KR101749668B1 - Composition for preventing or treating of allergic skin disease comprising root extract of Rubus coreanus as an active ingredient - Google Patents

Abstract

The present invention relates to the use of a berry extract of strawberry root, and more particularly to a pharmaceutical composition, food composition, external preparation for skin and cosmetic composition for prevention or treatment of an allergic disease containing berry extract as an active ingredient .
The bacterium strawberry root extract of the present invention is characterized by having preventive, ameliorating, and therapeutic effects against allergic skin diseases. It is excellent in the effect of suppressing β -hexosaminidase and histamine secretion, which are major factors related to allergy, Cytokine and chemokine production, and this effect is remarkable in comparison with a known therapeutic agent for allergic skin disease (tacrolimus).

Description

TECHNICAL FIELD The present invention relates to a composition for preventing or treating an allergic skin disease comprising an extract of Rubus coreanus as an active ingredient,

The present invention relates to the use of bokbunja strawberry root extract, and more particularly to a pharmaceutical composition, food composition, external preparation for skin and cosmetic composition for prevention or treatment of an allergic skin disease comprising bokbunja strawberry root extract as an active ingredient will be.

Atopy is a type of autoimmune skin disease and is a complex disease that is affected by specific genes with high sensitivity, environment, degree of damage of the outer wall of the skin, and immunological factors. If the immune defense response in the human body persists excessively, the immune hypersensitivity reaction may cause atopic symptoms. An autoimmune disease such as atopy refers to a disease in which the body recognizes an organ or tissue as an antigen derived from the outside and has symptoms that cause an immune response. In the case of atopy, it is known to contain antibodies against proteins derived from keratinocytes and endothelial cells. It is known that the amount of autoantibody present in the serum of an individual depends on the severity of the disease It is known to be related to each other. In addition, it has been reported that an autoantibody against CD28 exists in atopic disease, and that the autoantibody can induce T cell activation and induce atopic disease. In addition, it has been suggested that CD28 autoantibodies are presented as new markers that can differentiate between atopic disease and other inflammatory skin diseases, and can be distinguished from atopic disease and other inflammatory skin diseases (Clin Exp Immunol 2006 Nov; 146 2): 262-9.).

Atopy is a chronic skin disease that involves dry skin, keratinization, and itching. Approximately 15% of the population is atopic, with about 20% of these children being infected. In the past, atopy began in infancy and early childhood, and the disease gradually grew with the progress of the disease, but disappear before the age of 7 to 8 years, since the 1970s due to rapid industrialization caused by the pollution rate is increasing every year, This period continues until adolescence and adulthood, and the number of new cases that have become worse or worse after adolescence has also increased remarkably. The exact pathophysiology of atopy has not yet been fully elucidated, but environmental factors are thought to be involved with genetic factors. Serious atopy is a serious social problem, even leading to social problems such as employment or marriage, and it can develop into mental stress, which can lead to gangrene or depression. Although atopy is a serious social and medical problem, the pathophysiology has not been accurately identified, so there is no effective treatment until now.

Conventional atopic treatments include steroids, antibiotics, etc. However, existing treatments have not been effective or safe, and cosmetic, medical devices, or herbal remedies have been widely used. As described above, considering that atopy is intensively developed in infants, safe medicines are now in desperate need. Since atopic asthma or allergic rhinitis also develops and may cause various immune diseases in the body, Early treatment is required (Eichenfield LF, Janifin JM, Beck LA, Lemanske Jr RF, HA Sampson, Weiss ST, Leung DYM, Atorpic Dermatitis and Asthma: Parallels in the Evolution of Treatment, Pediatrics 2003; 111: 608-616. ).

Accordingly, the inventors of the present invention have been studying for a therapeutic agent for an allergic skin disease which has a high therapeutic effect from natural products and has a small side effect. However, the bacterium strawberry root extract of the present invention significantly inhibits the production of cytokines and chemokines related to allergic diseases, It is not only superior in suppressing secretion of β- hexosaminidase and histamine, which is a major factor, but also, for example, when applied to an atopy-induced animal model, which is one of allergic skin diseases, The present invention has been completed.

Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating an allergic skin disease comprising an extract of berries of bramble strawberry as an active ingredient.

Another object of the present invention is to provide a food composition for preventing or ameliorating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

Yet another object of the present invention is to provide an external preparation for skin for the prevention or treatment of an allergic skin disease comprising an extract of strawberry root as an active ingredient.

Yet another object of the present invention is to provide a cosmetic composition for preventing or ameliorating an allergic skin disease comprising an extract of strawberry root as an active ingredient.

In order to achieve the object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

In order to accomplish another object of the present invention, the present invention provides a food composition for preventing or ameliorating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

In order to accomplish still another object of the present invention, the present invention provides an external preparation for skin for preventing or treating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

In order to accomplish still another object of the present invention, the present invention provides a cosmetic composition for prevention or improvement of an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing or treating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient, and an external preparation for skin. The present invention also provides a food composition and a cosmetic composition for preventing or ameliorating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

Rubus Coreanus Miquel is a deciduous shrub belonging to Rosaceae. It grows up to about 3m in length and has barks of sword-red color with thorns and covered with white powder. When the tip of the branch falls down and touches the ground, the root grows. Leaves are alternate phyllotaxis and consist of 3 ~ 7 small leaves. The small leaf is an elliptical rhombus-like ovate with a pointed end and an irregular mount on the edge. There are thorns on petiole. From May to June, flowers of pink or pink bloom from the tip of the branch or from the end of the branches. Petal is obovate with red color, calyx leaf is dried behind flower. The fruit is round, ripened from red to black. The fruit is called bokbunja and it is edible.

In the present invention, only the root portion (bottom portion) of the bramble berries is used.

The bramble strawberry root extract may include a pretreatment step for increasing the extraction efficiency. The pretreatment may include washing, peeling, cutting, sieving, drying, and pulverizing. For example, bokbunja strawberry roots can be used after drying.

The bramble strawberry root extract may be extracted by a known natural product extraction method and may be extracted with one or more solvents selected from the group consisting of, for example, water, organic solvents having 1 to 6 carbon atoms, and subcritical or supercritical fluids. , The organic solvent having 1 to 6 carbon atoms may be selected from the group consisting of alcohols having 1 to 6 carbon atoms, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride methylene chloride, hexane, cyclohexane, diethyl ether, and petroleum ether. Preferably water or a mixture of 1 to 6 alcohols (methanol (C1), ethanol (C2), propanol (C3), butanol (C4), pentanol (C5), hexanol Can be extracted by using any one of the solvents selected from the above. Most preferably, the extraction solvent of the present invention may be an aqueous 70% to 90% (v / v) ethanol solution.

The extraction temperature of the extract of the present invention is not particularly limited and may be, for example, from 1 ° C to 130 ° C, preferably from 10 ° C to 40 ° C. The extraction time of the extract of the present invention is not particularly limited depending on the extraction temperature, and can be, for example, 1 hour to 10 days, preferably 5 hours to 60 hours.

The extract of the present invention can be extracted by a known natural substance extraction method. For example, it can be extracted by a cold extraction, a normal temperature extraction, a hot water extraction, an ultrasonic extraction, a reflux cooling extraction, a heating extraction method, preferably a hot water extraction method or a room temperature extraction method, have.

The extract of the present invention can be used in the form of a liquid by filtration and / or concentration, and solidified through a conventional drying process such as spray drying or freeze drying. In the drying step, dextrin or the like may be mixed and dried before spray drying or freeze drying.

The bacterium strawberry root extract of the present invention is characterized by having preventive, ameliorating, and therapeutic effects against allergic skin diseases. It is excellent in the effect of suppressing β -hexosaminidase and histamine secretion, which are major factors related to allergy, Cytokine and chemokine production, and this effect is remarkable in comparison with a known therapeutic agent for allergic skin diseases (in particular, tacrolimus, which is known as an atopic treatment agent).

This is well illustrated in the embodiments of the present invention.

In one embodiment of the present invention, hydrothermal, methanol, ethanol and acetone extracts were prepared from the berry raspberry roots, and the antiallergic effect of these extracts was evaluated in vitro . As a result of treatment of the above extracts with HMC-1 cells as mast cells, the bacterium strawberry root extract of the present invention was found to have an allergic cytokine such as IL-4, IL-5, IL-12, IFN- ?, TNF- ?, TARC And chemokine protein and their mRNA expression, and was found to excel in inhibiting the secretion of β -hexosaminidase and histamine. This effect was particularly good with the ethanol extract of berry strawberry root, The extracts of bokbunja strawberry root showed better efficacy than the bokbunja (fruit).

In another embodiment of the present invention, the anti-allergic effect of the extract is evaluated in vivo by applying the bacterium strawberry root extract of the present invention to atopic skin-induced mouse skin as one of the allergic skin diseases. As a result, the bokbunja strawberry root extract of the present invention remarkably improved symptoms such as keratin, general erythema, exudative epithelium formation, hemorrhage, and edema, and this effect is remarkably improved as compared with the known atopic treatment agent tacrolimus And exhibited therapeutic effects at the same level or higher (see Example 5). Therefore, when the composition (extract) of the present invention was used, it was confirmed that it exerts excellent effects in the treatment of allergic skin diseases such as atopy.

The pharmaceutical composition according to the present invention may contain the bramble strawberry root extract of the present invention alone, or may further contain one or more pharmaceutically acceptable carriers, excipients or diluents. The term "pharmaceutically acceptable" as used herein means a non-toxic composition which is physiologically acceptable and which, when administered to humans, does not inhibit the action of the active ingredient and does not normally cause an allergic reaction such as gastrointestinal disorder, dizziness, .

The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. In addition, the carrier for parenteral administration may contain water, a suitable oil, a saline solution, an aqueous glucose and a glycol, and may further contain a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, etc. in addition to the above components. Other pharmaceutically acceptable carriers and preparations can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

The composition of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal administration Lt; / RTI >

The pharmaceutical composition of the present invention can be formulated into oral preparations or parenteral administration preparations according to the administration route as described above.

In the case of a preparation for oral administration, the composition of the present invention may be formulated into a powder, a granule, a tablet, a pill, a sugar, a tablet, a liquid, a gel, a syrup, a slurry, . For example, an oral preparation can be obtained by combining the active ingredient with a solid excipient, then milling it, adding suitable auxiliaries, and then processing the mixture into a granular mixture. Examples of suitable excipients include, but are not limited to, sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches including corn starch, wheat starch, rice starch and potato starch, Cellulose such as methylcellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose and the like, fillers such as gelatin, polyvinylpyrrolidone and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may optionally be added as a disintegrant. Further, the pharmaceutical composition of the present invention may further comprise an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and an antiseptic agent.

In the case of a preparation for parenteral administration, it can be formulated by a method known in the art in the form of injection, cream, lotion, external ointment, oil, moisturizer, gel, aerosol and nasal aspirate. These formulations are described in Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, Pa., 1995, which is a commonly known formulary for all pharmaceutical chemistries.

The total effective amount of the composition of the present invention may be administered to a patient in a single dose and may be administered by a fractionated treatment protocol administered over a prolonged period of time in multiple doses. In the pharmaceutical composition of the present invention, the content of the active ingredient may be varied depending on the degree of the disease. Preferably, the total preferred dose of the pharmaceutical composition of the present invention may be from about 0.01 μg to 1,000 mg, and most preferably from 0.1 μg to 500 mg, per kilogram of patient body weight per day. However, the dosage of the pharmaceutical composition may be determined depending on various factors such as the formulation method, administration route and frequency of treatment, as well as the patient's age, body weight, health condition, sex, severity of disease, diet and excretion rate, It will be possible to determine the appropriate effective dose of the composition of the present invention by those of ordinary skill in the art in view of this point. The pharmaceutical composition according to the present invention is not particularly limited to its formulation, administration route and administration method as long as the effect of the present invention is exhibited.

The external preparation for skin of the present invention includes a berry extract of berries as an active ingredient and may include a pharmaceutically acceptable carrier. In addition, A thickening agent, a foaming agent, a fragrance, a surfactant, water, an ionic or non-ionic emulsifier, a filler, a metal ion, a surfactant, an antioxidant, In the field of dermatology, such as sequestering and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or any other ingredient conventionally used in external preparations for skin And may contain auxiliary agents used. In addition, the components can be introduced in amounts commonly used in the dermatology field.

The dose of the bokbunja strawberry root extract to the external preparation for skin is 0.0001 to 1000 mg / kg, preferably 0.001 to 100 mg / kg, but is not limited thereto. The dose may vary depending on the weight, age, sex, health condition, age, elimination rate, severity of disease, etc. of the particular patient.

Examples of the form of the external preparation for skin include, but are not limited to, liquid coating agents, spray agents, lotions, gels, pastes, ointments, aerosols, powders and transdermal absorbers.

Pharmaceutically acceptable carriers in the external preparation of the present invention include, but are not limited to, hydrocarbons such as vaseline, liquid paraffin, gelling hydrocarbons (plastid base); Vegetable oils such as medium-chain fatty acid triglycerides, lard, hard fat, cacao butter and the like; Higher fatty alcohols such as cetanol, stearyl alcohol, stearic acid and isopropyl palmitate; fatty acids and esters thereof; Water-soluble bases such as polyethylene glycol, 1,3-butylene glycol, glycerol, gelatin, white sugar, sugar alcohol and the like; Emulsifiers such as glycerin fatty acid esters, polyoxyl stearate, and polyoxyethylene hardened castor oil; Acrylic acid ester, and sodium alginate; Jet agents such as liquefied petroleum gas and carbon dioxide; And preservatives such as paraoxybenzoic acid esters. In addition to these, a stabilizer, a flavoring agent, a coloring agent, a pH adjuster, a diluent, a surfactant, a preservative, an antioxidant, and the like can be optionally incorporated. The use of the external preparation of the present invention is preferably applied to an allergic skin disease (particularly atopic disease) by a conventional method.

In addition, the external preparation according to the present invention can be used by being adhered to a solid support such as a wound dressing cover of a conventional bandage. Adhesion can be achieved by saturating the bramble strawberry root extract of the present invention with a solid support, followed by dehydration. Preferably, the solid support is first coated with a pressure sensitive adhesive to enhance adhesion of the bramble strawberry root extract of the present invention to a solid support have. Examples of the pressure-sensitive adhesive include polyacrylate and cyanoacrylate. This type of formulation includes, for example, a bandage (Smith & Nephew Ltd) having a non-adhesive wound peel-off cover in the form of a perforated plastic film; Johnson & Johnson's thin strips, patches, spots, band-aids in the form of plastic strips (BAND-AID); Curity CURAD Ouchless from Colgate-Palmolive Co. (Kendall) Bandage; And STIK-TITE elastic strips from American White Cross Laboratories Inc. The bramble strawberry root extract of the present invention can be applied as an active ingredient to this type of formulation.

The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food and food additives. Food compositions of this type may be prepared in a variety of forms according to conventional methods known in the art.

For example, as a health food, the bokbunja strawberry root extract of the present invention may be prepared in the form of tea, juice, and drink, and may be ingested, granulated, encapsulated and powdered. In addition, the bramble strawberry root extract of the present invention can be prepared in the form of a composition by mixing it with a known substance or active ingredient known to be effective for allergic skin diseases (especially atopic). For example, the food composition of the present invention may further contain trace minerals, vitamins, lipids, saccharides, and components having known antiallergic activity in addition to berry extract of strawberry root. The minerals may include nutrients necessary for growing period such as calcium and iron. Vitamins may include vitamin C, vitamin E, vitamin B1, vitamin B2, and vitamin B6. The lipid may include alkoxyglycerol or lecithin, and the saccharides may include fructo-oligosaccharides and the like.

Functional foods also include beverages (including alcoholic beverages), fruits and their processed foods (e.g., canned fruits, bottled, jam, maalmalade, etc.), fish, meat and processed foods such as ham, Etc.), breads and noodles (eg udon, buckwheat noodles, ramen noodles, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, , Retort food, frozen food, various seasonings (e.g., soybean paste, soy sauce, sauce, etc.) by adding the bokbunja strawberry root extract of the present invention.

Further, in order to use the bokbunja strawberry root extract of the present invention in the form of a food additive, it may be used in the form of powder or concentrate.

The desirable content of the bokbunja strawberry root extract in the food composition of the present invention may be 0.01 to 90%, preferably 0.1 to 50%, based on the total weight of the food composition, based on the total weight of the food composition.

The cosmetic composition of the present invention comprises Can be prepared in any formulation conventionally produced in the art and can be applied topically or systemically, which is commonly used in the field of dermatology, by containing a dermatologically acceptable medium or base in addition to the bramble rootberry root extract of the present invention ≪ / RTI >

In addition, the cosmetic composition of the present invention may further contain a fatty substance, an organic solvent, a solubilizer, a thickening agent and a gelling agent, a softening agent, an antioxidant, a suspending agent, a stabilizer, a foaming agent, , Water, ionic or nonionic emulsifiers, fillers, sequestering agents and chelating agents, preservatives, vitamins, barrier agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or cosmetics And any other ingredients used, such as cosmetics or adjuvants commonly used in the field of dermatology. And the above ingredients may be introduced in amounts commonly used in the dermatology field.

Formulations of suitable cosmetic compositions include, for example, solutions, gels, solid or paste anhydrous products, emulsions obtained by dispersing the oil phase in water, suspensions, microemulsions, microcapsules, microgranules or ionic (liposomes) In the form of a foliar dispersant, in the form of a cream, a skin, a lotion, a powder, an ointment, a spray or a conceal stick. It can also be prepared in the form of a foam or an aerosol composition further containing a compressed propellant.

Examples of the cosmetic composition to which the cosmetic composition of the present invention can be added include but are not limited to skin lotion, skin softener, skin toner, convergent lotion, softening longevity, nutritional lotion, astringent, lotion, milk lotion, Cream, Massage Cream, Nourishing Cream, Moisture Cream, Hand Cream, Essence, Nutrition Essence, Pack, Soap, Shampoo, Cleansing Foam, Cleansing Lotion, Cleansing Cream, Body Lotion, Body Cleanser, Treatment, Serum, Milk, Press Powder, Loose powder, eye shadow, and the like.

The content of the berry extract of strawberry root contained in the cosmetic composition of the present invention may be 0.0001 to 50% by weight, preferably 0.01 to 10% by weight based on the total weight of the cosmetic composition.

The bacterium strawberry root extract of the present invention is characterized by having preventive, ameliorating, and therapeutic effects against allergic skin diseases. It is excellent in the effect of suppressing β -hexosaminidase and histamine secretion, which are major factors related to allergy, Cytokine and chemokine production, and this effect is remarkable in comparison with a known therapeutic agent for allergic skin disease (tacrolimus).

FIG. 1 shows the results of measuring the secretion of β- hexosaminidase and histamine by treating hydrothermal, methanol, ethanol and acetone extracts of the bacterium strawberry root with HMC-1 cells, which are commonly used in allergic reactions, as a human obesity cell line FIG.
FIG. 2 is a graph showing the results of measuring the secretion of β- hexosaminidase and histamine by treating bacterium strawberry root ethanol extract or bacterium fruit ethanol extract with HMC-1 cells, a human obesity cell line commonly used for allergic reaction measurement .
FIG. 3 is a photograph showing the degree of skin damage of a NC / Nga mouse in a control and an experimental group (Normal: Normal mouse, DNCB: Atopy-induced NC / Nga mouse, Tacrolimus: Atopy-induced NC / Treatment, Rubus root: atopy induction NC / Nga mouse bramble strawberry root ethanol extract treatment, all the same meaning in the following drawings).
FIG. 4 is a graph comparing the number of scratches of an NC / Nga mouse against a control group and an experimental group for 10 minutes (a graph of the number of scratches of the mouse).
FIG. 5 is a graph showing the results of an NC / Nga mouse treated with atorvastatin (NC) / Nga mouse treated with atorvastatin (Tacrolimus) and DNCB treated with bokbullus strawberry root ethanol And the epidermis and dermis from the ear were stained with H & E and photographed with an optical microscope.
FIG. 6 is a graph showing the results of an NC / Nga mouse treated with atorvastatin (NC) / Nga mouse treated with atopy (Tacrolimus) after atopy induction with DNCB, NC / Nga mouse treated with ethanol extract of bokbule strawberry root after atopy induction with DNCB The results of comparative evaluation of immunoglobulin IgE production of serum isolated from the blood using ELISA KIT are shown.
FIG. 7 is a graph showing the results of an NC / Nga mouse treated with atorvastatin (NC) / Nga mouse treated with an atopy treatment (tacrolimus) with DNCB and a NC / Nga mouse treated with a bacterium strawberry root ethanol extract MRNA expression levels of allergen-related chemokines and cytokines (IL-4, IL-5, IL-12, IFN-y, TNF-α and TARC) .
FIG. 8 (Figs. 8A to 8C) shows normal mice, NC / Nga mice induced by DNCB, NC / Nga mice treated with atopic treatments (tacrolimus) after atopy induction with DNCB, and bokbullus strawberry root ethanol (IL-4, IL-5, IL-12, IFN-γ, TNF-α, and TARC) were determined by immunoblotting with ELISA KIT The results are shown in FIG.

Hereinafter, the present invention will be described in detail.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Statistical analysis

Statistical analysis was performed by one-way ANOVA. The significance of each group was analyzed at the level of P <0.05. When the p value is 0.05 or less, * is shown in the figure.

&Lt; Example 1 >

 Bokbunja strawberry root Rubus coreanus Miquel root), methanol, ethanol and acetone extract

In order to prepare hot water, methanol, ethanol and acetone extracts of bokbunja strawberry roots, bokbunja strawberry roots were purchased from Hongcheon, Gangwon province. The extracts of methanol, ethanol, and acetone, which are organic solvents, were prepared by mixing 20 g of bokbunja strawberry root with 200 ml of water and boiling at 100 ° C for 2 hours. Was mixed with 200 ml of an aqueous solution of 80% (v / v) of an organic solvent, and the mixture was allowed to stand at 24 占 폚 for 24 hours. Each extract was separated into sludge and solution using a vacuum suction filter and the solution was taken. (3.9g), methanol extract (3.1g) and ethanol extract (3.9g) were obtained by concentrating at 42 ° C using a concentrator (Evaporator, Heidolph vv 2000) to remove water, methanol, 3.4 g) and acetone extract (3.0 g).

&Lt; Example 2 >

Bokbunja strawberry root Rubus coreanus Miquel root), methanol, ethanol, acetone extract in vitro  Evaluation of anti-allergy efficacy

<2-1> Bokbunja strawberry root Rubus coreanus (HMC-1) by hydrothermal, methanol, ethanol, acetone extract beta -hexosaminidase secretion comparison

β- hexosaminidase secretion is widely used as a major factor in the activation and degranulation of mast cells. Therefore, in this study, β- hexosaminidase secretion was measured using HMC-1 cells, a human obesity cell line. HMC-1 cells were transfected 4-5 times a week. The medium was cultured in IMDM (Iscove's modified Dulbecco's Medium) medium containing 20 μg / ml gentamycin solution and 10% FBS (fetal bovine serum) And cultured in an environment of 5% CO ₂ . The cells were cultured in a 24-well plate at a concentration of 1 × 10 ⁶ cells / well, and the hydrothermal, methanol, ethanol and acetone extracts of the raspberry roots of the bokbule were subjected to two concentration conditions (final concentrations of 50 and 100 μg / ml), and the cells were mixed with tyrode's buffer (137 mM NaCl, 2.7 mM KCl, 1.8 mM CaCl ₂ , 1.1 mM MgCl ₂ , 11.9 mM NaHCO ₃ , 0.4 mM NaH ₂ PO ₄ , 5.6 mM glucose, pH 7.2) And cultured at 37 ° C for 30 minutes. Compound 48/80 was added at a concentration of 6 / / ml and incubated at 37 캜 for 30 minutes. Completion of the reaction for 10 minutes at ice and centrifuged to then immersed the cell, only the supernatant 30㎕ 96 of the moving substrate with the well plate 1mM 4- p -nitrophenyl-N -acetyl- β -D-glucosaminide 30㎕ ml supernatant And the mixture was reacted at 37 캜 for one hour. Finally, the reaction was terminated with 120 μl stop solution (sodium bicarbonate, pH 10.2) and the absorbance was measured at 405 nm with a microplate reader.

Figure 1 shows the results of comparing secreted β- hexosaminidase by inducing degranulation in compound 48/80 after treatment of hydrothermal, methanol, ethanol and acetone extracts of bokbunja strawberry root with HMC-1 cells. As shown in FIG. 1, ethanol extract of various solvent extracts showed excellent inhibitory effect on β- hexosaminidase, and ethanol extract of brambleberry strawberry root inhibited β -hexosaminidase secretion by 67%.

<2-2> Bokbunja strawberry root Rubus coreanus Histamine secretion of mast cell (HMC-1) by hydrothermal, methanol, ethanol and acetone extracts

HMC-1 cells were cultured and cultured in a 24-well plate at a concentration of 1 × 10 ⁵ cells / well in order to measure the concentration of histamine secreted from the human mast cell line HMC-1 cells. After culturing, hot water, methanol, ethanol, and acetone extracts of bokbunja strawberry roots were treated with concentrations (50 and 100 μg / ml, respectively) in the same manner as in Example 2-1, and cultured for 1 hour. The cells were treated with compound 48/80 (10 μg / ml) for 20 min, and the cell culture was collected. The concentration of histamine in the cell culture medium was measured with a microplate reader at 450 nm using a Histamine assay ELISA kit (Cayman Chemical Company, Ann Arbor, IL, USA).

Fig. 1 shows the results of histamine-induced secretion of histamine in HMC-1 cells by compound 48/80 after treatment with hydrothermal, methanol, ethanol and acetone extracts of the bokbunja strawberry roots. As can be seen from FIG. 1, the ethanol extract of bokbunja strawberry root showed the highest inhibitory ability than the other solvent extracts due to its ability to inhibit histamine secretion by 54%. This suggests that the ethanol extract of the bokbunja strawberry root has higher healing efficacy than other solvent extracts in allergy. The results of this study showed that the ethanol extract of bokbunja strawberry root showed higher healing efficacy against allergies than other solvent extracts, so that the extract of bokbunja strawberry root ethanol is more easily applied to antiallergic composition and more widely used as allergy treatment or pharmaceutical composition It is possible.

&Lt; Example 3 >

Bokbunja strawberry root Rubus coreanus Miquel root) and bokbunja Rubus coreanus Miquel fruit)

The ethanol extracts of the bokbunja strawberry roots were those obtained in Example 1 above. In order to produce the ethanol extract of the bokbunja fruit, the bokbunja fruit (the bokbunja fruit was used as a dried herbal medicine condition) was prepared and prepared in Hongcheon, Gangwon province. 20 g of berry fruit, which was dried and pulverized in the form of a medicinal product, was mixed with 200 ml of an 80% (v / v) ethanol aqueous solution and left at 24 ° C for 24 hours for extraction. The fruit extract of Bokbunja was separated into sludge and solution using a vacuum suction filter and only the solution was taken. Then, in order to remove ethanol from the separated solution, 3.5 g of ethanol extract of bokbunja was obtained by concentrating the mixture at 42 DEG C using a concentrator (Evaporator, Heidolph vv2000).

<Example 4>

Bokbunja strawberry root Rubus coreanus Miquel root) Ethanol Extract and. Rubus coreanus Miquel fruit) Antioxidant effect of ethanol extracts

<4-1> Bokbunja strawberry root Rubus coreanus Miquel root) ethanol extract or bokbull fruit Rubus coreanus Miquel fruit) in ethanol extracts from mast cells (HMC-1) beta -hexosaminidase secretion comparison

The β- hexosaminidase secretion in the HMC-1 cells by the ethanol extract of the brambleberry strawberry root extract or the bamboo fruit extract prepared in Examples 1 and 3 was measured in the same manner as in Example 2-1.

Figure 2 shows the results of comparing the amount of secreted β -hexosaminidase by inducing degranulation in compound 48/80 after treatment of HMC-1 cells with ethanol extract of bokbunja strawberry root or bokbunja fruit. As shown in FIG. 2, the ethanol extract of bokbunja strawberry root suppressed the secretion of ? -Hexosaminidase to 77% level and inhibited the extract of bokbunja fruit ethanol to 56% level. Therefore, ethanol extract of bokbunja strawberry root showed 21% higher inhibition of β- hexosaminidase secretion.

<4-2> Bokbunja strawberry root Rubus coreanus Miquel root) ethanol extract or bokbull fruit Rubus coreanus Comparison of Histamine Secretion in Mast Cell (HMC-1) by Ethanol Extract of Miquel fruit

In the HMC-1 cells treated with the extracts of brambleberry strawberry ethanol or bokbulean fruit ethanol prepared in Examples 1 and 3 Histamine secretion measurement was performed in the same manner as in Example 2-2.

The HMC-1 cells were treated with ethanol extract of bokbunja strawberry root or bokbunja fruit, and the amount of histamine secreted by inducing histamine with compound 48/80 was shown in Fig. As shown in FIG. 2, the ethanol extract of bokbunja strawberry root inhibited the secretion of histamine by 68%, and the extract of bokbunja fruit ethanol suppressed the secretion of histamine by 50%. Therefore, ethanol extract of bokbunja strawberry root showed an ability to inhibit histamine secretion by 18%. The results of this study showed that ethanol extract of bokbunja strawberry root showed higher healing efficacy against allergies than that of bokbunjae ethanol extract. Therefore, bokbunja strawberry root ethanol extract is more easily applied to antiallergic composition and more widely used as allergy treatment or pharmaceutical composition This is possible.

&Lt; Example 5 >

For atopy-induced mouse model of bokbunja strawberry root extract In vivo  Efficacy evaluation

<5-1> Atopy induction and drug treatment

The groups were divided into four groups: normal, DNCB, tacrolimus, and bokbunja strawberry root ethanol extract groups, and each group was evaluated using 10 NC / Nga mice. 0.1 g of hair removal cream was applied to the back and neck of the NC / Nga mouse and the hair was removed using a soft tissue to prevent scratching. After leaving for 5 days so as to keep the fine scratches, atopic dermatitis was induced by applying 200 μl of 1% DNCB (acetone: olive oil = 3: 1) three times a week for 2 weeks. After the induction of atopy, bokbunja strawberry ethanol extracts were applied to the lesion at 100 mg / kg twice a week for 4 weeks. To compare efficacy, tacrolimus was used as a treatment for atopy. Tacrolimus was applied to the atopic lesion at 100 mg / kg twice a week for 4 weeks.

<5-2> Atopic Model Mouse Visual Evaluation

tacrolimus or bokbunja strawberry root ethanol extracts. The visual evaluation evaluated the skin condition in four steps (0 = absence, 1 = mild, 2 = moderate, 3 = severe) according to the evaluation index of erythema / bleeding, dry / scar, edema, erosion / Or higher, the atopy symptoms reached the peak, and the results are shown in Tables 1 to 4 below. In addition, the number of scratches of the NC / Nga mouse was measured for 10 minutes, as shown in FIG.

Normal NC / Nga mouse (normal) visual evaluation result (-) 1 week 2 weeks 3 weeks 4 weeks 5 weeks 6 weeks One 2 3 4 5 6 7 8 9 10 11 12 erythema / hemorrhage One 0 0 0 0 0 0 0 0 0 0 0 Erythema dryness / scarring 0 0 0 0 0 0 0 0 0 0 0 0 Dry / scar edema 0 0 0 0 0 0 0 0 0 0 0 0 edema erosion / excoriation 0 0 0 0 0 0 0 0 0 0 0 0 Erosion / exfoliation Sum One 0 0 0 0 0 0 0 0 0 0 0 Average 0.5 0 0 0 0 0

Atopic evaluation of NC / Nga mice induced by DNCB DNCB 1 week 2 weeks 3 weeks 4 weeks 5 weeks 6 weeks One 2 3 4 5 6 7 8 9 10 11 12 erythema / hemorrhage One One One One 2 2 3 3 2 3 3 2 Erythema dryness / scarring One 2 2 2 3 3 3 3 3 3 3 3 Dry / scar edema 0 One One 2 One 2 3 2 2 2 2 One edema erosion / excoriation 0 2 One 2 2 3 3 3 3 3 3 3 Erosion / exfoliation Sum 2 6 5 7 8 10 12 11 10 11 11 9 Average 4.5 6 9 11.5 10.5 10

NC / Nga mice treated with atopic dermatitis (tacrolimus) after atopy induction with DNCB DNCB + atopy treatment 1 week 2 weeks 3 weeks 4 weeks 5 weeks 6 weeks One 2 3 4 5 6 7 8 9 10 11 12 erythema / hemorrhage 0 One One One 2 2 3 3 3 2 2 2 Erythema dryness / scarring One One 2 3 3 2 3 2 2 2 One One Dry / scar edema One One One One 2 2 3 2 One One One One edema erosion / excoriation 0 One 2 2 3 3 2 2 2 2 One One Erosion / exfoliation Sum 2 4 6 7 10 9 11 9 8 7 5 5 Average 3 6.5 9.5 10 7.5 5

NC / Nga mouse treated with ethanol extract of bokbunja strawberry root after atopy induction with DNCB DNCB + Rubus root 1 week 2 weeks 3 weeks 4 weeks 5 weeks 6 weeks One 2 3 4 5 6 7 8 9 10 11 12 erythema / hemorrhage 0 One 2 2 3 3 3 3 2 One One One Erythema dryness / scarring One One 2 2 2 2 3 2 2 One 2 2 Dry / scar edema 0 One One One One 2 2 One One One One 0 edema erosion / excoriation One 2 3 3 3 3 2 2 2 2 One One Erosion / exfoliation Sum 2 5 8 8 9 10 10 8 7 5 5 4 Average 3.5 8 9.5 9 6 4.5

After atopy induction through DNCB treatment for 2 weeks (0 to 2week in FIG. 3), tacrolimus, an atopy treatment, and bokbunja strawberry root ethanol extract were applied twice at 100 mg / kg for 4 weeks (3-6 weeks in FIG. 3) FIG. 3 and Tables 1 to 4 show the results of visually observing the skin damage state. Atopy induced skin showed various symptoms such as keratin and general erythema, formation of exudative skin, hemorrhage and edema due to skin dryness, and a remarkable improvement was observed by tacrolimus and extract of berry strawberry root ethanol. Especially, the extract of strawberry root extract of bokbunja showed higher healing than tacrolimus, an atopic treatment. This phenomenon was also the same in the evaluation of the number of scratching of NC / Nga mice, and the scraping phenomenon in the mice treated with the brambleberry strawberry root ethanol extract was significantly lower than in the tacrolimus treated group.

<5-3> Histopathology

After completion of the treatment, the dorsal skin tissue (1.5 x 1.5 cm) and the ear of the experimental and control mice were removed and fixed in 10% paraformaldehyde for 24 hours. The tissues were hardened sufficiently in paraffin, A slide glass was produced. H & E (haematoxylin-eosin) was used for staining by known methods, and the thickness of epidermis and dermis was observed using an optical microscope. The results are shown in Fig.

As shown in Fig. 5, skin exfoliation, skin hypertrophy, and hyperkeratosis were observed in the epidermis of atopy-induced mice by DNCB. On the other hand, it was confirmed that the removal of keratin, skin thickening, and corneal thickening was significantly reduced by the treatment with tacrolimus, an atopy treatment, and ethanol extract of bokbunja strawberry root, and it was confirmed that treatment effect of bacille strawberry root ethanol extract was better .

<5-4> Measurement of immunoglobulin IgE

After the treatment of the test substance, mice treated with atorvia-induced atopy by DNCB, ethanol treated with bacterium strawberry root ethanol extract and mice treated with tacrolimus were sacrificed, blood was collected from the heart, and serum was separated therefrom to measure IgE . Specifically, the antibody was diluted in a buffer solution using an IgE ELISA Kit (BD Biosciences, San Diego, Calif.), Adhered to a 96-well plate, allowed to stand overnight at 4 ° C, and the experiment was conducted according to the manual. The amount of IgE protein was measured with a microplate reader at 450 nm.

The amount of IgE mediating the allergic disease from the serum separated from the blood collected from the heart was measured using an IgE ELISA kit, and the result is shown in FIG. In comparison with NC / Nga mice induced by DNCB, NC / Nga mice treated with tacrolimus and bacterium strawberry root ethanol extracts showed decreased IgE. Especially, it was confirmed that the production of IgE was significantly inhibited in berry extract of strawberry root extract group than tacrolimus.

<5-5> Measurement of chemokines and cytokines

After the treatment of the test substance, mice treated with atorvium-induced control mice and bacterium strawberry root ethanol extracts with DNCB and mice treated with tacrolimus were sacrificed, skin tissues were removed, Trizol was added, and the resulting solution was pulverized with a homogenizer until dissolved RNA was extracted from the tissues. Specifically, Trizol was added to the skin tissues extracted from each of the control and experimental mice, and chloroform (CHCl ₃ ) was added thereto and mixed. The mixture was allowed to stand for 10 minutes and centrifuged. The centrifuged supernatant was recovered, mixed with the same amount of 2-propanol, allowed to stand for 10 minutes, centrifuged again, washed with 80% EtOH and dried to obtain RNA. CDNA was obtained by reverse transcription PCR using AMV reverse transcriptase, dNTP (Promega, Madison, Wis.), EX Taq DNA polymerase (Takara Shuzou, Kyoto, Japan), and the cDNA obtained showed mRNA expression of allergen-related chemokines and cytokines . Specifically, PCR was performed using the primer pairs described in Table 5 below for each of IL-4, IL-5, IL-12, IFN- ?, TNF- ?, cytokines of TARC and chemokine and control GAPDH Respectively. The PCR reaction was repeated 30 cycles at 94 ° C for 1 minute, 95 ° C for 30 seconds, 55-65 ° C for 30 seconds, and 70 ° C for 3 minutes. After the PCR reaction, the reaction product was analyzed using a 1.5% agarose gel electrophoresis method and imaged using GelDoc ^TM XR + (Bio-Rad, Hercules, CA, USA). The results are shown in FIG. The primers used in the PCR were prepared and used in Macrogen. Table 5 below is the base sequence of the primers used in the reverse transcription PCR.

In addition, changes in IL-4, IL-5, IL-12, IFN-γ, TNF-α and TARC proteins were measured in the IL-4 Quantikine® Immunoassay Kit, IL -5 Quantikine® Immunoassay Kit, IL-12 Quantikine® Immunoassay Kit, TNF-α Quantikine® Immunoassay Kit, CCL17 / TARC Quantikine® Immunoassay Kit (R & D Systems, Minneapolis, MN, USA).

The primer sequence used in PCR Gene direction Primer base sequence
(5 'to 3') SEQ ID NO: IL-4 sense TCAACCCCCAGCTAGTTGTCA One antisense CATCGAAAAGCCCGAAAGAG 2 IL-5 sense AGCACAGTGGTGAAAGAGACCTT 3 antisense TCCAATGCATAGCTGGTGATTT 4 IL-12 sense GACACGCCTGAAGAAGATGAC 5 antisense CGCCATTCCACATGTCACTGC 6 IFN-y sense AACGCTACACACTGCATCT 7 antisense GAGCTCATTGAATGCTTGG 8 TNF-a sense CAGGCGGTGCCTATGTCTC 9 antisense CGATCACCCCGAAGTTCAGTAG 10 TARC sense CAGGAAGTTGGTGAGCTGGTATA 11 antisense TTGTGTTCGCCTGTAGTGCATA 12 GAPDH sense AAGCTGTGGCGTGATGGCCG 13 antisense TGGGCCCTCAGATGCCTGCT 14

Control mice with DNCB induced atopy, mice treated with bacterium strawberry root ethanol extract and mice treated with tacrolimus were sacrificed and RNA extracted from the extracted tissues was identified with respective chemokine and cytokine specific primers IL-5, IL-12, IFN-γ, TNF-α, and TARC of NC / Nga mice treated with tacrolimus and bramble root strawberry ethanol extracts compared with atopic NC / Nga mice induced by DNCB (Fig. 7).

In addition, the amount of chemokines and cytokines mediating allergic diseases from serum collected from the heart was measured using an ELISA kit. As a result, tacrolimus and brambleberry strawberry root ethanol IL-5, IL-12, IFN-y, TNF-alpha and TARC of NC / Nga mice to which the extract was applied (Fig. 8A to Fig. 8C). In particular, it was confirmed that the bacterium strawberry root extract of the present invention inhibits IL-4, IL-5, IL-12, IFN- ?, TNF- ?, TARC protein and mRNA expression thereof at a level similar to or higher than that of tacrolimus .

As described above, the present invention relates to the use of bokbunja strawberry root extract, and more particularly, to a pharmaceutical composition, food composition, external preparation for skin and skin for preventing or treating an allergic disease containing bokbunja strawberry root extract as an active ingredient To a cosmetic composition.

The bacterium strawberry root extract of the present invention is characterized by having preventive, ameliorating, and therapeutic effects against allergic skin diseases. It is excellent in the effect of suppressing β -hexosaminidase and histamine secretion, which are major factors related to allergy, Cytokine and chemokine production, and this effect is remarkably effective even in comparison with a known therapeutic agent for allergic skin diseases (tacrolimus), and thus is highly industrially applicable.

<110> CHUNG ANG University industry Academic Cooperation Foundation <120> Composition for preventing or treating allergic skin disease          containing root extract of Rubus coreanus as an active ingredient <130> NP14-0077 <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IL-4 <400> 1 tcaaccccca gctagttgtc a 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for IL-4 <400> 2 catcgaaaag cccgaaagag 20 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IL-5 <400> 3 agcacagtgg tgaaagagac ctt 23 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for IL-5 <400> 4 tccaatgcat agctggtgat tt 22 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IL-12 <400> 5 gacacgcctg aagaagatga c 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for IL-12 <400> 6 cgccattcca catgtcactg c 21 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IFN-gamma <400> 7 aacgctacac actgcatct 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for IFN-gamma <400> 8 gagctcattg aatgcttgg 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer for TNF-alpha <400> 9 caggcggtgc ctatgtctc 19 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for TNF-alpha <400> 10 cgatcacccc gaagttcagt ag 22 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer for TARC <400> 11 caggaagttg gtgagctggt ata 23 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for TARC <400> 12 ttgtgttcgc ctgtagtgca ta 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer for GAPDH <400> 13 aagctgtggc gtgatggccg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for GAPDH <400> 14 tgggccctca gatgcctgct 20

Claims (7)

A pharmaceutical composition for the prevention or treatment of an allergic skin disease comprising ethanol extract of berry strawberry root as an active ingredient.
A food composition for preventing or ameliorating an allergic skin disease comprising an ethanol extract of a bokbunja strawberry root as an active ingredient.
A composition for external application for skin for the prevention or treatment of an allergic skin disease comprising an ethanol extract of bokbunja strawberry root as an active ingredient.
A cosmetic composition for preventing or ameliorating an allergic skin disease comprising an ethanol extract of a bokbunja strawberry root as an active ingredient.
delete delete The composition according to any one of claims 1 to 4, wherein the allergic skin disease is an atopic skin disease.

Images