KR101749668B1 - Composition for preventing or treating of allergic skin disease comprising root extract of Rubus coreanus as an active ingredient - Google Patents

Composition for preventing or treating of allergic skin disease comprising root extract of Rubus coreanus as an active ingredient Download PDF

Info

Publication number
KR101749668B1
KR101749668B1 KR1020140169145A KR20140169145A KR101749668B1 KR 101749668 B1 KR101749668 B1 KR 101749668B1 KR 1020140169145 A KR1020140169145 A KR 1020140169145A KR 20140169145 A KR20140169145 A KR 20140169145A KR 101749668 B1 KR101749668 B1 KR 101749668B1
Authority
KR
South Korea
Prior art keywords
extract
strawberry root
present
bokbunja
ethanol
Prior art date
Application number
KR1020140169145A
Other languages
Korean (ko)
Other versions
KR20160072849A (en
Inventor
김원용
김미경
최우진
Original Assignee
중앙대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 중앙대학교 산학협력단 filed Critical 중앙대학교 산학협력단
Priority to KR1020140169145A priority Critical patent/KR101749668B1/en
Publication of KR20160072849A publication Critical patent/KR20160072849A/en
Application granted granted Critical
Publication of KR101749668B1 publication Critical patent/KR101749668B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/73Rosaceae (Rose family), e.g. strawberry, chokeberry, blackberry, pear or firethorn

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Medical Informatics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Cosmetics (AREA)

Abstract

본원 발명은 복분자딸기 뿌리 추출물의 용도에 관한 것으로, 보다 상세하게는 복분자딸기 뿌리 추출물을 유효성분으로 함유하는 알레르기성 질환의 예방 또는 치료용 약학적 조성물, 식품 조성물, 피부 외용제 및 화장료 조성물에 관한 것이다.
본 발명의 복분자딸기 뿌리 추출물은 알레르기성 피부 질환에 대한 예방, 개선, 및 치료효과를 가지는 것이 그 특징으로서, 알레르기 관련 주요인자인 β-hexosaminidase 및 Histamine 분비를 억제하는 효과가 뛰어날 뿐만아니라, 알레르기성 사이토카인 및 케모카인의 생성을 현저하게 억제하며, 이러한 효능은 공지의 알레르기 피부질환 치료제(타크로리무스)와 비교하여도 효과가 현저한 것이 그 특징이다.
The present invention relates to the use of a berry extract of strawberry root, and more particularly to a pharmaceutical composition, food composition, external preparation for skin and cosmetic composition for prevention or treatment of an allergic disease containing berry extract as an active ingredient .
The bacterium strawberry root extract of the present invention is characterized by having preventive, ameliorating, and therapeutic effects against allergic skin diseases. It is excellent in the effect of suppressing β -hexosaminidase and histamine secretion, which are major factors related to allergy, Cytokine and chemokine production, and this effect is remarkable in comparison with a known therapeutic agent for allergic skin disease (tacrolimus).

Description

복분자딸기 뿌리 추출물을 유효성분으로 함유하는 알레르기성 피부질환의 예방 또는 치료용 조성물{Composition for preventing or treating of allergic skin disease comprising root extract of Rubus coreanus as an active ingredient}TECHNICAL FIELD The present invention relates to a composition for preventing or treating an allergic skin disease comprising an extract of Rubus coreanus as an active ingredient,

본원 발명은 복분자딸기 뿌리 추출물의 용도에 관한 것으로, 보다 상세하게는 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 치료용 약학적 조성물, 식품 조성물, 피부 외용제 및 화장료 조성물에 관한 것이다.
The present invention relates to the use of bokbunja strawberry root extract, and more particularly to a pharmaceutical composition, food composition, external preparation for skin and cosmetic composition for prevention or treatment of an allergic skin disease comprising bokbunja strawberry root extract as an active ingredient will be.

아토피는 자가면역 피부질환의 일종으로서 민감성이 높은 특정 유전자, 환경, 피부외벽의 손상 정도 및 면역학적인 요인 등에 의한 복합적인 영향을 받는 질환이다. 인체 내의 면역 방어 반응이 과도하게 지속될 경우, 면역과민 반응에 의하여 아토피 증상이 유발될 수 있다. 아토피와 같은 자가면역질환은 몸에서 자신의 기관이나 조직을 외부에서 유래한 항원으로 인식, 면역 반응을 일으키는 증상을 가지는 질환을 말한다. 아토피의 경우, 케라틴세포(keratinocyte) 및 내피세포(endothelial cell)에서 유래한 단백질에 대한 항체를 포함하고 있는 것으로 알려져 있으며, 개체의 세럼 내에 존재하는 자가항체(autoantibody)의 양이 상기 질환의 심각도와 서로 관련되어 있다고 알려져 있다. 또한, 아토피 질환에서는 CD28에 대한 자가항체가 존재하며, 상기 자가항체는 T 세포의 활성화를 가져와 아토피 질환을 유도할 수 있음이 보고되었다. 또한, CD28 자가항체가 아토피 질환 및 다른 염증성 피부 질환을 구별할 수 있는 새로운 마커로서 제시되어 아토피 질환과 다른 염증성 피부 질환이 서로 구별될 수 있는 질환임이 제시되었다(Clin Exp Immunol. 2006 Nov;146(2):262-9.).Atopy is a type of autoimmune skin disease and is a complex disease that is affected by specific genes with high sensitivity, environment, degree of damage of the outer wall of the skin, and immunological factors. If the immune defense response in the human body persists excessively, the immune hypersensitivity reaction may cause atopic symptoms. An autoimmune disease such as atopy refers to a disease in which the body recognizes an organ or tissue as an antigen derived from the outside and has symptoms that cause an immune response. In the case of atopy, it is known to contain antibodies against proteins derived from keratinocytes and endothelial cells. It is known that the amount of autoantibody present in the serum of an individual depends on the severity of the disease It is known to be related to each other. In addition, it has been reported that an autoantibody against CD28 exists in atopic disease, and that the autoantibody can induce T cell activation and induce atopic disease. In addition, it has been suggested that CD28 autoantibodies are presented as new markers that can differentiate between atopic disease and other inflammatory skin diseases, and can be distinguished from atopic disease and other inflammatory skin diseases (Clin Exp Immunol 2006 Nov; 146 2): 262-9.).

아토피는 만성 피부 질환으로 피부 건조증, 각화 및 가려움증을 수반하며 전체 인구의 약 15%가 아토피 환자이며, 이 중 유소아 어린이에게 약 20% 정도로 그 유발률이 집중되어 있다. 예전에는 아토피가 영아기나 유아기에 시작되어 성장과 함께 병세가 점점 개선되어 7 내지 8세 이전에 사라지는 경우가 대부분이었으나, 1970년대 이후 급격한 산업화로 유발된 공해 등으로 인하여 발생률이 해마다 증가하고 있으며, 증상이 청소년기 및 성인기 까지 지속되며 점점 심해지거나 청소년기 이후에 새롭게 발생하는 경우도 현저히 증가하고 있다. 아토피의 정확한 병태생리의 경우, 아직까지 완전히 규명되지 않았으나, 유전적 요인과 함께 환경적 요인이 관여할 것으로 생각되고 있다. 심각한 아토피의 경우, 취업 또는 결혼과 같은 사회 생활에 지장을 초래하기까지 하여 심각한 사회문제가 되고 있으며, 심하면 정신적 스트레스로 발전하여 대인기피증 또는 우울증을 앓기도 한다. 이렇듯 아토피는 심각한 사회적, 의학적 문제가 됨에도 병태생리가 정확하게 규명되지 않아 현재까지 효율적인 치료제가 없는 실정이다.Atopy is a chronic skin disease that involves dry skin, keratinization, and itching. Approximately 15% of the population is atopic, with about 20% of these children being infected. In the past, atopy began in infancy and early childhood, and the disease gradually grew with the progress of the disease, but disappear before the age of 7 to 8 years, since the 1970s due to rapid industrialization caused by the pollution rate is increasing every year, This period continues until adolescence and adulthood, and the number of new cases that have become worse or worse after adolescence has also increased remarkably. The exact pathophysiology of atopy has not yet been fully elucidated, but environmental factors are thought to be involved with genetic factors. Serious atopy is a serious social problem, even leading to social problems such as employment or marriage, and it can develop into mental stress, which can lead to gangrene or depression. Although atopy is a serious social and medical problem, the pathophysiology has not been accurately identified, so there is no effective treatment until now.

기존의 아토피 치료제는 스테로이드 제제, 항생제 등이 사용되었으나 기존에 사용되던 치료제들이 치료 효과가 없거나 안전하지 못하여 화장품, 의료기기 또는 한방요법으로 현재 그 치료가 광범위하게 이루어지고 있는 실정이다. 상기에서 기술한 바와 같이, 아토피가 유소아에 집중적으로 발병된다는 점을 감안한다면 현재 안전한 약제가 절실히 요구되는 상황이며, 아토피는 천식 또는 알러지성 비염 등으로도 발전하여 여러 체내 면역질환을 유발할 수 있으므로 적절한 조기 치료가 요구되고 있다(Eichenfield LF, Janifin JM, Beck LA, Lemanske Jr RF, HA Sampson, Weiss ST, Leung DYM. Atorpic Dermatitis and Asthma: Parallels in the Evolution of Treatment. Pediatrics 2003; 111: 608-616.).
Conventional atopic treatments include steroids, antibiotics, etc. However, existing treatments have not been effective or safe, and cosmetic, medical devices, or herbal remedies have been widely used. As described above, considering that atopy is intensively developed in infants, safe medicines are now in desperate need. Since atopic asthma or allergic rhinitis also develops and may cause various immune diseases in the body, Early treatment is required (Eichenfield LF, Janifin JM, Beck LA, Lemanske Jr RF, HA Sampson, Weiss ST, Leung DYM, Atorpic Dermatitis and Asthma: Parallels in the Evolution of Treatment, Pediatrics 2003; 111: 608-616. ).

이에 본 발명의 발명자들은 천연물로부터 치료효과가 높으면서도 부작용이 적은 알레르기성 피부질환 치료제를 찾고자 연구하던 중, 본 발명의 복분자딸기 뿌리 추출물이 알레르기 질환과 관계된 사이토카인 및 케모카인의 생성을 현저히 억제하며 알레르기 주요 인자인 β-hexosaminidase 및 Histamine의 분비를 억제하는 효과가 뛰어날 뿐만 아니라, 일례로 알레르기성 피부질환 중의 하나인 아토피 유발 동물모델에 적용하였을 때 기존에 사용되어오던 공지의 치료제 이상의 수준으로 치료효과가 있음을 확인하여 본 발명을 완성하였다.
Accordingly, the inventors of the present invention have been studying for a therapeutic agent for an allergic skin disease which has a high therapeutic effect from natural products and has a small side effect. However, the bacterium strawberry root extract of the present invention significantly inhibits the production of cytokines and chemokines related to allergic diseases, It is not only superior in suppressing secretion of β- hexosaminidase and histamine, which is a major factor, but also, for example, when applied to an atopy-induced animal model, which is one of allergic skin diseases, The present invention has been completed.

따라서 본 발명의 목적은, 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating an allergic skin disease comprising an extract of berries of bramble strawberry as an active ingredient.

본 발명의 다른 목적은, 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 개선용 식품 조성물을 제공하는 것이다.
Another object of the present invention is to provide a food composition for preventing or ameliorating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

본 발명의 또 다른 목적은, 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 치료용 피부 외용제를 제공하는 것이다.
Yet another object of the present invention is to provide an external preparation for skin for the prevention or treatment of an allergic skin disease comprising an extract of strawberry root as an active ingredient.

본 발명의 또 다른 목적은, 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 개선용 화장료 조성물을 제공하는 것이다.
Yet another object of the present invention is to provide a cosmetic composition for preventing or ameliorating an allergic skin disease comprising an extract of strawberry root as an active ingredient.

상기 본 발명의 목적을 달성하기 위하여, 본 발명은 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 치료용 약학적 조성물을 제공한다.
In order to achieve the object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

본 발명의 다른 목적을 달성하기 위하여, 본 발명은 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 개선용 식품 조성물을 제공한다.
In order to accomplish another object of the present invention, the present invention provides a food composition for preventing or ameliorating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 치료용 피부 외용제를 제공한다.
In order to accomplish still another object of the present invention, the present invention provides an external preparation for skin for preventing or treating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 개선용 화장료 조성물을 제공한다.
In order to accomplish still another object of the present invention, the present invention provides a cosmetic composition for prevention or improvement of an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

이하, 본 발명을 상세히 설명한다.
Hereinafter, the present invention will be described in detail.

본 발명은 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 치료용 약학적 조성물, 피부 외용제를 제공한다. 또한 본 발명은 복분자딸기 뿌리 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 개선용 식품조성물, 화장료 조성물을 제공한다.
The present invention provides a pharmaceutical composition for preventing or treating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient, and an external preparation for skin. The present invention also provides a food composition and a cosmetic composition for preventing or ameliorating an allergic skin disease comprising an extract of berries of bokbunja as an active ingredient.

상기 복분자딸기(Rubus Coreanus Miquel)는 장미과에 속하는 낙엽관목으로서, 수고 3m 내외로 자라며 수피는 검붉은 색으로 가시가 있고 흰 가루로 덮여있다. 가지 끝이 아래로 처지며 땅에 닿으면 뿌리가 자란다. 어긋나게 달리는 잎은 우상복엽으로 3~7개의 작은잎으로 구성된다. 작은잎은 타원 마름모처럼 생긴 난형으로 끝이 뾰족하고 가장자리에 불규칙한 거치가 있다. 잎자루에 가시가 있다. 5~6월에 가지 끝에서 산방 또는 복산방화서로 분홍색의 꽃이 핀다. 꽃잎은 도란형으로 홍색을 띠고 꽃받침잎은 꽃이 지면 뒤로 말린다. 열매는 둥글고 붉은색에서 검은색으로 익는다. 열매를 복분자라고 하여 식용한다.
Rubus Coreanus Miquel is a deciduous shrub belonging to Rosaceae. It grows up to about 3m in length and has barks of sword-red color with thorns and covered with white powder. When the tip of the branch falls down and touches the ground, the root grows. Leaves are alternate phyllotaxis and consist of 3 ~ 7 small leaves. The small leaf is an elliptical rhombus-like ovate with a pointed end and an irregular mount on the edge. There are thorns on petiole. From May to June, flowers of pink or pink bloom from the tip of the branch or from the end of the branches. Petal is obovate with red color, calyx leaf is dried behind flower. The fruit is round, ripened from red to black. The fruit is called bokbunja and it is edible.

본 발명에서는 복분자딸기의 뿌리 부위(지하부) 만을 사용하는 것을 특징으로 한다.
In the present invention, only the root portion (bottom portion) of the bramble berries is used.

상기 복분자딸기 뿌리 추출물은 추출효율을 증대시키기 위해 원료에 대한 전처리 과정을 포함할 수 있으며, 상기 전처리는 수세, 박피, 절단 또는 세단(세절), 건조, 분쇄 등 일 수 있으나 이에 제한되지 않으며, 예를 들어 복분자딸기 뿌리를 건조 시킨 후 세절하여 사용할 수 있다.
The bramble strawberry root extract may include a pretreatment step for increasing the extraction efficiency. The pretreatment may include washing, peeling, cutting, sieving, drying, and pulverizing. For example, bokbunja strawberry roots can be used after drying.

상기 복분자딸기 뿌리 추출물은 공지의 천연물 추출방법에 의하여 추출될 수 있으며, 예를들어 물, 탄소수 1 내지 6개의 유기용매 및 아임계 또는 초임계 유체로 이루어진 군에서 선택된 하나 이상의 용매로 추출될 수 있으며, 상기 탄소수 1 내지 6개의 유기용매는 탄소수 1 내지 6개의 알코올(alcohol), 아세톤(acetone), 에테르(ether), 벤젠(benzene), 클로로포름(chloroform), 에틸아세테이트(ethyl acetate), 메틸렌클로라이드(methylene chloride), 헥산(hexane), 시클로헥산(cyclohexane), 디에틸에테르(diethyl ether) 및 석유에테르(petroleum ether)로 이루어진 군 중에서 선택된 것일 수 있다. 바람직하게 물 또는 탄소수 1 내지 6[메탄올(C1), 에탄올(C2), 프로판올(C3), 부탄올(C4), 펜탄올(C5), 헥산올(C6)] 개의 알코올 및 이들의 혼합물로 이루어진 군에서 선택된 어느 하나의 용매를 사용하여 추출할 수 있다. 가장 바람직하게 본 발명의 추출용매는 70% 내지 90% (v/v) 에탄올 수용액일 수 있다.
The bramble strawberry root extract may be extracted by a known natural product extraction method and may be extracted with one or more solvents selected from the group consisting of, for example, water, organic solvents having 1 to 6 carbon atoms, and subcritical or supercritical fluids. , The organic solvent having 1 to 6 carbon atoms may be selected from the group consisting of alcohols having 1 to 6 carbon atoms, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride methylene chloride, hexane, cyclohexane, diethyl ether, and petroleum ether. Preferably water or a mixture of 1 to 6 alcohols (methanol (C1), ethanol (C2), propanol (C3), butanol (C4), pentanol (C5), hexanol Can be extracted by using any one of the solvents selected from the above. Most preferably, the extraction solvent of the present invention may be an aqueous 70% to 90% (v / v) ethanol solution.

본 발명의 추출물 추출온도는 특별히 제한되지 아니하며, 예를 들어 1℃ 내지 130℃일 수 있으며, 바람직하게는 10℃ 내지 40℃일 수 있다. 본 발명의 추출물 추출시간은 추출 온도에 따라 특별히 제한되지 아니하며 , 예를 들어 1시간 내지 10일일 수 있으며, 바람직하게 5시간 내지 60시간 동안 추출할 수 있다.
The extraction temperature of the extract of the present invention is not particularly limited and may be, for example, from 1 ° C to 130 ° C, preferably from 10 ° C to 40 ° C. The extraction time of the extract of the present invention is not particularly limited depending on the extraction temperature, and can be, for example, 1 hour to 10 days, preferably 5 hours to 60 hours.

본 발명 추출물은 공지의 천연물 추출법으로 추출될 수 있다. 예를 들어 냉침추출, 상온추출, 열수추출, 초음파 추출, 환류냉각 추출, 가열 추출법으로 추출할 수 있으며, 바람직하게는 열수 추출법 또는 상온 추출법으로 추출할 수 있고, 1회 내지 10회 반복 추출할 수 있다.
The extract of the present invention can be extracted by a known natural substance extraction method. For example, it can be extracted by a cold extraction, a normal temperature extraction, a hot water extraction, an ultrasonic extraction, a reflux cooling extraction, a heating extraction method, preferably a hot water extraction method or a room temperature extraction method, have.

본 발명의 추출물은 여과 및/또는 농축하여 액상으로 사용할 수 있고, 분무건조 또는 동결건조 등 통상의 건조 공정을 통하여 고형화하여 사용할 수 있다. 상기 건조 공정에서는 분무건조 또는 동결건조 전 덱스트린 등을 혼합하여 건조할 수 있다.
The extract of the present invention can be used in the form of a liquid by filtration and / or concentration, and solidified through a conventional drying process such as spray drying or freeze drying. In the drying step, dextrin or the like may be mixed and dried before spray drying or freeze drying.

본 발명의 복분자딸기 뿌리 추출물은 알레르기성 피부 질환에 대한 예방, 개선, 및 치료효과를 가지는 것이 그 특징으로서, 알레르기 관련 주요인자인 β-hexosaminidase 및 Histamine 분비를 억제하는 효과가 뛰어날 뿐만아니라, 알레르기성 사이토카인 및 케모카인의 생성을 현저하게 억제하며, 이러한 효능은 공지의 알레르기 피부질환 치료제(특히 아토피 치료제로 알려진 타크로리무스)와 비교하여도 효과가 현저한 것이 그 특징이다.
The bacterium strawberry root extract of the present invention is characterized by having preventive, ameliorating, and therapeutic effects against allergic skin diseases. It is excellent in the effect of suppressing β -hexosaminidase and histamine secretion, which are major factors related to allergy, Cytokine and chemokine production, and this effect is remarkable in comparison with a known therapeutic agent for allergic skin diseases (in particular, tacrolimus, which is known as an atopic treatment agent).

이는 본 발명의 실시예에 잘 나타나 있다.
This is well illustrated in the embodiments of the present invention.

본 발명의 일실시예에서는 복분자딸기 뿌리에 대하여 열수, 메탄올, 에탄올, 아세톤 추출물을 각각 제조하고, in vitro 상에서 이들 추출물의 항알러지 효능을 평가하였다. 상기 추출물들을 비만세포인 HMC-1 세포에 처리한 결과, 본 발명의 복분자 딸기 뿌리 추출물은 IL-4, IL-5, IL-12, IFN-γ, TNF-α, TARC 등의 알레르기성 사이토카인 및 케모카인 단백질과 이들의 mRNA 발현을 억제하는 효능 탁월하고, β-hexosaminidase 및 Histamine 분비를 억제하는 효과가 뛰어남을 확인하였다. 이러한 효과는 특히 복분자딸기 뿌리의 에탄올 추출물이 가장 좋았으며, 뿐만아니라 본 발명의 복분자딸기 뿌리 추출물은 복분자(열매)와 비교하여 우수한 효능을 나타내었다.
In one embodiment of the present invention, hydrothermal, methanol, ethanol and acetone extracts were prepared from the berry raspberry roots, and the antiallergic effect of these extracts was evaluated in vitro . As a result of treatment of the above extracts with HMC-1 cells as mast cells, the bacterium strawberry root extract of the present invention was found to have an allergic cytokine such as IL-4, IL-5, IL-12, IFN- ?, TNF- ?, TARC And chemokine protein and their mRNA expression, and was found to excel in inhibiting the secretion of β -hexosaminidase and histamine. This effect was particularly good with the ethanol extract of berry strawberry root, The extracts of bokbunja strawberry root showed better efficacy than the bokbunja (fruit).

또한 본 발명의 다른 일실시예에서는 알레르기성 피부질환 중의 하나로서 일례로 아토피가 유도된 마우스 피부에 본 발명의 복분자딸기 뿌리 추출물을 도포하여 in vivo 상에서 추출물의 항알러지 효능을 평가하였다. 그 결과 본 발명의 복분자딸기뿌리 추출물은 각질, 전반적 홍반, 삼출성 가피의 형성, 출혈, 부종 등의 증상을 현저히 개선하는 결과를 보였으며, 이러한 효과는 공지의 아토피 치료제인 타크로리무스(tacrolimus)와 비교하여 동등 내지 그 이상의 수준으로 치료 효과를 나타내었다(실시예 5 참조). 따라서 본원 발명의 조성물(추출물)을 이용할 경우, 아토피와 같은 알레르기성 피부질환 치료에 우수한 효과를 보이는 것을 확인하였다.
In another embodiment of the present invention, the anti-allergic effect of the extract is evaluated in vivo by applying the bacterium strawberry root extract of the present invention to atopic skin-induced mouse skin as one of the allergic skin diseases. As a result, the bokbunja strawberry root extract of the present invention remarkably improved symptoms such as keratin, general erythema, exudative epithelium formation, hemorrhage, and edema, and this effect is remarkably improved as compared with the known atopic treatment agent tacrolimus And exhibited therapeutic effects at the same level or higher (see Example 5). Therefore, when the composition (extract) of the present invention was used, it was confirmed that it exerts excellent effects in the treatment of allergic skin diseases such as atopy.

본 발명에 따른 약학적 조성물은 본 발명의 복분자딸기 뿌리 추출물을 단독으로 함유하거나 또는 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 추가로 함유할 수 있다. 상기에서 "약학적으로 허용되는" 이란 생리학적으로 허용되고 인간에게 투여될 때, 활성성분의 작용을 저해하지 않으며 통상적으로 위장 장애, 현기증과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 비독성의 조성물을 말한다.
The pharmaceutical composition according to the present invention may contain the bramble strawberry root extract of the present invention alone, or may further contain one or more pharmaceutically acceptable carriers, excipients or diluents. The term "pharmaceutically acceptable" as used herein means a non-toxic composition which is physiologically acceptable and which, when administered to humans, does not inhibit the action of the active ingredient and does not normally cause an allergic reaction such as gastrointestinal disorder, dizziness, .

약학적으로 허용되는 담체로는 예컨대, 경구 투여용 담체 또는 비경구 투여용 담체를 추가로 포함할 수 있다. 경구 투여용 담체는 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등을 포함할 수 있다. 또한, 비경구 투여용 담체는 물, 적합한 오일, 식염수, 수성 글루코오스 및 글리콜 등을 포함할 수 있으며, 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다. 본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현택제 등을 추가로 포함할 수 있다. 그 밖의 약학적으로 허용되는 담체 및 제제는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다(Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. In addition, the carrier for parenteral administration may contain water, a suitable oil, a saline solution, an aqueous glucose and a glycol, and may further contain a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, etc. in addition to the above components. Other pharmaceutically acceptable carriers and preparations can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

본 발명의 조성물은 인간을 비롯한 포유동물에 어떠한 방법으로도 투여할 수 있다. 예를 들면, 경구 또는 비경구적으로 투여할 수 있다. 비경구적인 투여방법으로는 이에 한정되지는 않으나, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장내 투여일 수 있다.
The composition of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal administration Lt; / RTI >

본 발명의 약학적 조성물은 상술한 바와 같은 투여 경로에 따라 경구 투여용 또는 비경구 투여용 제제로 제형화 할 수 있다.The pharmaceutical composition of the present invention can be formulated into oral preparations or parenteral administration preparations according to the administration route as described above.

경구 투여용 제제의 경우에 본 발명의 조성물은 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 슬러리제, 현탁액 등으로 당업계에 공지된 방법을 이용하여 제형화될 수 있다. 예를 들어, 경구용 제제는 활성성분을 고체 부형제와 배합한 다음 이를 분쇄하고 적합한 보조제를 첨가한 후 과립 혼합물로 가공함으로써 정제 또는 당의정제를 수득할 수 있다. 적합한 부형제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨 및 말티톨 등을 포함하는 당류와 옥수수 전분, 밀 전분, 쌀 전분 및 감자 전분 등을 포함하는 전분류, 셀룰로즈,메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 등을 포함하는 셀룰로즈류, 젤라틴, 폴리비닐피롤리돈 등과 같은 충전제가 포함될 수 있다. 또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있다. 나아가, 본 발명의 약학적 조성물은 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.In the case of a preparation for oral administration, the composition of the present invention may be formulated into a powder, a granule, a tablet, a pill, a sugar, a tablet, a liquid, a gel, a syrup, a slurry, . For example, an oral preparation can be obtained by combining the active ingredient with a solid excipient, then milling it, adding suitable auxiliaries, and then processing the mixture into a granular mixture. Examples of suitable excipients include, but are not limited to, sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches including corn starch, wheat starch, rice starch and potato starch, Cellulose such as methylcellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose and the like, fillers such as gelatin, polyvinylpyrrolidone and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may optionally be added as a disintegrant. Further, the pharmaceutical composition of the present invention may further comprise an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and an antiseptic agent.

비경구 투여용 제제의 경우에는 주사제, 크림제, 로션제, 외용연고제, 오일제, 보습제, 겔제, 에어로졸 및 비강 흡입제의 형태로 당업계에 공지된 방법으로 제형화할 수 있다. 이들 제형은 모든 제약 화학에 일반적으로 공지된 처방서인 문헌(Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, PA,1995)에 기재되어 있다.
In the case of a preparation for parenteral administration, it can be formulated by a method known in the art in the form of injection, cream, lotion, external ointment, oil, moisturizer, gel, aerosol and nasal aspirate. These formulations are described in Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, Pa., 1995, which is a commonly known formulary for all pharmaceutical chemistries.

본 발명의 조성물의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)으로 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 본 발명의 약학적 조성물은 질환의 정도에 따라 유효성분의 함량을 달리할 수 있다. 바람직하게 본 발명의 약학적 조성물의 바람직한 전체 용량은 1일당 환자 체중 1㎏ 당 약 0.01㎍ 내지 1,000mg, 가장 바람직하게는 0.1㎍ 내지 500mg일 수 있다. 그러나 상기 약학적 조성물의 용량은 제제화 방법, 투여 경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이 및 배설율등 다양한 요인들을 고려하여 환자에 대한 유효 투여량이 결정되는 것이므로, 이러한 점을 고려할 때 당 분야의 통상적인 지식을 가진 자라면 본 발명의 조성물의 적절한 유효 투여량을 결정할 수 있을 것이다. 본 발명에 따른 약학적 조성물은 본 발명의 효과를 보이는 한 그 제형, 투여 경로 및 투여 방법에 특별히 제한되지 아니한다.
The total effective amount of the composition of the present invention may be administered to a patient in a single dose and may be administered by a fractionated treatment protocol administered over a prolonged period of time in multiple doses. In the pharmaceutical composition of the present invention, the content of the active ingredient may be varied depending on the degree of the disease. Preferably, the total preferred dose of the pharmaceutical composition of the present invention may be from about 0.01 μg to 1,000 mg, and most preferably from 0.1 μg to 500 mg, per kilogram of patient body weight per day. However, the dosage of the pharmaceutical composition may be determined depending on various factors such as the formulation method, administration route and frequency of treatment, as well as the patient's age, body weight, health condition, sex, severity of disease, diet and excretion rate, It will be possible to determine the appropriate effective dose of the composition of the present invention by those of ordinary skill in the art in view of this point. The pharmaceutical composition according to the present invention is not particularly limited to its formulation, administration route and administration method as long as the effect of the present invention is exhibited.

본 발명의 피부 외용제는 유효성분으로서 복분자딸기 뿌리 추출물을 포함하며 약제학적으로 허용 가능한 담체를 포함할 수 있다. 이외에도, 추가 적으로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭 또는 피부용 외용제에 통상적으로 사용되는 임의의 다른 성분과 같은 피부 과학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있다. 또한, 상기 성분들은 피부 과학분야에서 일반적으로 사용되는 양으로 도입될 수 있다.The external preparation for skin of the present invention includes a berry extract of berries as an active ingredient and may include a pharmaceutically acceptable carrier. In addition, A thickening agent, a foaming agent, a fragrance, a surfactant, water, an ionic or non-ionic emulsifier, a filler, a metal ion, a surfactant, an antioxidant, In the field of dermatology, such as sequestering and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or any other ingredient conventionally used in external preparations for skin And may contain auxiliary agents used. In addition, the components can be introduced in amounts commonly used in the dermatology field.

상기 피부 외용제에 복분자딸기 뿌리 추출물의 투여량은 0.0001 내지 1000 ㎎/㎏이고, 바람직하게는 0.001 내지 100 ㎎/㎏이며, 이에 제한되는 것은 아니다. 투여량은 특정 환자의 체중, 연령, 성별, 건강상태, 여기간, 제거율, 질환의 중증도 등에 따라 변화될 수 있다.
The dose of the bokbunja strawberry root extract to the external preparation for skin is 0.0001 to 1000 mg / kg, preferably 0.001 to 100 mg / kg, but is not limited thereto. The dose may vary depending on the weight, age, sex, health condition, age, elimination rate, severity of disease, etc. of the particular patient.

상기 피부 외용제의 제제 형태로는 이에 한정되지는 않으나 예를 들면, 액상도포제, 분무제, 로션제, 겔제, 파스타제, 연고제, 에어로졸, 분말제, 경피흡수제 등이 있다.
Examples of the form of the external preparation for skin include, but are not limited to, liquid coating agents, spray agents, lotions, gels, pastes, ointments, aerosols, powders and transdermal absorbers.

본 발명의 외용제에서 약학적으로 허용되는 담체로는 그의 제형에 따라 다르나, 바셀린, 유동 파라핀, 겔화 탄화수소(플라스티베이스) 등의 탄화수소류; 중쇄지방산트리글리세라이드, 돈지, 하드 팻, 카카오지 등의 동식물성 오일; 세탄올, 스테아릴알코올, 스테아린산, 팔미틴산이소프로필 등의 고급지방산 알코올 및 지방산 및 그의 에스테르류; 폴리에틸렌글리콜, 1,3-부틸렌글리콜, 글리세롤, 젤라틴, 백당, 당알코올 등의 수용성 기제; 글리세린 지방산 에스테르, 스테아린산폴리옥실, 폴리옥시에틸렌경화 피마자유 등의 유화제; 아크릴산에스테르, 알긴산나트륨 등의 점착제; 액화석유가스, 이산화탄소 등의 분사제; 파라옥시벤조산에스테르류 등의 방부제 등을 들 수 있다. 또한, 이들 외에도 안정제, 향료, 착색제, pH 조정제, 희석제, 계면활성제, 보존제, 항산화제 등을필요에 따라 배합할 수 있다. 본 발명의 외용제의 사용은 통상의 방법에 의해 알레르기성 피부질환(특히 아토피) 환부에 도포하는 것이 바람직하다.
Pharmaceutically acceptable carriers in the external preparation of the present invention include, but are not limited to, hydrocarbons such as vaseline, liquid paraffin, gelling hydrocarbons (plastid base); Vegetable oils such as medium-chain fatty acid triglycerides, lard, hard fat, cacao butter and the like; Higher fatty alcohols such as cetanol, stearyl alcohol, stearic acid and isopropyl palmitate; fatty acids and esters thereof; Water-soluble bases such as polyethylene glycol, 1,3-butylene glycol, glycerol, gelatin, white sugar, sugar alcohol and the like; Emulsifiers such as glycerin fatty acid esters, polyoxyl stearate, and polyoxyethylene hardened castor oil; Acrylic acid ester, and sodium alginate; Jet agents such as liquefied petroleum gas and carbon dioxide; And preservatives such as paraoxybenzoic acid esters. In addition to these, a stabilizer, a flavoring agent, a coloring agent, a pH adjuster, a diluent, a surfactant, a preservative, an antioxidant, and the like can be optionally incorporated. The use of the external preparation of the present invention is preferably applied to an allergic skin disease (particularly atopic disease) by a conventional method.

또한, 본 발명에 따른 외용제는 통상적인 반창고의 창상 박리 커버 등과 같은 고체 지지체 상에 점착되어 사용될 수 있다. 점착은 본 발명의 복분자딸기 뿌리 추출물을 고체 지지체에 포화시킨 후 탈수시켜 달성할 수 있다.바람직하게는 고체 지지체를 먼저 점착제로 피복하여 고체 지지체에 본 발명의 복분자딸기 뿌리 추출물의 부착을 향상시킬 수 있다. 점착제의 예로는 폴리아크릴레이트 및 시아노아크릴레이트 등이 있다. 이러한 형태의 제형은, 예를 들어 천공된 플라스틱 필름 형태의 비부착성 상처 박리 커버를 갖는 반창고(Smith & Nephew Ltd); Johnson& Johnson의 얇은 스트립(strip), 패취(patch), 스팟(spot), 가소성 스트립 형태의 밴드-에이드(BAND-AID); Colgate-Palmolive Co.(Kendall)의 큐리티 큐러드 오우취리스(Curity CURAD Ouchless) 반창고; 및 American White Cross Laboratories Inc.의 스틱-타이트(STIK-TITE) 탄성 스트립을 들 수 있다. 본 발명의 복분자딸기 뿌리 추출물은 이러한 형태의 제형에 유효성분으로서 적용될 수 있다.In addition, the external preparation according to the present invention can be used by being adhered to a solid support such as a wound dressing cover of a conventional bandage. Adhesion can be achieved by saturating the bramble strawberry root extract of the present invention with a solid support, followed by dehydration. Preferably, the solid support is first coated with a pressure sensitive adhesive to enhance adhesion of the bramble strawberry root extract of the present invention to a solid support have. Examples of the pressure-sensitive adhesive include polyacrylate and cyanoacrylate. This type of formulation includes, for example, a bandage (Smith & Nephew Ltd) having a non-adhesive wound peel-off cover in the form of a perforated plastic film; Johnson & Johnson's thin strips, patches, spots, band-aids in the form of plastic strips (BAND-AID); Curity CURAD Ouchless from Colgate-Palmolive Co. (Kendall) Bandage; And STIK-TITE elastic strips from American White Cross Laboratories Inc. The bramble strawberry root extract of the present invention can be applied as an active ingredient to this type of formulation.

본 발명의 식품 조성물은 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food) 및 식품 첨가제(food additives) 등의 모든 형태를 포함한다. 상기 유형의 식품 조성물은 당 업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food and food additives. Food compositions of this type may be prepared in a variety of forms according to conventional methods known in the art.

예를 들면, 건강식품으로는 본 발명의 복분자딸기 뿌리 추출물을 차, 쥬스 및 드링크의 형태로 제조하여 음용하도록 하거나, 과립화, 캡슐화 및 분말화 하여 섭취할 수 있다. 또한, 본 발명의 복분자딸기 뿌리 추출물을 알레르기성 피부질환(특히 아토피)에 대하여 효과가 있다고 알려진 공지의 물질 또는 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다. 예를 들어 본 발명의 식품 조성물은 복분자딸기 뿌리 추출물 성분 이외에 미량의 미네랄, 비타민, 지질, 당류 및 공지의 항알레르기 활성을 가진 성분 등을 추가로 함유할 수 있다. 상기 미네랄로는 칼슘, 철 등 성장기에 필요한 영양성분이 함유될 수 있으며 비타민으로는 비타민 C, 비타민 E, 비타민 B1, 비타민 B2, 비타민 B6 등이 함유될 수 있다. 지질로는 알콕시글리세롤 또는 레시틴 등이 함유될 수 있으며 당류로는 프락토올리고당 등이 함유될 수 있다.
For example, as a health food, the bokbunja strawberry root extract of the present invention may be prepared in the form of tea, juice, and drink, and may be ingested, granulated, encapsulated and powdered. In addition, the bramble strawberry root extract of the present invention can be prepared in the form of a composition by mixing it with a known substance or active ingredient known to be effective for allergic skin diseases (especially atopic). For example, the food composition of the present invention may further contain trace minerals, vitamins, lipids, saccharides, and components having known antiallergic activity in addition to berry extract of strawberry root. The minerals may include nutrients necessary for growing period such as calcium and iron. Vitamins may include vitamin C, vitamin E, vitamin B1, vitamin B2, and vitamin B6. The lipid may include alkoxyglycerol or lecithin, and the saccharides may include fructo-oligosaccharides and the like.

또한, 기능성 식품으로는 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마아말레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지콘비이프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치이즈 등), 식용식물유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 본 발명의 복분자딸기 뿌리 추출물을 첨가하여 제조할 수 있다.Functional foods also include beverages (including alcoholic beverages), fruits and their processed foods (e.g., canned fruits, bottled, jam, maalmalade, etc.), fish, meat and processed foods such as ham, Etc.), breads and noodles (eg udon, buckwheat noodles, ramen noodles, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, , Retort food, frozen food, various seasonings (e.g., soybean paste, soy sauce, sauce, etc.) by adding the bokbunja strawberry root extract of the present invention.

또한, 본 발명의 복분자딸기 뿌리 추출물을 식품 첨가제의 형태로 사용하기 위해서는 분말 또는 농축액 형태로 제조하여 사용할 수 있다.
Further, in order to use the bokbunja strawberry root extract of the present invention in the form of a food additive, it may be used in the form of powder or concentrate.

본 발명의 식품 조성물 중 복분자딸기 뿌리 추출물의 바람직한 함량은 식품 조성물 총 중량에 대하여 식품의 전체 중량을 기준으로 0.01∼90%, 바람직하게는 0.1∼50%의 비율로 함유될 수 있다.
The desirable content of the bokbunja strawberry root extract in the food composition of the present invention may be 0.01 to 90%, preferably 0.1 to 50%, based on the total weight of the food composition, based on the total weight of the food composition.

본 발명의 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 본 발명의 복분자딸기 뿌리 추출물 이외에도 피부과학적으로 허용 가능한 매질 또는 기제를 함유함으로써 피부과학 분야에서 통상적으로 사용되는 국소적용 또는 전신적용할 수 있는 보조제 형태로 제조될 수 있다.The cosmetic composition of the present invention comprises Can be prepared in any formulation conventionally produced in the art and can be applied topically or systemically, which is commonly used in the field of dermatology, by containing a dermatologically acceptable medium or base in addition to the bramble rootberry root extract of the present invention ≪ / RTI >

또한, 본 발명의 화장료 조성물은 복분자딸기 뿌리 추출물에 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온 봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭 또는 화장품에 통상적으로 사용되는 임의의 다른 성분과 같은 화장품학 또는 피부과학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있다. 그리고 상기의 성분들은 피부과학 분야에서 일반적으로 사용되는 양으로 도입될 수 있다.
In addition, the cosmetic composition of the present invention may further contain a fatty substance, an organic solvent, a solubilizer, a thickening agent and a gelling agent, a softening agent, an antioxidant, a suspending agent, a stabilizer, a foaming agent, , Water, ionic or nonionic emulsifiers, fillers, sequestering agents and chelating agents, preservatives, vitamins, barrier agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or cosmetics And any other ingredients used, such as cosmetics or adjuvants commonly used in the field of dermatology. And the above ingredients may be introduced in amounts commonly used in the dermatology field.

적합한 화장료 조성물의 제형으로는 예를 들면 용액, 겔, 고체 또는 반죽 무수 생성물, 수상에 유상을 분산시켜 얻은 에멀젼, 현탁액, 마이크로에멀젼, 마이크로캡슐, 미세과립구 또는 이온형(리포좀), 비이온형의 소낭 분산제의 형태, 크림, 스킨, 로션, 파우더, 연고, 스프레이 또는 콘실 스틱(conceal stick)의 형태로 제공될 수 있다. 또한, 포말(foam)의 형태 또는 압축된 추진제를 더 함유한 에어로졸 조성물의 형태로도 제조될 수 있다.
Formulations of suitable cosmetic compositions include, for example, solutions, gels, solid or paste anhydrous products, emulsions obtained by dispersing the oil phase in water, suspensions, microemulsions, microcapsules, microgranules or ionic (liposomes) In the form of a foliar dispersant, in the form of a cream, a skin, a lotion, a powder, an ointment, a spray or a conceal stick. It can also be prepared in the form of a foam or an aerosol composition further containing a compressed propellant.

본 발명의 화장료 조성물을 첨가할 수 있는 제품으로는 이에 한정되는 것은 아니나 스킨로션, 스킨 소프너, 스킨토너, 수렴화장수, 유연화장수, 영양화장수, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 바디 크림, 마사지크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 영양에센스, 팩, 비누, 샴푸, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 트리트먼트, 미용액, 유액, 프레스파우더, 루스파우더, 아이섀도 등의 제형을 포함한다.
Examples of the cosmetic composition to which the cosmetic composition of the present invention can be added include but are not limited to skin lotion, skin softener, skin toner, convergent lotion, softening longevity, nutritional lotion, astringent, lotion, milk lotion, Cream, Massage Cream, Nourishing Cream, Moisture Cream, Hand Cream, Essence, Nutrition Essence, Pack, Soap, Shampoo, Cleansing Foam, Cleansing Lotion, Cleansing Cream, Body Lotion, Body Cleanser, Treatment, Serum, Milk, Press Powder, Loose powder, eye shadow, and the like.

상기 본 발명의 화장료 조성물에 함유되는 복분자딸기 뿌리 추출물의 함량은 화장료 조성물 총 중량에 대하여 0.0001 내지 50 중량%, 바람직하게는 0.01 내지 10 중량% 범위로 함유될 수 있다.
The content of the berry extract of strawberry root contained in the cosmetic composition of the present invention may be 0.0001 to 50% by weight, preferably 0.01 to 10% by weight based on the total weight of the cosmetic composition.

본 발명의 복분자딸기 뿌리 추출물은 알레르기성 피부 질환에 대한 예방, 개선, 및 치료효과를 가지는 것이 그 특징으로서, 알레르기 관련 주요인자인 β-hexosaminidase 및 Histamine 분비를 억제하는 효과가 뛰어날 뿐만아니라, 알레르기성 사이토카인 및 케모카인의 생성을 현저하게 억제하며, 이러한 효능은 공지의 알레르기 피부질환 치료제(타크로리무스)와 비교하여도 효과가 현저한 것이 그 특징이다. The bacterium strawberry root extract of the present invention is characterized by having preventive, ameliorating, and therapeutic effects against allergic skin diseases. It is excellent in the effect of suppressing β -hexosaminidase and histamine secretion, which are major factors related to allergy, Cytokine and chemokine production, and this effect is remarkable in comparison with a known therapeutic agent for allergic skin disease (tacrolimus).

도 1은 복분자딸기 뿌리의 열수, 메탄올, 에탄올, 아세톤 추출물을 통상적으로 알레르기 반응 측정에 사용되는 인간 비만세포주인 HMC-1 세포에 처리하여, 각각 β-hexosaminidase 및 Histamine의 분비를 측정한 결과를 나타낸 도면이다.
도 2는 복분자딸기 뿌리 에탄올 추출물 또는 복분자 열매 에탄올 추출물을 통상적으로 알레르기반응 측정에 사용되는 인간 비만세포주인 HMC-1 세포에 처리하여, 각각 β-hexosaminidase 및 Histamine의 분비를 측정한 결과를 나타낸 도면이다.
도 3은 대조군과 실험군에 대하여 NC/Nga 마우스의 피부손상 정도를 직접 촬영한 사진을 나타낸 도면이다(Normal: 정상 마우스, DNCB: 아토피 유발 NC/Nga 마우스, Tacrolimus: 아토피 유발 NC/Nga 마우스에 타크로리무스 처리, 복분자 뿌리: 아토피 유발 NC/Nga 마우스에 복분자딸기 뿌리 에탄올 추출물 처리, 이하의 도면에서 모두 동일한 의미).
도 4는 대조군과 실험군에 대하여 NC/Nga 마우스가 긁는 횟수를 10분간 측정하고 그 값을 그래프로 비교한 도면이다(atopy score: 마우스가 긁는 횟수를 의미).
도 5는 정상 마우스, DNCB에 의해 아토피 유도된 NC/Nga 마우스, DNCB로 아토피 유발 후 아토피치료제(타크로리무스) 처리된 NC/Nga 마우스, DNCB로 아토피 유발 후 복분자딸기 뿌리 에탄올 추출물 처리된 NC/Nga 마우스의 등쪽 피부조직과 귀에서 표피 및 진피를 H&E로 염색하여 광학현미경으로 촬영한 모습을 나타낸다.
도 6은 정상 마우스, DNCB에 의해 아토피 유도된 NC/Nga 마우스, DNCB로 아토피 유발 후 아토피치료제(타크로리무스) 처리된 NC/Nga 마우스, DNCB로 아토피 유발 후 복분자딸기 뿌리 에탄올 추출물 처리된 NC/Nga 마우스의 혈액에서 분리한 혈청의 면역글로블린 IgE 생성량을 ELISA KIT를 이용하여 비교 평가한 결과를 나타낸다.
도 7은 정상 마우스, DNCB에 의해 아토피 유도된 NC/Nga 마우스, DNCB로 아토피 유발 후 아토피치료제(타크로리무스) 처리된 NC/Nga 마우스, DNCB로 아토피 유발 후 복분자딸기 뿌리 에탄올 추출물 처리된 NC/Nga 마우스의 피부조직에서 알레르기 관련 케모카인 및 사이토카인(IL-4, IL-5, IL-12, IFN-γ, TNF-α, 및 TARC)의 mRNA 발현량을 역전사 PCR방법에 의해 비교 평가한 결과를 나타낸다.
도 8(도 8a 내지 도 8c)은 정상 마우스, DNCB에 의해 아토피 유도된 NC/Nga 마우스, DNCB로 아토피 유발 후 아토피치료제(타크로리무스) 처리된 NC/Nga 마우스, DNCB로 아토피 유발 후 복분자딸기 뿌리 에탄올 추출물 처리된 NC/Nga 마우스의 혈액에서 분리한 혈청의 알레르기 관련 케모카인 및 사이토카인(IL-4, IL-5, IL-12, IFN-γ, TNF-α, 및 TARC) 단백질 생성량을 ELISA KIT를 이용하여 비교 평가한 결과를 나타낸다.
FIG. 1 shows the results of measuring the secretion of β- hexosaminidase and histamine by treating hydrothermal, methanol, ethanol and acetone extracts of the bacterium strawberry root with HMC-1 cells, which are commonly used in allergic reactions, as a human obesity cell line FIG.
FIG. 2 is a graph showing the results of measuring the secretion of β- hexosaminidase and histamine by treating bacterium strawberry root ethanol extract or bacterium fruit ethanol extract with HMC-1 cells, a human obesity cell line commonly used for allergic reaction measurement .
FIG. 3 is a photograph showing the degree of skin damage of a NC / Nga mouse in a control and an experimental group (Normal: Normal mouse, DNCB: Atopy-induced NC / Nga mouse, Tacrolimus: Atopy-induced NC / Treatment, Rubus root: atopy induction NC / Nga mouse bramble strawberry root ethanol extract treatment, all the same meaning in the following drawings).
FIG. 4 is a graph comparing the number of scratches of an NC / Nga mouse against a control group and an experimental group for 10 minutes (a graph of the number of scratches of the mouse).
FIG. 5 is a graph showing the results of an NC / Nga mouse treated with atorvastatin (NC) / Nga mouse treated with atorvastatin (Tacrolimus) and DNCB treated with bokbullus strawberry root ethanol And the epidermis and dermis from the ear were stained with H & E and photographed with an optical microscope.
FIG. 6 is a graph showing the results of an NC / Nga mouse treated with atorvastatin (NC) / Nga mouse treated with atopy (Tacrolimus) after atopy induction with DNCB, NC / Nga mouse treated with ethanol extract of bokbule strawberry root after atopy induction with DNCB The results of comparative evaluation of immunoglobulin IgE production of serum isolated from the blood using ELISA KIT are shown.
FIG. 7 is a graph showing the results of an NC / Nga mouse treated with atorvastatin (NC) / Nga mouse treated with an atopy treatment (tacrolimus) with DNCB and a NC / Nga mouse treated with a bacterium strawberry root ethanol extract MRNA expression levels of allergen-related chemokines and cytokines (IL-4, IL-5, IL-12, IFN-y, TNF-α and TARC) .
FIG. 8 (Figs. 8A to 8C) shows normal mice, NC / Nga mice induced by DNCB, NC / Nga mice treated with atopic treatments (tacrolimus) after atopy induction with DNCB, and bokbullus strawberry root ethanol (IL-4, IL-5, IL-12, IFN-γ, TNF-α, and TARC) were determined by immunoblotting with ELISA KIT The results are shown in FIG.

이하 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

통계분석Statistical analysis

모든 실험결과에서 실험군 간의 통계분석은 one-way ANOVA로 각군 간의 평균치에 대한 유의성 검정을 P<0.05 수준에서 분석 하였다. p 값이 0.05 이하인 경우 * 로 도면에 표시하여 나타내었다.
Statistical analysis was performed by one-way ANOVA. The significance of each group was analyzed at the level of P <0.05. When the p value is 0.05 or less, * is shown in the figure.

<실시예 1>&Lt; Example 1 >

복분자딸기 뿌리( Bokbunja strawberry root Rubus coreanus Rubus coreanus Miquel root)의 열수, 메탄올, 에탄올 및 아세톤 추출물 제조Miquel root), methanol, ethanol and acetone extract

복분자딸기 뿌리의 열수, 메탄올, 에탄올, 아세톤 추출물을 제조하기 위해, 강원도 홍천에서 복분자딸기 뿌리를 구입하여 준비하였다. 건조하여 약재의 형태로 세절된 복분자딸기 뿌리 20g을 물 200ml과 혼합하여 100℃에서 2시간 동안 중탕하여 열수 추출물을 제조하였고, 유기용매인 메탄올, 에탄올, 아세톤 추출물은 각각 복분자딸기 뿌리 20g을 각각의 유기용매 80%(v/v) 수용액 200ml과 혼합하여 24℃에서 24시간 동안 방치하여 추출하였다. 각각의 추출물은 감압 흡입 여과기를 이용하여 슬러지와 용액으로 분리하고 용액만 취하였다. 이후 분리한 용액에서 물, 메탄올, 에탄올, 아세톤을 제거하기 위해 농축기(Evaporator, Heidolph vv 2000)를 이용하여 42℃에서 농축함으로써 각각 열수 추출물(3.9g), 메탄올 추출물(3.1g), 에탄올 추출물(3.4g), 아세톤 추출물(3.0g)을 수득하였다.
In order to prepare hot water, methanol, ethanol and acetone extracts of bokbunja strawberry roots, bokbunja strawberry roots were purchased from Hongcheon, Gangwon province. The extracts of methanol, ethanol, and acetone, which are organic solvents, were prepared by mixing 20 g of bokbunja strawberry root with 200 ml of water and boiling at 100 ° C for 2 hours. Was mixed with 200 ml of an aqueous solution of 80% (v / v) of an organic solvent, and the mixture was allowed to stand at 24 占 폚 for 24 hours. Each extract was separated into sludge and solution using a vacuum suction filter and the solution was taken. (3.9g), methanol extract (3.1g) and ethanol extract (3.9g) were obtained by concentrating at 42 ° C using a concentrator (Evaporator, Heidolph vv 2000) to remove water, methanol, 3.4 g) and acetone extract (3.0 g).

<실시예 2>&Lt; Example 2 >

복분자딸기 뿌리(Bokbunja strawberry root Rubus coreanus Rubus coreanus Miquel root)의 열수, 메탄올, 에탄올, 아세톤 추출물의 Miquel root), methanol, ethanol, acetone extract in vitroin vitro 항알러지 효능 평가 Evaluation of anti-allergy efficacy

<2-1>복분자딸기 뿌리(<2-1> Bokbunja strawberry root Rubus coreanus Rubus coreanus Miquel root) 열수, 메탄올, 에탄올, 아세톤 추출물에 의한 비만세포(HMC-1)의 (HMC-1) by hydrothermal, methanol, ethanol, acetone extract βbeta -hexosaminidase 분비 비교-hexosaminidase secretion comparison

β-hexosaminidase 분비는 비만세포의 활성화와 탈과립을 나타내는 주요인자로 널리 사용된다. 따라서 본 연구에서는 인간 비만 세포주인 HMC-1 세포를 이용하여 β-hexosaminidase 분비를 측정 하였다. HMC-1 세포는 1주일에 4-5회 계대하였으며, 배지는 20㎍/ml 젠타마이신 용액과 10% FBS(fetal bovine serum)를 함유한 IMDM(Iscove's modified Dulbecco's Medium) 배지를 이용하여 37℃, 5% CO2의 환경에서 배양하였다. 이렇게 배양된 세포를 이용하여 1x106세포/well의 농도로 24-well plate에 분주하고, 각각 복분자딸기 뿌리의 열수, 메탄올, 에탄올, 아세톤 추출물을 두 가지 농도 조건(최종 농도가 50 및 100㎍/ml이 되는 각각의 조건)으로 tyrode's buffer(137mM NaCl, 2.7mM KCl, 1.8mM CaCl2, 1.1mM MgCl2, 11.9mM NaHCO3, 0.4mM NaH2PO4, 5.6mM glucose, pH 7.2)에 섞어 세포에 처리하고 30분간 37℃에서 배양한다. 이후 compound 48/80을 6㎍/ml 농도로 첨가하고 다시 37℃에서 30분 동안 배양하였다. 10분간 ice에서 반응을 종결시키고 원심분리하여 세포를 가라앉힌 후, 상등액만을 취하여 상등액 30㎕를 96 well plate로 옮겨 기질인 1mM의 4-p-nitrophenyl-N-acetyl-β-D-glucosaminide 30㎕를 첨가하여 37℃에서 한 시간 반응시켰다. 마지막으로 120㎕의 stop solution(sodium bicarbonate, pH 10.2)으로 반응을 종료시킨 뒤 microplate reader로 405nm에서 흡광도를 측정하였다.
β- hexosaminidase secretion is widely used as a major factor in the activation and degranulation of mast cells. Therefore, in this study, β- hexosaminidase secretion was measured using HMC-1 cells, a human obesity cell line. HMC-1 cells were transfected 4-5 times a week. The medium was cultured in IMDM (Iscove's modified Dulbecco's Medium) medium containing 20 μg / ml gentamycin solution and 10% FBS (fetal bovine serum) And cultured in an environment of 5% CO 2 . The cells were cultured in a 24-well plate at a concentration of 1 × 10 6 cells / well, and the hydrothermal, methanol, ethanol and acetone extracts of the raspberry roots of the bokbule were subjected to two concentration conditions (final concentrations of 50 and 100 μg / ml), and the cells were mixed with tyrode's buffer (137 mM NaCl, 2.7 mM KCl, 1.8 mM CaCl 2 , 1.1 mM MgCl 2 , 11.9 mM NaHCO 3 , 0.4 mM NaH 2 PO 4 , 5.6 mM glucose, pH 7.2) And cultured at 37 ° C for 30 minutes. Compound 48/80 was added at a concentration of 6 / / ml and incubated at 37 캜 for 30 minutes. Completion of the reaction for 10 minutes at ice and centrifuged to then immersed the cell, only the supernatant 30㎕ 96 of the moving substrate with the well plate 1mM 4- p -nitrophenyl-N -acetyl- β -D-glucosaminide 30㎕ ml supernatant And the mixture was reacted at 37 캜 for one hour. Finally, the reaction was terminated with 120 μl stop solution (sodium bicarbonate, pH 10.2) and the absorbance was measured at 405 nm with a microplate reader.

복분자딸기 뿌리의 열수, 메탄올, 에탄올, 아세톤 추출물 각각을 HMC-1 세포에 처리한 후, compound 48/80로 탈과립을 유도하여 분비된 β-hexosaminidase를 비교한 결과를 도 1에 나타내었다. 도 1에서 도시된 바와 같이, 여러 가지 용매 추출물 중 에탄올 추출물에서 β-hexosaminidase 억제 효과가 뛰어난 것으로 확인되었으며, 복분자딸기 뿌리 에탄올 추출물은 β-hexosaminidase 분비를 67% 억제하였다. Figure 1 shows the results of comparing secreted β- hexosaminidase by inducing degranulation in compound 48/80 after treatment of hydrothermal, methanol, ethanol and acetone extracts of bokbunja strawberry root with HMC-1 cells. As shown in FIG. 1, ethanol extract of various solvent extracts showed excellent inhibitory effect on β- hexosaminidase, and ethanol extract of brambleberry strawberry root inhibited β -hexosaminidase secretion by 67%.

<2-2> 복분자딸기 뿌리(<2-2> Bokbunja strawberry root Rubus coreanus Rubus coreanus Miquel root) 열수, 메탄올, 에탄올, 아세톤 추출물에 의한 비만세포(HMC-1)의 Histamine 분비 비교Histamine secretion of mast cell (HMC-1) by hydrothermal, methanol, ethanol and acetone extracts

인간 비만 세포주인 HMC-1 세포로부터 분비되는 히스타민의 농도를 측정하기 위해 HMC-1세포를 배양하여, 1x105 세포/well의 농도로 24-well plate에 24시간 배양하였다. 배양 후 상기 실시예 2-1과 같은 방법으로 각각 복분자딸기 뿌리의 열수, 메탄올, 에탄올, 아세톤 추출물을 농도별(각각 50 및 100㎍/ml)로 처리하여 1시간 동안 배양하였다. 여기에 compound 48/80(10㎍/ml)을 처리하여 20분 동안 배양한 다음 세포 배양액을 수거하였다. 세포배양액 내 히스타민의 농도는 Histamine assay ELISA Kit(Cayman Chemical Company; Ann Arbor, IL, USA)를 사용하여 microplate reader로 450nm에서 흡광도를 측정하였다.
HMC-1 cells were cultured and cultured in a 24-well plate at a concentration of 1 × 10 5 cells / well in order to measure the concentration of histamine secreted from the human mast cell line HMC-1 cells. After culturing, hot water, methanol, ethanol, and acetone extracts of bokbunja strawberry roots were treated with concentrations (50 and 100 μg / ml, respectively) in the same manner as in Example 2-1, and cultured for 1 hour. The cells were treated with compound 48/80 (10 μg / ml) for 20 min, and the cell culture was collected. The concentration of histamine in the cell culture medium was measured with a microplate reader at 450 nm using a Histamine assay ELISA kit (Cayman Chemical Company, Ann Arbor, IL, USA).

복분자딸기 뿌리의 열수, 메탄올, 에탄올, 아세톤 추출물 각각을 처리한 후, compound 48/80로 HMC-1 세포의 히스타민을 유도하여 분비된 히스타민 양을 비교한 결과를 도 1에 나타내었다. 도 1에서 확인할 수 있는 것과 같이, 복분자딸기 뿌리 에탄올 추출물은 54%의 히스타민 분비 억제능력으로 다른 용매 추출물들보다 가장 높은 억제능력을 보여주었다. 이로서 복분자딸기 뿌리 에탄올 추출물은 다른 용매 추출물들에 비해서 알러지에 높은 치유효능을 나타낸다는 것을 알 수 있다. 본 연구의 결과는 복분자딸기 뿌리 에탄올 추출물이 다른 용매 추출물들에 비해서 알러지에 높은 치유효능을 보여줌으로써 복분자딸기 뿌리 에탄올 추출물이 항알러지 조성물에 더 용이하며, 더 넓게는 알러지 치료 또는 약학적 조성물로 사용 가능함을 나타낸다.
Fig. 1 shows the results of histamine-induced secretion of histamine in HMC-1 cells by compound 48/80 after treatment with hydrothermal, methanol, ethanol and acetone extracts of the bokbunja strawberry roots. As can be seen from FIG. 1, the ethanol extract of bokbunja strawberry root showed the highest inhibitory ability than the other solvent extracts due to its ability to inhibit histamine secretion by 54%. This suggests that the ethanol extract of the bokbunja strawberry root has higher healing efficacy than other solvent extracts in allergy. The results of this study showed that the ethanol extract of bokbunja strawberry root showed higher healing efficacy against allergies than other solvent extracts, so that the extract of bokbunja strawberry root ethanol is more easily applied to antiallergic composition and more widely used as allergy treatment or pharmaceutical composition It is possible.

<실시예 3>&Lt; Example 3 >

복분자딸기 뿌리(Bokbunja strawberry root Rubus coreanus Rubus coreanus Miquel root) 및 복분자 열매(Miquel root) and bokbunja Rubus coreanus Rubus coreanus Miquel fruit)의 에탄올 추출물 제조Miquel fruit)

복분자딸기 뿌리의 에탄올 추출물은 상기 실시예 1에서 수득한 것을 이용하였다. 복분자 열매의 에탄올 추출물을 제조하기 위해, 강원도 홍천에서 복분자 열매(복분자 열매는 건조된 한방약재의 상태를 사용)를 구입하여 준비하였다. 건조하여 약재의 형태로 세절된 복분자 열매 20g을 80%(v/v) 에탄올 수용액 200ml과 혼합하여 24℃에서 24시간 동안 방치하여 추출하였다. 복분자 열매 추출물은 감압 흡입 여과기를 이용하여 슬러지와 용액으로 분리하고 용액만 취하였다. 이후 분리한 용액에서 에탄올을 제거하기 위해 농축기(Evaporator, Heidolph vv 2000)를 이용하여 42℃에서 농축함으로써 복분자 열매 에탄올 추출물을 3.5g 수득하였다.
The ethanol extracts of the bokbunja strawberry roots were those obtained in Example 1 above. In order to produce the ethanol extract of the bokbunja fruit, the bokbunja fruit (the bokbunja fruit was used as a dried herbal medicine condition) was prepared and prepared in Hongcheon, Gangwon province. 20 g of berry fruit, which was dried and pulverized in the form of a medicinal product, was mixed with 200 ml of an 80% (v / v) ethanol aqueous solution and left at 24 ° C for 24 hours for extraction. The fruit extract of Bokbunja was separated into sludge and solution using a vacuum suction filter and only the solution was taken. Then, in order to remove ethanol from the separated solution, 3.5 g of ethanol extract of bokbunja was obtained by concentrating the mixture at 42 DEG C using a concentrator (Evaporator, Heidolph vv2000).

<실시예 4><Example 4>

복분자딸기 뿌리(Bokbunja strawberry root Rubus coreanus Rubus coreanus Miquel root) 에탄올 추출물 및 복분자 열매(Miquel root) Ethanol Extract and. Rubus coreanus Rubus coreanus Miquel fruit) 에탄올 추출물의 항알러지 효능 비교Miquel fruit) Antioxidant effect of ethanol extracts

<4-1> 복분자딸기 뿌리(<4-1> Bokbunja strawberry root Rubus coreanus Rubus coreanus Miquel root) 에탄올 추출물 또는 복분자 열매(Miquel root) ethanol extract or bokbull fruit Rubus coreanus Rubus coreanus Miquel fruit) 에탄올 추출물에 의한 비만세포(HMC-1)에서의 Miquel fruit) in ethanol extracts from mast cells (HMC-1) βbeta -hexosaminidase 분비 비교-hexosaminidase secretion comparison

상기 실시예 1과 3에서 제조된 복분자딸기 뿌리 에탄올 추출물 또는 복분자 열매 에탄올 추출물 처리에 의한 HMC-1 세포에서의 β-hexosaminidase 분비 측정은 상기 실시예 2-1에서 수행한 것과 같은 방법으로 수행하였다.
The β- hexosaminidase secretion in the HMC-1 cells by the ethanol extract of the brambleberry strawberry root extract or the bamboo fruit extract prepared in Examples 1 and 3 was measured in the same manner as in Example 2-1.

복분자딸기 뿌리 에탄올 추출물 또는 복분자 열매 에탄올 추출물을 HMC-1 세포에 처리한 후, compound 48/80로 탈과립을 유도하여 분비된 β-hexosaminidase의 양을 비교한 결과를 도 2에 나타내었다. 도 2에서 도시된 바와 같이, 복분자딸기 뿌리 에탄올 추출물은 β-hexosaminidase의 분비를 77% 수준으로 억제하였으며, 복분자 열매 에탄올 추출물은 56% 수준으로 억제하였다. 따라서 복분자딸기 뿌리 에탄올 추출물이 21% 더 높은 β-hexosaminidase 분비 억제능력을 보였다.
Figure 2 shows the results of comparing the amount of secreted β -hexosaminidase by inducing degranulation in compound 48/80 after treatment of HMC-1 cells with ethanol extract of bokbunja strawberry root or bokbunja fruit. As shown in FIG. 2, the ethanol extract of bokbunja strawberry root suppressed the secretion of ? -Hexosaminidase to 77% level and inhibited the extract of bokbunja fruit ethanol to 56% level. Therefore, ethanol extract of bokbunja strawberry root showed 21% higher inhibition of β- hexosaminidase secretion.

<4-2> 복분자딸기 뿌리(<4-2> Bokbunja strawberry root Rubus coreanus Rubus coreanus Miquel root) 에탄올 추출물 또는 복분자 열매(Miquel root) ethanol extract or bokbull fruit Rubus coreanus Rubus coreanus Miquel fruit) 에탄올 추출물에 의한 비만세포(HMC-1)에서의 Histamine 분비 비교Comparison of Histamine Secretion in Mast Cell (HMC-1) by Ethanol Extract of Miquel fruit

상기 실시예 1과 3에서 제조된 복분자딸기 뿌리 에탄올 추출물 또는 복분자 열매 에탄올 추출물 처리에 의한 HMC-1 세포에서의 Histamine 분비 측정은 상기 실시예 2-2에서 수행한 것과 같은 방법으로 수행하였다.
In the HMC-1 cells treated with the extracts of brambleberry strawberry ethanol or bokbulean fruit ethanol prepared in Examples 1 and 3 Histamine secretion measurement was performed in the same manner as in Example 2-2.

복분자딸기 뿌리 에탄올 추출물 또는 복분자 열매 에탄올 추출물을 HMC-1 세포에 처리한 후, compound 48/80로 히스타민을 유도하여 분비된 히스타민의 양을 비교한 결과를 도 2에 나타내었다. 도 2에서 도시된 바와 같이, 복분자딸기 뿌리 에탄올 추출물은 히스타민의 분비를 68% 억제하였고, 복분자 열매 에탄올 추출물은 히스타민의 분비를 50% 억제하였다. 따라서 복분자딸기 뿌리 에탄올 추출물이 18% 더 높은 히스타민 분비 억제능력을 보였다. 본 연구의 결과는 복분자딸기 뿌리 에탄올 추출물이 복분자 열매 에탄올 추출물에 비해서 알러지에 높은 치유효능을 보여줌으로써 복분자딸기 뿌리 에탄올 추출물이 항알러지 조성물에 더 용이하며, 더 넓게는 알러지 치료 또는 약학적 조성물로 사용 가능하다는 것을 시사한다.
The HMC-1 cells were treated with ethanol extract of bokbunja strawberry root or bokbunja fruit, and the amount of histamine secreted by inducing histamine with compound 48/80 was shown in Fig. As shown in FIG. 2, the ethanol extract of bokbunja strawberry root inhibited the secretion of histamine by 68%, and the extract of bokbunja fruit ethanol suppressed the secretion of histamine by 50%. Therefore, ethanol extract of bokbunja strawberry root showed an ability to inhibit histamine secretion by 18%. The results of this study showed that ethanol extract of bokbunja strawberry root showed higher healing efficacy against allergies than that of bokbunjae ethanol extract. Therefore, bokbunja strawberry root ethanol extract is more easily applied to antiallergic composition and more widely used as allergy treatment or pharmaceutical composition This is possible.

<실시예 5>&Lt; Example 5 >

복분자딸기 뿌리 추출물의 아토피 유발 마우스 모델에 대한 For atopy-induced mouse model of bokbunja strawberry root extract In vivoIn vivo 효능 평가 Efficacy evaluation

<5-1> 아토피 유도 및 약물처리<5-1> Atopy induction and drug treatment

무처리군(normal), DNCB 군, tacrolimus 군, 복분자딸기 뿌리 에탄올 추출물군의 총 4그룹으로 나누어, 그룹별로 각각 10마리의 NC/Nga 마우스를 이용해 평가하였다. NC/Nga 마우스의 등 및 목 부위에 제모 크림을 0.1g 도포하고 상처가 나지 않도록 부드러운 티슈를 사용하여 털을 제거 하였다. 미세상처가 아물도록 5일 동안 방치한 후, 주 3회씩 2주간 1% DNCB 200㎕(아세톤:올리브오일=3:1)를 등과 귀에 도포하여 아토피를 유도하였다. 아토피가 유도된 후에는 주 2회씩 4주간 복분자딸기 뿌리 에탄올 추출물을 환부(患部)에 100mg/kg으로 도포하였다. 효능을 비교하기 위하여 아토피 치료제로 사용중인 tacrolimus를 사용하였다. tacrolimus는 아토피 환부에 100mg/kg으로 주 2회씩 4주간 도포하였다.
The groups were divided into four groups: normal, DNCB, tacrolimus, and bokbunja strawberry root ethanol extract groups, and each group was evaluated using 10 NC / Nga mice. 0.1 g of hair removal cream was applied to the back and neck of the NC / Nga mouse and the hair was removed using a soft tissue to prevent scratching. After leaving for 5 days so as to keep the fine scratches, atopic dermatitis was induced by applying 200 μl of 1% DNCB (acetone: olive oil = 3: 1) three times a week for 2 weeks. After the induction of atopy, bokbunja strawberry ethanol extracts were applied to the lesion at 100 mg / kg twice a week for 4 weeks. To compare efficacy, tacrolimus was used as a treatment for atopy. Tacrolimus was applied to the atopic lesion at 100 mg / kg twice a week for 4 weeks.

<5-2> 아토피 모델 쥐 육안 평가<5-2> Atopic Model Mouse Visual Evaluation

tacrolimus 또는 복분자딸기 뿌리 에탄올 추출물 각각의 치료 효과를 평가하기 위하여 육안평가를 실시하였다. 육안평가는 평가지표인 홍반/출혈, 건조/흉터, 부종, 침식/벗겨짐 정도에 따라 피부상태를 4단계(0=absence, 1=mild, 2=moderate, 3=severe)로 평가하여 약 12점 이상이면 아토피 증상이이 최고조에 달하는 것으로 판단하였고, 그 결과는 하기 표 1 내지 표 4에서 보여준다. 또한 NC/Nga 마우스가 긁는 횟수를 10분간 측정하여 도 4와 같이 나타내었다.tacrolimus or bokbunja strawberry root ethanol extracts. The visual evaluation evaluated the skin condition in four steps (0 = absence, 1 = mild, 2 = moderate, 3 = severe) according to the evaluation index of erythema / bleeding, dry / scar, edema, erosion / Or higher, the atopy symptoms reached the peak, and the results are shown in Tables 1 to 4 below. In addition, the number of scratches of the NC / Nga mouse was measured for 10 minutes, as shown in FIG.

정상 NC/Nga 마우스(normal) 육안평가 결과Normal NC / Nga mouse (normal) visual evaluation result (-)(-) 1주1 week 2주2 weeks 3주3 weeks 4주4 weeks 5주5 weeks 6주6 weeks 1One 22 33 44 55 66 77 88 99 1010 1111 1212 erythema/hemorrhageerythema / hemorrhage 1One 00 00 00 00 00 00 00 00 00 00 00 홍반/출혈Erythema dryness/ scarringdryness / scarring 00 00 00 00 00 00 00 00 00 00 00 00 건조/흉터Dry / scar edemaedema 00 00 00 00 00 00 00 00 00 00 00 00 부종edema erosion/excoriationerosion / excoriation 00 00 00 00 00 00 00 00 00 00 00 00 침식/벗겨짐Erosion / exfoliation 합 계Sum 1One 00 00 00 00 00 00 00 00 00 00 00 평균 Average 0.50.5 00 00 00 00 00

DNCB에 의해 아토피 유도된 NC/Nga 마우스 육안평가 결과Atopic evaluation of NC / Nga mice induced by DNCB DNCBDNCB 1주1 week 2주2 weeks 3주3 weeks 4주4 weeks 5주5 weeks 6주6 weeks 1One 22 33 44 55 66 77 88 99 1010 1111 1212 erythema/hemorrhageerythema / hemorrhage 1One 1One 1One 1One 22 22 33 33 22 33 33 22 홍반/출혈Erythema dryness/ scarringdryness / scarring 1One 22 22 22 33 33 33 33 33 33 33 33 건조/흉터Dry / scar edemaedema 00 1One 1One 22 1One 22 33 22 22 22 22 1One 부종edema erosion/excoriationerosion / excoriation 00 22 1One 22 22 33 33 33 33 33 33 33 침식/벗겨짐Erosion / exfoliation 합 계Sum 22 66 55 77 88 1010 1212 1111 1010 1111 1111 99 평균Average 4.54.5 66 99 11.511.5 10.510.5 1010

DNCB로 아토피 유발 후 아토피치료제(타크로리무스) 처리된 NC/Nga 마우스 육안평가NC / Nga mice treated with atopic dermatitis (tacrolimus) after atopy induction with DNCB DNCB+아토피 치료제DNCB + atopy treatment 1주1 week 2주2 weeks 3주3 weeks 4주4 weeks 5주5 weeks 6주6 weeks 1One 22 33 44 55 66 77 88 99 1010 1111 1212 erythema/hemorrhageerythema / hemorrhage 00 1One 1One 1One 22 22 33 33 33 22 22 22 홍반/출혈Erythema dryness/ scarringdryness / scarring 1One 1One 22 33 33 22 33 22 22 22 1One 1One 건조/흉터Dry / scar edemaedema 1One 1One 1One 1One 22 22 33 22 1One 1One 1One 1One 부종edema erosion/excoriationerosion / excoriation 00 1One 22 22 33 33 22 22 22 22 1One 1One 침식/벗겨짐Erosion / exfoliation 합 계Sum 22 44 66 77 1010 99 1111 99 88 77 55 55 평균Average 33 6.56.5 9.59.5 1010 7.57.5 55

DNCB로 아토피 유발 후 복분자딸기 뿌리 에탄올 추출물 처리된 NC/Nga 마우스NC / Nga mouse treated with ethanol extract of bokbunja strawberry root after atopy induction with DNCB DNCB+복분자 뿌리DNCB + Rubus root 1주1 week 2주2 weeks 3주3 weeks 4주4 weeks 5주5 weeks 6주6 weeks 1One 22 33 44 55 66 77 88 99 1010 1111 1212 erythema/hemorrhageerythema / hemorrhage 00 1One 22 22 33 33 33 33 22 1One 1One 1One 홍반/출혈Erythema dryness/ scarringdryness / scarring 1One 1One 22 22 22 22 33 22 22 1One 22 22 건조/흉터Dry / scar edemaedema 00 1One 1One 1One 1One 22 22 1One 1One 1One 1One 00 부종edema erosion/excoriationerosion / excoriation 1One 22 33 33 33 33 22 22 22 22 1One 1One 침식/벗겨짐Erosion / exfoliation 합 계Sum 22 55 88 88 99 1010 1010 88 77 55 55 44 평균Average 3.53.5 88 9.59.5 99 66 4.54.5

2주간(도 3의 0~2week)의 DNCB 처리를 통하여 아토피 유도후, 아토피치료제인 tacrolimus와 복분자딸기 뿌리 에탄올 추출물 각각을 2회씩 4주(도 3의 3~6week)간 100mg/kg으로 도포하여 피부손상상태를 육안으로 관찰한 결과를 도 3 및 상기 표 1~표 4에서 보여준다. 아토피가 유도된 피부는 피부건조로 인한 각질과 전반적 홍반, 삼출성 가피의 형성과 출혈, 부종 등의 여러 증상들이 일어났으며, tacrolimus와 복분자딸기 뿌리 에탄올 추출물에 의해 현저히 좋아지는 현상이 관찰되었다. 특히 복분자딸기 뿌리 에탄올 추출물은 아토피 치료제인 tacrolimus에 비해 더 높게 치유되는 현상을 보였다. 이러한 현상은 NC/Nga 마우스의 긁는 횟수 평가에서도 마찬가지로 동일한 경향을 보여, tacrolimus 처리군에서 보다 복분자딸기 뿌리 에탄올 추출물을 처리한 마우스에서 긁는 현상이 현저하게 감소하였다.
After atopy induction through DNCB treatment for 2 weeks (0 to 2week in FIG. 3), tacrolimus, an atopy treatment, and bokbunja strawberry root ethanol extract were applied twice at 100 mg / kg for 4 weeks (3-6 weeks in FIG. 3) FIG. 3 and Tables 1 to 4 show the results of visually observing the skin damage state. Atopy induced skin showed various symptoms such as keratin and general erythema, formation of exudative skin, hemorrhage and edema due to skin dryness, and a remarkable improvement was observed by tacrolimus and extract of berry strawberry root ethanol. Especially, the extract of strawberry root extract of bokbunja showed higher healing than tacrolimus, an atopic treatment. This phenomenon was also the same in the evaluation of the number of scratching of NC / Nga mice, and the scraping phenomenon in the mice treated with the brambleberry strawberry root ethanol extract was significantly lower than in the tacrolimus treated group.

<5-3> 조직 병리검사<5-3> Histopathology

시험물질 처리 종료 후, 실험군 및 대조군 마우스들의 등 쪽 피부조직(1.5 x 1.5cm)과 귀를 떼어내어 10% 파라포름알데히드에서 24시간 고정한 뒤, 상기 조직들을 파라핀에 충분히 굳힌 후 5㎛로 절편하여 슬라이드 글라스를 제작하였다. H&E(haematoxylin-eosin)을 이용하여 공지의 방법으로 염색을 실시하였고, 광학현미경을 이용하여 표피와 진피의 두께정도를 관찰하여, 그 결과를 도 5에 나타내었다.
After completion of the treatment, the dorsal skin tissue (1.5 x 1.5 cm) and the ear of the experimental and control mice were removed and fixed in 10% paraformaldehyde for 24 hours. The tissues were hardened sufficiently in paraffin, A slide glass was produced. H & E (haematoxylin-eosin) was used for staining by known methods, and the thickness of epidermis and dermis was observed using an optical microscope. The results are shown in Fig.

도 5에 나타낸 것과 같이, DNCB에 의해 아토피 유도된 마우스의 표피에서 각질의 탈락, 표피 비후, 각막비후증(hyperkeratosis)이 관찰되었다. 반면에 아토피 치료제인 tacrolimus와 복분자딸기 뿌리 에탄올 추출물의 처리에 의해 각질의 탈락, 표피 비후, 각막비후증이 현저히 감소된 것을 확인하였으며, 특히 복분자딸기 뿌리 에탄올 추출물에 의한 치료 효과가 더 좋은 것을 확인하였다.
As shown in Fig. 5, skin exfoliation, skin hypertrophy, and hyperkeratosis were observed in the epidermis of atopy-induced mice by DNCB. On the other hand, it was confirmed that the removal of keratin, skin thickening, and corneal thickening was significantly reduced by the treatment with tacrolimus, an atopy treatment, and ethanol extract of bokbunja strawberry root, and it was confirmed that treatment effect of bacille strawberry root ethanol extract was better .

<5-4> 면역글로블린 IgE 측정<5-4> Measurement of immunoglobulin IgE

시험물질 처리 종료 후, DNCB로 아토피가 유도된 대조군 마우스와 복분자딸기 뿌리 에탄올 추출물을 처리한 마우스 및 tacrolimus를 처리한 마우스를 희생시키고 심장에서 혈액을 채취하였고, 이로부터 혈청을 분리하여 IgE 를 측정하였다. 구체적으로 IgE ELISA Kit(BD Biosciences, San Diego, CA)를 사용하여, 항체를 완충용액에 희석하여 96-well plate에 부착하여 4℃에서 밤새 정치하고 매뉴얼에 따라 실험을 진행하였다. IgE의 단백질량은 microplate reader로 450nm에서 흡광도를 측정하였다.
After the treatment of the test substance, mice treated with atorvia-induced atopy by DNCB, ethanol treated with bacterium strawberry root ethanol extract and mice treated with tacrolimus were sacrificed, blood was collected from the heart, and serum was separated therefrom to measure IgE . Specifically, the antibody was diluted in a buffer solution using an IgE ELISA Kit (BD Biosciences, San Diego, Calif.), Adhered to a 96-well plate, allowed to stand overnight at 4 ° C, and the experiment was conducted according to the manual. The amount of IgE protein was measured with a microplate reader at 450 nm.

심장에서 혈액을 채취하여 분리시킨 혈청으로부터 알러지 질환을 매개하는 IgE의 양을 IgE ELISA Kit를 사용하여 측정한 결과를 도 6에 나타내었다. DNCB에 의해 아토피 유도된 NC/Nga 마우스에 비해 tacrolimus와 복분자딸기 뿌리 에탄올 추출물을 도포한 NC/Nga 마우스에서는 IgE가 감소한 것을 확인할 수 있었다. 특히 복분자딸기 뿌리 추출물 처리군은 tacrolimus보다 현저하게 IgE 의 생성이 억제된 것을 확인하였다.
The amount of IgE mediating the allergic disease from the serum separated from the blood collected from the heart was measured using an IgE ELISA kit, and the result is shown in FIG. In comparison with NC / Nga mice induced by DNCB, NC / Nga mice treated with tacrolimus and bacterium strawberry root ethanol extracts showed decreased IgE. Especially, it was confirmed that the production of IgE was significantly inhibited in berry extract of strawberry root extract group than tacrolimus.

<5-5> 케모카인 및 사이토카인 측정<5-5> Measurement of chemokines and cytokines

시험물질 처리 종료 후, DNCB로 아토피 유도된 대조군 마우스와 복분자딸기 뿌리 에탄올 추출물을 처리한 마우스 및 tacrolimus를 처리한 마우스를 희생시키고 피부조직을 적출하여 Trizol을 넣고, 용해될 때까지 homogenizer로 분쇄하여 분쇄된 조직에서 RNA를 추출하였다. 구체적으로 상기 각각의 대조군 및 실험군 마우스로부터 적출된 피부조직에 Trizol을 넣고, 클로로포름(CHCl3)을 첨가하고 혼합한 후, 10분간 방치하여 원심분리 하였다. 원심분리된 상등액을 회수하여 2-propanol을 동량 혼합 후 10분간 방치하였고, 이를 다시 원심분리하여 80% EtOH로 수세하고 건조시켜 RNA를 획득했다. 역전사 PCR에서 AMV 역전사효소, dNTP(Promega, Madison, WI), EX Taq DNA 폴리머라제(Takara Shuzou, Kyoto, Japan)를 이용하여 cDNA를 수득 하였고, 수득한 cDNA는 알러지 관련 케모카인 및 사이토카인의 mRNA 발현량을 확인하는데 사용되었다. 구체적으로 IL-4, IL-5, IL-12, IFN-γ, TNF-α, TARC의 사이토카인 및 케이모카인과 대조군인 GAPDH 각각에 대한 하기 표 5에 기재된 프라이머쌍들을 사용하여 PCR을 수행하였다. 상기 PCR 반응은 94℃에서 1분, 95℃에서 30초, 55-65℃에서 30초, 및 70℃에서 3분의 조건으로 30순환 반복하였다. 상기와 같은 PCR 반응 후, 1.5% 아가로즈 젤 전기영동법을 이용해 반응물을 분석하였고, GelDocTMXR+ (Bio-Rad, Hercules, CA, USA)를 이용하여 이미지화 하고 그 결과를 도 7에 나타내었다. 상기 PCR에 사용된 프라이머는 마크로젠사에 제작하여 사용하였다. 하기 표 5는 역전사 PCR에 사용된 프라이머(primer)의 염기서열이다. After the treatment of the test substance, mice treated with atorvium-induced control mice and bacterium strawberry root ethanol extracts with DNCB and mice treated with tacrolimus were sacrificed, skin tissues were removed, Trizol was added, and the resulting solution was pulverized with a homogenizer until dissolved RNA was extracted from the tissues. Specifically, Trizol was added to the skin tissues extracted from each of the control and experimental mice, and chloroform (CHCl 3 ) was added thereto and mixed. The mixture was allowed to stand for 10 minutes and centrifuged. The centrifuged supernatant was recovered, mixed with the same amount of 2-propanol, allowed to stand for 10 minutes, centrifuged again, washed with 80% EtOH and dried to obtain RNA. CDNA was obtained by reverse transcription PCR using AMV reverse transcriptase, dNTP (Promega, Madison, Wis.), EX Taq DNA polymerase (Takara Shuzou, Kyoto, Japan), and the cDNA obtained showed mRNA expression of allergen-related chemokines and cytokines . Specifically, PCR was performed using the primer pairs described in Table 5 below for each of IL-4, IL-5, IL-12, IFN- ?, TNF- ?, cytokines of TARC and chemokine and control GAPDH Respectively. The PCR reaction was repeated 30 cycles at 94 ° C for 1 minute, 95 ° C for 30 seconds, 55-65 ° C for 30 seconds, and 70 ° C for 3 minutes. After the PCR reaction, the reaction product was analyzed using a 1.5% agarose gel electrophoresis method and imaged using GelDoc TM XR + (Bio-Rad, Hercules, CA, USA). The results are shown in FIG. The primers used in the PCR were prepared and used in Macrogen. Table 5 below is the base sequence of the primers used in the reverse transcription PCR.

또한 각각의 마우스 심장에서 혈액을 채취하여 분리시킨 혈청으로부터 IL-4, IL-5, IL-12, IFN-γ, TNF-α, TARC 단백질의 변화를 각각의 IL-4 Quantikine® Immunoassay Kit, IL-5 Quantikine® Immunoassay Kit, IL-12 Quantikine® Immunoassay Kit, TNF-α Quantikine® Immunoassay Kit, CCL17/TARC Quantikine® Immunoassay Kit (R&D Systems, Minneapolis, MN, USA)를 사용하여 microplate reader로 450nm에서 흡광도를 측정하였다.
In addition, changes in IL-4, IL-5, IL-12, IFN-γ, TNF-α and TARC proteins were measured in the IL-4 Quantikine® Immunoassay Kit, IL -5 Quantikine® Immunoassay Kit, IL-12 Quantikine® Immunoassay Kit, TNF-α Quantikine® Immunoassay Kit, CCL17 / TARC Quantikine® Immunoassay Kit (R & D Systems, Minneapolis, MN, USA).

PCR에 사용된 프라이머 염기서열The primer sequence used in PCR GeneGene 방향direction 프라이머 염기서열 Primer base sequence
(5′to 3′)(5 'to 3')
서열번호SEQ ID NO:
IL-4IL-4 sensesense TCAACCCCCAGCTAGTTGTCATCAACCCCCAGCTAGTTGTCA 1One antisenseantisense CATCGAAAAGCCCGAAAGAGCATCGAAAAGCCCGAAAGAG 22 IL-5IL-5 sensesense AGCACAGTGGTGAAAGAGACCTTAGCACAGTGGTGAAAGAGACCTT 33 antisenseantisense TCCAATGCATAGCTGGTGATTTTCCAATGCATAGCTGGTGATTT 44 IL-12IL-12 sensesense GACACGCCTGAAGAAGATGACGACACGCCTGAAGAAGATGAC 55 antisenseantisense CGCCATTCCACATGTCACTGCCGCCATTCCACATGTCACTGC 66 IFN-γIFN-y sensesense AACGCTACACACTGCATCTAACGCTACACACTGCATCT 77 antisenseantisense GAGCTCATTGAATGCTTGGGAGCTCATTGAATGCTTGG 88 TNF-αTNF-a sensesense CAGGCGGTGCCTATGTCTCCAGGCGGTGCCTATGTCTC 99 antisenseantisense CGATCACCCCGAAGTTCAGTAGCGATCACCCCGAAGTTCAGTAG 1010 TARCTARC sensesense CAGGAAGTTGGTGAGCTGGTATACAGGAAGTTGGTGAGCTGGTATA 1111 antisenseantisense TTGTGTTCGCCTGTAGTGCATATTGTGTTCGCCTGTAGTGCATA 1212 GAPDHGAPDH sensesense AAGCTGTGGCGTGATGGCCGAAGCTGTGGCGTGATGGCCG 1313 antisenseantisense TGGGCCCTCAGATGCCTGCTTGGGCCCTCAGATGCCTGCT 1414

DNCB로 아토피가 유도된 대조군 마우스와 복분자딸기 뿌리 에탄올 추출물을 처리한 마우스 및 tacrolimus를 처리한 마우스를 희생시키고, 적출된 조직에서 추출된 RNA를 각각의 케모카인 및 사이토카인 특이적 프라이머(primer)로 확인한 결과, DNCB에 의해 유도된 아토피 NC/Nga 마우스에 비해 tacrolimus와 복분자딸기 뿌리 에탄올 추출물을 도포한 NC/Nga 마우스의 IL-4, IL-5, IL-12, IFN-γ, TNF-α, TARC의 mRNA 발현량이 감소한 것을 확인하였다(도 7).Control mice with DNCB induced atopy, mice treated with bacterium strawberry root ethanol extract and mice treated with tacrolimus were sacrificed and RNA extracted from the extracted tissues was identified with respective chemokine and cytokine specific primers IL-5, IL-12, IFN-γ, TNF-α, and TARC of NC / Nga mice treated with tacrolimus and bramble root strawberry ethanol extracts compared with atopic NC / Nga mice induced by DNCB (Fig. 7).

또한 심장에서 혈액을 채취하여 분리시킨 혈청으로부터 알러지 질환을 매개하는 케모카인 및 사이토카인의 양을 ELISA Kit를 사용하여 측정한 결과, DNCB에 의해 유도된 아토피 NC/Nga 마우스에 비해 tacrolimus와 복분자딸기 뿌리 에탄올 추출물을 도포한 NC/Nga 마우스의 IL-4, IL-5, IL-12, IFN-γ, TNF-α, TARC가 감소한 것을 단백질 수준에서 확인 하였다(도 8a 내지 도 8c). 특히 본 발명의 복분자딸기 뿌리 추출물은 타크로리무스와 유사하거나 더 높은 수준으로 각각 IL-4, IL-5, IL-12, IFN-γ, TNF-α, TARC 단백질 및 이의 mRNA 발현을 억제함을 확인하였다.
In addition, the amount of chemokines and cytokines mediating allergic diseases from serum collected from the heart was measured using an ELISA kit. As a result, tacrolimus and brambleberry strawberry root ethanol IL-5, IL-12, IFN-y, TNF-alpha and TARC of NC / Nga mice to which the extract was applied (Fig. 8A to Fig. 8C). In particular, it was confirmed that the bacterium strawberry root extract of the present invention inhibits IL-4, IL-5, IL-12, IFN- ?, TNF- ?, TARC protein and mRNA expression thereof at a level similar to or higher than that of tacrolimus .

이상 살펴본 바와 같이, 본원 발명은 복분자딸기 뿌리 추출물의 용도에 관한 것으로, 보다 상세하게는 복분자딸기 뿌리 추출물을 유효성분으로 함유하는 알레르기성 질환의 예방 또는 치료용 약학적 조성물, 식품 조성물, 피부 외용제 및 화장료 조성물에 관한 것이다. As described above, the present invention relates to the use of bokbunja strawberry root extract, and more particularly, to a pharmaceutical composition, food composition, external preparation for skin and skin for preventing or treating an allergic disease containing bokbunja strawberry root extract as an active ingredient To a cosmetic composition.

본 발명의 복분자딸기 뿌리 추출물은 알레르기성 피부 질환에 대한 예방, 개선, 및 치료효과를 가지는 것이 그 특징으로서, 알레르기 관련 주요인자인 β-hexosaminidase 및 Histamine 분비를 억제하는 효과가 뛰어날 뿐만아니라, 알레르기성 사이토카인 및 케모카인의 생성을 현저하게 억제하며, 이러한 효능은 공지의 알레르기 피부질환 치료제(타크로리무스)와 비교하여도 효과가 현저하여 산업상 이용 가능성이 높다.
The bacterium strawberry root extract of the present invention is characterized by having preventive, ameliorating, and therapeutic effects against allergic skin diseases. It is excellent in the effect of suppressing β -hexosaminidase and histamine secretion, which are major factors related to allergy, Cytokine and chemokine production, and this effect is remarkably effective even in comparison with a known therapeutic agent for allergic skin diseases (tacrolimus), and thus is highly industrially applicable.

<110> CHUNG ANG University industry Academic Cooperation Foundation <120> Composition for preventing or treating of allergic skin disease comprising root extract of Rubus coreanus as an active ingredient <130> NP14-0077 <160> 14 <170> KopatentIn 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IL-4 <400> 1 tcaaccccca gctagttgtc a 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for IL-4 <400> 2 catcgaaaag cccgaaagag 20 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IL-5 <400> 3 agcacagtgg tgaaagagac ctt 23 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for IL-5 <400> 4 tccaatgcat agctggtgat tt 22 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IL-12 <400> 5 gacacgcctg aagaagatga c 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for IL-12 <400> 6 cgccattcca catgtcactg c 21 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IFN-gamma <400> 7 aacgctacac actgcatct 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for IFN-gamma <400> 8 gagctcattg aatgcttgg 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer for TNF-alpha <400> 9 caggcggtgc ctatgtctc 19 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for TNF-alpha <400> 10 cgatcacccc gaagttcagt ag 22 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer for TARC <400> 11 caggaagttg gtgagctggt ata 23 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for TARC <400> 12 ttgtgttcgc ctgtagtgca ta 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer for GAPDH <400> 13 aagctgtggc gtgatggccg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for GAPDH <400> 14 tgggccctca gatgcctgct 20 <110> CHUNG ANG University industry Academic Cooperation Foundation <120> Composition for preventing or treating allergic skin disease          containing root extract of Rubus coreanus as an active ingredient <130> NP14-0077 <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IL-4 <400> 1 tcaaccccca gctagttgtc a 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for IL-4 <400> 2 catcgaaaag cccgaaagag 20 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IL-5 <400> 3 agcacagtgg tgaaagagac ctt 23 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for IL-5 <400> 4 tccaatgcat agctggtgat tt 22 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IL-12 <400> 5 gacacgcctg aagaagatga c 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for IL-12 <400> 6 cgccattcca catgtcactg c 21 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IFN-gamma <400> 7 aacgctacac actgcatct 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for IFN-gamma <400> 8 gagctcattg aatgcttgg 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer for TNF-alpha <400> 9 caggcggtgc ctatgtctc 19 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for TNF-alpha <400> 10 cgatcacccc gaagttcagt ag 22 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer for TARC <400> 11 caggaagttg gtgagctggt ata 23 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for TARC <400> 12 ttgtgttcgc ctgtagtgca ta 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer for GAPDH <400> 13 aagctgtggc gtgatggccg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for GAPDH <400> 14 tgggccctca gatgcctgct 20

Claims (7)

복분자딸기 뿌리의 에탄올 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 치료용 약학적 조성물.
A pharmaceutical composition for the prevention or treatment of an allergic skin disease comprising ethanol extract of berry strawberry root as an active ingredient.
복분자딸기 뿌리의 에탄올 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 개선용 식품 조성물.
A food composition for preventing or ameliorating an allergic skin disease comprising an ethanol extract of a bokbunja strawberry root as an active ingredient.
복분자딸기 뿌리의 에탄올 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 치료용 피부 외용제 조성물.
A composition for external application for skin for the prevention or treatment of an allergic skin disease comprising an ethanol extract of bokbunja strawberry root as an active ingredient.
복분자딸기 뿌리의 에탄올 추출물을 유효성분으로 포함하는 알레르기성 피부질환의 예방 또는 개선용 화장료 조성물.
A cosmetic composition for preventing or ameliorating an allergic skin disease comprising an ethanol extract of a bokbunja strawberry root as an active ingredient.
삭제delete 삭제delete 제1항 내지 4항 중 어느 한 항에 있어서, 상기 알레르기성 피부질환은 아토피 피부질환인 것을 특징으로 하는 조성물.The composition according to any one of claims 1 to 4, wherein the allergic skin disease is an atopic skin disease.
KR1020140169145A 2014-11-28 2014-11-28 Composition for preventing or treating of allergic skin disease comprising root extract of Rubus coreanus as an active ingredient KR101749668B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140169145A KR101749668B1 (en) 2014-11-28 2014-11-28 Composition for preventing or treating of allergic skin disease comprising root extract of Rubus coreanus as an active ingredient

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140169145A KR101749668B1 (en) 2014-11-28 2014-11-28 Composition for preventing or treating of allergic skin disease comprising root extract of Rubus coreanus as an active ingredient

Publications (2)

Publication Number Publication Date
KR20160072849A KR20160072849A (en) 2016-06-24
KR101749668B1 true KR101749668B1 (en) 2017-06-22

Family

ID=56343075

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140169145A KR101749668B1 (en) 2014-11-28 2014-11-28 Composition for preventing or treating of allergic skin disease comprising root extract of Rubus coreanus as an active ingredient

Country Status (1)

Country Link
KR (1) KR101749668B1 (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
International Journal of Molecular Medicine, Vol. 29, pp.303-310 (2012)*

Also Published As

Publication number Publication date
KR20160072849A (en) 2016-06-24

Similar Documents

Publication Publication Date Title
KR102113193B1 (en) Composition for improving skin conditions comprising artemisiae annuae herba, centella asiatica and green tea extract or fraction thereof and method for improving skin conditions using the same
KR101367423B1 (en) Pharmaceutical composition and cosmetic compostion for improving skin condition and preparation method thereof
KR20150086982A (en) Composition comprising Polygala tenuifolia extract for preventing or treating atopic dermatitis
KR101782268B1 (en) A composition for treating atopic dermatitis comprising the extract of herbal mixture
KR101705354B1 (en) A composition comprising the alcohol extract of Botrychium ternatum for preventing or treating skin inflammation
EP3042651B1 (en) Composition containing monoacetyldiacylglycerol compound as active ingredient for preventing or treating atopic dermatitis
KR101816739B1 (en) Composition for preventing or treating inflammatory skin disease
KR102119421B1 (en) Composition for Anti-Allergy Using an Extract of Catalpa ovata
KR101842786B1 (en) A composition for treating atopic dermatitis comprising the extract of herbal mixture
KR101749668B1 (en) Composition for preventing or treating of allergic skin disease comprising root extract of Rubus coreanus as an active ingredient
KR102514502B1 (en) Composition for Improving for Atopic Dermatitis, Pruritis, and Inflammation Comprising Sparasis crispa, vegetable worms, and Tuber melanosporum as Active Ingredient
KR102150927B1 (en) Cosmetic and pharmaceutical compositin comprising sasa quelpaertensis extract and urea
KR102087651B1 (en) Composition for Improving Atopy Dermatitis Using an Extract of Careya arborea
KR102106440B1 (en) Composition for improving skin condition comprising blueberry and black rice extract fermented lactic acid bacteria
KR102209969B1 (en) Composition comprising Fritillariae Thunbergii Bulbs extract for preventing or treating atopic dermatitis
KR102088233B1 (en) Composition for Improving Atopy Dermatitis Using an Extract of Ecklonia cava and an Extract of Sargassum horneri
KR102497941B1 (en) Compositions for anti-inflammation and anti-allergy using an extract of Artemisia stolonifera
KR102443334B1 (en) Composition with Anti-Inflammation, Skin Moisturizing, Pruritis Improving, and Skin Regeneration Property Comprising Complex Extract of Hibiscus Syriacus as Active Ingredient
KR20180129691A (en) Composition for anti-inflammatory comprising Ambrosia trifida L extract
KR102048977B1 (en) Composition for Anti-allergy Using Extracts of Ulmus davidiana and Perillae Folium
KR102461785B1 (en) Composition comprising NueDongChungHaCho(Paecilomyces tenuipes) alcohol extract for preventing or treating inflammatory disease
KR102171987B1 (en) Composition for Anti-allergic Using Extract of Fallopia ciliinervis
KR102114674B1 (en) Composition for Anti-Allergy Using an Extract of Gnetum macrostachyum
KR101986008B1 (en) Pharmaceutical composition for preventing or treating atopic dermatitis comprising extract of resveratrol-enriched rice or resveratrol enriched rice callus as an active ingredient
JP2003267880A (en) Composition for antiallergy and antiinflammation

Legal Events

Date Code Title Description
A201 Request for examination
A302 Request for accelerated examination
E902 Notification of reason for refusal
AMND Amendment
E902 Notification of reason for refusal
AMND Amendment
E601 Decision to refuse application
X091 Application refused [patent]
AMND Amendment
J201 Request for trial against refusal decision
J301 Trial decision

Free format text: TRIAL NUMBER: 2016101003606; TRIAL DECISION FOR APPEAL AGAINST DECISION TO DECLINE REFUSAL REQUESTED 20160620

Effective date: 20170424

S901 Examination by remand of revocation
GRNO Decision to grant (after opposition)
FPAY Annual fee payment

Payment date: 20200309

Year of fee payment: 4