KR101709256B1 - Hard candy having low calory, good sweetness and formability - Google Patents

Hard candy having low calory, good sweetness and formability Download PDF

Info

Publication number
KR101709256B1
KR101709256B1 KR1020150079166A KR20150079166A KR101709256B1 KR 101709256 B1 KR101709256 B1 KR 101709256B1 KR 1020150079166 A KR1020150079166 A KR 1020150079166A KR 20150079166 A KR20150079166 A KR 20150079166A KR 101709256 B1 KR101709256 B1 KR 101709256B1
Authority
KR
South Korea
Prior art keywords
composition
hard candy
candy
weight
parts
Prior art date
Application number
KR1020150079166A
Other languages
Korean (ko)
Other versions
KR20160143076A (en
Inventor
서일
김봉찬
임혜진
전세희
정일헌
천희순
한태철
김혜정
Original Assignee
주식회사 삼양사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 삼양사 filed Critical 주식회사 삼양사
Priority to KR1020150079166A priority Critical patent/KR101709256B1/en
Publication of KR20160143076A publication Critical patent/KR20160143076A/en
Application granted granted Critical
Publication of KR101709256B1 publication Critical patent/KR101709256B1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23G—COCOA; COCOA PRODUCTS, e.g. CHOCOLATE; SUBSTITUTES FOR COCOA OR COCOA PRODUCTS; CONFECTIONERY; CHEWING GUM; ICE-CREAM; PREPARATION THEREOF
    • A23G3/00—Sweetmeats; Confectionery; Marzipan; Coated or filled products
    • A23G3/34—Sweetmeats, confectionery or marzipan; Processes for the preparation thereof
    • A23G3/36—Sweetmeats, confectionery or marzipan; Processes for the preparation thereof characterised by the composition containing organic or inorganic compounds
    • A23G3/42—Sweetmeats, confectionery or marzipan; Processes for the preparation thereof characterised by the composition containing organic or inorganic compounds characterised by the carbohydrates used, e.g. polysaccharides
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23G—COCOA; COCOA PRODUCTS, e.g. CHOCOLATE; SUBSTITUTES FOR COCOA OR COCOA PRODUCTS; CONFECTIONERY; CHEWING GUM; ICE-CREAM; PREPARATION THEREOF
    • A23G3/00—Sweetmeats; Confectionery; Marzipan; Coated or filled products
    • A23G3/34—Sweetmeats, confectionery or marzipan; Processes for the preparation thereof
    • A23G3/36—Sweetmeats, confectionery or marzipan; Processes for the preparation thereof characterised by the composition containing organic or inorganic compounds
    • A23G3/48—Sweetmeats, confectionery or marzipan; Processes for the preparation thereof characterised by the composition containing organic or inorganic compounds containing plants or parts thereof, e.g. fruits, seeds, extracts
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/28—Oligosaccharides
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/60—Sugars, e.g. mono-, di-, tri-, tetra-saccharides
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/60—Sugars, e.g. mono-, di-, tri-, tetra-saccharides
    • A23V2250/606—Fructose
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/60—Sugars, e.g. mono-, di-, tri-, tetra-saccharides
    • A23V2250/61—Glucose, Dextrose
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/60—Sugars, e.g. mono-, di-, tri-, tetra-saccharides
    • A23V2250/64—Sugar alcohols

Abstract

The present invention relates to a composition for making a hard candy and a hard candy prepared using the composition, and more particularly to a composition for making a hard candy including sugar and psicose, a low calorie hard candy will be.

Description

[0001] The present invention relates to a low-calorie hard candy having excellent sweetness and moldability,

The present invention relates to a composition for making a hard candy and a hard candy prepared using the composition. More particularly, the present invention relates to a composition for making a hard candy containing sugar and a viscose, and a low calorie hard candy .

Hard candy is generally prepared by heating, concentrating, molding and cooling a saccharide aqueous solution such as sugar or syrup. In recent years, various kinds of sugar alcohols have come to be used as raw materials for hard candy, along with a change in consumers' preferences for low calorie and low calorie and low maze.

Sugars such as sugar syrup and sugar in hard candy are important raw materials affecting not only the role of sweetener but also physical properties such as elasticity of final product and texture. Syrup is used in relatively large quantities in the production of hard candy to prevent recrystallization of sugar.

However, as consumers' interest in health has increased recently, the feeling of rejection of sugar intake is increasing. Particularly, consumers who are on the diet feel the burden of increasing calories from sugar consumption. Consumers also feel burdened by the increase in tooth corrosion due to the consumption of sugars. Sugar and starch syrup candies are not suitable for the food industry, especially the sugar industry trend, which is not suitable for the trend of food culture and low calorie and no additives because sugar content is high. In order to solve this problem, candies and the like are being manufactured using raw materials capable of reducing or replacing saccharides.

Techniques have been developed to reduce the amount of sugar contained in hard candy and increase the use of starch syrup. When a large amount of starch syrup is used in the production of the hard candy, the sweet sweetness expression of the starch becomes blurred by the sweetness of the starch syrup, and the tail comes out, and when the temperature becomes high, it becomes easy to stick to other candy and packing materials, There is a problem that the tail is formed due to the high viscosity during molding and the workability is bad.

Also, the main constituent of starch syrup is fructose maltose and monosaccharide fructose and glucose. Hard candy which mainly uses starch syrup having such saccharide composition has a delicate sweetness like hard candy using sugar, and various high-sweetness sweeteners are additionally used. In addition, hard candy using only a syrup containing a saccharide other than sugar as a main ingredient has a problem of quality deterioration due to moisture absorption, and a problem of manufacturing difficulties such as difficulty in stamp molding.

In general, the viscosity of the candy syrup prior to molding depends on the sugar chain length of the saccharide used. Therefore, the candy syrup prepared by using only the syrup containing monosaccharide such as fructose or glucose and disaccharide such as maltose as the main constituent is lowered in the molding temperature range of the hard candy and is easily melted at the distribution stage, .

Recent developments in hard candy manufacturing have replaced some or all of sugar with sugar alcohols (polyols) in order to provide low calorie and low-caries products. Examples of the alternative raw materials include maltitol, reduced starch syrup, sorbitol, xylitol, and polydextrose.

Double sugar alcohols, especially maltitol syrup, may have problems such as increasing the hygroscopicity of the candy, decreasing the formability during the manufacturing process, and increasing the manufacturing cost. In addition, although a certain effect can be recognized with regard to low calorie properties, the effect of improving the sweetness is insufficient, and most of them are intended to improve insufficient sweetness by adding high-sweetness sweeteners such as aspartame, acesulfame K, Stevia and sucralose.

Therefore, in a hard candy produced by using starch syrup, it is possible to solve problems such as a decrease in viscosity during molding of a hard candy, a deterioration in the quality of a distribution step, and a high hygroscopicity of a hard candy using sugar alcohol, There is still a demand for a hard candy which is improved in moldability, sweetness and sweetness

It is an object of the present invention to provide a candy manufacturing composition capable of replacing starch syrup, improving moldability of the candy and improving workability, and a candy produced from the composition for making candy.

The present invention provides a candy manufacturing composition for improving the sensory characteristics such as taste, sweetness, and taste by regulating the kind and the composition ratio of the saccharide for candy according to the present invention, and a candy produced from the composition for preparing candy.

It is a further object of the present invention to provide a candy which is manufactured from a composition for preparing a low-calorie hard candy, and a composition for making a candy, which has tooth-releasing property and anti-woof property.

In order to solve the above problems, the present invention provides a hard candy composition comprising 40 to 60 parts by weight of sucrose and 1 to 30 parts by weight of sucrose based on 100 parts by weight of the total solid content of the composition for preparing a hard candy, To provide a hard candy made from the composition.

The hardness of the hard candy according to the present invention may be from 4,000 to 20,000 and may have a water content of not more than 4% by weight, for example 1-3% by weight or not more than 2% by weight, based on the weight of the hard candy .

The composition for preparing a hard candy according to the present invention or the hard candy produced therefrom can improve the workability by improving the moldability of the candy by having a certain viscosity value by replacing part or all of the starch syrup with a psicose, A composition for preparing a hard candy having tooth dysplasia, anti-wasting property and low calorie caused by the saccharide saccharide characteristic, and a hard candy prepared therefrom, can be provided.

Sicose is a two-saccharide in which two molecules of glucose are alpha-1-bonded, and two molecules of glucose are bonded to each other. Therefore, there is no reduction reaction, and the browning reaction does not occur. The sweetness has a refreshing characteristic There is an effect of suppressing excessive coloration and improving the sweetness.

D-Sucos is also known to be a non-combinable sugar with little calories (J Agric Food Chem. 2012 Feb 1; 60 (4): 863-9). D-Cycose itself shows low or almost no metabolism by Streptococcus mutans, a causative bacterium of caries, and thus shows non-viability and substantially inhibits the growth of bacteria and the decrease of pH (KR2009-0080088A). ≪ / RTI >

Hereinafter, the present invention will be described in more detail.

The composition for making a hard candy according to the present invention includes sugar and psicose, and may optionally contain starch syrup. For example, the composition for making a hard candy may include 40 to 60 parts by weight of sugar and 1 to 30 parts by weight of Cicosane based on 100 parts by weight of the total solid content of the composition.

Another aspect of the invention relates to candies. The candy according to the present invention is prepared from the above-described composition for preparing a candy. Specifically, predetermined distilled water is added to and mixed with the composition for preparing candy, and the mixture is heated to about 140 to 150 DEG C to concentrate the mixture. Substances such as organic acids, fragrances, and pigments are added thereto and mixed to prepare a mixed concentrate . Thereafter, the mixed concentrate is cooled to a temperature of about 55 to 85 ° C on a cooling plate, and the candy is hardened to prepare a candy (a demolding process) or a stamp to form a candy (stamping process).

The candy produced from the composition for preparing a candy containing the starch syrup of the present invention, especially the hard candy, is excellent in moldability and excellent in sensory properties. In particular, the composition for preparing a hard candy according to the present invention can solve the problem that the viscosity of the candy syrup prepared using only the syrup is lowered in the molding temperature range of the hard candy and the quality of the product is lowered due to easy melting at the distribution stage.

The hardness of the hard candy may be 4,000 to 20,000 and may have a water content of 4% by weight or less, for example, 1-3% by weight, or 2% by weight or less based on the weight of the hard candy.

In the composition for preparing a hard candy of the present invention, the sugar may be at least one selected from the group consisting of white sugar, yellow sugar, brown sugar, and sugar substitute, preferably white sugar. 40 to 60 parts by weight of sugar may be included based on 100 parts by weight of the solid content of the composition of the present invention.

The composition of the present invention may be prepared by dissolving or suspending a mixture of the above-mentioned ingredients in water. In addition, the above-mentioned cyclosaccharide may be a mixed saccharide containing cyclosaccharide alone or an additional saccharide. Examples of the saccharide saccharide may further include at least one selected from the group consisting of fructose, glucose, and oligosaccharide. The mixed sugar may contain 1 to 99.9 parts by weight of a viscose based on 100 parts by weight of the total solid content, and may further include one or more selected from the group consisting of fructose, glucose, and oligosaccharides.

Specific examples of the saccharide-containing mixed sugar include 2 to 55 parts by weight of psicose, 30 to 80 parts by weight of fructose, 2 to 60 parts by weight of glucose and 0 to 15 parts by weight of oligosaccharide based on 100 parts by weight of the total solid content of the mixed sugar And may not include oligosaccharides. Saikos, fructose and glucose are preferably both D-isomer.

Saikosu can be carried out by chemical synthesis, or by biological methods using a cyclic epimerase, preferably by a biological method. Thus, the above-mentioned psicose includes at least one selected from the group consisting of psicose epimerase, cells of the strain producing the enzyme, culture of the strain, lysate of the strain, and extracts of the lysate or the culture The composition for producing psicose may be one prepared by reacting with a fructose-containing raw material.

In one embodiment of the present invention, a method for producing a scikos according to a biological method includes a method of culturing a strain producing a < RTI ID = 0.0 > cytokine < / RTI > epimerizing enzyme or a recombinant strain into which a gene encoding a scikos epimerase has been introduced, The course epimerase can be produced by reacting with a fructose-containing raw material. The above-mentioned cyclic epimerase can be carried out as a solid phase reaction using a liquid phase reaction or an immobilized enzyme.

Alternatively, a strain producing a cytomegalovirus or a recombinant strain into which a gene encoding a cytomegalovirus is introduced is obtained, and the culture of the strain, the culture of the strain, the lysate of the strain, and the lysate of the lysate or the culture Extract of the present invention can be produced by reacting a composition for producing a scorch, which comprises at least one member selected from the group consisting of a fructose-containing raw material, and a fructose-containing raw material. In the case of producing the cytosine using bacterial strains producing the Escherichia epimerase, the reaction can be carried out in the solid phase reaction using a liquid reaction or immobilized cells.

In a specific example of the present invention, as a strain producing a psicose epimerase, it may be a strain capable of producing a psicose epimerase at a high yield while having high stability. The recombinant strain may be a variety of host cells such as Escherichia coli, Bacillus sp., Salmonella sp., And Corynebacterium sp., Preferably, a strain of the genus Corynebacterium, which is a GRAS strain, Lt; / RTI > glutaricum.

In the case of using a recombinant strain, the gene encoding an enzyme derived from various strains can be used as a cytomegalic epimerase. For example, an enzyme derived from trifoneme primitia described in Korean Patent Publication No. 2014-0021974, Korean Patent Publication No. 2014-0080282 Or an enzyme derived from Clostridials dans according to Korean Patent No. 10-1318422, and may also be an enzyme derived from enciphered Halsen. In a specific example, the cytosine epimerase according to the present invention may be an enzyme derived from a clostridial synthase, for example, having the amino acid sequence of SEQ ID NO: 7, and the nucleic acid sequence of SEQ ID NO: 8 or SEQ ID NO: 9 . The nucleic acid sequence of SEQ ID NO: 8 is an E. coli optimized nucleic acid sequence and the SEQ ID NO: 9 is a nucleic acid sequence modified appropriately to Corynebacterium.

In the production of the recombinant strain according to an embodiment of the present invention, the expression of the enzyme may be regulated using a regulatory sequence located on the upper side of the nucleic acid sequence encoding the above-mentioned cyclic epimerase, and the regulatory sequence is essentially a transcription promoter And may further include ribosome binding regions and / or spacer sequences, and the like. The elements constituting the regulatory sequence may be directly linked or linked by including one or more linkers of the nucleic acid sequence having 1 to 100 bases, for example, 5 to 80 bases.

In one embodiment, the transcriptional promoter may be a nucleic acid molecule that expresses a nucleic acid sequence encoding a cyclic epimerase in a Corynebacterium sp. Strain, but may be a tac1, tac2, trc, or sod promoter. The sod promoter is derived from Corynebacterium glutaricum, and preferably comprises the nucleotide sequence of SEQ ID NO: 1 as a core region. The trc promoter is an Escherichia coli -derived promoter produced by a combination of the trp promoter and the lac UV5 promoter. The Tac1 promoter is an Escherichia coli-derived promoter, which is produced by a combination of the trp promoter and the lac UV5 promoter. The Tac2 promoter is an E. coli -based promoter, which is prepared by a combination of the trp promoter and the lac UV5 promoter, and is optimized by modifying the sequence of the Tac1 promoter.

The ribosome binding region and the spacer may be chemically linked directly or indirectly via a linker nucleic acid sequence in between. In an embodiment of the present invention, the ribosome binding region and the spacer sequence may include one oligonucleotide sequentially connected in 5 'to 3' order. The nucleotide sequences of the promoter sequence, the ribosome binding region and the spacer sequence according to an embodiment of the present invention are shown in Table 1 below. In Table 1, italic and boldly underlined parts indicate the ribosome binding region, the spacer sequence, the linker sequence, and the like in the regulatory sequence.

order
number Sequences (5 '-> 3') denomination One aagcgcctcatcagcggtaaccatcacgggttcgggtgcgaaaaaccatgccataacaggaatgttcctttcgaaaattgaggaagccttatgcccttcaaccctacttagctgccaattattccgggcttgtgacccgctacccgataaataggtcggctgaaaaatttcgttgcaatatcaacaaaaaggcctatcattgggaggtgtcgcaccaagtacttttgcgaagcgccatctgacggattttcaaaagatgtatatgctcggtgcggaaacctac
gaaaggattttttacccatggctgtatacgaactcccagaactcgactacgcatacgac
gaaaggattacaaa Sod promoter
2 tgacaattaatcatcggctcgtatattgt gtggaattgtgagcggataacaatttcacacaggaaa cagaattcccggggaaaggattacaaa tac1 promoter
3 Tgacaattaatcatccggctcgtataatgt taacaatttgtggaattgtgagcggacacacaggaaacagaccatggaattcgagctcggtacccggggaaaggattacaaa Tac2 promoter
4 tgacaattaatcatcggcctcgtataatgt trc promoter
5 gaaagga Ribosome binding region 6 ttacaaa Spacer sequence

It is preferable that the cyclic epimerase according to the present invention is excellent in enzyme activity and thermal stability. Accordingly, in the embodiment of the present invention, the combination of the transcriptional promoter or the regulatory sequence with the gene encoding the cyclic epimerase is important , The tac1, tac2, trc, and sod promoters used in the present invention can provide more than adequate titers of protein expression, and when the sod promoter is used, folding of the protein is robust, It is more preferable to obtain a result which is high.

The method of producing a psicos using a recombinant strain can be carried out according to the method described in Korean Patent Publication Nos. 2014-0021974, 2014-0080282 and Korean Patent No. 10-1318422, but is not particularly limited. In the above-mentioned method of producing a scicos, the concentration of fructose used as a substrate may be 40 to 75% (w / v), for example, 50 to 75% (w / v) have. When the concentration of fructose is lower than the above range, economical efficiency is lowered. When the concentration of fructose is higher than the above range, fructose is not dissolved well, so that the concentration of fructose is preferably within the above range. The fructose may be used in the form of a solution dissolved in a buffer solution or water (e.g., distilled water).

In the composition for preparing a hard candy of the present invention, starch syrup is not included or may be used in part. For example, 0 to 40 parts by weight of starch syrup may be added per 100 parts by weight of the total solid content of the composition for preparing a hard candy according to the present invention . The term "starch syrup" refers to a viscous sweet substance produced by partial hydrolysis (saccharification) of a starch or starch raw material with an acid or an enzyme. Preferably, starch or starch is used as a raw material and liquefied with an enzyme. , Concentrated enriched syrup. The above-mentioned syrup can be used in all of the syrups for making a hard candy, and for example, malt sugar syrup can be used, and there is no particular limitation.

The composition for preparing a hard candy of the present invention may further include sugar alcohols, for example, xylitol, maltitol, erythritol, sorbitol, mannitol, polyglycitol polyglycitol, lactitol, and combinations thereof, preferably xylitol, erythritol, sorbitol, mannitol, and combinations thereof.

The composition for preparing a hard candy of the present invention can be applied to a variety of foods such as green tea, black tea, coffee, cocoa, herb, and ginseng; Extracts of green tea, black tea, coffee, cocoa, herbs, and ginseng; And a flavoring agent. [0031] The present invention also provides The composition may also contain one or more additional additives selected from the group consisting of dairy products, fruit juice, salt additives, additives such as vegetable oils, acidulants, perfumes, and coloring agents.

The green tea, black tea, coffee, cocoa or herb is not particularly limited and may be added in the form of powder, juice and extract.

The ginseng may be added in the form of powder, juice, or extract. The ginseng may be at least one selected from the group consisting of white ginseng, ginseng, red ginseng, Taegeuk ginseng, black ginseng, phytophthora ginseng, fermented ginseng and enzyme-treated ginseng. Ginseng is a non-dried ginseng, and red ginseng is produced by mixing ginseng with steam. The white ginseng refers to the ginseng that has been dried without being cooked, and the ginseng is the dried up ginseng that has been slightly cooked with the surface water. In addition, there are various kinds of ginseng. For example, it can include Korean ginseng, wild tosam, American ginseng, etc. It can be divided into ginseng, wild ginseng, and ginseng ginseng depending on whether they are cultivated or not, Depending on the period, 4 years old or 6 years old can be mentioned, but all of them are included in the ginseng of the present invention.

The kind and the composition ratio of the saccharide for candy according to the present invention are adjusted to improve the moldability of the candy to improve the workability and to suppress the erosion of the teeth and the improvement of the sweetness and the sweetness.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a photograph showing a shape of a hard candy produced according to Examples 1 and 2 of the present invention and Comparative Examples 1 to 3 according to storage time. FIG.
FIG. 2 is a photograph showing the shape of the hard candy according to the storage time according to Examples 1 and 2 and Comparative Examples 1 to 3 of the present invention. FIG.
3 is a photograph taken immediately after the red ginseng candy produced according to Example 3 of the present invention is separated from a mold.
4 is a photograph taken immediately after the red ginseng candy produced according to Comparative Example 3 was separated from the mold.
5 is a photograph showing the moldability of the red ginseng candy prepared in Example 3 of the present invention.
6 is a photograph showing the moldability of the red ginseng candy produced according to Comparative Example 3. Fig.
Fig. 7 is a view showing an example of an expression recombinant vector (pCES_sodCDPE) for producing a psicose syrup used in the present invention.

The present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited to the following examples.

< Manufacturing example  1> Saikos  Produce

1-1: Saikos  Production of production strains

The DPE gene (Gene bank: EDS06411.1) derived from Clostridium scindens ATCC 35704 was synthesized as modified polynucleotides by optimizing E. coli for the Escherichia coli To name it CDPE. The polynucleotide optimized for Escherichia coli (SEQ ID NO: 2) and the sod promoter and T7 terminator obtained from the pET21a vector were obtained through PCR using each template, which was then ligated into a template by overlap PCR (PCR) And cloned into pGEM T-easy vector through T-vector cloning to confirm the sequence of the polynucleotide including the sod promoter (SEQ ID NO: 1), the optimized CDPE sequence of SEQ ID NO: 8 and the T7-terminator.

The entire confirmed polynucleotide was inserted into the same restriction enzyme site of the expression vector pCES208 (J. Microbiol. Biotechnol., 18: 639-647, 2008) using restriction enzymes NotI and XbaI (NEB) to obtain a recombinant vector pCES208 / (PCES_sodCDPE) was prepared. A cleavage map of the prepared recombinant vector (pCES_sodCDPE) is shown in Fig.

The prepared recombinant vector (pCES_sodCDPE) plasmid was transformed into Corynebacterium glutaricum using electroporation. Colonies were picked and inoculated into 4 ml of LB medium (10 g / L of tryptone, 10 g / L of NaCl, 5 g / L of yeast extract) supplemented with kanamycin at a final concentration of 15 ug / And 250 rpm for about 16 hours. Then, 1 ml of the above culture was obtained and inoculated into 100 ml of LB medium containing 15 ug / ml kanamycin, and the culturing was continued for 16 hours or more. After lysis of cells cultured with Beadbeater, only the supernatant is obtained, mixed with sample buffer 1: 1, and heated at 100? For 5 minutes. The prepared sample was subjected to electrophoresis on a 12% SDS-PAGE gel (composition: running gel - 3.3 ml H2O, 4.0 ml 30% acrylamide, 2.5 ml 1.5 M Tris buffer (pH 8.8) ㎕ TEMED / stacking gel - 1.4 ml H 2 O, 0.33 ml 30% acrylamide, 0.25 ml 1.0M Tris buffer (pH 6.8), 20 ㎕ 10% SDS, 20 ㎕ 10% APS, from about 50 to 180V for 2 ㎕ TEMED) Min for a few minutes to confirm protein expression. After the expression of CDPE was confirmed on SDS-PAGE gel, the His-tag purification was performed using Ni-NTA resin to determine the precise expression level. The expression (%) = (Purified protein (mg) / Total soluble protein )) * 100). The transformed Corynebacterium glutaricum prepared above produced 16.62 mg of total soluble protein and 1.74 mg of purified enzyme protein.

1-2: Saikos  Manufacture of syrups

Cells were recovered by centrifugation in a strain culture in order to produce a scissors from fructose using the recombinant strain producing the scuche epimerase obtained in Production Example 1-1.

The cell suspension was then treated with 0.05% (w / v) of an emulsifier (M-1695) in a final volume at 35 ° C (± 5 ° C) for 60 minutes. After the completion of the reaction, the supernatant containing the emulsifier was removed using a centrifuge, and the cells were recovered.

For the preparation of the immobilized beads, the recovered cells were mixed with DW to a final cell concentration of 5% (w / v), mixed with 4% (w / v) alginic acid dissolved in water and 5% ) Were mixed at a ratio of 1: 1, and stored in a refrigerator at 4 ° C to remove bubbles generated during mixing. The mixture solution was injected through a Neddle (inner diameter: 0.20 to 0.30 mm) and formed into a droplet shape. The mixture was dropped by weight. The dropped mixed solution was dropped into a 100 mM calcium chloride (CaCl 2 ) To form spherical or elliptical beads (diameter 2.0 to 2.2 mm). The formed beads were soaked in a 100 mM calcium chloride solution and mixed evenly by a stirrer so as to be further cured.

After all of the mixed solution was injected, the beads were further cured while refrigerated for 4 to 6 hours, and then replaced with a fresh 100 mM calcium chloride solution, and cured in a refrigerated state for about 6 hours. The hardened beads were completely removed from the beads, and then water having a volume three times the bead volume was added thereto. The beads were then stirred for 10 minutes. This process was repeated three times to remove the calcium chloride solution. The washed beads were completely removed for manganese soaking, and then a 40-brix (%) reaction substrate containing 10 mM of manganese was added thereto in a volume three times as large as the bead volume, followed by stirring for 10 minutes. And replaced with a reaction substrate containing 10 mM manganese. The reaction substrate is adjusted to pH 6.8 ~ 7.2 with 3N NaOH. Depending on the type of product, liquid fructose or crystalline fructose can be the reaction substrate. After the beads were replaced with a reaction substrate containing 10 mM manganese, the beads were transferred to the reaction tank and reacted at a reaction temperature of 50 ° C. for about 30 to 60 minutes to complete the sorbing of beads with manganese and fructose. The diameter of the finished bead decreases to 1.6 ~ 1.8mm and the strength also increases. The substrate of the beads which had been soaked was removed and the immobilized reaction column was filled and used for the production of the viscose syrup.

&Lt; Immobilization column reaction conditions >

Reaction temperature: Internal temperature of column jacket 50 ℃

Substrate flow rate: 0.5 SV (space velocity L. h-1)

Reaction Substrate: Crystalline fructose 40brix, pH 6.8 to 7.2

Bead preparation: 2.5% (w / w) cells, 2% (w / w) alginic acid mixture and 10 mM Mn 2 + soaking

The immobilization reaction column was provided with a raw material containing 92% by weight of fructose when the raw material solution contained 75% of solid content and 100% by weight of total solid content, Respectively. That is, 25 (w / w)% of psicose syrup of glucose: fructose: sucrose: oligosaccharide = 6: 67: 25: 2 was obtained from the reaction solution in the weight ratio of glucose: fructose: Lt; / RTI &gt;

1-3: Saikos  Preparation of powder

To remove impurities such as color and ion components, the psicose syrup obtained in Preparation Example 1-2 was added to a column at room temperature filled with a cation exchange resin, an anion exchange resin, and a resin mixed with a cation and an anion exchange resin, Exchanged resin at a flow rate of 2 times the volume of the exchange resin, and separated into a high-purity scorch solution by chromatography packed with a calcium (Ca 2 + ) type ion exchange resin. The high-purity cicos syrup was concentrated to a concentration of 82 Bx, and the solution was cooled to a supersaturated temperature of 35 캜 and then gradually cooled to a temperature of 10 캜 to form crystals. The mother liquor obtained in the crystallization step was centrifugally dehydrated to remove the mother liquor, and the crystal was washed with cooling water, followed by drying and recovering.

< Example  1 and 2> Saikos  Including hard candy manufacturing

The weight of sucrose powder (purity: 99%), sugar, starch syrup and water in Production Example 1-3 was weighed, and the raw material was put into a pot according to the composition shown in Table 2 below. The mixture was heated to 145 to 150 캜 And concentration was performed until the final moisture content was 2%. The concentrate was poured into a mold and cooled for 10 minutes. After cooling, the candy was separated from the mold and packed.

The packaged hard candy was photographed at a storage time of 0, 1.5 hours, 3 hours, 4.5 hours, and 6 hours while keeping the conditions at a temperature of 45 캜 and a relative humidity of 75%.

Ingredients for the preparation of candy are shown in Table 2 below, and the content of each ingredient is expressed in terms of solid content (%). The sugar used in this example was Samyangsan white sugar. The starch syrup contained about 5.4% by weight of glucose, about 58.7% by weight of maltose, and about 17.5% by weight of water, using malt syrup having a sugar content of 82 Bx.

division Example 1 Example 2 Comparative Example 1 Comparative Example 2 Comparative Example 3 Sugar 60 60 60 60 60 corn syrup 30 20 40 10 0 Saikosu (powder) 10 20 0 30 40 Sum 100 100 100 100 100

As shown in Figs. 1 and 2, the samples of Examples 1 and 2 exhibited physical properties equivalent to those of the conventional hard candy compositions at a temperature of 45 ° C and a relative humidity of 75RH for 6 hours, In the case of Comparative Examples 2 and 3 including 30% or more, it was found that the hard candy containing an excessive amount of psicose had a problem of moisture absorption and melting more easily than the hard candy of Comparative Example 1.

< Comparative Example  1> Manufacture of candy containing sugar and syrup

The comparative example is one of the commercially available candy compositions, which is a candy made from sugar and syrup without containing a psicose. Specifically, the hard candy was produced in substantially the same manner as in Example 1, but contained 60% by weight of sugar and 40% by weight of starch syrup, and did not include any sicos.

After cooling, the candy was removed from the mold, and the hard candy was stored at a temperature of 45 ° C. and a humidity of 75 RH. After each storage time of 0, 1.5 hours, 3 hours, 4.5 hours, and 6 hours, 1 and 2.

< Comparative Example  2 and 3>

Comparative Example 1 contained 60 wt% of sugar, 10 wt% of starch syrup and 30 wt% of Sikosu powder, and Comparative Example 2 contained 60 wt% of sugar and 10 wt% of sucrose powder. Comparative Example 1 was prepared in the same manner as Example 1, And 40 wt% of the powder.

After cooling, the candy was removed from the mold, and the hard candy was stored at a temperature of 45 ° C. and a humidity of 75 RH. After each storage time of 0, 1.5 hours, 3 hours, 4.5 hours, and 6 hours, 1 and 2.

< Example  3> Saikos  Manufacture of red ginseng candy containing

The weights of sugarcane, starch syrup, and water in Production Example 1-3 were weighed and weighed according to the composition shown in Table 3 below. The ingredients were placed in a pot and heated to 145 to 150 ° C Concentration was performed until the final moisture content was 2%. Thereafter, 1% by weight of red ginseng concentrate (75%) was added to the pot, stirred, and then poured into a mold for cooling for 10 minutes. The composition of the raw materials is shown in Table 3, and the content of each component is expressed in terms of solid content (%). The same starch syrup and sugar as used in Example 1 were used.

division Comparative Example 4 Example 3 Sugar 60 60 corn syrup 39 19 Saikosu powder - 20 Red ginseng concentrate (75%) One One Sum 100 100

After cooling, the candy was separated from the mold, and the candies of Example 3 and Comparative Example 4 were photographed immediately after the separation and shown in FIG. The candy separated from the mold was stored at room temperature after packaging.

As shown in Fig. 3, the red ginseng candy containing the psicose was well formed and separated, and the shape and color of the candy were uniform.

Comparing the photographs of FIG. 3 and FIG. 4, it can be seen that compared to the hard candy of Comparative Example 4 in which a red ginseng concentrate was added to a candy made of sugar and starch syrup, The hard candy used in Example 3 showed a somewhat darker color, but there was no significant difference in the shape of the hard candy.

< Comparative Example  4> Manufacture of red ginseng candy containing sugar and syrup

This comparative example is one of commercially available candy compositions, in which a red ginseng concentrate is added to a candy made from sugar and starch syrup without containing a scorch. The hard candy was prepared in substantially the same manner as in Example 3 except that it contained 60% by weight of sugar and 40% by weight of starch syrup, and did not contain any cicos.

After cooling, the candy was separated from the mold, and the candy of Example 3 and Comparative Example 4 was photographed immediately after the separation and shown in FIG. The candy separated from the mold was stored at room temperature after packaging.

As shown in FIG. 4, the red ginseng candy containing syrup is relatively low in workability in molding and separation as compared with the candy containing sicos, and the shape and color of the candy are not uniform, Which are the observed characteristics.

< Test Example  1> Moldability and workability evaluation of candy

In order to evaluate the moldability and workability of the composition for preparing a hard candy according to the present invention, the syrup for preparing a candy according to Example 3 and Comparative Example 4 was poured into a molding die at 90 DEG C to cool it, And whether or not it affected the workability was visually evaluated.

The results of the experiment using the syrup for preparing the red ginseng candy of Comparative Example 4 are shown in Fig. 5, and the results of the experiment using the syrup for preparing the red ginseng candy of Example 3 are shown in Fig.

As shown in FIG. 5, when using starch syrup in the preparation of the red ginseng candy of Comparative Example 4, there was a problem that the workability was bad because the tail was poured into the molding die at 90 ° C to form a tail outside the molding die.

However, as shown in Fig. 6, the viscosity of the candy molding liquid was lowered at the time of pouring into a molding mold at 90 DEG C while partially replacing the psicose in the preparation of the red ginseng candy of Example 3, so that it was possible to form neatly, .

< Test Example  2> Evaluation of hardness of candy

The hardness of the hard candy prepared in Example 3 and Comparative Example 4 was measured by the following method. The hardness of the sample was measured according to the following measurement conditions using a texture analyzer. The hardness measurement was repeated five times, and the average value was shown in the following table. As a result of hardness measurement, it was possible to manufacture a hard candy having a physical property equivalent to that of a conventional hard candy by using corn syrup.

Test Speed 2.0 mm / s Post Speed 5.0 mm / s Distance 60% Trig.Force 1.000kg Probe P2N Needle

The maximum value of the hardness of malt syrup red ginseng according to Comparative Example 4 was 8613 ± 486 and the hardness of the red ginseng containing 20% of Example 3 was 8183 ± 632. Therefore, it can be expected that the red ginseng candy containing the psicose and the conventional malt syrup red ginseng candy have the same level of hardness, and the physical properties of the red ginseng candy have a similar degree of rigidity when the two types of candy are ingested.

< Test Example  3> Sensory evaluation of candy

To evaluate the sensory properties of color preference, sweetness and overall acceptability, the hard candy of Comparative Example 2 and Example 5 was placed in the mouth, stimulated evenly for 20 seconds, and spit out. When the evaluation of one sample was completed, After washing the mouth and 10 minutes later, the next sample was evaluated and the sensory elements were indicated on a 7-point box scale. The sensory evaluation staff consisted of 10 panel members who were trained on taste and flavor evaluation, and were represented on a 7 point scale. The evaluation criteria of the above items are as follows, and the results are shown in Table 5 below.

division Comparative Example 4 Example 3 Color preference 4.8 5.1 Sweetness 3.9 5.4 Overall flavor preference 4.6 5.9

As described above, the hard candy containing the psicose was superior to the conventional composition in color preference and sweetness. The composition of the hard candy composition including a part of the psicose instead of the syrup makes the color expression of the candy more effective and prevents the sweetness of the sweetness of the sugar from being micaschicken due to the syrup, . &Lt; / RTI &gt;

<110> SAMYANG GENEX CORPORATION <120> Hard candy having low calory, good sweetness and formability <130> DPP20151550KR <160> 9 <170> Kopatentin 1.71 <210> 1 <211> 356 <212> DNA <213> Artificial Sequence <220> The sod promoter (6) <400> 1 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg acgaaaggat tacaaa 356 <210> 2 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> The Tac1 promoter (4) <400> 2 tgacaattaa tcatcggctc gtatattgtg tggaattgtg agcggataac aatttcacac 60 aggaaacaga attcccgggg aaaggattac aaa 93 <210> 3 <211> 112 <212> DNA <213> Artificial Sequence <220> <223> The Tac2 promoter (4) <400> 3 tgacaattaa tcatccggct cgtataatgt taacaatttg tggaattgtg agcggacaca 60 caggaaacag accatggaat tcgagctcgg tacccgggga aaggattaca aa 112 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> The Trc promoter (1) <400> 4 tgacaattaa tcatcggcct cgtataatgt 30 <210> 5 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Ribosome binding region <400> 5 gaaagga 7 <210> 6 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Spacer sequence <400> 6 ttacaaa 7 <210> 7 <211> 289 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of an enzyme protein originated from          Clostridium scindens <400> 7 Met Lys His Gly Ile Tyr Tyr Ala Tyr Trp Glu Gln Glu Trp Ala Ala   1 5 10 15 Asp Tyr Lys Arg Tyr Val Glu Lys Ala Ala Lys Leu Gly Phe Asp Ile              20 25 30 Leu Glu Val Gly Ala Ala Pro Leu Pro Asp Tyr Ser Ala Gln Glu Val          35 40 45 Lys Glu Leu Lys Lys Cys Ala Asp Asp Asn Gly Ile Gln Leu Thr Ala      50 55 60 Gly Tyr Gly Pro Ala Phe Asn His Asn Met Gly Ser Ser Asp Pro Lys  65 70 75 80 Ile Arg Glu Glu Ala Leu Gln Trp Tyr Lys Arg Leu Phe Glu Val Met                  85 90 95 Ala Gly Leu Asp Ile His Leu Ile Gly Gly Ala Leu Tyr Ser Tyr Trp             100 105 110 Pro Val Asp Phe Ala Thr Ala Asn Lys Glu Glu Asp Trp Lys His Ser         115 120 125 Val Glu Gly Met Gln Ile Leu Ala Pro Ile Ala Ser Gln Tyr Gly Ile     130 135 140 Asn Leu Gly Met Glu Val Leu Asn Arg Phe Glu Ser His Ile Leu Asn 145 150 155 160 Thr Ser Glu Glu Gly Val Lys Phe Val Thr Glu Val Gly Met Asp Asn                 165 170 175 Val Lys Val Met Leu Asp Thr Phe His Met Asn Ile Glu Glu Ser Ser             180 185 190 Ile Gly Asp Ala Ile Arg His Ala Gly Lys Leu Leu Gly His Phe His         195 200 205 Thr Gly Glu Cys Asn Arg Met Val Pro Gly Lys Gly Arg Thr Pro Trp     210 215 220 Arg Glu Ile Gly Asp Ala Leu Arg Glu Ile Glu Tyr Asp Gly Thr Val 225 230 235 240 Val Met Glu Pro Phe Val Arg Met Gly Gly Gln Val Gly Ser Asp Ile                 245 250 255 Lys Val Trp Arg Asp Ile Ser Lys Gly Ala Gly Glu Asp Arg Leu Asp             260 265 270 Glu Asp Ala Arg Arg Ala Val Glu Phe Gln Arg Tyr Met Leu Glu Trp         275 280 285 Lys     <210> 8 <211> 870 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (1) of the enzyme protein of SEQ          ID NO: 7 <400> 8 atgaaacacg gtatctacta cgcgtactgg gaacaggaat gggcggcgga ctacaaacgt 60 tacgttgaaa aagcggcgaa actgggtttc gacatcctgg aagttggtgc ggcgccgctg 120 ccggactact ctgcgcagga agttaaagaa ctgaaaaaat gcgcggacga caacggtatc 180 cagctgaccg cgggttacgg tccggcgttc aaccacaaca tgggttcttc tgacccgaaa 240 atccgtgaag aagcgctgca gtggtacaaa cgtctgttcg aagttatggc gggtctggac 300 atccacctga tcggtggtgc gctgtactct tactggccgg ttgacttcgc gaccgcgaac 360 aaagaagaag actggaaaca ctctgttgaa ggtatgcaga tcctggcgcc gatcgcgtct 420 cagtacggta tcaacctggg tatggaagtt ctgaaccgtt tcgaatctca catcctgaac 480 acctctgaag aaggtgttaa attcgttacc gaagttggta tggacaacgt taaagttatg 540 ctggacacct tccacatgaa catcgaagaa tcttctatcg gtgacgcgat ccgtcacgcg 600 ggtaaactgc tgggtcactt ccacaccggt gaatgcaacc gtatggttcc gggtaaaggt 660 cgtaccccgt ggcgtgaaat cggtgacgcg ctgcgtgaaa tcgaatacga cggtaccgtt 720 gttatggaac cgttcgttcg tatgggtggt caggttggtt ctgacatcaa agtttggcgt 780 gacatctcta aaggtgcggg tgaagaccgt ctggacgaag acgcgcgtcg tgcggttgaa 840 ttccagcgtt acatgctgga atggaaataa 870 <210> 9 <211> 870 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (2) of the enzyme protein of SEQ ID          NO: 7 <400> 9 atgaagcacg gcatctacta cgcatactgg gagcaggagt gggcagcaga ctacaagcgc 60 tacgttgaga aggcagcaaa gctgggcttc gacatcctgg aggttggcgc agcaccactg 120 ccagactact ccgcacagga ggttaaggag ctgaagaagt gcgcagacga caacggcatc 180 cagctgaccg caggctacgg cccagcattc aaccacaaca tgggctcctc cgacccaaag 240 atccgcgagg aggcactgca gtggtacaag cgcctgttcg aggttatggc aggcctggac 300 atccacctga tcggcggcgc actgtactcc tactggccag ttgacttcgc aaccgcaaac 360 aaggaggagg actggaagca ctccgttgag ggcatgcaga tcctggcacc aatcgcatcc 420 cagtacggca tcaacctggg catggaggtt ctgaaccgct tcgagtccca catcctgaac 480 acctccgagg agggcgttaa gttcgttacc gaggttggca tggacaacgt taaggttatg 540 ctggacacct tccacatgaa catcgaggag tcctccatcg gcgacgcaat ccgccacgca 600 ggcaagctgc tgggccactt ccacaccggc gagtgcaacc gcatggttcc aggcaagggc 660 cgcaccccat ggcgcgagat cggcgacgca ctgcgcgaga tcgagtacga cggcaccgtt 720 gttatggagc cattcgttcg catgggcggc caggttggct ccgacatcaa ggtttggcgc 780 gacatctcca agggcgcagg cgaggaccgc ctggacgagg acgcacgccg cgcagttgag 840 ttccagcgct acatgctgga gtggaagtaa 870

Claims (9)

A composition for making a hard candy comprising 40 to 60 parts by weight of sugar and 1 to 30 parts by weight of a cosmetic powder based on 100 parts by weight of the total solid content of the composition for preparing a hard candy,
Saikosuke powder is prepared from a mixed sugar syrup produced by a biological method by reacting with a fructose-containing raw material, A mixed sugar syrup containing 2 to 55 parts by weight of psicose, 30 to 80 parts by weight of fructose and 2 to 60 parts by weight of glucose based on 100 parts by weight of the total solid content of the mixed sugar,
Wherein the water content of the hard candy prepared by adding water to the composition for making a hard candy, and by heat condensation, molding and cooling is 2 wt% or less.
The composition of claim 1, wherein the composition comprises 0 to 40 parts by weight of starch syrup, based on 100 parts by weight of the total solids content of the composition for preparing a hard candy.
The composition of claim 1, wherein the hard candy made from the composition for making a hard candy has a hardness of 4,000 to 20,000.
[Claim 3] The syrup according to claim 1, wherein the mixed sugar syrup is selected from the group consisting of psicose epimerase, cells of the strain producing the enzyme, culture of the strain, lysate of the strain, and extracts of the lysate or culture Wherein the composition is a mixed sugar syrup produced by a biological process by reacting with a fructose-containing raw material.
delete delete The composition of claim 1, further comprising a sugar alcohol.
The method according to claim 1, wherein the tea, tea, coffee, cocoa, herb, and ginseng; Extracts of green tea, tea, coffee, cocoa, herbs and ginseng; And a perfume. &Lt; Desc / Clms Page number 24 &gt;
8. A hard candy made from the composition for making a hard candy according to any one of claims 1 to 4 and 8 to 8 and having a hardness of 4,000 to 20,000 and a water content of less than 4% by weight.
KR1020150079166A 2015-06-04 2015-06-04 Hard candy having low calory, good sweetness and formability KR101709256B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020150079166A KR101709256B1 (en) 2015-06-04 2015-06-04 Hard candy having low calory, good sweetness and formability

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020150079166A KR101709256B1 (en) 2015-06-04 2015-06-04 Hard candy having low calory, good sweetness and formability

Publications (2)

Publication Number Publication Date
KR20160143076A KR20160143076A (en) 2016-12-14
KR101709256B1 true KR101709256B1 (en) 2017-03-08

Family

ID=57575790

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150079166A KR101709256B1 (en) 2015-06-04 2015-06-04 Hard candy having low calory, good sweetness and formability

Country Status (1)

Country Link
KR (1) KR101709256B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102557161B1 (en) 2023-01-26 2023-07-19 홍영 Manufacturing method of pear juice candy with excellent taste and refreshing feeling

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102111012B1 (en) * 2017-10-31 2020-05-19 씨제이제일제당 주식회사 A gummy jelly comprising allulose and a preparation method thereof
KR102108426B1 (en) * 2018-06-28 2020-05-07 주식회사 삼양사 Hard candy containing malto oligosaccharides
KR102277493B1 (en) * 2019-02-19 2021-07-14 씨제이제일제당 (주) Composition for production of candy

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR19990083531A (en) 1998-04-28 1999-11-25 도시오 미야께 Hard candy with a relatively-high moisture and hardness, and process of the same
KR101325061B1 (en) 2006-11-10 2013-11-05 고쿠리츠다이가쿠호우징 카가와다이가쿠 Sweetener containing d-psicose and foods and drinks obtained by using the same

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6099870B2 (en) * 2012-01-06 2017-03-22 松谷化学工業株式会社 Novel sweetener containing sucrose and D-psicose

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR19990083531A (en) 1998-04-28 1999-11-25 도시오 미야께 Hard candy with a relatively-high moisture and hardness, and process of the same
KR100535247B1 (en) * 1998-04-28 2005-12-08 가부시끼가이샤 하야시바라 세이부쓰 가가꾸 겐꾸조 Hard candy with a relatively-high moisture and hardness, and process of the same
KR101325061B1 (en) 2006-11-10 2013-11-05 고쿠리츠다이가쿠호우징 카가와다이가쿠 Sweetener containing d-psicose and foods and drinks obtained by using the same

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102557161B1 (en) 2023-01-26 2023-07-19 홍영 Manufacturing method of pear juice candy with excellent taste and refreshing feeling

Also Published As

Publication number Publication date
KR20160143076A (en) 2016-12-14

Similar Documents

Publication Publication Date Title
JP3633648B2 (en) Maltose / trehalose converting enzyme, its production method and use
KR100306868B1 (en) Trehalose Free Enzyme and Manufacturing Method and Uses
JP6835825B2 (en) Psicose mixed sugar composition with improved sweetness and crystallization
KR101731063B1 (en) Composition for soaking syrup and use of the same
KR101709256B1 (en) Hard candy having low calory, good sweetness and formability
DK160792B (en) SWEATER AND PROCEDURE FOR PREPARING THEREOF
JPH0866187A (en) Heat-resistant trehalose release enzyme and its production and use
KR101709255B1 (en) microbial growth inhibitor comprising psicose
KR101703264B1 (en) The low calorie lactic-acid fermented milk with an enhanced storage stability and method for preparing the same
KR100464831B1 (en) Trehalulose-containing sugar composition, preparation method thereof and use
KR101647477B1 (en) Cookie with an improved quality and method of preparing the same
KR101709257B1 (en) Ice cream composition with low calories and low fat and method of preparing the same
JP3616166B2 (en) Trehalose and its production method and use
JPS6251584B2 (en)
KR101696833B1 (en) Composition for preparing frozen food using the culture product of lactic acid bacteria, and frozen food using the culture product
KR101703265B1 (en) Premix composition for preparing muffin with soft and wet taste and muffin prepared from the premix composition
KR101703263B1 (en) The semisolid yoghurt with an enhanced storage stability and method for preparing the same
KR101709258B1 (en) fermented alcoholic beverage of grains with improved storage stability and sweetness quality and method of preparing the same
JP5240480B2 (en) Trehalose-releasing enzyme, its production method and use
KR100870328B1 (en) Powder comprising water-containing ?-maltose crystals and production process and use thereof
KR20160143070A (en) Gummy candy with improved mold releasing property and good taste and preparation method
JPH10304881A (en) Trehalose phosphorylase, its production and use
KR101626589B1 (en) Brownie with an improved quality and method of preparing the same
JP3725148B2 (en) Maltose / trehalose converting enzyme, its production method and use
JPS6328369A (en) Food and drink and preparation thereof

Legal Events

Date Code Title Description
N231 Notification of change of applicant
A201 Request for examination
A302 Request for accelerated examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20191216

Year of fee payment: 4