KR101888797B1 - Ocean Acidification responsive genes in Dendronephthya gigantea and the method for diagnosing marine ecosystem using the same - Google Patents

Abstract

The present invention relates to a gene derived from Dendronephthya gigantea corresponding to a change in acidity of seawater and a method for diagnosing a marine ecosystem using the same. Particularly, Therefore, they can be usefully used as microarrays and kits which can confirm exposure to acidified sea water by changing the acidity of seawater by using them as biomarkers.

Description

[Ocean Acidification responsive genes in Dendronephthya gigantea and the method for diagnosing marine ecosystem using the same}

The present invention relates to a Dendronephthya gigantea gene corresponding to ocean acidification and a method for diagnosing acidification of marine ecosystems using the same.

Since the Industrial Revolution, the concentration of carbon dioxide in the atmosphere has increased by more than 100 ppm due to human activities, and the ocean is playing a very important carbon dioxide sink, absorbing about a quarter of the additional carbon dioxide released into the atmosphere. Carbon dioxide absorbed into the ocean _{forms carbonic acid (H 2} CO ₃ ) in sea water, and the additionally absorbed carbon dioxide increases the acidity of sea water.

When the acidity (hydrogen ion concentration) of seawater increases due to ocean acidification, the concentration of carbonate ions (CO ₃ ^2- ) decreases, which has a great influence on marine organisms composed of a carbonic acid skeleton. In the future, if the concentration of carbonate ions in the surface seawater continues to decrease due to ocean acidification and reaches a state of carbonate unsaturation, species using the carbonate skeleton may no longer sustain life activities and may become extinct.

The effect of acidification of marine organisms in the entire ocean has been detected in various ways, and it is predicted that if this trend goes along, corals will disappear due to acidification in tropical oceans within a few centuries, and the formation of skeletons of calcified organisms will be difficult in most polar seas.

In the past year, the amount of carbon dioxide emitted by humans was 31.6 billion tons, an increase of about 1 billion tons compared to 2010, and when the amount of carbon dioxide exceeds the critical point of the ecosystem, the ecosystem will bring about a serious change that cannot be returned. Recently, it has been reported that the East Sea of Korea also undergoes rapid acidification after the Industrial Revolution. This suggests that marine acidification is progressing seriously in the coastal waters of Korea, and this suggests that the habitat of biota based on calcium carbonate may decrease in the future. Therefore, it is urgent to develop a biological forecasting system that can detect ecosystem changes in advance on a regional scale.

Corals are used as a habitat for various marine organisms and play a role like a cradle, but species diversity and populations are rapidly decreasing due to the increase in sea water temperature and acidification due to climate change, and habitat destruction due to human interference is rapidly progressing. Therefore, a research approach at the molecular biological level is needed along with ecological monitoring to conserve corals.

In terms of taxonomically, the large resin manscabin (scientific name: Dendronephthya gigantea ) belongs to the family of decapitated animals, coral reefs, sea snails, and club sea snails. It is mainly found in the subtidal zone of rock around 5 m deep, and prefers to live in a place with a somewhat strong current. Colonies of various colors such as purple, red, and pink are found due to many variations in color of colonies, and when they grow, they can reach a maximum height of 30cm or more, playing a large role in maintaining marine biodiversity along the coast. This coral species is designated as a legally managed animal by the Ministry of Environment's notification list (notified species), and is a biological resource subject to approval for overseas export.

Research on corals in Korea started with taxonomic studies in the 1970s, followed by studies on systemic evolution, symbiosis, life history, propagation, and conservation, but studies related to ocean acidification and climate change are still in the beginning.

The method of evaluating the health of the ecosystem using changes in gene expression diagnoses the reaction in organisms to external environmental stress at the molecular level by substituting a genomic technology that is developing at a very fast pace through the application of molecular biology technology to various factors of change in the environment. This is a method of evaluating risk or health.

Existing methods (mutation, behavioral abnormalities, mortality, enzyme activity, etc.) that use organisms to determine whether they are harmful are methods of measuring the results of organisms already exposed to stress substances. It has a weakness that it can be measured only at a fairly high level. On the other hand, the evaluation method using the change in gene expression is a method of evaluating the stress level that an organism is receiving by using the change that appears in the transcriptional level, where the gene information passes to the protein after receiving an external stimulus, and detects even a very small external stimulus. Since it has the advantage of being able to produce a small amount of environmental changes or long-term exposure to external stimuli, it can predict the results of the bioreaction. The genetic biomarkers used in the evaluation method using such gene expression changes can tell the existence and association of external stimuli through their specificity, and the long-term effects of various environmental changes in the ecosystem and the health of living organisms in the environment. It has the advantage of enabling evaluation, but until now, there is no known method for determining the degree of ocean acidification using a large resin cockscomb.

Accordingly, the present inventors investigated the change in the expression level of a specific gene due to ocean acidification in the large resin mansrel, which plays a large role in maintaining marine biodiversity, while discovering a biomarker capable of detecting ocean acidification. The present invention was completed by confirming that it is possible to determine the degree of marine acidification and health diagnosis of the mandrel, using the gene.

An object of the present invention is to provide a gene derived from Dendronephthya gigantea corresponding to ocean acidification, and a method for confirming whether or not the marine ecosystem is acidified using the same, or a method for diagnosing environmental changes in marine ecosystems.

In order to achieve the above object, the present invention provides a microarray for confirming exposure to acidified seawater in which an oligonucleotide of a nucleic acid sequence of one or more genes selected from the following group or its complementary strand molecules are integrated do:

The gene shown in SEQ ID NO: 1 (Acetyl-CoA hydrolase), the gene shown in SEQ ID NO: 2 (L-Asparaginase), the gene shown in SEQ ID NO: 3 (Cadherin EGF LAG seven-pass G-type receptor), SEQ ID NO: 4 The gene described by (Calpain small subunit 1), the gene described by SEQ ID NO: 5 (DNA-directed RNA polymerase III subunit), the gene described by SEQ ID NO: 6 (Dynactin subunit 1), the gene described by SEQ ID NO: 7 (FAD -dependent oxidoreductase), the gene shown in SEQ ID NO: 8 (Ficolin), the gene shown in SEQ ID NO: 9 (Myosin light polypeptide 6), the gene shown in SEQ ID NO: 10 (Phosphoenolpyruvate carboxykinase), the gene shown in SEQ ID NO: 11 ( Phosphoserine aminotransferase), the gene shown in SEQ ID NO: 12 (polyketide synthase), the gene shown in SEQ ID NO: 13 (Protein phosphatase 1 regulatory subunit 12A), the gene shown in SEQ ID NO: 14 (Pyrroline-5-carboxylate reductase), SEQ ID NO The gene of 15 (Transferrin receptor protein 2), the gene of SEQ ID NO: 16 (Alcohol dehydrogenase 1), the gene of SEQ ID NO: 17 (Aquaporin TIP2-3), the gene of SEQ ID NO: 18 (Deoxyribose-phosphate aldolase), a gene represented by SEQ ID NO: 19 (Guanidinoacetate N-methyltransferase) or a gene represented by SEQ ID NO: 20 (Protein tyrosine phosphatase type IV A3).

In addition, the present invention provides a method for confirming exposure to acidified seawater comprising the following steps:

1) separating RNA from each of the experimental group Dendronephthya gigantea and the control group, Dendronephthya gigantea, exposed to acidified seawater;

2) labeling the experimental group and the control group with different fluorescent substances while synthesizing cDNA from RNA of the experimental group and the control group of step 1);

3) hybridizing the cDNAs labeled with different fluorescent materials in step 2) with the microarray of the present invention;

4) analyzing the reacted microarray; And

5) Checking the level of expression of the genes accumulated in the microarray of the present invention from the analyzed data compared with the control group.

In addition, the present invention provides a kit for confirming exposure to acidified seawater comprising the microarray according to the present invention.

In addition, the present invention provides a kit for confirming exposure to acidified seawater comprising a primer pair that is complementary to each gene and capable of gene amplification for the genes according to the present invention.

The present invention relates to a gene derived from Dendronephthya gigantea corresponding to changes in seawater acidity and a marine ecosystem diagnosis method using the same. Since they show a change in expression, they can be usefully used as microarrays and kits that can confirm exposure to acidified seawater due to changes in the acidity of seawater by using them as biomarkers.

1 is a diagram showing a group of common genes among genes differentially expressed more than twice as a result of microarray experiments in a control group (pH 8.0) and an experimental group (pH 6.5, 7.0, and 7.5).

Hereinafter, the present invention will be described in detail.

The present inventors discovered a gene derived from Dendronephthya gigantea whose expression changes in response to acidified seawater. Therefore, the microarray in which the gene derived from the mandrel cockscomb, whose expression level changes in response to the change in the acidity of seawater, can be used for detecting whether acidified seawater is exposed and diagnosing the health status of marine ecosystems.

The present invention provides a microarray for confirming exposure to acidified seawater in which an oligonucleotide of a nucleic acid sequence of one or more genes selected from the following group or its complementary strand molecules are integrated:

The gene shown in SEQ ID NO: 1 (Acetyl-CoA hydrolase), the gene shown in SEQ ID NO: 2 (L-Asparaginase), the gene shown in SEQ ID NO: 3 (Cadherin EGF LAG seven-pass G-type receptor), SEQ ID NO: 4 The gene described by (Calpain small subunit 1), the gene described by SEQ ID NO: 5 (DNA-directed RNA polymerase III subunit), the gene described by SEQ ID NO: 6 (Dynactin subunit 1), the gene described by SEQ ID NO: 7 (FAD -dependent oxidoreductase), the gene shown in SEQ ID NO: 8 (Ficolin), the gene shown in SEQ ID NO: 9 (Myosin light polypeptide 6), the gene shown in SEQ ID NO: 10 (Phosphoenolpyruvate carboxykinase), the gene shown in SEQ ID NO: 11 ( Phosphoserine aminotransferase), the gene shown in SEQ ID NO: 12 (polyketide synthase), the gene shown in SEQ ID NO: 13 (Protein phosphatase 1 regulatory subunit 12A), the gene shown in SEQ ID NO: 14 (Pyrroline-5-carboxylate reductase), SEQ ID NO The gene of 15 (Transferrin receptor protein 2), the gene of SEQ ID NO: 16 (Alcohol dehydrogenase 1), the gene of SEQ ID NO: 17 (Aquaporin TIP2-3), the gene of SEQ ID NO: 18 (Deoxyribose-phosphate aldolase), a gene represented by SEQ ID NO: 19 (Guanidinoacetate N-methyltransferase) or a gene represented by SEQ ID NO: 20 (Protein tyrosine phosphatase type IV A3).

It is preferable that the said gene is derived from a soft coral, and it is more preferable that it is derived from a large resinous cockscomb.

The acidified seawater is preferably pH 6 to 7.7, more preferably pH 6.5 to 7.5, but is not limited thereto.

In addition, the present invention provides a method for confirming exposure to acidified seawater comprising the following steps:

1) separating RNA from the large resinous cockscomb, the experimental group and the large resinous cockscomb, the control group exposed to acidified seawater;

2) labeling the experimental group and the control group with different fluorescent substances while synthesizing cDNA from RNA of the experimental group and the control group of step 1);

3) hybridizing the cDNAs labeled with different fluorescent materials in step 2) with the microarray of the present invention;

4) analyzing the reacted microarray; And

5) Checking the level of expression of the genes accumulated in the microarray of the present invention from the analyzed data compared with the control group.

The fluorescent material of step 2) is Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (rhodamine-B- It is preferably selected from the group consisting of isothiocyanate, RITC) and rhodamine, but is not limited thereto.

In addition, the present invention provides a method for confirming exposure to acidified seawater comprising the following steps:

1) separating RNA from the large resinous cockscomb, the experimental group and the large resinous cockscomb, the control group exposed to acidified seawater;

2) Using the RNA of step 1) as a template, and performing a real-time reverse transcript polymerase chain reaction (RT-PCR) using a primer pair that is complementary to each of the following genes and capable of gene amplification:

The gene shown in SEQ ID NO: 1 (Acetyl-CoA hydrolase), the gene shown in SEQ ID NO: 2 (L-Asparaginase), the gene shown in SEQ ID NO: 3 (Cadherin EGF LAG seven-pass G-type receptor), SEQ ID NO: 4 The gene described by (Calpain small subunit 1), the gene described by SEQ ID NO: 5 (DNA-directed RNA polymerase III subunit), the gene described by SEQ ID NO: 6 (Dynactin subunit 1), the gene described by SEQ ID NO: 7 (FAD -dependent oxidoreductase), the gene shown in SEQ ID NO: 8 (Ficolin), the gene shown in SEQ ID NO: 9 (Myosin light polypeptide 6), the gene shown in SEQ ID NO: 10 (Phosphoenolpyruvate carboxykinase), the gene shown in SEQ ID NO: 11 ( Phosphoserine aminotransferase), the gene shown in SEQ ID NO: 12 (polyketide synthase), the gene shown in SEQ ID NO: 13 (Protein phosphatase 1 regulatory subunit 12A), the gene shown in SEQ ID NO: 14 (Pyrroline-5-carboxylate reductase), SEQ ID NO The gene of 15 (Transferrin receptor protein 2), the gene of SEQ ID NO: 16 (Alcohol dehydrogenase 1), the gene of SEQ ID NO: 17 (Aquaporin TIP2-3), the gene of SEQ ID NO: 18 (Deoxyribose-phosphate aldolase), a gene represented by SEQ ID NO: 19 (Guanidinoacetate N-methyltransferase) or a gene represented by SEQ ID NO: 20 (Protein tyrosine phosphatase type IV A3); And

3) Checking the level of expression by comparing the gene product of step 2) with a control.

The genes represented by SEQ ID NO: 1 to SEQ ID NO: 15 are compared with the control, the expression increases, and the genes represented by SEQ ID NO: 16 to SEQ ID NO: 20 are reduced in expression compared to the control.

In addition, the present invention provides a kit for confirming exposure to acidified seawater comprising the microarray according to the present invention.

The acidified seawater is preferably pH 6 to 7.7, more preferably pH 6.5 to 7.5, but is not limited thereto.

In addition, the kit further comprises any one selected from the group of fluorescent substances consisting of streptavidin-like phosphatase conjugate, chemifluorescent and chemiluminescent. It is preferable but is not limited thereto.

In addition, the kit is any selected from the group of reaction reagents consisting of a buffer solution used for hybridization, a reverse transcriptase for synthesizing cDNA from RNA, dNTP and rNTP (pre-mixed or separately supplied type), a labeling reagent, and a washing buffer solution. It is preferable to additionally include one, but is not limited thereto.

In addition, the present invention provides a kit for confirming exposure to acidified seawater comprising a pair of primers that are complementary to each of the following genes and capable of amplifying the gene:

The gene shown in SEQ ID NO: 1 (Acetyl-CoA hydrolase), the gene shown in SEQ ID NO: 2 (L-Asparaginase), the gene shown in SEQ ID NO: 3 (Cadherin EGF LAG seven-pass G-type receptor), SEQ ID NO: 4 The gene described by (Calpain small subunit 1), the gene described by SEQ ID NO: 5 (DNA-directed RNA polymerase III subunit), the gene described by SEQ ID NO: 6 (Dynactin subunit 1), the gene described by SEQ ID NO: 7 (FAD -dependent oxidoreductase), the gene shown in SEQ ID NO: 8 (Ficolin), the gene shown in SEQ ID NO: 9 (Myosin light polypeptide 6), the gene shown in SEQ ID NO: 10 (Phosphoenolpyruvate carboxykinase), the gene shown in SEQ ID NO: 11 ( Phosphoserine aminotransferase), the gene shown in SEQ ID NO: 12 (polyketide synthase), the gene shown in SEQ ID NO: 13 (Protein phosphatase 1 regulatory subunit 12A), the gene shown in SEQ ID NO: 14 (Pyrroline-5-carboxylate reductase), SEQ ID NO The gene of 15 (Transferrin receptor protein 2), the gene of SEQ ID NO: 16 (Alcohol dehydrogenase 1), the gene of SEQ ID NO: 17 (Aquaporin TIP2-3), the gene of SEQ ID NO: 18 (Deoxyribose-phosphate aldolase), a gene represented by SEQ ID NO: 19 (Guanidinoacetate N-methyltransferase) or a gene represented by SEQ ID NO: 20 (Protein tyrosine phosphatase type IV A3).

The primer is preferably at least one selected from the group consisting of SEQ ID NO: 21 to SEQ ID NO: 60.

The acidified seawater is preferably pH 6 to 7.7, more preferably pH 6.5 to 7.5, but is not limited thereto.

In a specific embodiment of the present invention, in order to discover a gene derived from a cockscomb in response to changes in the acidity of seawater, after culturing the cockscomb in seawater at various pHs, cDNA derived from the cultivated cockscomb is synthesized. Genes with varying expression levels were examined. Specifically, after each mRNA was isolated from the tissues of the cockscomb cultivated at pH 6.5, pH 7.0 and pH 7.5, cDNA was synthesized using this as a template. After the synthesized cDNA was fluorescently labeled with Cy3-CTP and Cy5-CTP, a microarray was prepared using the same. The prepared microarray was scanned using an Axon GenePix 4000B scanner (Axon Instrument, USA) and then analyzed. As a result, 15 types of genes with increasing expression levels (see Table 1) and 5 types of decreasing genes (see Table 2) were identified in the experimental group based on the control group. In addition, common genes were grouped among the genes that were differentially expressed more than two times in the experimental group (see FIG. 1). Climate change causes changes in the acidity of seawater, and changes in the environment cause changes in physiology and metabolism of marine life. Therefore, it can be used as a biomarker that can confirm the stress and health status according to changes in the external environment by checking the change in the expression level of the gene derived from a marine organism, the mandrel.

Therefore, the genes can be usefully used as microarrays and kits for confirming exposure to acidified seawater according to changes in the acidity of seawater.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

<Example 1> Large resin cockscomb ( Dendronephthya gigantea ) Culture and exposure to acidified seawater

<1-1> Cultivation of large resin cockscomb

The inventors of the present inventors took a sample of a cockscomb snail from the coastal waters of Jeju and cultured it in a laboratory.

Specifically, the large resin cockscomb collected from the coast of Jeju was cultured in natural seawater that passed through three types of filters of 100, 10 and 1 µm. At this time, the water temperature was fixed at 24° C. using an underwater heater and purified for at least 1 week, and the photoperiod was adjusted to 14:10.

<1-2> Exposure to acidified seawater

The large resinous cockscomb cultured by the method of Example <1-1> was exposed to acidified seawater.

Specifically, large resinous mandrel was divided into three groups and cultured in seawater at pH 7.5, pH 7.0, and pH 6.5 for 48 hours, and the control group was cultured in natural seawater (pH 8.0) for 48 hours. In addition, the gene candidate group for the pink sea squirrels of the family Blackfish family was selected through a microarray experiment after exposure to acidified seawater, and the gene sequences corresponding to the acidification exposure were compared with the gene sequences of the large resinous mandrel.

<Example 2> Measurement of genetic changes in the resinous cockscomb by acidification

<2-1> RNA isolation from large resinous cockscomb

RNA was isolated according to the method developed by the present inventors in order to measure the genetic change of the cockscomb exposed to the acidified seawater by the method of Example <1-2>.

Specifically, the large resin cockscomb tissues of the experimental group and the control group were made into powder using liquid nitrogen in a mortar, and a lysis solution [35 mM EDTA, 0.7 M LiCl, 7% SDS, 200 mM Tris-Cl (pH 9.0)] 700 µl was added and homogenized. An equal amount of phenol solution was added to the homogenized sample, mixed well, centrifuged for 10 minutes, the supernatant was taken and transferred to a new tube, and 1/3 of the total volume of 8 M lithium chloride (LiCl) was added and mixed well. After that, it was left at 4° C. for 2 hours or more. The left sample was centrifuged for about 30 minutes to remove the supernatant, and the precipitate was taken and dissolved in 300 µl of DEPC-treated water, and 1/10 volume of 3 M sodium acetate (pH 5.2) and the same amount of isopropanol were added. Then, after centrifugation for about 30 minutes, the supernatant was removed and the precipitate was taken. 50 µl of a 70% ethanol solution was added to the precipitate and centrifuged for 5 minutes, the ethanol solution was removed, and the precipitated RNA was dried, and the dried RNA was dissolved in an appropriate amount of DEPC-treated water.

<2-2> Synthesis of cDNA

CDNA was synthesized from the large resinous cockscomb RNA isolated by the method of Example <2-1>.

Specifically, Tri-reagent (Molecular Research Center Inc., USA) was used to isolate a specific gene corresponding to acidified seawater. The extracted total mRNA (3.0 μg) was used as a template, and cDNA of the control group and the experimental group was synthesized using reverse transcriptase.

<2-3> cDNA sequencing

The cDNA synthesized in Example <2-2> was directly subjected to nucleotide sequence sequencing using the next-generation sequencing technique, and the obtained nucleotide sequence portion was aligned to obtain a full map of the expression body using the control genome. .

Specifically, poly(A) RNA was obtained, and the first strand was synthesized using oligo(dT) or random hexamer. Then, a second strand complementary from the first strand was obtained, and cDNA synthesis was completed. The DNA double strand was partially cut, deoxyadenine base was added to the 3'end, conjugated using an illumina adapter, amplified by PCR, and then the amplified products were selected for each size, followed by sequencing.

<2-4> Hybridization and scanning

The present inventors prepared a large resin cockscomb cDNA microarray, hybridized and scanned.

Specifically, 1-2 μg of cDNA was prepared in the experimental group and the control group, dissolved in 0.1 M sodium bicarbonate buffer (pH 8.7), mixed with 40 nm of Cy3 and Cy5 fluorescent materials, and placed in the dark for 90 minutes. Left unattended. After 90 minutes, 15 µl of 4 M hydroxylamine was added and left in the dark for 15 minutes. The fluorescent substance-labeled cDNA sample of the cockscomb was purified using a PCR purification kit (Qiagen, Germany), and eluted with distilled water. After adding the purified fluorescent-labeled-cDNA sample to a hybridization buffer [3x SSC, 0.3% SDS, 50% formamide, 20 µg Cot-1 DNA, 20 µg yeast tRNA], microcon YM- Concentrated to 30 to make a hybridization mixture. The hybridization mixture was denatured by heating at 95° C. for 3 minutes, and centrifuged at 12,000 g for 30 seconds to reduce the temperature of the heated hybridization compound. Coverslip was covered on the prepared large resin mandrel cDNA microarray, and the denatured hybridization mixture was pipetted. The microarray was placed in a GT-Hyb chamber and reacted at 65° C. for 16 hours. After the hybridization was completed, the microarray was removed from the chamber to perform a washing process, and the microarray was rotated and dried, and then stored in a dark room until scanning. The large resin mandrel microarray of which the experiment was completed was scanned using an Axon GenePix 4000B scanner (Axon Instrument, USA). In the GenePix Pro 6.0 program, each point from the scanned image is gridd using a gridding file, quantified, and analyzed values such as Cy5/Cy3 intensity and ratio of each point are included. Obtained the GPR file (GPR file).

<2-4> Microarray data analysis

From the GPR file obtained in the GenePix Pro 6.0 program, analysis was performed as follows using GeneSpring 7.3.1 (GeneSpring 7.3.1, Agilent Technologies, USA), an analysis program. Normalization was performed using LOWESS (locally weighted regression scatterplot smoothing), and for reliable genes, the sum of the median values was lower than the background or the standard deviation of each pixel value was significant. The point that was not made was obtained by flag-out. In addition, significant genes were selected for points that showed a difference of 2 times or more in normalized ratio values.

As a result, as shown in Tables 1 and 2, 15 genes (Table 1) and 5 reduced genes (Table 1) significantly increased the expression level in the acidification experimental group (pH 6.5, 7.0, 7.5) compared to the control group (Table 1). 2) was excavated, and a total of 20 genes were described in SEQ ID NOs: 1 to 20. In addition, as shown in Fig. 1, a common gene among the genes differentially expressed by two or more times in the experimental group was grouped (Fig. 1).

List of upregulated genes and amount of change in acidified seawater number gene Change (times) One Acetyl-CoA hydrolase 6.82 2 L-Asparaginase 5.91 3 Cadherin EGF LAG seven-pass G-type receptor 15.34 4 Calpain small subunit 1 20.26 5 DNA-directed RNA polymerase III subunit 18.50 6 Dynactin subunit 1 28.53 7 FAD-dependent oxidoreductase 6.96 8 Ficolin 6.21 9 Myosin light polypeptide 6 5.40 10 Phosphoenolpyruvate carboxykinase 6.97 11 Phosphoserine aminotransferase 6.22 12 polyketide synthase 11.56 13 Protein phosphatase 1 regulatory subunit 12A 4.59 14 Pyrroline-5-carboxylate reductase 6.57 15 transferrin receptor protein 2 7.29

List of downregulated genes and amount of change in acidified seawater number gene Change (times) One Alcohol dehydrogenase I -2.44 2 Aquaporin TIP2-3 -2.26 3 Deoxyribose-phosphate aldolase -2.30 4 Guanidinoacetate N-methyltransferase mRNA -9.30 5 Protein tyrosine phosphatase type IV A3 -11.84

Primers for detection of genes regulated expression in acidified seawater of the present invention and PC R product size number gene primer PCR product size (bp) One Acetyl-CoA hydrolase F-AGATGAAGCATAACCCTCAA (SEQ ID NO: 21)
R-CTTAAGCTGGCAGACTTTTT (SEQ ID NO: 22) 188 2 Alcohol dehydrogenase I F-AAACAAGCCACTCTGAAAGA (SEQ ID NO: 23)
R-CTTTCGGAAATCTTCATCAG (SEQ ID NO: 24) 249 3 Aquaporin TIP2-3 F-AGTCACAGCTTGAAACCACT (SEQ ID NO: 25)
R-CGTATTCTGGTACGCATCTT (SEQ ID NO: 26) 251 4 Cadherin EGF LAG seven-pass G-type receptor F-CAGAGGAATGTTTCTTCGAG (SEQ ID NO: 27)
R-TTGTTGGAGAAGCAGTAGGT (SEQ ID NO: 28) 205 5 Calpain small subunit 1 F-ACGACAAGGACTACAGCATT (SEQ ID NO: 29)
R-CCATAGACCAGCCAGTTTAG (SEQ ID NO: 30) 230 6 Deoxyribose-phosphate aldolase F-AACAAGAGTGCGTTGAAGTT (SEQ ID NO: 31)
R-TGAGATTTTTGTAGGGATGC (SEQ ID NO: 32) 178 7 DNA-directed RNA polymerase III subunit F-CGGACTACTTCAAGACGAAC (SEQ ID NO: 33)
R-CCGTGGTTGAGTGAGTAAGT (SEQ ID NO: 34) 238 8 Dynactin subunit 1 F-AAGAAAGGAAAGCCAGAACT (SEQ ID NO: 35)
R-TGGTGGAGGAGTTAGAAGAA (SEQ ID NO: 36) 220 9 FAD-dependent oxidoreductase F- CGTTTCTTACAGCTCGTTCT (SEQ ID NO: 37)
R-ACTTTTCCACAACAGCAACT (SEQ ID NO: 38) 230 10 Ficolin F-CTACTCCACTTTCGAGTCGT (SEQ ID NO: 39)
R-CTCTTGTGGAACTCCAGATT (SEQ ID NO: 40) 174 11 Guanidinoacetate N-methyltransferase F-ACAGTTCCCTCAATGATTTC (SEQ ID NO: 41)
R-GTTATTGGGTTGATCAGGAA (SEQ ID NO: 42) 200 12 L-Asparaginase F-ATCACTGACCCTCAATGTTC (SEQ ID NO: 43)
R-TTCCCTCAGAGTGTCTGTTC (SEQ ID NO: 44) 295 13 Myosin light polypeptide 6 F-CTGAGTTCCAAGACTCCAAG (SEQ ID NO: 45)
R-AGATCACCTTGCACTGATTC (SEQ ID NO: 46) 174 14 Phosphoenolpyruvate carboxykinase F-ACACCAGGTACAAGATGCTC (SEQ ID NO: 47)
R-CTCCTTCTCCTTGATCTCCT (SEQ ID NO: 48) 203 15 Phosphoserine aminotransferase F-AATATCTTGCATTGGGATTG (SEQ ID NO: 49)
R-CGCAAATTTCTTTCTGTCTT (SEQ ID NO: 50) 199 16 polyketide synthase F-ACACAGCAGAAACAAGAGGT (SEQ ID NO: 51)
R-CATCTTCATTCAACCCAAAT (SEQ ID NO: 52) 213 17 Protein phosphatase 1 regulatory subunit 12A F-AATACCAGTCAGTGGTCAGG (SEQ ID NO: 53)
R-AAGTCTCCAAATGTCTCCAA (SEQ ID NO: 54) 229 18 Protein tyrosine phosphatase type IV A3 F-ATCAAAGCGCAGGAGAAG (SEQ ID NO: 55)
R-GAAGTCCACCCTTTCAGTG (SEQ ID NO: 56) 206 19 Pyrroline-5-carboxylate reductase F-TTTAGCCACTTCAGGACAAT (SEQ ID NO: 57)
R-GTTGTCTGAAATCGGAGTTG (SEQ ID NO: 58) 191 20 transferrin receptor protein 2 F-CCTCGAACACTGAAGGACTA (SEQ ID NO: 59)
R-GGCACTGCTACTGAAGATGT (SEQ ID NO: 60) 214

<110> Office of Reseach/Ewha University-Industry Collaboration Foundation <120> Ocean Acidification responsive genes in Dendronephthya gigantea and the method for diagnosing marine ecosystem using the same <130> 2015P-06-002 <150> KR 10-2015-0121637 <151> 2015-08-28 <160> 60 <170> KopatentIn 2.0 <210> 1 <211> 273 <212> DNA <213> Dendronephthya gigantea <400> 1 ccaatcagat cgctccggcg gcagatgaag cataaccctc aatgcatcgg catgtccgca 60 cagctgcaga gcaagaaaac ttctggagcg acccaagcgg aaagagggtc acgcatcagg 120 tcgtctcacc atgcagagct tctcggcaca tcggccaatc aggaaaacaa ggcacaaagc 180 caatgcttgc aaaaagtctg ccagcttaag catgcaagcg ccagcaagag ctgggtggag 240 tcacgcgcac catcaaagta cagggcgctc tga 273 <210> 2 <211> 478 <212> DNA <213> Dendronephthya gigantea <400> 2 cccaaccccg atattccggt tggcaaggtg ctgggaaata ttgccagcag aggcgtcatg 60 ttcgcgatct gtctcactct ggacaacaga gaccacggat cactgaccct caatgttctc 120 cagggccagc agcaggagca caggaacatg ccggtggatg acgctatgtc attcatctct 180 aaacagtttc ccagcctcgt gggcggagga ggaggtggga actctgtgat atctcgggac 240 gggtcagcac tgccgggccc ctcccacacc ggccatcctc cagacatcag caagatactc 300 agcttcctca cagacgacag acctctctcc atcatggagt atgacaagat gattaaatac 360 ctggtcacca agagaacaga cactctgagg gaagagtacg gagacagcat cccagcccac 420 ctgcagcatc caccagtggg gcctcaccag gatccagcca ccaaggccaa gcaggaag 478 <210> 3 <211> 306 <212> DNA <213> Dendronephthya gigantea <400> 3 gggtgcctgc tggccgtttt gggctgcctc tccctcctgg cgggggcaca cggctacttt 60 atcaccgtgg acgcccatgc agaggaatgt ttcttcgaga aggtgacggc gggtacaaaa 120 ttaggcctgg catttgaggt tgctgaggga ggcttccttg acatagacat caagatctac 180 aaccctgaga tgaagaccat ccatgagggc gagcgcgagt ccaacgggcg gtacaccttc 240 cctgccagca tggacggcgt ctacacctac tgcttctcca acaagatgtc caccatgacg 300 cccaag 306 <210> 4 <211> 369 <212> DNA <213> Dendronephthya gigantea <400> 4 cttaaaattg acgacaagga ctacagcatt accttttcac tttatttcaa tgttcaatgg 60 tccgagccac gtttgaattt gtcccaagag tttttcaaca gtgaaaacat cactactgat 120 gagcagctgg tgccagtgaa tctggagctc attcatgacc tttgggtgcc aaacatttac 180 atatacaacc tgaaatcctt caaagtcatt gatgtcctct ctaaactggc tggtctatgg 240 attaacaaca agaaggaaat ctattatagc caagccactc acatcacctt catttgtcca 300 atgcttttcg actcgtttcc tctggatact caagtctgca agttccaagt tggcagctat 360 tcttacgac 369 <210> 5 <211> 366 <212> DNA <213> Dendronephthya gigantea <400> 5 aggtacaatg cccgcgggtt cgacatcaac cgcaacttcc cggactactt caagacgaac 60 aacaagcgat ctcagccgga gactgaggcg gtgaaggagt ggctgtccaa gatccagttc 120 gtcttgtcgg gcaacatcca cggcggcgcc ctggtggcct cctacccgtt cgacaacacg 180 ccaagctcca tcttcagctc ggtcctctcg tccccctcgc tcaccccgga cgacgacacc 240 ttcaaacacc tggccacaac ttactcactc aaccacggac gcatgtatct tggggacccc 300 tgcaaggttg gcgcgccaca gttcggaaac gggacgacga acggagcggc gtggtacccg 360 ctgact 366 <210> 6 <211> 423 <212> DNA <213> Dendronephthya gigantea <400> 6 atgtcaaagc gtggacgcgg tggtaaagga ggtggaaagt tccacatctc cctcgccctc 60 ccagttgctg ccgttatgaa ctgcgctgat aacactggcg ccaagtctct ctacgtcatc 120 gctgttgccg gcatcaaagg tcgattgaac cgactcccag ccgccggatc aggagatctc 180 gtcatggcct ccgtgaagaa aggaaagcca gaactccgaa agaaggtcca ccccgccgtc 240 gttgtccgac agtccaaggc tttccgaaga cgagacggta ccttcctgta cttcgaagat 300 aacgccggtg ttattgtcaa caacaaggga gaaatgaagg gctctgccgt cactggaccc 360 gtcgcgaagg aatgcgctga tctctggccc cgtatttctt ctaactcctc caccattgcc 420 taa 423 <210> 7 <211> 987 <212> DNA <213> Dendronephthya gigantea <400> 7 cttgtggctc tgacatgtct ctcacggtgg ctgtactggc aagtccacgc gatgtcacta 60 ggttgtgcgg tgggattgca aaggctgcgc tacacatgtg aagctatcgg ggccgagggc 120 tcaatccacg agtccatcga acagttgccg accttcgtgg ctggaccagc ccgacacggc 180 catggcctgg cgttggataa agacatgggc gtttcttaca gctcgttctt gggtgaggca 240 cctccgttga ggccacggca tgcggaaact gcgttcgacc agatgaccat ctacttcaag 300 ccacgcaagg aagcgctggt cgcccaggaa atgaaatgcg acgacgacat ggcttcttgc 360 tctcgcgaat gcgagcgctt atacggagac caagtttcga cgatgatgga accctgcaaa 420 gttgctgttg tggaaaagta tgctggtggc ggaggcggca gctgctttcc tgccaaggcc 480 gccgtctgga accagaacgt tggtcgcatc cgtatctccg acgtgcgcat cggtgacgag 540 cttgagactg gcagcggcaa ctcgtcgccg gttgtcgccc tactgcacgc tgatccggag 600 gcctgggtcg actacgtccg catctcgcat tctgccgggg aagacttgta catttcgcct 660 gcgcatatcc tgcagcttct ttctcgcagt caagggccca cctgggtgcc cgccagcctt 720 gttcgcccag gcgataactt gaagtcctca gcagggccga ccttggtgaa cgctgtggac 780 accgtgcggc tgaaaggcgc atacgcgccc ctgactgact cgggccagct gcttgtggag 840 ggcgtgctct gctcctgtta cgctcccccg cagagctttg agctctcaca caatatctgc 900 cactgggcca tgtttccgct gcgcgtcttt cacgctttga ggggtgtggt ggcgtccgca 960 gctcccgcac gcgttttcgt caccgca 987 <210> 8 <211> 1113 <212> DNA <213> Dendronephthya gigantea <400> 8 cccgtcctga tggaaaatct tcccacggac gcctgcctgc tcgttttcag gatcctcagt 60 gttctcggca tggcgatgcc caagattgcc agcattttcg tcctgggcat cgggactgcg 120 agaacttctc ggttgccaaa tggcgtcgcc gattacacgc taggcctcgt gcagctgcac 180 gcggagaaga ccgacggggc cctggctact gcgttccgca gtgaagatgc gccacagccc 240 gtggacgccg caagcagccc gattttggcg accgcggagg cggacaccaa atcgcagtgg 300 tgtttggctt cacaggcgaa ggcggtggag atgcatcagg aggtacagct gctcctggcg 360 cgaaatcgaa gcccgaacag taccgacgaa agccttatcc acatgaccta ctcgcagctc 420 caggaaggcc cgcagtctcg tatccttgac gaagagcaga tgcttgtgga tatggagtca 480 acggagttca ccgagaagtg cgatttgggc aacgaccttt ggttgctgaa ggacgaggtg 540 aatttcgctt cttgccctcc tgggaagtac ctccgtcatc agaccgcgga ggaccacaag 600 cgcaaacgga tgcgcctgcg gaaggccctg tgccagttga agctgcgcgg cgcacggcca 660 tggaacaagc gcgagcggtc gttcttcagg gcgcggggct actccacttt cgagtcgtcg 720 gtgtggccga agttgcccgg gtgcgcgtcc gtggtcgacg aaagctggta cagtgggcag 780 cacaagagct gggacatgcc cgccttccgc ccggacagcg cgcctccaca catgggcaag 840 ctggtccgcg ggaatctgga gttccacaag agctggaagg tggcatccac tggcttcccc 900 gactacttgc agtgcgagta tgacggcacc tggaaagagg ttccagtcac caaccccgtt 960 gggcagggct ccagtgtggt cttcgccgtg cgggagccta tcgggcgttg gatctccgct 1020 gtgggcgagc tgttggagcg atccatcaac cattggtgcc caaacgggcc ttgcagtaag 1080 caggacggtt tcgacctgat gacgacaatg gat 1113 <210> 9 <211> 372 <212> DNA <213> Dendronephthya gigantea <400> 9 ccacggattg ccctgttcgc tgtttgctcg gcgctcgtgg ttcagctggg catgtcgagc 60 tctcttcgaa cgcaacctgc agtgaaggtt gtggacgccc accagtgcaa agtgatgtgc 120 cagcgctttg cgtaccgctt catgggccct gagttccaag actccaagag ccctacggac 180 tgctccaaga agtgcgaggc agtttacggg ggcgcttcgc caacgagcgc cctggaggtc 240 aaggctgaag tcaccgaccg caaggctgaa gtcaagcaac gcggtgtgga cgtgcatgat 300 gcgaatcagt gcaaggtgat ctgccagcgc ttcggcatgc cgatgcttgg tccggatttt 360 gaaggtatca ag 372 <210> 10 <211> 384 <212> DNA <213> Dendronephthya gigantea <400> 10 ggaggcgggt catgggagga ggactgggag gggatggtga ccagctccgt ggaggcggac 60 accccctgct tcatcctgtt cagactggat gagaaggaca gcgggggatg cttcctgtgg 120 acccttctct cctggtcacc tgacaccagc cacaccaggt acaagatgct ctacgcctcg 180 accaaggcca ccttcaagaa gcagttcggg gcggggcaga tcaaggacga atactacgcc 240 aacctgaagg aggaggtcac cctggcggga tacaagaagc acctgagtgt cgaggcggca 300 cctggccccc tgaccagggc ggaggaggag gccaaggaga tcaaggagaa ggagtcccgg 360 gtcgagatta gcgtggactc caag 384 <210> 11 <211> 341 <212> DNA <213> Dendronephthya gigantea <400> 11 gttaatactt ctcaaggagt accaatatct tgcattggga ttgcacaagt aaaaattgaa 60 ggaaagaatc aagatatgct tgctaatgca tgcatgcagt ttcttggaaa atcagaacat 120 gaaatccaac agattgcact tgaaactctt gaaggccatc aaagagcaat tatgggcaat 180 atgacagtgg aagaaattta ccaagacaga aagaaatttg cgaaagaggt gtttgaagtt 240 gcatcgtctg atcttctgca aatgggaata tatgttgtat catacacact gaaagatgtg 300 acagacaacg aaggatacct tgcagccctt ggaaaaaccc g 341 <210> 12 <211> 372 <212> DNA <213> Dendronephthya gigantea <400> 12 atggccatgg caatgcagaa aaaattgaat gttcgattac ccccagaagt caatcgcata 60 ctttacgtcc ggaatctacc atacaagatt acatcagaag aaatgtatga tatattcggg 120 aaatatggag ccatacgaca aatccgtgtt ggaaacacag cagaaacaag aggtacagct 180 tttgtggtat atgaagatat ttttgatgca aagaatgctt gtgaccacct ttcgggtttt 240 aatgtttgca accgctattt agtagttctt tactatcagc ccacaaaagc cttcaagaag 300 gtagacacag ataaaaagaa agaagaaatc gagaaaatga aggccaaatt tgggttgaat 360 gaagatgaat aa 372 <210> 13 <211> 405 <212> DNA <213> Dendronephthya gigantea <400> 13 atgctgcgaa ctgctgttct cgcatttatc tgcagttgct tggtccagac gacgtacggg 60 gggaccgtcg aagcgaagtt cctttcccgc ggccaacgca gtgaagacga ggtgaagcac 120 gacaccgcgc gccaatacca gtcagtggtc aggcttcacg acaatgctga gaggaggctg 180 accagaatcg tcgtcgagtt gttgggtgtc gacgagtctg aggtcaagcg tgatgcgagc 240 ttcgtggaag accttggcgc tgatgagctg gacacggtgg aactcgtcgt ggcagtgggg 300 gaggagtttg gcttccaaat tccagatgat gacgcggagt cgttggagac atttggagac 360 ttggtcgact acgtgaataa ttacgaacac aacacagtcc gttga 405 <210> 14 <211> 270 <212> DNA <213> Dendronephthya gigantea <400> 14 ggaggactca gccgggaaga tatcatatct ttagccactt caggacaatc gcttggtggc 60 gacatgagtg agctggacga tgctggaact tactttgatc tgggattgcg caaagtgaca 120 atgccgggaa cttatcaata catgtgcacc cggaacaaca acttctcgaa ccggagtcag 180 aaaggaaagc tggtggtcac caactccgat ttcagacaac agagcgttga ccaaaatggc 240 ggcgtcgtgg tcgtctccga cgtcgagtaa 270 <210> 15 <211> 290 <212> DNA <213> Dendronephthya gigantea <400> 15 atggaacgca gcgagagcaa ccagttggag gctgcacctg tcctttgccg ggcgggctgc 60 ggcttctttg gctcctcgaa cactgaagga ctatgttcaa aatgttacaa agaccaattg 120 aagaaaaagc agcaaccccc aaatcaaagc aataatactt cttcatccac tgcaacagca 180 cagccaacag ttccttctat cacaccgcaa ataagcgaaa gctcatccac atctcccacc 240 acatcctcta caactgcatc ggttgccaca tcttcagtag cagtgccaag 290 <210> 16 <211> 426 <212> DNA <213> Dendronephthya gigantea <400> 16 tggagttatt ataattaccc gttggttgtc ggtatgtcta catctctact gaaaaagagt 60 ttagaactct ttgatgaaga gggaaagacg gacagaacca aatcaaacaa aggacgccct 120 gctcgtacca ttgtgaagaa taaacaagcc actctgaaag ataggaaagt gaagtcagca 180 ttagaatcat acacgaagaa gaaccgtaag gaagacagga cacttggaaa tttggctgtt 240 cttgaaaaga tatcgctgaa aaactctgtt agccaagact cggccaacaa aattctgaaa 300 tatcatctgc agaagtctcg gaaagttgtg gaagctgagc caaagaaaga ggccgagaag 360 tctgtgttta ctgatgaaga tttccgaaag ttccagcagg aatattttgt caaaggaaag 420 atataa 426 <210> 17 <211> 1107 <212> DNA <213> Dendronephthya gigantea <400> 17 atgaacggct acggtgtgac cgccgagcag cggtctttgt tgaacagaaa cagtcacagc 60 ttgaaaccac tatccgctgc cggccacctc aacatctggc aggtggtcgt gcaagccatc 120 gtaccgatcc tcatcttctt gttcgcgctc gggatcctga caatcacgcc acgctattcc 180 agccctgact ccgtgtccac gctctgcgcc attggccttt tcggcgcttt gctgtacccc 240 acgatctcct tcctgctggt ggtcgtaggg gttgtgtcaa cgaagatgcg taccagaata 300 cgctggcccc cagtcgtctt ctggtcatgg tggccgtgct ggaagttctc cgcctgctgt 360 ctcgcggcgt ttctgggcat cagcatcggc aactacatct ggtacaagca gctcctgccc 420 taccaccaga tggaccgcct ccaggcatat gacaatgtca acccttccga ggtgaccggc 480 actcggatgc aggacgccgg ggtcgtcgag ttcaagtcca ccaacggtgt ggatcgcaca 540 cggactgggt gcatcaagaa tggtgccacc tactgcatcg cccctgtcgt gctgaatggc 600 aaggtggagc caggtgtggc accaggggag acgtacgact tcttcatggc agggaaggac 660 tgctgcagct gccccggcga gttccgttgt ggcgactgga acatgccgtc gccaactcta 720 ggtgggctgc gaatcgtgga ctcgggcgat cgcgccttct acaggctcgc cgcggagcag 780 tggggcagcc tgtacggcaa gcccgtggag cacccgctgt tcttcacgtg gtcaacggat 840 ccggtggaga cctggcacga aatgcgcacg acagcgacac gtgaggcctg tctggccatg 900 ctcgtggtcc catttttctt gatcacgtac gccttcctcg ctaatggtct gttgggcatc 960 ctccacgatc ggggctacgc ggcgccccaa gaggctccga tgccgcctgc gggcatgggg 1020 cgcgacatga ctgcgaagtt cctgccccag atgcacaagt acacggcaga ctcgcaggct 1080 cagcaggccg gcgcgaccgt gatctga 1107 <210> 18 <211> 1821 <212> DNA <213> Dendronephthya gigantea <400> 18 atgtcggcaa cccctgcgcc gatcgtggag ggctgcccgg cgttctcgga aggatgcccg 60 ttctccaagc tcgacatcgc gctgctgcca caggtcatcc aggaggtgcc gaaggagatc 120 acggagaagt gccctgcatt tgagaagggc tgccctttca aggaggacga ctccgtggag 180 gcgctgtaca agcgcatgtc ggaaatgccg gcctcgcacc gcatgggcca ggagagcccc 240 tcacccgcgg cacagaaggt ggaggccacg ctgcgcctgg tgcacgagca gtcgaaggcc 300 ttgaagtcca ggttgaaagc cacctgcccc gtcttcgcca catcctgccc tttcaagaca 360 gtaacctcgg acggccagcc cttggtgcac gagttggacg acgtcgtcga gaggtgggga 420 ctgaaggaga tcgaggaggt gatcacctct cctgtgtcag cgaacgccga gccgctctcc 480 aagaccatga aagctgggac caggtctgtg caccgcgctg ccgagaacgt ccgatttgtc 540 cgcgacttcc tcaagggcac ggtgcccaaa gacagctacg tggagctgtt gcgtgcgttg 600 taccatgtct acgacgccct ggagcgagct atccgaggcc tgccagagca tttgcagcac 660 tgcgacttca acaagttgtg gcgcaccgag accttgcttg ccgacctgtg ccactacacc 720 aacagcgcct acccagagac cccggaggct gtgagcagaa tcgtcggtgt tccttctcag 780 gtggcccagc agtacgtgga tcatttggac gctctcgggg agcaggagcc cctgctggtg 840 ttggcgcacg cctacacccg ctacctgggg gacttgagcg gcggccagat cctggcccga 900 gcggctgaga aggcgtacgg cctggagggc ggccgaggca ctgcattcta cagcttcgag 960 ctggtgggaa cagctgcgtc cgaggtcaag gacttcaaga aagcgtacag agcgtccttg 1020 gacgcgttgc agctgaaagc acacgaggcg gacgcgttgg tggaggaggc caacatggct 1080 ttcttgatga acatgctcct cttcgaggac cgggatgtcg ctgctggtca cctagcgcga 1140 gtgcggactc tggaagaggc tcgcgagctg gtggcagcga acaagagtgc gttgaagttc 1200 cagcaggcct acgctggggg tagcaccgca gcagggaagt gccccttctt gccgccgcca 1260 gagcagcggg gggccagtgg cgccagctgc ccctggccct tcttgtggct gcacgacccc 1320 cgcgcagcct tgatggggca tccctacaaa aatctcaccg gtgctctcgt ggcagcgggc 1380 ttcacgaagt ttgcatggga gcgtcctcgc agtgcagcgg tcgggtcttt gttgtgtgcc 1440 gtgggctgct acagcttgaa gccgacgcgc aatacccaag ccgggcgtgg cgtctgcccg 1500 ttcatgcctg catccacgaa cagcgcgtcg ccggcatcgc ggagcgccgc ccaagaacac 1560 catggcgacc gtgtgtgccc atggcctttc gtgtgcttcc acgacccccg tgctgcgttc 1620 cggggccacc cttgcaagaa cgcgtgcggt gtgctggcga cggcgggctt tgcgaaggtc 1680 gcatgggagt accctcgcag cgctgcggcc gggtcgctga tctgtgcgct ggggtgctac 1740 agtctgaagc caaagcgcaa gagcatttcg aatgatgcgg cgccagcctg tgaacctgcc 1800 gaccggatgc ttgccgcctg a 1821 <210> 19 <211> 204 <212> DNA <213> Dendronephthya gigantea <400> 19 tccgacagtt ccctcaatga tttcctccat gcggactccg tcagcatagc ttccagctgg 60 ccctgcccca gatccacggg tgcgcccatt ggtatcctgg aaggctctga tcagcagatg 120 caccagccta ggaatggatc cattctcacg gagcggcgca tgattggccg ggcacagagc 180 caagttcctg atcaacccaa taac 204 <210> 20 <211> 20 <212> DNA <213> Dendronephthya gigantea <400> 20 agatgaagca taaccctcaa 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 21 agatgaagca taaccctcaa 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 22 cttaagctgg cagacttttt 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 23 aaacaagcca ctctgaaaga 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 24 ctttcggaaa tcttcatcag 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 25 agtcacagct tgaaaccact 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 26 cgtattctgg tacgcatctt 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 27 cagaggaatg tttcttcgag 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 28 ttgttggaga agcagtaggt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 29 acgacaagga ctacagcatt 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 30 ccatagacca gccagtttag 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 31 aacaagagtg cgttgaagtt 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 32 tgagattttt gtagggatgc 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 33 cggactactt caagacgaac 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 34 ccgtggttga gtgagtaagt 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 35 aagaaaggaa agccagaact 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 36 tggtggagga gttagaagaa 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 37 cgtttcttac agctcgttct 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 38 acttttccac aacagcaact 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 39 ctactccact ttcgagtcgt 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 40 ctcttgtgga actccagatt 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 41 acagttccct caatgatttc 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 42 gttattgggt tgatcaggaa 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 43 atcactgacc ctcaatgttc 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 44 ttccctcaga gtgtctgttc 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 45 ctgagttcca agactccaag 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 46 agatcacctt gcactgattc 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 47 acaccaggta caagatgctc 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 48 ctccttctcc ttgatctcct 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 49 aatatcttgc attgggattg 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 50 cgcaaatttc tttctgtctt 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 51 acacagcaga aacaagaggt 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 52 catcttcatt caacccaaat 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 53 aataccagtc agtggtcagg 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 54 aagtctccaa atgtctccaa 20 <210> 55 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 55 atcaaagcgc aggagaag 18 <210> 56 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 56 gaagtccacc ctttcagtg 19 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 57 tttagccact tcaggacaat 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 58 gttgtctgaa atcggagttg 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 59 cctcgaacac tgaaggacta 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotides <400> 60 ggcactgcta ctgaagatgt 20

Claims (11)

Microarray for the determination of exposure to acidified seawater at pH 6-7.7 where oligonucleotide or complementary strand molecules of the nucleic acid sequence of all the following genes derived from a large resin dendronephthya gigantea are integrated:
(L-Asparaginase), a gene described in SEQ ID NO: 3 (Cadherin EGF LAG seven-pass G-type receptor), SEQ ID NO: 4 (DNA-directed RNA polymerase III subunit), the gene described in SEQ ID NO: 6 (Dynactin subunit 1), the gene described in SEQ ID NO: 7 (FAD -dependent oxidoreductase), Ficolin (SEQ ID NO: 8), Myosin light polypeptide 6, Phosphoenolpyruvate carboxykinase (SEQ ID NO: 10), Gene A polyketide synthase, a gene described in SEQ ID NO: 13 (Protein phosphatase 1 regulatory subunit 12A), a gene described in SEQ ID NO: 14 (Pyrroline-5-carboxylate re the gene described in SEQ ID NO: 16 (Alcohol dehydrogenase 1), the gene described in SEQ ID NO: 17 (Aquaporin TIP2-3), the gene described in SEQ ID NO: 18 (Deoxyribose-phosphate aldolase) and a gene described in SEQ ID NO: 19 (Guanidinoacetate N-methyltransferase).
delete 1) isolating the RNA from the large resin bumblebees as the experimental group exposed to acidified sea water and the large resin bumblebees as the control group;
2) labeling the experimental group and the control group with different fluorescent substances while synthesizing cDNA from the RNA of the experimental group and the control group of step 1);
3) hybridizing the cDNA labeled with each of the different fluorescent substances of step 2) with the microarray of claim 1;
4) analyzing the reacted microarray; And
5) comparing the degree of gene expression integrated in the microarray of claim 1 with the control group in the analyzed data;
Wherein the pH of the acidified seawater is between 6 and 7.7.
The method according to claim 3, wherein the fluorescent material of step 2) is selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (RITC), rhodamine-B-isothiocyanate (RITC), and rhodamine To determine whether the acidified sea water is exposed.
1) isolating the RNA from the large resin beetle, which is an experimental group exposed to acidified sea water, and the large resin beetle, which is a control group;
2) Performing Real-time Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) using a primer pair complementary to the following genes and capable of gene amplification, using the RNA of step 1) as a template,
(L-Asparaginase), a gene described in SEQ ID NO: 3 (Cadherin EGF LAG seven-pass G-type receptor), SEQ ID NO: 4 (DNA-directed RNA polymerase III subunit), the gene described in SEQ ID NO: 6 (Dynactin subunit 1), the gene described in SEQ ID NO: 7 (FAD -dependent oxidoreductase), Ficolin (SEQ ID NO: 8), Myosin light polypeptide 6, Phosphoenolpyruvate carboxykinase (SEQ ID NO: 10), Gene A polyketide synthase, a gene described in SEQ ID NO: 13 (Protein phosphatase 1 regulatory subunit 12A), a gene described in SEQ ID NO: 14 (Pyrroline-5-carboxylate re the gene described in SEQ ID NO: 16 (Alcohol dehydrogenase 1), the gene described in SEQ ID NO: 17 (Aquaporin TIP2-3), the gene described in SEQ ID NO: 18 A gene (Deoxyribose-phosphate aldolase) and a gene described in SEQ ID NO: 19 (Guanidinoacetate N-methyltransferase); And
3) comparing the gene product of step 2) with the control group to confirm the expression level;
Wherein the pH of the acidified seawater is between 6 and 7.7.
A kit for confirming exposure to acidified sea water at a pH of 6 to 7.7, which comprises the microarray of claim 1.
delete The method according to claim 6, further comprising adding any one selected from the group consisting of streptavidin-like phosphatase conjugate, chemifluorescent, and chemiluminescent fluorescent substance Wherein the acidicized sea water is exposed to the water.
The method according to claim 6, which is selected from the group of reaction reagents consisting of the buffer solution used for hybridization, the reverse transcriptase for the synthesis of cDNA from RNA, dNTP and rNTP (premixed or separate feed type), marker reagent, and wash buffer solution Wherein the acidified sea water is one or more of the following:
A kit for confirming exposure to acidified seawater having a pH of 6 to 7.7, which contains both primer pairs complementary to each of the following genes derived from a large resin dendronephthya gigantea and capable of amplifying genes:
(L-Asparaginase), a gene described in SEQ ID NO: 3 (Cadherin EGF LAG seven-pass G-type receptor), SEQ ID NO: 4 (DNA-directed RNA polymerase III subunit), the gene described in SEQ ID NO: 6 (Dynactin subunit 1), the gene described in SEQ ID NO: 7 (FAD -dependent oxidoreductase), Ficolin (SEQ ID NO: 8), Myosin light polypeptide 6, Phosphoenolpyruvate carboxykinase (SEQ ID NO: 10), Gene A polyketide synthase, a gene described in SEQ ID NO: 13 (Protein phosphatase 1 regulatory subunit 12A), a gene described in SEQ ID NO: 14 (Pyrroline-5-carboxylate re the gene described in SEQ ID NO: 16 (Alcohol dehydrogenase 1), the gene described in SEQ ID NO: 17 (Aquaporin TIP2-3), the gene described in SEQ ID NO: 18 (Deoxyribose-phosphate aldolase) and a gene described in SEQ ID NO: 19 (Guanidinoacetate N-methyltransferase).
delete

Images