addition, in the case of the 9 single compounds, almost no toxicity was found at 0 to 100 uM (FIG. 15).

Based on the above results, it was confirmed that the Yugeunpi extract and the single compound isolated therefrom ensure sufficient stability as a food material.

Example 6: Evaluation of anti-inflammatory efficacy of a single compound isolated from Yugeunpi extract

In order to evaluate the anti-inflammatory efficacy of a single compound derived from the Eugenia extract isolated and identified in Example 2, NO (Nitric oxide) assay was performed.

Specifically, NO production inhibition was measured by iNtRON's nitric oxide plus detection kit. That is, Griess reagent (1% sulfanilamide, 0.1% naphthylethylendiaminein, 25% phosphoric acid) oxidizes NO to NO ₂ , and the absorbance of the produced NO ₂ is measured at 540 nm, and a calibration curve is obtained using NaNO ₂ . First, 100 μL of RAW 264.7 cells were dispensed into a 96-well plate at 5 Х10 ⁵ cells per 1 mL of DMEM medium, and cultured for 24 hours to allow the cells to adhere. Next, 180 μL of 1 ug/mL of LPS and 20 μL of a single compound derived from radishes of various concentrations were added and cultured for 24 hours, and then the amount of NO produced in the culture medium was measured using Griess reagent.

As a result, the NO production inhibitory ability was confirmed in the 9 kinds of yugeunpi-derived single substances, and the inhibitory ability of 80% or more was confirmed at 100uM (FIG. 16).

The above description of the present invention is for illustrative purposes, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting.

<110> Seoul National University R&DB Foundation Pyeongchang R&BD Support Center <120> A composition for treating, preventing and improving bone associated diseases containing an ulmus extracts or an effective single compound isolated therefrom <130> PN144633KR <150> KR 10-2021-0185379 <151> 2021-12-22 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> NFATc1_F <400> 1 gggtcagtgt gaccgaagat 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> NFATc1_R <400> 2 ggaagtcaga agtgggtgga 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> CTSK_F <400> 3 ggccaactca agaagaaaac 20 <210> 4 <211> 19 <212> DNA <213> artificial sequence <220> <223> CTSK_R <400> 4 gtgcttgcttcccttctgg 19 <210> 5 <211> 21 <212> DNA <213> artificial sequence <220> <223> OSCAR_F <400> 5 ctgctggtaa cggatcagct c 21 <210> 6 <211> 18 <212> DNA <213> artificial sequence <220> <223> OSCAR_R <400> 6 ccaaggagcc agaacctt 18 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> DC-STAMP_F <400> 7 ccaaggagtc gtccatgatt 20 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> DC-STAMP_R <400> 8 ggctgctttg atcgtttctc 20 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> GAPDH_F <400> 9 aactttggca ttgtggaagg 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> GAPDH_R <400> 10 acacattggg ggtaggaaca 20

Claims (6)

A pharmaceutical composition for preventing or treating bone-related diseases caused by osteoclast overexpression or hyperdifferentiation, comprising a compound represented by Formula 10, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof,
[Formula 10]

R ₁ to R ₃ are each independently H or OH;
R ₄ is H or ego,
R ₅ is OH; or ego,
X is above is H when it is a single bond, is O when is a double bond,
AB is a hydrocarbon with a single bond (CH-CH) or a double bond (C=C),
The compound represented by Formula 10 is a compound represented by Formula 9 below,
[Formula 9]

Bone-related diseases caused by the overexpression or hyperdifferentiation of osteoclasts include osteoporosis, osteomalacia, osteopenia, bone defect, bone atrophy, osteonecrosis, fibrous dysplasia, and fibrous osteitis , Paget's disease, metabolic bone disease with calcium dysregulation, bone metastasis of cancer cells or wear debris of artificial joints, bone resorption disease caused by cancer, bone neoplasia Alveolar bone loss due to neoplastic destruction, fracture, osteolysis, osteoarthritis, osteoogenesis imperfecta, rickets, bone loss secondary to endocrine disorders or drugs, periodontitis And at least one selected from the group consisting of rheumatoid arthritis, a pharmaceutical composition.
delete The pharmaceutical composition according to claim 1, wherein the compound, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof is derived from an extract or a fraction thereof. The pharmaceutical composition according to claim 1, wherein the compound, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof has at least one of osteoclast differentiation inhibitory activity and anti-inflammatory activity. A food composition for preventing or improving bone-related diseases caused by overexpression or differentiation of osteoclasts, comprising a compound represented by Formula 10, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof,
[Formula 10]

R ₁ to R ₃ are each independently H or OH;
R ₄ is H or ego,
R ₅ is OH; or ego,
X is above is H when it is a single bond, is O when is a double bond,
AB is a hydrocarbon with a single bond (CH-CH) or a double bond (C=C),
The compound represented by Formula 10 is a compound represented by Formula 9 below,
[Formula 9]

Bone-related diseases caused by the overexpression or hyperdifferentiation of osteoclasts include osteoporosis, osteomalacia, osteopenia, bone defect, bone atrophy, osteonecrosis, fibrous dysplasia, and fibrous osteitis , Paget's disease, metabolic bone disease with calcium dysregulation, bone metastasis of cancer cells or wear debris of artificial joints, bone resorption disease caused by cancer, bone neoplasia Alveolar bone loss due to neoplastic destruction, fracture, osteolysis, osteoarthritis, osteoogenesis imperfecta, rickets, bone loss secondary to endocrine disorders or drugs, periodontitis And at least one selected from the group consisting of rheumatoid arthritis, a food composition.
A feed composition for preventing or improving bone-related diseases caused by overexpression or differentiation of osteoclasts, comprising a compound represented by Formula 10, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof,
[Formula 10]

R ₁ to R ₃ are each independently H or OH;
R ₄ is H or ego,
R ₅ is OH; or ego,
X is above is H when it is a single bond, is O when is a double bond,
AB is a hydrocarbon with a single bond (CH-CH) or a double bond (C=C),
The compound represented by Formula 10 is a compound represented by Formula 9 below,
[Formula 9]

Bone-related diseases caused by the overexpression or hyperdifferentiation of osteoclasts include osteoporosis, osteomalacia, osteopenia, bone defect, bone atrophy, osteonecrosis, fibrous dysplasia, and fibrous osteitis , Paget's disease, metabolic bone disease with calcium dysregulation, bone metastasis of cancer cells or wear debris of artificial joints, bone resorption disease caused by cancer, bone neoplasia Alveolar bone loss due to neoplastic destruction, fracture, osteolysis, osteoarthritis, osteoogenesis imperfecta, rickets, bone loss secondary to endocrine disorders or drugs, periodontitis And at least one selected from the group consisting of rheumatoid arthritis, a feed composition.