KR101908834B1 - Acidified ocean exposure responsive gene in Alveopora japonica and diagnosing kits of the oceanic environmental change using the same - Google Patents

Abstract

The present invention relates to a gene for Alveopora japonica gene corresponding to acidified sea water exposure and a kit for diagnosing a marine environment change using the gene. More particularly, the present invention relates to a gene derived from bubbles of diphosphate corresponding to acidified sea water, Can be usefully used as a biosensor and a kit for confirming exposure to acidified seawater because it uses a specific gene group of bubbles dolomye whose expression amount changes according to the change of acidity of seawater according to climate change.

Description

[0001] The present invention relates to a kerosene phos- phate gene corresponding to acidified sea water exposure, and a kit for diagnosing a marine environment change using the same,

The present invention relates to a gene for Alveopora japonica gene corresponding to acidified sea water exposure and a kit for diagnosing a marine environment change using the same.

Since the Industrial Revolution, human activity has increased atmospheric carbon dioxide concentrations by more than 100 ppm, and about one-fourth of the increased atmospheric carbon dioxide is absorbed by the oceans, making the oceans a very important carbon dioxide sink. Carbon dioxide absorbed into the ocean forms carbonate (H ₂ CO ₃ ) in the seawater and the acidity of the seawater is increased by the additional absorbed carbon dioxide.

As the acidity (oceanic acidification) of the ocean increases, the concentration of carbonate ion (CO ₃ ^2- ) in the seawater decreases, which greatly affects marine organisms composed of carbonate skeletons. In this way, acidification of the ocean causes the carbonate ion concentration in the surface sea water to decrease continuously, so that if the carbonate is in an unsaturated state, the species using the carbonate skeleton are likely to become extinct without sustaining any further life activity.

It is now widely anticipated that the acidification of seawater in the oceans affects marine life, and that this trend will lead to the disappearance of corals in the tropical oceans over the next few centuries and to the skeletal formation of calcified organisms in most polar waters do.

As of 2014, the amount of carbon dioxide emitted by mankind is about 32.3 billion tons, an increase of about 1.7 billion tons compared to 2010, and if the amount of carbon dioxide emitted exceeds the critical point of the ecosystem, there will be serious irreversible changes in the ecosystem Will be. Recently, rapid acidification has been reported in the East Sea of Korea after the Industrial Revolution. This suggests that marine acidification is also proceeding seriously in the offshore waters of Korea, suggesting that the habitat of biomass with calcium carbonate skeleton may be reduced in the future. Therefore, it is urgent to develop a biological forecasting system that can detect ecosystem change at a local scale in advance.

Corals are used as habitats for a variety of marine life, but species diversity and populations are rapidly declining due to rising sea water temperature and acidification due to climate change. In addition, habitat destruction due to human intervention is underway, and ecological monitoring to conserve coral reefs is needed, along with a molecular biologic approach.

Studies on coral reefs in Korea began with taxonomic studies in the 1970s, and researches on phylogeny, evolution, symbiosis, life history, propagation and conservation have been carried out. However, studies on ocean acidification and climate change are still in the beginning stages.

On the other hand, Alveopora japonica is widely distributed in the coastal area of Jeju Island. It is relatively common in coastal rocks near 15 to 20 m depth and on the surface of large rocks. do. It belongs to the zoophyllous animal, the coral reef river, the Doshan lacquer, the mushroom Doshan lokamok, the hole dorun lacquer, and it is a group of cormorant and cormorant cormorant in the coral body. There are variations in the color of the tentacles and body, ranging from light green to dark and hazy tan. Each polyp has twelve tentacles. When the tentacles are spread out, their diameter is about 1 cm, and they also emit fluorescent light according to the reflection angle of the light reflected by the tentacles. The coral body with the tentacles refracted is in the form of a lump of eggs, and the coral is a delusion of porosity and reminiscent of a honeycomb. Although this coral species is not designated marine protected by the Ministry of Maritime Affairs and Fisheries, internationally, international trade is restricted by the "Convention on the International Trade of Endangered Species of Wild Fauna and Flora (CITES)".

The method of assessing the health of an ecosystem using gene expression changes is based on the molecular biologic technique for various environmental factors in the environment. By applying the genetic technique that is developing very rapidly, It is a method of diagnosing and evaluating the risk or health.

Existing methods of assessing the presence of harmful organisms (such as mutation / behavioral abnormality / mortality / enzyme activity) using biological organisms are methods of measuring changes in organisms already exposed to stressed substances, It must be high enough to be able to measure. On the other hand, the evaluation method using the gene expression change is a method of evaluating the level of stress the organism undergoes after receiving the external stimulus, using the change in the transcription level that the gene information is transferred to the protein. The method has the advantage of detecting even very small external stimuli, so that even a small amount of environmental change or biological response to long-term exposure to external stimuli can be predicted. The gene biomarkers used in the evaluation method using the expression changes of these genes show the existence and the relation of the external stimuli due to the specificity thereof and can evaluate the long term influence on the various environmental changes of the ecosystem and the health of the organisms in the environment Let's do it.

Accordingly, the present inventors have made efforts to develop a biological forecasting system capable of detecting ecosystem change corresponding to acidified sea water in advance, and have found that the expression level of the acidic sea water in the bacterium, And confirmed that the gene group can be effectively used as a biosensor capable of detecting changes in the degree of acidity of seawater and a change in the marine ecosystem, thereby completing the present invention.

It is an object of the present invention to provide a microarray for confirming exposure to acidified sea water using a gene of bubble stone and a kit for diagnosing exposure to acidified sea water using the microarray.

In order to achieve the above object, the present invention provides a microarray for confirming exposure to acidified sea water of a foamed dodecan sulfate in which oligonucleotides of nucleotide sequences of all the following genes or complementary strand molecules thereof are integrated: (Protein phosphatase 1 regulatory subunit 3D), a gene described in SEQ ID No. 2 (aquaporin AQPcic), a gene described in SEQ ID No. 3 (protein phosphatase 1 regulatory subunit 12C), a gene described in SEQ ID No. 4 myosin light chain kinase family member 4, a gene described in SEQ ID NO: 7, a gene described in SEQ ID NO: An alcohol dehydrogenase [NADP (+)] A), a gene described in SEQ ID NO: 8, a gene described in SEQ ID NO: 9 (microtubule-associated serine / threonine- (DNA-directed RNA polymerase I, II, and III subunit RPABC5), a gene described in SEQ ID NO: 11 (solute carrier organic anion transporter family member 4A1), SEQ ID NO: 12 (DNA-directed RNA polymerase II subunit RPB3), a gene described in SEQ ID NO: 14 (protein phosphatase 1K), a gene described in SEQ ID NO: 15 (synaptotagmin-14) (ATP-dependent RNA helicase DDX60-like), a receptor-type tyrosine-protein phosphatase gamma (SEQ ID NO: 17), a gene described in SEQ ID NO: 18 (RNA helicase SDE3) The gene (L-asparaginase) shown in SEQ ID NO: 19 and the gene described in SEQ ID NO: 20 (myosin essential light chain, striated adductor muscle).

The present invention also relates to a method for preparing a bacterium of the present invention, which comprises the steps of: 1) separating RNA from a bacterium dicotylaluminium exposed to acidified sea water and a control bacterium dicolor; 2) labeling the experimental group and the control group with different fluorescent materials while synthesizing cDNA from the separated RNA of step 1); 3) hybridizing the cDNA labeled with each of the different fluorescent substances of step 2) with the microarray of claim 1; 4) analyzing the reacted microarray; And 5) comparing the degree of gene expression integrated in the microarray of claim 1 with the control group in the analyzed data to confirm whether the acidified sea water is exposed.

The present invention also relates to a method for preparing a bacterium of the present invention, which comprises the steps of: 1) separating RNA from a bacterium dicotylaluminium exposed to acidified sea water and a control bacterium dicolor; 2) Performing real-time RT-PCR using the RNA of step 1) using primer pair complementary to each of the following genes and capable of gene amplification: a gene described in SEQ ID NO: 1 (protein phosphatase 1 regulatory subunit 3D) (Aquaporin AQPcic), a gene described in SEQ ID NO: 3 (protein phosphatase 1 regulatory subunit 12C), a gene described in SEQ ID NO: 4 (myosin-2 essential light chain) A gene described in SEQ ID NO: 6, a gene described in SEQ ID NO: 7 (alcohol dehydrogenase [NADP (+)] A) (Actin), a gene described in SEQ ID NO: 9 (microtubule-associated serine / threonine-protein kinase 1), a gene described in SEQ ID NO: 10 (DNA-directed RNA polymerases I, II, and III subunit RPABC5), sequence A gene described in SEQ ID NO: 12, a gene described in SEQ ID NO: 13 (DNA-directed RNA polymerase II subunit RPB3), a gene described in SEQ ID NO: 14 A gene described in SEQ ID NO: 15 (synaptotagmin-14), a gene described in SEQ ID NO: 16 (ATP-dependent RNA helicase DDX60-like), a gene described in SEQ ID NO: (tyrosine-protein phosphatase gamma), RNA helicase SDE3, L-asparaginase, and myosin essential light chain, striated adductor muscle ); And 3) comparing the gene product of step 2) with a control to confirm the degree of expression of the acidified sea water.

In addition, the present invention provides a kit for confirming exposure to acidified sea water of a bubbles dorsal arc containing the microarray of claim 1.

In addition, the present invention provides a kit for confirming exposure to acidified sea water comprising all the primer pairs complementary to each of the following genes and capable of amplifying the gene: a gene described in SEQ ID NO: 1 (protein phosphatase 1 regulatory subunit 3D), aquaporin AQPcic, a gene described in SEQ ID NO: 3 (protein phosphatase 1 regulatory subunit 12C), a gene described in SEQ ID NO: 4 (myosin-2 essential light chain) (Cadherin EGF LAG seven-pass G-type receptor 2), the gene described in SEQ ID NO: 6 (myosin light chain kinase family member 4), the gene described in SEQ ID NO: 7 (alcohol dehydrogenase [NADP +)] A), the actin described in SEQ ID NO: 8, the microtubule-associated serine / threonine-protein kinase 1, the DNA described in SEQ ID NO: 10 a gene described in SEQ ID NO: 12 (melanotransferrin), a gene described in SEQ ID NO: 13 (SEQ ID NO: 13), a gene described in SEQ ID NO: DNA-directed RNA polymerase II subunit RPB3), a gene described in SEQ ID NO: 14 (protein phosphatase 1K), a gene described in SEQ ID NO: 15 (synaptotagmin-14), a gene described in SEQ ID NO: 16 (ATP-dependent RNA helicase DDX60 -like, a receptor-type tyrosine-protein phosphatase gamma, a gene described in SEQ ID NO: 18 (RNA helicase SDE3), a gene described in SEQ ID NO: 19 (L-asparaginase) 20 (myosin essential light chain, striated adductor muscle).

Since the gene derived from the bubbles of diphosphate corresponding to the acidified sea water of the present invention and the diagnostic kit for the marine ecosystem using the gene of the present invention uses a specific gene group of the foam diphosphate whose expression amount changes according to the change of the acidity of the sea water according to the climate change, And can be usefully used as a biosensor and a kit for confirming whether or not it is exposed.

FIG. 1 shows a microarray experiment using a gene of bubbles of diphosphate exposed to acidified sea water (pH 7.5) or normal sea water (pH 8.0) and grouping common genes among genes more than 2 times differentially expressed to be.

Hereinafter, the present invention will be described in detail.

The present invention provides a microarray for confirming whether or not an oligonucleotide of the nucleic acid sequence of all of the following genes, or a complementary strand molecule thereof, has been integrated into an acidified sea water of a foamed diclofenac:

A protein described in SEQ ID NO: 1 (protein phosphatase 1 regulatory subunit 3D), a gene described in SEQ ID NO: 2 (aquaporin AQPcic), a gene described in SEQ ID NO: 3 (protein phosphatase 1 regulatory subunit 12C) Myosin-2 essential light chain, the cadherin EGF LAG seven-pass G-type receptor 2, the gene described in SEQ ID NO: 6 (myosin light chain kinase family member 4) 7, the gene described in SEQ ID NO: 8, the gene described in SEQ ID NO: 9 (microtubule-associated serine / threonine-protein kinase 1) (DNA-directed RNA polymerases I, II, and III subunit RPABC5), a gene described in SEQ ID NO: 11 (a solute carrier organic anion transporter family member 4A1), a gene described in SEQ ID NO: 12 (melanotransferrin) SEQ ID NO: 13, a gene described in SEQ ID NO: 14 (protein phosphatase 1K), a gene described in SEQ ID NO: 15 (synaptotagmin-14), a gene described in SEQ ID NO: 16 (DNA-directed RNA polymerase II subunit RPB3) ATP-dependent RNA helicase DDX60-like, a receptor-type tyrosine-protein phosphatase gamma, a gene described in SEQ ID NO: 18 (RNA helicase SDE3), a gene described in SEQ ID NO: 19 -asparaginase) and the gene described in SEQ ID NO: 20 (myosin essential light chain, striated adductor muscle).

The gene may be derived from bovine diphosphate.

The acidified seawater may be at a pH of 6 to 7.7, more specifically at a pH of 6.5 to 7.6. According to one embodiment of the present invention, the acidified sea water may have a pH of 7.5.

The present invention also relates to a method for preparing a bacterium of the present invention, which comprises the steps of: 1) separating RNA from a bacterium dicotylaluminium exposed to acidified sea water and a control bacterium dicolor; 2) labeling the experimental group and the control group with different fluorescent substances while synthesizing cDNA from the RNA of the experimental group and the control group of step 1); 3) hybridizing the cDNA labeled with each of the different fluorescent substances of step 2) with the microarray of claim 1; 4) analyzing the reacted microarray; And 5) comparing the degree of gene expression integrated in the microarray of claim 1 with the control group in the analyzed data to confirm whether the acidified sea water is exposed.

The fluorescent material of step 2) may be any one selected from the group consisting of Cy3, Cy5, poly-L-lysine-fluorescein isothiocyanate (RITC), rhodamine-B-isothiocyanate (RITC) and rhodamine.

The present invention also relates to a method for preparing a bacterium of the present invention, which comprises the steps of: 1) separating RNA from a bacterium dicotylaluminium exposed to acidified sea water and a control bacterium dicolor; 2) Performing Real-time Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) using primer pair complementary to each of the following genes and capable of gene amplification: Step 1) (Protein phosphatase 1 regulatory subunit 3D), aquaporin AQPcic (SEQ ID NO: 2), the gene described in SEQ ID NO: 3 (protein phosphatase 1 regulatory subunit 12C), the gene described in SEQ ID NO: 4 light chain), the gene described in SEQ ID NO: 5 (cadherin EGF LAG seven-pass G-type receptor 2), the gene described in SEQ ID NO: 6 (myosin light chain kinase family member 4) alcohol dehydrogenase [NADP (+)] A), a gene described in SEQ ID NO: 8, a microtubule-associated serine / threonine-protein kinase 1 described in SEQ ID NO: DNA-direc the gene described in SEQ ID NO: 12, the gene described in SEQ ID NO: 13 (SEQ ID NO: 13), the gene described in SEQ ID NO: DNA-directed RNA polymerase II subunit RPB3), a gene described in SEQ ID NO: 14 (protein phosphatase 1K), a gene described in SEQ ID NO: 15 (synaptotagmin-14), a gene described in SEQ ID NO: 16 (ATP-dependent RNA helicase DDX60 a gene described in SEQ ID NO: 18 (RNA helicase SDE3), a gene described in SEQ ID NO: 19 (L-asparaginase), a gene described in SEQ ID NO: 20 (myosin essential light chain, striated adductor muscle); And 3) comparing the gene product of step 2) with a control to confirm the degree of expression of the acidified sea water.

In addition, the present invention provides a kit for confirming exposure to acidified sea water of a bubble Dosh mountain call including the microarray according to the present invention.

The acidified seawater may be at a pH of 6 to 7.7, more specifically at a pH of 6.5 to 7.6. According to one embodiment of the present invention, the acidified sea water may have a pH of 7.5.

The kit may further include at least one fluorescent substance selected from the group consisting of a streptavidin-like phosphatase conjugate, a chemifluorescent, and a chemiluminescent substance. have.

The kit may further comprise at least one reaction selected from the group consisting of a buffer solution used for hybridization, a reverse transcriptase for synthesizing cDNA from RNA, dNTP and rNTP (premixed or separated feed type), a labeled reagent and a washing buffer solution Additional reagents may be included.

In addition, the present invention provides a kit for confirming exposure to acidified sea water comprising a pair of primers complementary to each of the following genes and capable of amplifying the gene: a gene described in SEQ ID NO: 1 (protein phosphatase 1 regulatory subunit 3D), aquaporin AQPcic, a gene described in SEQ ID NO: 3 (protein phosphatase 1 regulatory subunit 12C), myosin-2 essential light chain (SEQ ID NO: 4) 5, a gene described in SEQ ID NO: 6 (myosin light chain kinase family member 4), a gene described in SEQ ID NO: 7 (alcohol dehydrogenase [NADP (+ ), A gene described in SEQ ID NO: 8, a gene described in SEQ ID NO: 9 (microtubule-associated serine / threonine-protein kinase 1), a gene described in SEQ ID NO: 10 A gene described in SEQ ID NO: 12, a gene described in SEQ ID NO: 13 (DNA (SEQ ID NO: 13), a DNA described in SEQ ID NO: -directed RNA polymerase II subunit RPB3), the gene described in SEQ ID NO: 14 (protein phosphatase 1K), the gene described in SEQ ID NO: 15 (synaptotagmin-14), the gene described in SEQ ID NO: 16 (ATP- dependent RNA helicase DDX60- a gene described in SEQ ID NO: 18 (RNA helicase SDE3), a gene described in SEQ ID NO: 19 (L-asparaginase), a gene represented by SEQ ID NO: (Myosin essential light chain, striated adductor muscle).

The acidified seawater may be at a pH of 6 to 7.7, more specifically at a pH of 6.5 to 7.6. According to one embodiment of the present invention, the acidified sea water may have a pH of 7.5.

In a specific embodiment of the present invention, the present inventors cultured bubble dicornshells in seawater at an acidified pH, and synthesized cDNA from the genes of the above-mentioned bubble diclofenate cultured to investigate genes whose expression levels were changed.

Specifically, the mRNA isolated from the tissue of the bovine dorsal arc cultured at pH 7.5 was synthesized as cDNA. The synthesized cDNA was fluorescently labeled and a microarray was prepared using the same. As a result of analyzing the obtained microarrays, 20 kinds of genes whose expression levels were increased or decreased in the experimental group (see Table 2) were confirmed based on the control group. In addition, the common genes among the above genes differentially expressed in the experimental group 2 times or more were grouped (see FIG. 1).

Changes in climate cause changes in the acidity of seawater, and changes in these environments cause changes in physiology and metabolism of marine organisms. Therefore, it is possible to confirm the stress and health state due to the change of the external environment by confirming the change of the gene expression amount derived from the marine bubbles, and the gene whose expression is changed can be used as a biomarker. Therefore, the genes can be usefully used as microarrays and kits for confirming exposure to acidified sea water according to changes in acidity of seawater.

       Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

< Example  1> Foam Dolsan courtesy  Exposure to culture and acidified sea water

After collecting the bubble Dolsan samples from the coastal waters of Jeju, we exposed the bubble Dolsan in the sea water of pH 7.5 for 24 hours. The control bubbles were stored in natural sea water (pH 8.0) for 24 hours Lt; / RTI &gt;

< Example  2> Foam Dolsan courtesy  Synthesis of cDNA

In order to measure the gene change of the bubbles of diphosphate exposed to the acidified sea water in Example 1, RNA was isolated by the method developed by the present inventors.

Specifically, the bubbles in the experimental group and the control group were made into powder by using liquid nitrogen in a mortar and dissolved in a lysis solution (35 mM EDTA, 0.7 M LiCl, 7% SDS, 200 mM Tris-Cl 9.0)] was added and homogenized. An equal volume of phenol solution was added to the homogenized sample, mixed well, centrifuged for 10 minutes, and the supernatant was taken and transferred to a new tube. To this was added 8M lithium chloride (LiCl) 1/3 of the total volume, and the mixture was allowed to stand at 4 占 폚 for 2 hours or more. The supernatant was removed by centrifugation for about 30 minutes, and the precipitate was taken out and dissolved in 300 μl of DEPC-treated water. The same amount of isopropanol was added to 1/10 volume of 3 M sodium acetate (pH 5.2) After centrifugation for about 30 minutes, the supernatant was removed and the precipitate was taken. 50 μl of a 70% ethanol solution was added to the precipitate, followed by centrifugation for 5 minutes. Then, the ethanol solution was removed, the precipitated RNA was dried, and the dried RNA was dissolved in an appropriate amount of DEPC-treated water.

Next, cDNA was synthesized from the separated bovine dicornate RNA. Tri-reagent (Molecular Research Center Inc.) was used for extraction, and cDNAs of experimental group and control group were synthesized using reverse transcriptase using extracted RNA as a template.

< Example  3> by acidification Bubble Dolsan  Gene change measurement

<3-1> Hybridization (hybridization) and scanning (scanning)

The microarray experiment was carried out as follows using the foamy dorsal arc cDNA synthesized in Example 2 as follows.

Specifically, a cDNA sample labeled with Cy3-CTP and Cy5-CTP, which are fluorescent substances, was purified using a PCR purification kit (Qiagen, Germany) and eluted with distilled water. The purified fluorescent label-cDNA sample was added to a hybridization buffer (3 x SSC, 0.3% SDS, 50% formamide, 20 μg Cot-1 DNA, 20 μg yeast tRNA) &Lt; / RTI &gt; to produce a hybridization mixture. The hybridization mixture was denatured by heating at 95 DEG C for 3 minutes and centrifuged at 12,000 g for 30 seconds to reduce the temperature. The cover slip was covered with the prepared foam dodecane microarray, and the denatured hybridization mixture was mixed by pipetting. The microarray was placed in a GT-Hyb chamber and reacted at 65 ° C for 16 hours. After hybridization, the microarray was removed from the chamber, washed, and stored in a dark room until spinning, drying and scanning. The bubble Doshan microarray, which had been tested, was scanned using an Exxon Jeffix 4000B scanner (Axon Instrument, USA). In the GenePix Pro 6.0 program, each point was scanned from a scanned image using a gridding file and quantified to obtain a GPR file containing analysis values such as Cy5 / Cy3 intensity and ratio of each point.

<3-2> Analysis of data

From the GPR files obtained from the Jean Fix program, the following analysis was performed using the analysis program Jean Spring 7.3.1 (GeneSpring 7.3.1, Agilent Technologies, USA). The normalization was performed using LOWESS (locally weighted regression scatterplot smoothing), and the reliable gene indicated that the sum of the median values was lower than the background or the standard deviation of each pixel value was not significant (flag-out). In addition, significant genes were selected only at points where the leveled ratio difference was more than 2 times.

As a result, a grouping of common genes differentially expressed two or more times in the experimental group among the genes is shown in Fig. 1 (Fig. 1).

< Example  4> Identification of genes that were altered by acidification

Sequences of 20 genes showing significant expression changes in Example 3 were confirmed using the next-generation sequencing technique.

Specifically, a poly (A) RNA was obtained and a first strand was synthesized using oligo (dT) or a random hexamer, and a second complementary strand was obtained from the first strand to synthesize cDNA. The double strand of the cDNA was partially digested, the deoxyadenine base was added to the 3 'end, and the amplified product was amplified by the PCR method using an illumina adapter. Then, amplified products were selected by size And nucleotide sequences were analyzed. The resulting nucleotide sequence was aligned using a control gene to obtain a full map of the expression construct. The nucleotide sequences of the primers used for the PCR amplification are shown in Table 1 below.

number Gene name primer
(5 '- &gt;3') SEQ ID NO: PCR Size (bp) One Protein phosphatase 1 regulatory subunit 3D F-TGGGCGAAACATTTACTTCC SEQ ID NO: 21 191 R-TCCCAATCATCCAGTGTGAA SEQ ID NO: 22 2 Aquaporin AQPcic F-TTTACTGTATGCGCCAGCAC SEQ ID NO: 23 194 R-TACACCCAATGATGCTTCCA SEQ ID NO: 24 3 Protein phosphatase 1 regulatory subunit 12C F-ATGGACGTTTCCTCCACAAG SEQ ID NO: 25 188 R-ATGGCGTCCAGATCAAACTC SEQ ID NO: 26 4 Myosin-2 essential light chain F-GGCAAAGTGGAATCCTCAAA SEQ ID NO: 27 217 R-CGCTGTCGAAGACACGTAAA SEQ ID NO: 28 5 Cadherin EGF LAG seven-pass G-type receptor 2 F-AGTGTTCACGCAAACACCAG SEQ ID NO: 29 162 R-ACTCCAATCGCATCAGCAC SEQ ID NO: 30 6 Myosin light chain kinase family member 4 F-TTTGCGTTAGCAAAGACAGC SEQ ID NO: 31 169 R-CCGACACTCCACATGTCTGT SEQ ID NO: 32 7 Alcohol dehydrogenase [NADP (+)] A F-GGCACCCATACTTTCCTCAA SEQ ID NO: 33 233 R-TTTTGGGAGGACTGGAACAC SEQ ID NO: 34 8 Actin F- TCAAAATCATTGCTCCACCA SEQ ID NO: 35 104 R-TTCAGCCTTGCTAATCCACA SEQ ID NO: 36 9 Microtubule-associated serine / threonine-protein kinase 1 F-AGAAGGCGGAGTTCATTCCT SEQ ID NO: 37 185 R-ATGCTGCTCCAACATGACTG SEQ ID NO: 38 10 DNA-directed RNA polymerases I, II, and III subunit RPABC5 F-TTGCTCACACCACCATGATT SEQ ID NO: 39 182 R-AATCAGGTCCACATGGGAAA SEQ ID NO: 40 11 Solute carrier organic anion transporter family member 4A1 F-CCTGCAATTGGCTTTTTGAT SEQ ID NO: 41 171 R-AGCAAGCAATGGAAGGCTAA SEQ ID NO: 42 12 Melanotransferrin F-ATGCGAGTATTCATTTTCCTTACA SEQ ID NO: 43 150 R-AAGGTAATCAGTCCAATCTGACAA SEQ ID NO: 44 13 DNA-directed RNA polymerase II subunit RPB3 F-TTGGGTGCAAATTGAGAACA SEQ ID NO: 45 190 R-TTGATCATCCGAGCATTTGA SEQ ID NO: 46 14 Protein phosphatase 1K F-CGATGCAGTATGGCTCAAAA SEQ ID NO: 47 220 R-TTTCCTTTGTGCCAGTGAGA SEQ ID NO: 48 15 Synaptotagmin-14 F-CGTCCACAGAAGACAGCAAA SEQ ID NO: 49 211 R-TCGATAACGTGTCGCTTCAG SEQ ID NO: 50 16 ATP-dependent RNA helicase DDX60-like F-GAGCGTATTCGACGCCTAAA SEQ ID NO: 51 159 R-CTCCTCCAGGGAACAACTGA SEQ ID NO: 52 17 Receptor-type tyrosine-protein phosphatase gamma F-GGAAGACTTCAAGGCTCACG SEQ ID NO: 53 174 R-CGACTGTGGTCAAATGCTGT SEQ ID NO: 54 18 RNA helicase SDE3 F-TCCAGTGCAGCTCATTTGAC SEQ ID NO: 55 241 R-CACATGGCAAGGGAGGTTAT SEQ ID NO: 56 19 L-asparaginase F-CAATGTACGTGGGCTTTGAA SEQ ID NO: 57 248 R-GTGGAAAATGGGAAGGGACT SEQ ID NO: 58 20 Myosin essential light chain, striated adductor muscle F-GGCTATGTCTCCAAGGCTGA SEQ ID NO: 59 158 R-CCAGCCATCACCTTCTTGAT SEQ ID NO: 60

As a result, as shown in Table 2 below, genes whose expression levels were significantly changed were identified.

number Gene name SEQ ID NO: Change in expression One Protein phosphatase 1 regulatory subunit 3D SEQ ID NO: 1 10.50 2 Aquaporin AQPcic SEQ ID NO: 2 9.20 3 Protein phosphatase 1 regulatory subunit 12C SEQ ID NO: 3 5.69 4 Myosin-2 essential light chain SEQ ID NO: 4 3.21 5 Cadherin EGF LAG seven-pass G-type receptor 2 SEQ ID NO: 5 3.19 6 Myosin light chain kinase family member 4 SEQ ID NO: 6 2.90 7 Alcohol dehydrogenase [NADP (+)] A SEQ ID NO: 7 2.81 8 Actin SEQ ID NO: 8 2.77 9 Microtubule-associated serine / threonine-protein kinase 1 SEQ ID NO: 9 2.74 10 DNA-directed RNA polymerases I, II, and III subunit RPABC5 SEQ ID NO: 10 2.53 11 Solute carrier organic anion transporter family member 4A1 SEQ ID NO: 11 2.41 12 Melanotransferrin SEQ ID NO: 12 2.34 13 DNA-directed RNA polymerase II subunit RPB3 SEQ ID NO: 13 2.19 14 Protein phosphatase 1K SEQ ID NO: 14 2.18 15 Synaptotagmin-14 SEQ ID NO: 15 2.18 16 ATP-dependent RNA helicase DDX60-like SEQ ID NO: 16 2.06 17 Receptor-type tyrosine-protein phosphatase gamma SEQ ID NO: 17 -2.77 18 RNA helicase SDE3 SEQ ID NO: 18 -2.77 19 L-asparaginase SEQ ID NO: 19 -3.90 20 Myosin essential light chain, striated adductor muscle SEQ ID NO: 20 -4.06

<110> Ewha University - Industry Collaboration Foundation <120> Acidified ocean exposure responsive gene in Alveopora japonica          and diagnosing kits of the oceanic environmental change using the          same <130> 2016P-12-019 <160> 60 <170> KoPatentin 3.0 <210> 1 <211> 654 <212> DNA <213> Artificial Sequence <220> <223> Protein phosphatase 1 regulatory subunit 3D <400> 1 atgaaaacag atgcacagca aagaaactcc atgtcagcaa gcccctctcc tggttccaaa 60 aaagtgtgtt ttgcagactt tgtaggcctc aaactcgagt tcgtcaaaac aataactccg 120 tgtagcagtg atgacaactt gacctgctcg gcggccggtc tcgtcaatac atggaagcgg 180 aatcactgtg acatcaataa caatgtcttg cttgggaagt gggcgaaaca tttacttccg 240 tgctttgtta tcccatcgaa aacggagagt tttatggtgc gcgtctttga ccagaatgtt 300 tgcctcgagg acatcgcttg cgcgaacttt gtggtaaccg gagttattcg ggtaacaaat 360 ttatcgtacg cgaaggaagt gactgttcga ttcacactgg atgattggga ctcctttaga 420 gacatttggg ctgattatat gtcgtcttgc tccgacggta aaaccgacaa gtttagcttc 480 cgaataacag tgcctttcga ttttgatgtg catagataca tgtgctttgc agtccggtac 540 aaagtcatga atcaggagtt ctgggataat aatcatacta gaaattatca tatacagtgt 600 ttggaggtga aaaggggttc ctgctttaat aattatacca attttgaaca ctga 654 <210> 2 <211> 765 <212> DNA <213> Artificial Sequence <220> <223> Aquaporin AQPcic <400> 2 atgaaaattc tacttgtatc tgagatgaag agcctccatt tctgggcaag tgccttggtg 60 gagctgatcg caaccttctt tttcattttc ctgaccactg gtaccaccat tacttggaaa 120 ataagctatc ctccatcaac agaattaatt tctctgtcct tcgggttcag catagcaacc 180 ctggctatgt gtagtttgca tctaagcggt ggacacatca accctgcagt aactattgcc 240 atgatggcca ttagaaaagt caccatcctg cgaggcgtaa cctatgttat ttttcaactg 300 gtcggaggta tcgcgggctc agctgtcctg aaattcataa caccagaggc aaaacgtggg 360 acccttggtg cgactgtccc aggccccgaa gtgactccgg cgcaggcagt tggtgttgag 420 atactgctga cattcctcct cgtgtttact gtatgcgcca gcaccgactc caaaaggcta 480 cactacggtt atgaggttcc attatctatt ggattatgcg tggctgtctg tcacttcatc 540 gggattggat ttaccggatg tggaataaat cctgctcgtt cttttggtcc ggccgtggta 600 atgaacaaac ctgaaatatg gaagcatcat tgggtgtatt gggtcgggcc cattggtgga 660 gccttagttg cagcggtcct atatcaggtg atatttcggg cccgtgagga aactggcccc 720 acctccaaca acgatgtgga gatgagtcac gattcgaagt tgtga 765 <210> 3 <211> 513 <212> DNA <213> Artificial Sequence <220> <223> Protein phosphatase 1 regulatory subunit 12C <400> 3 atggacgttt cctccacaag acagagacag actgggaaag catacaggat aaagtcatgt 60 ccgcagccat tcgatttgat ctttcaaatt gcgtgttgta aggactcctc tgactgtgaa 120 ttcactgagg cgagaaagat tatagagctt ttccgtcaaa atggagaaga gtttgatctg 180 gacgccataa gcgcctctgg tatgactgct ctcacacagt gtgttcttga tggtaactta 240 cagagtgtaa aggctttgat tgcgctcgga gccaatgtga acaagaaaga cggacaaggt 300 agcacggcct tgcattacgc agctagcgag ggatacgttg acatcgtcaa atgtttgctt 360 gactgtgatg ctaacgcgag agctctaaat cgtcaagaac agatgccttt agacgtagct 420 gatggagagg aaatacaaaa actcttgtca cgtaaaagta aaatcttccg ttctgccagt 480 aaggtactga ctcgtcaaac cagcttgccg tga 513 <210> 4 <211> 453 <212> DNA <213> Artificial Sequence <220> <223> Myosin-2 essential light chain <400> 4 atggcaagca cactgaccga tcgggagatg gacgaattac gcgataattt tggtctttat 60 gatacggtgg gcgacggcaa agtggaatcc tcaaacatgg gtcagatgct gcgatcggtc 120 ggattaaacc cgacacaagc cgaagtcgaa aaggtagtga aagagatcga ccctcaagga 180 aacaagagga tatcattcga ggaatttgtg ccagtggttc tgtcgcttcg tacgcgcacc 240 cacaaatacg gtcaagacgt ttttatcgac agtttacgtg tcttcgacag cgatggttcg 300 ggcgcgatca gctccggaga gcttcgtcat gttctcacaa gcttgggtga aaagttaaaa 360 gacgaagatg tagataccct tactcagggt ttcgaggaca acactggtct tataaactac 420 gaggaatttg ttaaaagcgt catgaacggt taa 453 <210> 5 <211> 234 <212> DNA <213> Artificial Sequence <220> <223> Myosin-2 essential light chain <400> 5 gtcaatgaca acgctccagt gttcacgcaa acaccagaat tcacgatcag agaggaccat 60 agggccaaca taaactccgg tgtcggaacc atccaggcaa cagatgccga catgccggga 120 ccaaacagtg aaatctttta ctatgtgaca agtggtgctg gtgctgatgc gattggagtt 180 gtatctagaa ctggactggt gtatttgatg agaaacgtgg attacgaaaa cgtc 234 <210> 6 <211> 228 <212> DNA <213> Artificial Sequence <220> <223> Myosin light chain kinase family member 4 <400> 6 cacatgcaca gcaagaacat tgttcacttg gatctaaagc ctgagaacat tgtttgcgtt 60 agcaaagaca gctgggatat caaactgatt gactttggat tggcgcaaga gcttgttcct 120 ggagttcgaa tgaaagcact gaagggaact cctgagttta tggcccctga agcggtgaat 180 tttgaagcaa tcacattagc aacagacatg tggagtgtcg gggtaata 228 <210> 7 <211> 960 <212> DNA <213> Artificial Sequence <220> <223> Alcohol dehydrogenase [NADP (+)] A <400> 7 atggctgcaa aatatgtcaa gctgaacaac ggagaaaaga tgccactaat tggtttagga 60 acctggaaat ctaaaaaagg gaaagcaagc aaagcagtga agcttgccct gcactatgga 120 taccgacaca ttgattgtgc acatatctat ttcaacgaag ctgaaattgg tgaagcatta 180 aatgaagtat ttcaagagga aaatctgaaa cgtgaagacc tcttcatcac ttcaaaactt 240 tggtcgaata gccatgcccc agaggatgtt cttcctgcct gtcagacaac attgaaaaat 300 cttcagatag attacttgga tctctacctg attcatatgc cattggcttt ctcaaaagcg 360 tccatgcgac ctcgatgcat agctgacggt gtcctcggat attcacccca acgtattgca 420 aagacgtggg aggccatgga acaacttgtg gaacaagggc tttgtaaagc tattggaatc 480 tcaaatttta cgataaaaaa aacagcaaat cttcttgaga ctgccaagat agtaccagct 540 tgtaaccaag tggaatggca cccatacttt cctcaaccgg ccttaaagaa attcagtgac 600 agcaaaggga ttgtaataac tgcttattct cctctgggat cacctgatcg accttatcca 660 gacaagcaag atcttcccat cctacttaat gacccagttc tgaagaatat cgccgaaaaa 720 cataaaacaa cagttggttt ggttgcttta gcgtggggga ttacctatgg tgttccagtc 780 ctcccaaaag ccgtgtctga gagtcatatc caagagaatc taaaagccct tgacgtgaaa 840 ctagatgaag acgacatgga agcgattaaa aacattggaa cccggtaccg gtatatcaag 900 attagttgga tgttcaagcc ggatgaagtt ccaaaggatc tatgggacgg agaggattga 960                                                                          960 <210> 8 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> Actin <400> 8 atcaaaatca ttgctccacc agagaggaag tactctgtct ggattggtgg ttctattcta 60 gcttcactgt ccaccttcca gcagatgtgg attagcaagg ctgaatatga tgagtctgga 120 ccatctattg tgcacaggaa gtgcttctaa 150 <210> 9 <211> 246 <212> DNA <213> Artificial Sequence <220> <223> Microtubule-associated serine / threonine-protein kinase 1 <400> 9 cacggcttct ttggtgggat tgactgggaa aatcttctgc gccagaaggc ggagttcatt 60 ccttcactgg aaggggaaga cgacacaagc tactttgatt ctcgcagtga ccgatacagc 120 cacgacttca tcagcgacga ggaagatggc gacgacgaag ctttccagtc ccccttcgaa 180 aatttcacgt ccacggcccc ccgattctca gtcatgttgg agcagcatca gcagagcttt 240 gaggag 246 <210> 10 <211> 282 <212> DNA <213> Artificial Sequence <220> DNA-directed RNA polymerases I, II, and III subunit RPABC5 <400> 10 tcagtcaaca gttcaagacg ttctttttca ccttcgcatt tgcaatattt actaattcta 60 aagcttgctc acaccaccat gattattcca attcgttgtt ttacttgtgg aaaagtaatc 120 ggaaacaagt gggaaacata tcttggtctt cttcaagcag agtacactga aggggatgct 180 ttagatgccc tgggattgaa aagatattgc tgccgaagaa tgctcctttc ccatgtggac 240 ctgattgaaa aacttctaaa ttatgctcca ttagaaaagt ag 282 <210> 11 <211> 2073 <212> DNA <213> Artificial Sequence <220> <223> Solute carrier organic anion transporter family member 4A1 <400> 11 atgcacgaag aaagaatgga gagtgcgttc gaaatccaaa gacacgtgag cgatcagtac 60 gatctggaca tcgaaagcga agagttcaga cccgcgtgtg gattgtcaac atggagaccc 120 agatttttgc aacggtttgc aaaggcgaaa tggtttctcg tttttcaatg ctggtttgtt 180 atcgctcagg gtatgattgt atcagggcta tctggagttg ttatttcttc gcttgaaaga 240 cgattctctt tgaaaactaa cgaagttggt gccattgtta gttgttacga catagccgct 300 gcaatcatgg ctgttcttgt aagctactac ggccatcatc acaaacccaa gtggctggga 360 actggagctt ttatcctagg aattggatgc tttttattcg ctctcccaca cgttctggtt 420 gggagatatg agcctggctc cagcggaaca aatctttgca cttcaaatga cggttctgca 480 gaggtagtgt gcaagagttc agtatggttt cacattcttg ctttcatcat agccgagttt 540 ttcattgggg ttggtgctac ccctgtgtac attttaggac catcatatat tgatgaaaac 600 gtcaagcaca ctacttcagg gttgttcctt ggaattatgt atgctgcctc aacattaggt 660 cctgcaattg gctttttgat gggaggagag ttccttgaca tttatgttga tattaaacag 720 ccagacggtg tgaatcttac accagaagac tctaacttta ttggagcatg gtggcttggt 780 tacattgttg gtggtcttct atctattttg gttagccttc cattgcttgc ttttcctcaa 840 gaacttccag gcacccctga aattcgagct gaaaaacaag actatactga ttatatgaag 900 gatgacaaca tgcctcacac tttacaacaa cttctaccga tgttaaagtc ccttcttaca 960 aataaaccat ttgtattcat agctttggca ggaacctttg aaggatttgc tgttagtgga 1020 ttttcaacat ttatgcctaa atttgtagaa acacaatttc atgtctctcc tggccaagct 1080 gcaacataca ctggtattgt agtggtaaca ggtggttgct ctggtatgct gtttggtgga 1140 tatcttatca aacgaatgaa gtggacttgt gataaaataa tcaaggcagc ttttattatt 1200 gcctcatttg caacgctgtg gacttttgga atgttttttg gttgctctaa cagaacattc 1260 attggtgtta cccaaccata tctcaacagt tccagttctg cacttggtag tataagatca 1320 tcatgtaatg ccgcctgcaa ctgtgatgtg aagttctttt cacctctttg ttcacaagaa 1380 gatcaactga cattttattc tccttgtttt gctggttgtt cagcagacaa tttacttggt 1440 gacaaaagtt atcaaaactg tagctgtttt ccagttccat caagtgaagg tattcaagga 1500 agtgggtgca taccagaatg caattcgctt attccatttc tgttttttct ctttggtctc 1560 atgattttca cattctccaa caatattcct gcaaccacag ctacattaag gtgtgttcct 1620 gagagtcaag ggtcccttgc acttggtatc acccagctaa taatacggat tttagccttt 1680 atacctgctc ctattgtctt tggttatatc attgattctg cttgccgttt acatcaggaa 1740 gatccttgtg atccacaggc tgaaagaaat tgtctggaat atgatgctga tctattcagg 1800 tatttgatgg tggcagtcgg tagcatattt aaggcattct ctgcaatttc ctttttcttc 1860 gcatggaaga cttacaagct tcctaattta acacacagac aggactccac cccaagtgat 1920 gtcgcttctc aagtaaccct tgtggatggc cttgttccca aggaaaaatt ggagatacag 1980 tgtgtcccag ccgtgcaact cattaatgtt gaaaattcct cctcagggaa ggtagaagat 2040 gataagtgta acatgaaagt aacatacgtt taa 2073 <210> 12 <211> 171 <212> DNA <213> Artificial Sequence <220> <223> Melanotransferrin <400> 12 atgcgagtat tcattttcct tacaattgca aagctaactg aactctcaag gcgaattctt 60 ttgagactat tctggtgtcg gaatacatgg aatattaatt ttaccaaatt tttgaaacga 120 atttcgttgt cagattggac tgattacctt actgttaatt ttatgggcta a 171 <210> 13 <211> 702 <212> DNA <213> Artificial Sequence <220> <223> Melanotransferrin <400> 13 aatccatcgt ggttgctgca gttgccatat tggaaatata tctcgaactt ctttcgtttt 60 attaaatcaa taaaacagcg aagatttaat ataatgccat tcgcaaacca accaagtatc 120 aaaatcctag agctaacgga agagaatgtc aagtttgtga tagagaacac agaccttagt 180 atggctaatg gcctccgaag aatatttatt gccgaaacgc caacgatagc aatagattgg 240 gtgcaaattg agaacaacac ctctgtgcta catgacgagt ttattgctca cagactagga 300 ttgatacctt tgataagtga tgatgttgta gatcgtttga cttattctcg tgattgtact 360 tgtgatgagt tttgtccaga ctgttctgtt gagctgaaac tagaagtcaa atgctcggat 420 gatcaaacaa gacatgtcac aacgagagat ctaatctctt cggacccaag agttattccg 480 gctacttcaa gacaccatga tgatgaaagc actgaatatg gtgaacaaga tgacatcttg 540 atagttaagc ttcgtaaaag ccaggaactg aagcttcggg catttgctaa aaagggcttt 600 gcaaaggaac atgccaaatg gaatccaaca gctggagtag catttgagta tgaccccgac 660 aatgcattga ggcacactac gtacccaaga ccggaggaat ga 702 <210> 14 <211> 282 <212> DNA <213> Artificial Sequence <220> <223> Protein phosphatase 1K <400> 14 atgcgcgatg cagtatggct caaaagacaa tgtcactgta atagttattc ccctgagatt 60 atgggggaag tatcgttcac agcaggtttc aaaagaacac agcttgttga aaaatataag 120 ccttgcaagc 180 aaagtttacc atctggagga gatcctctca ctggcacaaa ggaaagaaga agccttagct 240 tgcagggtat cttcttcaca gcctgttatg actaagtctt ga 282 <210> 15 <211> 1260 <212> DNA <213> Artificial Sequence <220> <223> Synaptotagmin-14 <400> 15 atgtcgaaaa cggacgccga cacgggcacc aaaaaatctg tgtccctttt tgcgttgttc 60 cgatgctgtt tcaaaggtca atggagacca actgttcaaa gaaaaagcgg tgcatacgat 120 gcaaaggacg ctcctccaac ggcagaagag ggaaaggaag ctttggacaa tgaaaaacct 180 ggctccaaat ctaatgattt agaattagaa tacagtgaca aacctgatcc agcagaaccg 240 tttgtctctc ccagcgacga atacaaaccg agcttcgacg aagctagtac tgcgtctgtc 300 gtgccttcca gtgttggaag cgaagaagat caggcaagtt acgacgcgcc aagcaacatc 360 caacttgtac aaaatgacgg gacagcacac ccgcgtgatg tcgggacggg cggacgactc 420 agtctccagt ttatctacga tcctgagaca tccaagatga cactgactat cgtgggcttg 480 gagtttcccc ctttccaaaa ttggaagatg gacgatttgg aagtgagctg catgctgttg 540 cctgttcgac agcatagttt tcgtgtgcgt cccaagaagt tcaaagaccc atttacaatg 600 gttctgacac ccaaagagcg aattaagcaa atgtcccttc gctttcggct gtacgatcat 660 cgcgcaattt caaagcacat gattggtcaa ggtgttgtga atctcgtgga agtgaagttg 720 ggaccagaag cagtgactat agcattggaa ctgaacatac ctgagaccta tgcaattgat 780 tcccgctacg ttacaagcat cacgggtgaa agcaagcaaa cgtccacaga agacagcaaa 840 cccgaactct tgctctcttt ggagtaccgc gccttgacaa ggaagcttat tgccgaggtt 900 atcaagaccc gcaatctcgg gcttctaaat aactccaagc cgcaggacgt tgctgttgag 960 ttgaagctgg ttggcgaaga caacacaatt ctgcgagttt gtcgaaccac gctgaagcga 1020 cacgttatcg acgctgaatt caacgaaatg tttatgttcc gtgtaacgta cgagaagcta 1080 gccatggtca gtgtaatctt cacattgtat cgcgtgggcg aaagacgagc caagagagaa 1140 aatattggtg aagtgtgctt tggaaaacag tccagcagtt accaacagca aaatcattgg 1200 aatgatattg taaagggaag cgagcgagtc tttacacagt ggcatccttt gtttaaataa 1260                                                                         1260 <210> 16 <211> 279 <212> DNA <213> Artificial Sequence <220> <223> Probable ATP-dependent RNA helicase DDX60-like <400> 16 atggatgtag ttcccatcct tcgtgtggag cgtattcgac gcctaaattc ttacgccctg 60 gacttcttta agcatggatc cgctaaagta atcgagagag aaaacagaat cagagcaggg 120 gaggctttcg ctaagttgaa ggacttttgc ctaaccatca aatcaatcag ttgttccctg 180 gaggagctag gaacagaaag cgacaacgtg gtgcgtgcct ttaagcagct ggcggcagag 240 tttcaagata aattcgaaga acagtttcct cgctattag 279 <210> 17 <211> 486 <212> DNA <213> Artificial Sequence <220> <223> Receptor-type tyrosine-protein phosphatase gamma <400> 17 gagatgaagg agaaagaggc ggggtttcag gaccccctgg acgtcccctt tgagccgagt 60 ggagctgttt ccgtggaaga cttcaaggct cacgtggaga agtatgatgc caagaggcag 120 ctgctatttc aggaggagtt tgagtggatt acgaagaact ctccctggca tgacgccagt 180 gctagcgagg atgagcgcaa tgactccaag aacagataca gcaacatcac agcatttgac 240 cacagtcgag ttaagctgaa ggagaaacct ggcgtggagt gttccgacta catcaatgct 300 aactttatca ccggctacaa tggtcctcgt gagtacattg cctcccaagg tcccctggag 360 aagactgtgg aggacttctg gcggatggtg tgggagcagg ccaccacaac catcatcatg 420 ctcaccaatg tggtggagct gggaaagatg aagtgcactc agtactggcc caacagcaac 480 acgcc 486 <210> 18 <211> 606 <212> DNA <213> Artificial Sequence <220> <223> Probable RNA helicase SDE3 <400> 18 atcatggacg agggtgctca gtctcgagag ccagaggctc tagcagcact ggtgctggct 60 gatgtagaca cctgcatcat aatagcaggg gaccaccagc aggttggtcc tcaagtagca 120 gtgtacaaca aggtggccag agaggaaggt cttggcacat ctctgcttga gcgcctcttc 180 tcaatctaca aaagtatcaa tgccaaacat tcctccactc tactgaccaa ctatcgctgc 240 caccccagta tcctgatgct ggcctccagc ctcttctatg agtgcactct gctcagcagg 300 agcgacagca aggctctccc ttcggctcct ttccccattg tgttccagtg cagctcattt 360 gacagggaat gcttcgccaa ttcccctgct gaggacgtgg aggaggctga gattcttgtc 420 agcaaaatgc ttgatttcat tcagagtgac tggccaaaaa gtgagaaaca gacgtccatt 480 gggctcctgg ctagtacccg aaaacagacg tcatgcttga aaaggtgctt tcttcaagag 540 tgtcaaagga gaaggtgtca ccaaataacc tcccttgcca tgtggagacc attccaactt 600 acttaa 606 <210> 19 <211> 345 <212> DNA <213> Artificial Sequence <220> <223> Putative L-asparaginase <400> 19 atgggaccag cagccgcaat gtacgtgggc tttgaatcta ctgtgagccg taaagatgcc 60 aagctcctaa gtatagttac tatgcaccat ccactctggc cttggattgc tgatcagctc 120 attaaggacg ttaacccgga aaacccgtat tacagttggt tcaaagacaa caagcctgac 180 gcaaatcaca aaagccactt ggaacagttt gttcatcgct tcttcaaacc agaggataaa 240 gacaagtccc ttcccatttt ccaccaaggg ttggttaatg agctcaactt cttcaacgat 300 gcctgcggtg aacctctgta ttatggaaaa tcagtttata tttag 345 <210> 20 <211> 180 <212> DNA <213> Artificial Sequence <220> <223> Myosin essential light chain, striated adductor muscle <400> 20 gaaggtcaag gctatgtctc caaggctgag gttatccaca tgctcacttg catgggtgag 60 cgttgttctg attcatcaat tgaccagatc tttaagatga cggacaccac tgaagacttg 120 gatggaaaca ttaagtatga agattttatc aagaaggtga tggctggtgg tggtaactaa 180                                                                          180 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Protein phosphatase 1 regulatory subunit 3D F <400> 21 tgggcgaaac atttacttcc 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Protein phosphatase 1 regulatory subunit 3D R <400> 22 tcccaatcat ccagtgtgaa 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Aquaporin AQPcic F <400> 23 tttactgtat gcgccagcac 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Aquaporin AQPcic R <400> 24 tacacccaat gatgcttcca 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Protein phosphatase 1 regulatory subunit 12C F <400> 25 atggacgttt cctccacaag 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Protein phosphatase 1 regulatory subunit 12C R <400> 26 atggcgtcca gatcaaactc 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myosin-2 essential light chain F <400> 27 ggcaaagtgg aatcctcaaa 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myosin-2 essential light chain R <400> 28 cgctgtcgaa gacacgtaaa 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cadherin EGF LAG seven-pass G-type receptor 2 F <400> 29 agtgttcacg caaacaccag 20 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Cadherin EGF LAG seven-pass G-type receptor 2 R <400> 30 actccaatcg catcagcac 19 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myosin light chain kinase family member 4 F <400> 31 tttgcgttag caaagacagc 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myosin light chain kinase family member 4 R <400> 32 ccgacactcc acatgtctgt 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Alcohol dehydrogenase [NADP (+)] A F <400> 33 ggcacccata ctttcctcaa 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Alcohol dehydrogenase [NADP (+)] A R <400> 34 ttttgggagg actggaacac 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Actin F <400> 35 tcaaaatcat tgctccacca 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Actin R <400> 36 ttcagccttg ctaatccaca 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Microtubule-associated serine / threonine-protein kinase 1 F <400> 37 agaaggcgga gttcattcct 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Microtubule-associated serine / threonine-protein kinase 1 R <400> 38 atgctgctcc aacatgactg 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> DNA-directed RNA polymerases I, II, and III subunit RPABC5 F <400> 39 ttgctcacac caccatgatt 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> DNA-directed RNA polymerases I, II, and III subunit RPABC5 R <400> 40 aatcaggtcc acatgggaaa 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Solute carrier organic anion transporter family member 4A1 F <400> 41 cctgcaattg gctttttgat 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Solute carrier organic anion transporter family member 4A1 R <400> 42 agcaagcaat ggaaggctaa 20 <210> 43 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Melanotransferrin F <400> 43 atgcgagtat tcattttcct taca 24 <210> 44 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Melanotransferrin R <400> 44 aaggtaatca gtccaatctg acaa 24 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA-directed RNA polymerase II subunit RPB3 F <400> 45 ttgggtgcaa attgagaaca 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA-directed RNA polymerase II subunit RPB3 R <400> 46 ttgatcatcc gagcatttga 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Protein phosphatase 1K F <400> 47 cgatgcagta tggctcaaaa 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Protein phosphatase 1K R <400> 48 tttcctttgt gccagtgaga 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synaptotagmin-14 F <400> 49 cgtccacaga agacagcaaa 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synaptotagmin-14 R <400> 50 tcgataacgt gtcgcttcag 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ATP-dependent RNA helicase DDX60-like F <400> 51 gagcgtattc gacgcctaaa 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ATP-dependent RNA helicase DDX60-like R <400> 52 ctcctccagg gaacaactga 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Receptor-type tyrosine-protein phosphatase gamma F <400> 53 ggaagacttc aaggctcacg 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Receptor-type tyrosine-protein phosphatase gamma R <400> 54 cgactgtggt caaatgctgt 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RNA helicase SDE3 F <400> 55 tccagtgcag ctcatttgac 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RNA helicase SDE3 R <400> 56 cacatggcaa gggaggttat 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> L-asparaginase F <400> 57 caatgtacgt gggctttgaa 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> L-asparaginase R <400> 58 gtggaaaatg ggaagggact 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myosin essential light chain, striated adductor muscle F <400> 59 ggctatgtct ccaaggctga 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myosin essential light chain, striated adductor muscle R <400> 60 ccagccatca ccttcttgat 20

Claims (12)

A microarray for confirming whether or not the oligonucleotide of the nucleic acid sequence of all of the following genes or its complementary strand molecule is accumulated in the acidified sea water of the foam diclofenac:
A protein described in SEQ ID NO: 1 (protein phosphatase 1 regulatory subunit 3D), a gene described in SEQ ID NO: 2 (aquaporin AQPcic), a gene described in SEQ ID NO: 3 (protein phosphatase 1 regulatory subunit 12C) Myosin-2 essential light chain, the cadherin EGF LAG seven-pass G-type receptor 2, the gene described in SEQ ID NO: 6 (myosin light chain kinase family member 4) 7, the gene described in SEQ ID NO: 8, the gene described in SEQ ID NO: 9 (microtubule-associated serine / threonine-protein kinase 1) (DNA-directed RNA polymerases I, II, and III subunit RPABC5), a gene described in SEQ ID NO: 11 (a solute carrier organic anion transporter family member 4A1), a gene described in SEQ ID NO: 12 (melanotransferrin) SEQ ID NO: 13, a gene described in SEQ ID NO: 14 (protein phosphatase 1K), a gene described in SEQ ID NO: 15 (synaptotagmin-14), a gene described in SEQ ID NO: 16 (DNA-directed RNA polymerase II subunit RPB3) ATP-dependent RNA helicase DDX60-like, a receptor-type tyrosine-protein phosphatase gamma, a gene described in SEQ ID NO: 18 (RNA helicase SDE3), a gene described in SEQ ID NO: 19 -asparaginase) and the gene described in SEQ ID NO: 20 (myosin essential light chain, striated adductor muscle).
The microarray according to claim 1, wherein the gene is derived from Alveopora japonica , and the microarray for confirming exposure to acidified sea water.
The microarray according to claim 1, wherein the acidified sea water has a pH of 6 to 7.7.
1) separating the RNA from the bubble dicorn lake, which is an experimental group exposed to acidified sea water, and the control bubble dicor, respectively;
2) labeling the experimental group and the control group with different fluorescent materials while synthesizing cDNA from the separated RNA of step 1);
3) hybridizing the cDNA labeled with each of the different fluorescent substances of step 2) with the microarray of claim 1;
4) analyzing the reacted microarray; And
5) A method for confirming exposure to acidified sea water of a foam dodecane containing the step of comparing the degree of gene expression integrated in the microarray of claim 1 with the control group.
5. The method according to claim 4, wherein the fluorescent material of step 2) is at least one selected from the group consisting of Cy3, Cy5, FITC, RITC and rhodamine.
1) separating the RNA from the bubble dicorn lake, which is an experimental group exposed to acidified sea water, and the control bubble dicor, respectively;
2) Performing real-time RT-PCR using the RNA of step 1) using primer pairs complementary to each of the following genes and capable of gene amplification:
A protein described in SEQ ID NO: 1 (protein phosphatase 1 regulatory subunit 3D), a gene described in SEQ ID NO: 2 (aquaporin AQPcic), a gene described in SEQ ID NO: 3 (protein phosphatase 1 regulatory subunit 12C) Myosin-2 essential light chain, the cadherin EGF LAG seven-pass G-type receptor 2, the gene described in SEQ ID NO: 6 (myosin light chain kinase family member 4) 7, the gene described in SEQ ID NO: 8, the gene described in SEQ ID NO: 9 (microtubule-associated serine / threonine-protein kinase 1) (DNA-directed RNA polymerases I, II, and III subunit RPABC5), a gene described in SEQ ID NO: 11 (a solute carrier organic anion transporter family member 4A1), a gene described in SEQ ID NO: 12 (melanotransferrin) SEQ ID NO: 13, a gene described in SEQ ID NO: 14 (protein phosphatase 1K), a gene described in SEQ ID NO: 15 (synaptotagmin-14), a gene described in SEQ ID NO: 16 (DNA-directed RNA polymerase II subunit RPB3) ATP-dependent RNA helicase DDX60-like, a receptor-type tyrosine-protein phosphatase gamma, a gene described in SEQ ID NO: 18 (RNA helicase SDE3), a gene described in SEQ ID NO: 19 -asparaginase) and the gene described in SEQ ID NO: 20 (myosin essential light chain, striated adductor muscle); And
3) comparing the gene product of step 2) with the control group to confirm the degree of expression.
A kit for determining exposure to acidified sea water of a foam dodecane containing the microarray of claim 1.
8. The kit according to claim 7, wherein the acidified sea water has a pH of 6 to 7.7.
The kit according to claim 7, further comprising at least one fluorescent substance selected from the group consisting of a streptavidin-alkaline dephosphorylase conjugate, a chemiluminescent substance, and a chemiluminescent substance, .
The method according to claim 7, wherein the buffer solution used for hybridization, the reverse transcriptase for synthesizing cDNA from RNA, dNTP and rNTP (pre-mixed or separate feed type), marker reagent and wash buffer solution A kit for detecting exposure to acidified sea water, further comprising a reaction reagent.
A kit for confirming exposure to acidified sea water of a foam dodecane containing all pairs of primers complementary to each of the following genes and capable of amplifying the gene:
A protein described in SEQ ID NO: 1 (protein phosphatase 1 regulatory subunit 3D), a gene described in SEQ ID NO: 2 (aquaporin AQPcic), a gene described in SEQ ID NO: 3 (protein phosphatase 1 regulatory subunit 12C) Myosin-2 essential light chain, the cadherin EGF LAG seven-pass G-type receptor 2, the gene described in SEQ ID NO: 6 (myosin light chain kinase family member 4) 7, the gene described in SEQ ID NO: 8, the gene described in SEQ ID NO: 9 (microtubule-associated serine / threonine-protein kinase 1) (DNA-directed RNA polymerases I, II, and III subunit RPABC5), a gene described in SEQ ID NO: 11 (a solute carrier organic anion transporter family member 4A1), a gene described in SEQ ID NO: 12 (melanotransferrin) SEQ ID NO: 13, a gene described in SEQ ID NO: 14 (protein phosphatase 1K), a gene described in SEQ ID NO: 15 (synaptotagmin-14), a gene described in SEQ ID NO: 16 (DNA-directed RNA polymerase II subunit RPB3) ATP-dependent RNA helicase DDX60-like, a receptor-type tyrosine-protein phosphatase gamma, a gene described in SEQ ID NO: 18 (RNA helicase SDE3), a gene described in SEQ ID NO: 19 -asparaginase) and the gene described in SEQ ID NO: 20 (myosin essential light chain, striated adductor muscle).
12. The kit according to claim 11, wherein the acidified sea water has a pH of 6 to 7.7.

Images