KR101626589B1 - Brownie with an improved quality and method of preparing the same - Google Patents

Abstract

The present invention relates to a composition for making a brownie having improved quality and smooth texture, a method for preparing the composition, paste for making a brownie prepared by mixing the composition, and a brownie made using the composition for making a brownie. The composition for making a brownie contains, on the basis of 100 parts by weight of the total solid content, 30-60 parts by weight of wheat flour, 10-30 parts by weight of edible oil, 3-15 parts by weight of cocoa powder, and 10-50 parts by weight of sugar. The present invention provides a brownie which has smooth and moist texture by increasing the moisture retention power, has increased stability with respect to microorganism growth by having low moisture activity and reducing the content of fermented sugar, and realizes low calories.

Description

[0001] The present invention relates to a brownie having improved quality and a method for preparing the brownie,

The present invention relates to a composition for making a brownie having a soft texture with improved quality, a method for producing the composition, a kneaded product for making brownies produced by mixing the composition, and a brownie made using the composition.

Brownie is a kind of dark chocolate cake that is cut in a square shape and it is a kind of dark chocolate cake which is made with a variety of ingredients such as taste concentration, nuts, icing, cream cheese, chocolate chips and so on. Various types of brownies are being made. Generally, brownies are made by mixing chocolate and butter and then flour. They are widely known as desserts because of their sweetness, soft creamy taste, buttery taste, chocolate taste and unique texture.

Brownies are usually melted with butter and chocolates in a hot water bath, then mixed with eggs and salt to bubble up. Afterwards, sugar is poured into the cream, then flour is added to the flour to mix the ingredients. It is baked in the oven and cooled. It is common to eat alone or with ice cream as a dessert.

Brownie uses a high calorie material to obtain a deep sweetness, a creamy soft taste, a buttery taste, a chocolate taste and a unique texture, and the saturated fat is high because it contains a lot of butter.

Sugar is used as a sweet component to produce brownies, sugar has a high sweetness, and when it is used in an excessive amount, a smooth texture is deteriorated and a crunchy texture is increased.

The present invention relates to a composition for preparing brownies, which has a soft and moist texture by increasing water retention, a low water activity and a reduced fermentable saccharide content, thereby improving the stability of the microorganism during development, a process for producing the composition, And a brownie prepared by using the composition for making brownie.

The present invention relates to a composition for preparing brownies which can reduce the amount of saccharides having high calories and which is low in calorie content, a method for producing the composition, a kneading composition for preparing brownies mixed with the composition, and a composition for preparing brownie ≪ / RTI >

It is a further object of the present invention to provide a composition for preparing brownies which realizes a chocolate color and low calorie without reducing or using the amount of cocoa or chocolate, a method for producing the composition, a paste for preparing brownies, The present invention relates to a brownie prepared by using a composition for manufacture.

The present invention relates to a composition for making a brownie having a soft texture with improved quality, a method for producing the composition, a kneaded product for making brownies produced by mixing the composition, and a brownie made using the composition.

In addition to a moist and soft texture, the brownie requires a unique texture such as a deep sweet taste, a buttery taste, and a chocolate taste. In order to provide such a brownie-specific texture, a large amount of sugar and butter is used, and the calories are high, and the sweetness is excessively strong. When the sugar is used in an excess amount, the soft texture decreases and the crispy texture increases. Therefore, the present invention can reduce the sweetness and calorie by reducing or not using the sugar content, achieving a smooth texture, increasing the water holding power to have a soft and moist texture, a low water activity and a fermentable saccharide content , A method for producing the composition, a kneaded product for preparing brownies mixed with the composition, and a brownie prepared using the composition.

The brownie according to the present invention preferably has a moisture content of 15% or more and a water activity of 0.78 to 0.8. The brownie according to the present invention exhibits moisture and water activity in the above-mentioned numerical range, and thus has an excellent moisture-retaining ability, moist texture, and increased stability due to microbial growth.

Moisture refers to the water content contained in the food, and the moisture in the food is always fluctuating according to the surrounding environmental conditions, and indicates the water activity considering the relative humidity in the atmosphere. Water activity is a very important feature in food because it is related to the chemical, biophysical, and physical reactions in foods that change microbial growth and flavor, color, and flavor of food. Therefore, water activity has more significance in food stability than total moisture content. The pure water vapor pressure to the water pressure that the food represents is the definition of water activity.

Water activity and food shelf life are related to microbial growth and chemical reaction rate. Microorganisms can no longer grow at the minimum water activity, and even if the number of microorganisms increases, the number of microorganisms is very small, so water activity is the most easily controllable microorganism. Depending on the type of microorganism, there is a considerable difference in sensitivity to water activity, and fungi and yeast are microorganisms that should pay attention to low water activity. Depending on the moisture or water activity in the food, it affects the degradation (fermentation & decay), enzymatic activity and browning (especially non-enzymatic browning) of microorganisms in the food and these reactions are proportional to the water activity .

One embodiment of the present invention relates to a composition for making brownie comprising wheat flour, edible fats and saccharides, wherein the saccharide comprises a psicose.

The composition for preparing brownie of the present invention may contain 2 to 50 parts by weight of a saccharide as a sugar based on 100 parts by weight of the total solid content of the brownie composition. The composition for preparing brownies may contain, as a saccharide, a monosaccharide alone or in addition to a monosaccharide, at least one saccharide selected from the group consisting of sugar, fructose, and starch syrup.

 In the brownie composition of the present invention, the sugar may be at least one selected from the group consisting of white sugar, yellow sugar, brown sugar, and sugar replacer, preferably white sugar. The sugar may be contained in an amount of 10 to 40 parts by weight, preferably 15 to 30 parts by weight based on 100 parts by weight of the brownie composition of the present invention. The sugar content can be appropriately adjusted to take into consideration the texture and soft texture of the brownie sticking to the mouth.

Saikosu may be added in the form of a mixture with powders, psicose syrups, or other saccharides. However, unlike powders, since syrup contains a large amount of water, since the dough is excessively cured, some of the sugar may be included in consideration of the physical properties of the dough.

The composition of the present invention for preparing brownie, the psicose contained in the kneaded product or the brownie may be a solution prepared by using a psicose powder such as a psicose powder having a purity of 90% or more as a powder or using a psicose powder at various concentrations have. In addition, the above-mentioned cyclosaccharide may be a mixed saccharide containing cyclosaccharide alone or an additional saccharide. Examples of the saccharide saccharide may further include at least one selected from the group consisting of fructose, glucose, and oligosaccharide. The mixed sugar may contain 1 to 99.9 parts by weight of a viscose based on 100 parts by weight of the total solid content, and may further include one or more selected from the group consisting of fructose, glucose, and oligosaccharides.

Specific examples of the saccharide-containing mixed sugar include 2 to 55 parts by weight of psicose, 30 to 80 parts by weight of fructose, 2 to 60 parts by weight of glucose and 0 to 15 parts by weight of oligosaccharide based on 100 parts by weight of the total solid content of the mixed sugar And may not include oligosaccharides. Saikos, fructose and glucose are preferably both D-isomer.

Saikosu can be carried out by chemical synthesis, or by biological methods using a cyclic epimerase, preferably by a biological method. Thus, the above-mentioned psicose includes at least one selected from the group consisting of psicose epimerase, cells of the strain producing the enzyme, culture of the strain, lysate of the strain, and extracts of the lysate or the culture The composition for producing psicose may be one prepared by reacting with a fructose-containing raw material.

In one embodiment of the present invention, a method for producing a scikos according to a biological method includes a method of culturing a strain producing a < RTI ID = 0.0 > cytokine < / RTI > epimerizing enzyme or a recombinant strain into which a gene encoding a scikos epimerase has been introduced, The course epimerase can be produced by reacting with a fructose-containing raw material. The above-mentioned cyclic epimerase can be carried out as a solid phase reaction using a liquid phase reaction or an immobilized enzyme.

Alternatively, a strain producing a cytomegalovirus or a recombinant strain into which a gene encoding a cytomegalovirus is introduced is obtained, and the culture of the strain, the culture of the strain, the lysate of the strain, and the lysate of the lysate or the culture Extract of the present invention can be produced by reacting a composition for producing a scorch, which comprises at least one member selected from the group consisting of a fructose-containing raw material, and a fructose-containing raw material. In the case of producing the cytosine using bacterial strains producing the Escherichia epimerase, the reaction can be carried out in the solid phase reaction using a liquid reaction or immobilized cells.

In a specific example of the present invention, as a strain producing a psicose epimerase, it may be a strain capable of producing a psicose epimerase at a high yield while having high stability. The recombinant strain may be a variety of host cells such as Escherichia coli, Bacillus sp., Salmonella sp., And Corynebacterium sp., Preferably, a strain of the genus Corynebacterium, which is a GRAS strain, Lt; / RTI > glutaricum.

In the case of using a recombinant strain, the gene encoding an enzyme derived from various strains can be used as a cytomegalic epimerase. For example, an enzyme derived from trifoneme primitia described in Korean Patent Publication No. 2014-0021974, Korean Patent Publication No. 2014-0080282 Or an enzyme derived from Clostridials dans according to Korean Patent No. 10-1318422, and may also be an enzyme derived from enciphered Halsen. In a specific example, the cytosine epimerase according to the present invention may be an enzyme derived from a clostridial synthase, for example, having the amino acid sequence of SEQ ID NO: 7, and the nucleic acid sequence of SEQ ID NO: 8 or SEQ ID NO: 9 . The nucleic acid sequence of SEQ ID NO: 8 is an E. coli optimized nucleic acid sequence and the SEQ ID NO: 9 is a nucleic acid sequence modified appropriately to Corynebacterium.

In the production of the recombinant strain according to an embodiment of the present invention, the expression of the enzyme may be regulated using a regulatory sequence located on the upper side of the nucleic acid sequence encoding the above-mentioned cyclic epimerase, and the regulatory sequence is essentially a transcription promoter And may further include ribosome binding regions and / or spacer sequences, and the like. The elements constituting the regulatory sequence may be directly linked or linked by including one or more linkers of the nucleic acid sequence having 1 to 100 bases, for example, 5 to 80 bases.

In one embodiment, the transcriptional promoter may be a nucleic acid molecule that expresses a nucleic acid sequence encoding a cyclic epimerase in a Corynebacterium sp. Strain, but may be a tac1, tac2, trc, or sod promoter. The sod promoter is derived from Corynebacterium glutaricum, and preferably comprises the nucleotide sequence of SEQ ID NO: 1 as a core region. The trc promoter is an Escherichia coli -derived promoter produced by a combination of the trp promoter and the lac UV5 promoter. The Tac1 promoter is an Escherichia coli-derived promoter, which is produced by a combination of the trp promoter and the lac UV5 promoter. The Tac2 promoter is an E. coli -based promoter, which is prepared by a combination of the trp promoter and the lac UV5 promoter, and is optimized by modifying the sequence of the Tac1 promoter.

The ribosome binding region and the spacer may be chemically linked directly or indirectly via a linker nucleic acid sequence in between. In an embodiment of the present invention, the ribosome binding region and the spacer sequence may include one oligonucleotide sequentially connected in 5 'to 3' order. The nucleotide sequences of the promoter sequence, the ribosome binding region and the spacer sequence according to an embodiment of the present invention are shown in Table 1 below. In Table 1, italic and boldly underlined parts indicate the ribosome binding region, the spacer sequence, the linker sequence, and the like in the regulatory sequence.

order
number Sequences (5 '-> 3') denomination One aagcgcc tcatcagcgg taaccatca cgggttcgggt gcgaaaaacc atgccataac aggaatgttc ctttcgaaaa ttgaggaagc cttatgccct tcaaccctac ttagctgcca attattccgg gcttgtgacc cgctacccgataaataggtc ggctgaaaaa tttcgttgca atatcaacaa aaaggcctat cattgggaggtgtcgcacca agtacttttg cgaagcgcca tctgacggat tttcaaaaga tgtatatgct cggtgcggaa acctac
gaaagga ttttttaccc atggctg tatacgaact cccagaactc gactacgcat acgac
gaaagga ttacaaa Sod promoter
2 tgacaattaatcatcggctcgtatattgt gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggg gaaagga ttacaaa tac1 promoter
3 Tgacaattaatcatccggctcgtataatgt taacaatttgtggaattgtgagcggacacacaggaaacagaccatggaattcgagctcggtacccggg gaaagga ttacaaa Tac2 promoter
4 Tgacaattaatcatcggcctcgtataatgt trc promoter
5 Gaaagga Ribosome binding region 6 Ttacaaa Spacer sequence

It is preferable that the cyclic epimerase according to the present invention is excellent in enzyme activity and thermal stability. Accordingly, in the embodiment of the present invention, the combination of the transcriptional promoter or the regulatory sequence with the gene encoding the cyclic epimerase is important , The tac1, tac2, trc, and sod promoters used in the present invention can provide more than adequate titers of protein expression, and when the sod promoter is used, folding of the protein is robust, It is more preferable to obtain a result which is high.

The method of producing a psicos using a recombinant strain can be carried out according to the method described in Korean Patent Publication Nos. 2014-0021974, 2014-0080282 and Korean Patent No. 10-1318422, but is not particularly limited. In the above-mentioned method of producing a scicos, the concentration of fructose used as a substrate may be 40 to 75% (w / v), for example, 50 to 75% (w / v) have. When the concentration of fructose is lower than the above range, economical efficiency is lowered. When the concentration of fructose is higher than the above range, fructose is not dissolved well, so that the concentration of fructose is preferably within the above range. The fructose may be used in the form of a solution dissolved in a buffer solution or water (e.g., distilled water).

The composition for making brownie according to the present invention includes wheat flour, saccharides and cooking oil. The composition for preparing brownie according to the present invention may further comprise various ingredients including egg yolk, in addition to wheat flour, saccharide and edible oil. For example, 30 to 60 parts by weight of wheat flour, 10 to 30 parts by weight of edible oil, and 10 to 50 parts by weight of saccharides may be contained based on 100 parts by weight of the total solid content of the composition. The eggs may be included in an amount of 2 to 20 parts by weight, based on 100 parts by weight of the total solid content of the composition.

Examples of the additive component include one selected from the group consisting of chocolate, cocoa powder, emulsifier, swelling agent (sodium bicarbonate, acidic sodium pyrophosphate, etc.), indigestible dextrin, skim milk powder, protein powder, vitamins, minerals, nuts, Or more.

The wheat flour may be at least one kind selected from the group consisting of gravitational force, strong and powdery flour, and preferably, the powder may be used to prevent the texture from being formed due to the formation of gluten. 100 parts by weight of the brownie composition of the present invention contains 30 to 60 parts by weight of wheat flour, preferably 40 to 60 parts by weight. When the wheat flour content is less than 30 parts by weight per 100 parts by weight of the brownie composition, there is a problem that the binding force of the brownie dough is insufficient and molding is not performed well and a preferable texture is difficult to implement. When the wheat flour content exceeds 60 parts by weight, there is a problem.

The edible oil included in the present invention may be selected from vegetable oil, animal oil, margarine, butter, shortening, and mixtures thereof, preferably selected from margarine, butter, shortening, and mixtures thereof. The vegetable oil may be at least one selected from the group consisting of palm oil, vegetable oil, soybean oil, palm oil, sunflower oil, sunflower oil, ester-exchanged oil and fractionated liquid oil of the oil, and the animal fat is composed of lard, , But the present invention is not limited thereto.

The 100 parts by weight of the brownie composition of the present invention may contain 10 to 30 parts by weight, preferably 15 to 25 parts by weight of an edible oil. If the amount of the edible oil is less than 10 parts by weight, it is difficult to produce a brownie with a soft texture due to poor emulsification. In addition, there is a problem that brownie flavor is lowered. When the amount is more than 30 parts by weight, There is a problem that the dough is spread and the formability is poor.

The composition for preparing a brownie of the present invention may further comprise a whole egg, egg white, egg yolk or the like, and may be included in an amount of 2 to 20 parts by weight based on 100 parts by weight of the total solid content of the composition.

The composition for preparing brownies of the present invention may further contain cocoa powder. The cocoa powder is a raw material for imparting the color and flavor of brownie, and may be contained in an amount of 3 to 15 parts by weight based on 100 parts by weight of the total solid content of the composition for preparing brownie.

In addition, the composition for producing briquette may further include chocolate chips and / or nuts, and may further impart a chocolate flavor hard to be obtained with cocoa powder, and the nuts may further improve the taste of brownies. Chocolate chips or nuts can be added as appropriate. The chocolate may be contained in an amount of 3 to 15 parts by weight based on 100 parts by weight of the total solid content of the composition for preparing brownie.

The composition for preparing brownie according to the present invention may further comprise an emulsifier. The emulsifying agent can be used without limitation as long as it is commonly used in the brownie composition. Preferably, the emulsifying agent may be at least one selected from the group consisting of lecithin, glycerin fatty acid esters and sucrose fatty acid esters, but is not limited thereto. 100 parts by weight of the composition for preparing brownie of the present invention may contain 0.1 to 5 parts by weight, preferably 0.3 to 3 parts by weight, of an emulsifying agent. If the content of the emulsifier is less than 0.1 parts by weight, sufficient emulsification may not be obtained, resulting in a deterioration of product quality with time. If the amount of the emulsifier is more than 5 parts by weight, there is a problem that a taste peculiar to the emulsifier appears.

The starch can be used without limitation as long as it is commonly used in the brownie composition. Preferably, the starch is at least one starch selected from the group consisting of wheat starch, potato starch, cornstarch and sweet potato starch, modified starch, indigestible dextrin, . The starch may be contained in an amount of 1 to 10 parts by weight, preferably 3 to 8 parts by weight based on 100 parts by weight of the brownie composition of the present invention. If the starch content is less than 1 part by weight, a soft texture may not be exhibited and a brownie may stick to the mouth. If the starch content is more than 10 parts by weight, the dough may become stiff and hinder molding.

The indigestible dextrin, for example, indigestible maltodextrin, is a type of dietary fiber, which can also help improve a smooth texture. An indigestible maltodextrin may be used. When the brownish composition of the present invention contains the indigestible maltodextrin, the indigestible maltodextrin content is preferably 1 to 5 parts by weight, and more preferably 1 to 3 parts by weight per 100 parts by weight of the brownie composition.

The composition for making a brownie of the present invention may be a powdery composition comprising essential ingredients and optionally further ingredient (s), or may be a kneaded product prepared by mixing these compositions directly or by adding water. When the brownie composition of the present invention further comprises water, its content may preferably be 5 to 15 parts by weight, more preferably 8 to 12 parts by weight, per 100 parts by weight of the total components excluding water. When the components are mixed by dividing into at least two stages (e.g., two to three stages, preferably three stages), it is preferred that the water is introduced at the second stage or thereafter.

The method for producing brownies can be produced by a method known in the art and is not particularly limited. For example, mix margarine, sugar, and lightly mix. If mixed to a certain extent, add other powdered raw materials and eggs, mix gently, and bake in a forming pan and bake at 180 ℃ for 25 minutes. Finally, it can be cut and packed into a suitable size.

One aspect of the present invention provides brownies prepared using the brownie premix composition. The brownies have excellent physical properties, soft texture and flavor.

According to an embodiment of the present invention, there is provided a brownie prepared by molding and baking a kneaded product prepared by homogenizing the composition for making brownie, wherein the brownie has a water content of 15% or more and a water activity of 0.78 to 0.8 have.

The present invention relates to a composition for preparing a brownie having a soft texture with improved quality by replacing all or a part of saccharides such as sugar used in brownie with a sauce, a process for producing the composition, a dough for making brownies Water, and brownies produced using the composition. Also, the composition for preparing brownie having a soft texture of the present invention or the kneaded product or brownie produced therefrom has excellent effects such as moist texture, low calorie and fast coloring .

1 is a view showing an example of an expression recombinant vector (pCES_sodCDPE) for producing a psicose syrup used in the present invention.

The present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited to the following examples.

Manufacturing example  One: Saikos  Produce

1-1: Saikos  Production of production strains

The DPE gene (Gene bank: EDS06411.1) derived from Clostridium scindens ATCC 35704 was synthesized as modified polynucleotides by optimizing E. coli for the Escherichia coli To name it CDPE. The polynucleotide optimized for Escherichia coli (SEQ ID NO: 2) and the sod promoter and T7 terminator obtained from the pET21a vector were obtained through PCR using each template, which was then ligated into a template by overlap PCR (PCR) And cloned into pGEM T-easy vector through T-vector cloning to confirm the sequence of the polynucleotide including the sod promoter (SEQ ID NO: 1), the optimized CDPE sequence of SEQ ID NO: 8 and the T7-terminator.

The entire confirmed polynucleotide was inserted into the same restriction enzyme site of the expression vector pCES208 (J. Microbiol. Biotechnol., 18: 639-647, 2008) using restriction enzymes NotI and XbaI (NEB) to obtain a recombinant vector pCES208 / (PCES_sodCDPE) was prepared. A cleavage map of the prepared recombinant vector (pCES_sodCDPE) is shown in Fig.

The prepared recombinant vector (pCES_sodCDPE) plasmid was transformed into Corynebacterium glutaricum using electroporation. Colonies were picked and inoculated into 4 ml of LB medium (10 g / L of tryptone, 10 g / L of NaCl, 5 g / L of yeast extract) supplemented with kanamycin at a final concentration of 15 ug / And 250 rpm for about 16 hours. Then, 1 ml of the culture was obtained and inoculated into 100 ml of LB medium containing 15 ug / ml kanamycin, and the cultivation was continued for 16 hours or more. After lysis of cells cultured with Beadbeater, only the supernatant is obtained, mixed with sample buffer 1: 1, and heated at 100? For 5 minutes. The prepared sample was subjected to electrophoresis on a 12% SDS-PAGE gel (composition: running gel - 3.3 ml H2O, 4.0 ml 30% acrylamide, 2.5 ml 1.5 M Tris buffer (pH 8.8) 20 μl 10% SDS, 20 μl 10% APS, 2 μl TEMED) at 180 V for about 50 minutes at room temperature The protein expression was confirmed by electrophoresis. After the expression of CDPE was confirmed on SDS-PAGE gel, the His-tag purification was performed using Ni-NTA resin to determine the precise expression level. The expression (%) = (Purified protein (mg) / Total soluble protein )) * 100). The transformed Corynebacterium glutaricum prepared above produced 16.62 mg of total soluble protein and 1.74 mg of purified enzyme protein.

1-2: Saikos  Manufacture of syrups

Cells were recovered by centrifugation in a strain culture in order to produce a scissors from fructose using the recombinant strain producing the scuche epimerase obtained in Production Example 1-1.

The cell suspension was then treated with 0.05% (w / v) of an emulsifier (M-1695) in a final volume at 35 ° C (± 5 ° C) for 60 minutes. After the completion of the reaction, the supernatant containing the emulsifier was removed using a centrifuge, and the cells were recovered.

For the preparation of the immobilized beads, the recovered cells were mixed with DW to a final cell concentration of 5% (w / v), mixed with 4% (w / v) alginic acid dissolved in water and 5% ) Were mixed at a ratio of 1: 1, and the mixture was stored at 4 ° C in order to remove the bubbles generated during mixing. The refrigerated mixture was injected through a Neddle (inner diameter: 0.20 to 0.30 mm) to form droplets. The mixture was dropped by weight. The dropped mixture was dropped into a 100 mM calcium chloride (CaCl ₂ ) To form spherical or elliptical beads (diameter 2.0 to 2.2 mm). The formed beads were soaked in a 100 mM calcium chloride solution and mixed evenly by a stirrer so as to be further cured.

After all of the mixed solution was injected, the beads were further cured while refrigerated for 4 to 6 hours, and then replaced with a fresh 100 mM calcium chloride solution, and cured in a refrigerated state for about 6 hours. The hardened beads were completely removed from the beads, and then water having a volume three times the bead volume was added thereto. The beads were then stirred for 10 minutes. This process was repeated three times to remove the calcium chloride solution. The washed beads were completely removed for manganese soaking, and then a 40-brix (%) reaction substrate containing 10 mM of manganese was added thereto in a volume three times as large as the bead volume, followed by stirring for 10 minutes. And replaced with a reaction substrate containing 10 mM manganese. The reaction substrate is adjusted to pH 6.8 ~ 7.2 with 3N NaOH. Depending on the type of product, liquid fructose or crystalline fructose can be the reaction substrate. The beads were replaced with a reaction substrate containing 10 mM manganese. The beads were transferred to the reaction tank and reacted at a reaction temperature of 50 ° C for about 30 to 60 minutes to complete the sorbing of beads with manganese and fructose. The diameter of the finished bead decreases to 1.6 ~ 1.8mm and the strength also increases. The substrate of the beads which had been soaked was removed and the immobilized reaction column was filled and used for the production of the viscose syrup.

≪ Immobilization column reaction conditions >

Reaction temperature: Column jacket internal temperature 50?

Substrate flow rate: 0.5 SV (space velocity L. h-1)

Reaction Substrate: Crystalline fructose 40brix, pH 6.8 to 7.2

Bead preparation: 2.5% (w / w) cells, 2% (w / w) alginic acid mixture and 10 mM Mn ^{2 +} soaking

The immobilization reaction column was provided with a raw material containing 92% by weight of fructose when the raw material solution contained 75% of solid content and 100% by weight of total solid content, Respectively. That is, 25 (w / w)% of psicose syrup of glucose: fructose: sucrose: oligosaccharide = 6: 67: 25: 2 was obtained from the reaction solution in the weight ratio of glucose: fructose: Lt; / RTI >

1-3: Saikos  Preparation of powder

To remove impurities such as color and ion components, the psicose syrup obtained in Preparation Example 1-2 was subjected to ion-exchange per hour in a column packed with a cation exchange resin, an anion exchange resin, and a resin mixed with six cation and anion exchange resins The resin was passed through at a rate of 2 times the volume of the resin, desalted, and then separated into a high-purity scorch solution by chromatography packed with a calcium (Ca ²⁺ ) type ion exchange resin. The high-purity cicos syrup was concentrated to a concentration of 82 Bx, and the solution was cooled to a supersaturated temperature of 35 캜 and then gradually cooled to a temperature of 10 캜 to form crystals. The mother liquor obtained in the crystallization step was centrifugally dehydrated to remove the mother liquor, and the crystal was washed with cooling water, followed by drying and recovering.

Example  1 to 4: Saikos  Containing brownie  Produce

The components and compositions shown in Table 2 below were mixed to prepare a dough for making brownies. In Example 1, 25% by weight of sucrose was used based on the total weight of sugar and cicose powder (purity of 99%) using 22.5% by weight of sugar and 7.5% by weight of cicose powder, Using Sikos powder 15 weight, 50 weight% of Sikos was used based on the total weight of sugar and Sikos powder (purity 99%), Example 3 was prepared using 7.5 weight% of sugar and 22.5 weight of Sikos powder, (75% by weight) was used as a basis of the total weight of the powder of cypress (purity of 99%). In Example 4, 30% by weight of Sikos was used without using any sugar.

Brownies were prepared by dissolving chocolate in hot water, mixing margarine, adding sugar, and mixing lightly. The other powder ingredients and eggs listed in Table 2 were added and mixed gently, and then baked at 180 ° C for 25 minutes in a molding pan.

Raw material (unit:% by weight) Comparative Example 1 Example 1 Example 2 Example 3 Example 4 weak flour 19.54 19.54 19.54 19.54 19.54 Jungbang 30.00 22.5 15.0 7.5 0 Saikosu powder 0 7.5 15.0 22.5 30.0 chocolate 4.65 4.65 4.65 4.65 4.65 margarine 9.90 9.90 9.90 9.90 9.90 An exorcism 3.50 3.50 3.50 3.50 3.50 Cocoa powder 6.50 6.50 6.50 6.50 6.50 Skim milk powder 4.30 4.30 4.30 4.30 4.30 lecithin 0.40 0.40 0.40 0.40 0.40 baking soda 0.25 0.25 0.25 0.25 0.25 Refined salt 0.36 0.36 0.36 0.36 0.36 Corn starch 7.50 7.50 7.50 7.50 7.50 dextrin 13.00 13.00 13.00 13.00 13.00 Guar gum 0.10 0.10 0.10 0.10 0.10 Sum 100.00 100.00 100.00 100.00 100.00

Comparative Example  1: Using sugar brownie  Produce

In substantially the same manner as in Example 1, dough and brownies were prepared. However, in place of 22.5% by weight of sugar and 7.5% by weight of Sicose powder used in Example 1, 30% by weight of sugar was used as Comparative Example 1. The specific ingredients and composition used for the preparation of the dough are shown in Table 2.

Test Example  One: Brownie  Assessment of water and water activity

Moisture refers to the water content contained in the food, and the moisture in the food is always fluctuating according to the surrounding environmental conditions, and indicates the water activity considering the relative humidity in the atmosphere. Water activity is a very important feature in food because it is related to the chemical, biophysical, and physical reactions in foods that change microbial growth and flavor, color, and flavor of food.

The water and moisture activity of the brownies prepared in Examples 1 to 4 and Comparative Example 1 were evaluated by the following methods. Water activity is an intrinsic property of food, and equilibrium relative humidity is a property in an environment that equilibrates with food. The moisture content (%) in the brownies was measured by using a moisture analyzer (Satoriuns, Germany) and weighed 2 g of the sample. The moisture content was measured by setting the temperature to 105 ° C. and the time to the automatic mode. Water activity was measured using a water activity meter (LG Electronics, Korea).

Raw material moisture(%) Water activity Comparative Example 1 14.02 0.776 Example 1 15.53 0.786 Example 2 16.67 0.788 Example 3 18.55 0.787 Example 4 19.27 0.789

As shown in the results of Table 3, in the case of Examples 1 to 4, water content increased proportionally, but water activity remained almost the same level as the content of psicose increased in comparison with Comparative Example 1 using only sugar. Generally, the soft texture of the cake product is better as the moisture content is higher, but the higher moisture content also increases the water activity, which may cause microbial growth. However, the product according to the present invention has an increased water content Is not a significant difference, it has the advantage of having a smooth texture and stability against microorganisms. The results of this experiment show that the dicalcium silicate and brownies according to the present invention have better moisturizing effect than the sugar, and also have a better result in enhancing the softness of the brownie than the sugar. Thus, in Example 4 containing no sugar but containing only psicose, the results were superior to those in Comparative Example 1 containing only sugar, in terms of moisturizing property and texture.

Test Example  2: Evaluation of hardness (softness)

The hardness of the brownies prepared in Examples 1 to 4 and Comparative Example 1 was measured by the following method to evaluate the degree of soft texture. The hardness of the sample was measured according to the following measurement conditions using a texture analyzer. The hardness measurement was repeated five times and the average value was shown in Table 4 below.

Test Speed 2.0 mm / s Post Speed 10.0 mm / s Distance 5.0mm Trig.Force 5g Probe HDP / LKB LIGHT KNIFE BLADE PERSPEX

Raw material Hardness Comparative Example 1 780 Example 1 730 Example 2 710 Example 3 680 Example 4 620

As shown in Table 5, it was found that the brownie of Comparative Example 1 using only sugar had the highest hardness, and the hardness of the brownie gradually decreased and the degree of softness increased as the content of the cicos was increased in the products of the Examples .

Test Example  3: Brownie Degree of expansion  evaluation

The height of the brownies prepared in Examples 1 to 4 and brownies prepared in Comparative Example 1 (using only sugar) was measured to confirm that the degree of swelling was appropriate. Measurements were made by placing the finished product on a flat plate and measuring the height using a vernier caliper.

Raw material Height (mm) Comparative Example 1 29.07 Example 1 30.4 Example 2 30.2 Example 3 30.2 Example 4 29.9

The swelling degree of the brownie was confirmed to be equivalent to that of the product of Comparative Example 1 using only sugar.

Test Example  4: Brownie  Sensory evaluation

In order to evaluate the moist feelings, usability, flavor, shape and sweetness of the brownie, the brownies of Examples 1-4 and Comparative Example 1 were placed in the mouth, stimulated evenly for 20 seconds and then spit out, After the mouth was washed with water at the end of the evaluation, the next sample was evaluated after 10 minutes passed, and the sensory elements were expressed on a 10-point box scale. The sensory evaluation staff consisted of 10 panel members who were trained on taste and flavor evaluation, and were rated on a 10-point scale. The evaluation criteria of the above items are as follows, and the results are shown in Table 7 below.

[Evaluation standard]

Moist texture Based on the degree of softness and hardness in the mouth, it is set to 0 points for no moist feeling and 10 points for the maximum value.

Flavor: Based on the degree of high and low odor, it is set to 10 points with low degree of smell, high odor with zero point, high smell with maximum value and minimum odor value.

Geometry: It is set as minimum 0 point and maximum 10 point based on appearance preference.

Sweetness: Based on the degree of sweetness, set to a minimum of 0 points and a maximum of 10 points.

Overall taste preference: set as minimum 0 point and maximum 10 point as subjective criteria

division Moistness zest shape sweetness Overall
Taste preference Comparative Example 1 5.2 5.9 7.3 6.7 6.8 Example 1 5.5 6.0 7.5 6.5 6.2 Example 2 6.8 6.3 7.2 7.0 6.9 Example 3 7.6 7.4 7.6 7.1 7.7 Example 4 8.3 7.7 7.5 6.9 7.3

As shown in Table 7, the brownies using the sauces were superior to the brownies of the Comparative Example 1 in terms of moist feel and flavor. Shape and sweetness were not significantly different.

<110> SAMYANG GENEX CORPORATION <120> Brownie with an improved quality and method of preparing the same <130> DPP20150660KR <160> 9 <170> Kopatentin 1.71 <210> 1 <211> 356 <212> DNA <213> Artificial Sequence <220> The sod promoter (6) <400> 1 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg acgaaaggat tacaaa 356 <210> 2 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> The Tac1 promoter (4) <400> 2 tgacaattaa tcatcggctc gtatattgtg tggaattgtg agcggataac aatttcacac 60 aggaaacaga attcccgggg aaaggattac aaa 93 <210> 3 <211> 112 <212> DNA <213> Artificial Sequence <220> <223> The Tac2 promoter (4) <400> 3 tgacaattaa tcatccggct cgtataatgt taacaatttg tggaattgtg agcggacaca 60 caggaaacag accatggaat tcgagctcgg tacccgggga aaggattaca aa 112 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> The Trc promoter (1) <400> 4 tgacaattaa tcatcggcct cgtataatgt 30 <210> 5 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Ribosome binding region <400> 5 gaaagga 7 <210> 6 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Spacer sequence <400> 6 ttacaaa 7 <210> 7 <211> 289 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of an enzyme protein originated from          Clostridium scindens <400> 7 Met Lys His Gly Ile Tyr Tyr Ala Tyr Trp Glu Gln Glu Trp Ala Ala   1 5 10 15 Asp Tyr Lys Arg Tyr Val Glu Lys Ala Ala Lys Leu Gly Phe Asp Ile              20 25 30 Leu Glu Val Gly Ala Ala Pro Leu Pro Asp Tyr Ser Ala Gln Glu Val          35 40 45 Lys Glu Leu Lys Lys Cys Ala Asp Asp Asn Gly Ile Gln Leu Thr Ala      50 55 60 Gly Tyr Gly Pro Ala Phe Asn His Asn Met Gly Ser Ser Asp Pro Lys  65 70 75 80 Ile Arg Glu Glu Ala Leu Gln Trp Tyr Lys Arg Leu Phe Glu Val Met                  85 90 95 Ala Gly Leu Asp Ile His Leu Ile Gly Gly Ala Leu Tyr Ser Tyr Trp             100 105 110 Pro Val Asp Phe Ala Thr Ala Asn Lys Glu Glu Asp Trp Lys His Ser         115 120 125 Val Glu Gly Met Gln Ile Leu Ala Pro Ile Ala Ser Gln Tyr Gly Ile     130 135 140 Asn Leu Gly Met Glu Val Leu Asn Arg Phe Glu Ser His Ile Leu Asn 145 150 155 160 Thr Ser Glu Glu Gly Val Lys Phe Val Thr Glu Val Gly Met Asp Asn                 165 170 175 Val Lys Val Met Leu Asp Thr Phe His Met Asn Ile Glu Glu Ser Ser             180 185 190 Ile Gly Asp Ala Ile Arg His Ala Gly Lys Leu Leu Gly His Phe His         195 200 205 Thr Gly Glu Cys Asn Arg Met Val Pro Gly Lys Gly Arg Thr Pro Trp     210 215 220 Arg Glu Ile Gly Asp Ala Leu Arg Glu Ile Glu Tyr Asp Gly Thr Val 225 230 235 240 Val Met Glu Pro Phe Val Arg Met Gly Gly Gln Val Gly Ser Asp Ile                 245 250 255 Lys Val Trp Arg Asp Ile Ser Lys Gly Ala Gly Glu Asp Arg Leu Asp             260 265 270 Glu Asp Ala Arg Arg Ala Val Glu Phe Gln Arg Tyr Met Leu Glu Trp         275 280 285 Lys     <210> 8 <211> 870 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (1) of the enzyme protein of SEQ          ID NO: 7 <400> 8 atgaaacacg gtatctacta cgcgtactgg gaacaggaat gggcggcgga ctacaaacgt 60 tacgttgaaa aagcggcgaa actgggtttc gacatcctgg aagttggtgc ggcgccgctg 120 ccggactact ctgcgcagga agttaaagaa ctgaaaaaat gcgcggacga caacggtatc 180 cagctgaccg cgggttacgg tccggcgttc aaccacaaca tgggttcttc tgacccgaaa 240 atccgtgaag aagcgctgca gtggtacaaa cgtctgttcg aagttatggc gggtctggac 300 atccacctga tcggtggtgc gctgtactct tactggccgg ttgacttcgc gaccgcgaac 360 aaagaagaag actggaaaca ctctgttgaa ggtatgcaga tcctggcgcc gatcgcgtct 420 cagtacggta tcaacctggg tatggaagtt ctgaaccgtt tcgaatctca catcctgaac 480 acctctgaag aaggtgttaa attcgttacc gaagttggta tggacaacgt taaagttatg 540 ctggacacct tccacatgaa catcgaagaa tcttctatcg gtgacgcgat ccgtcacgcg 600 ggtaaactgc tgggtcactt ccacaccggt gaatgcaacc gtatggttcc gggtaaaggt 660 cgtaccccgt ggcgtgaaat cggtgacgcg ctgcgtgaaa tcgaatacga cggtaccgtt 720 gttatggaac cgttcgttcg tatgggtggt caggttggtt ctgacatcaa agtttggcgt 780 gacatctcta aaggtgcggg tgaagaccgt ctggacgaag acgcgcgtcg tgcggttgaa 840 ttccagcgtt acatgctgga atggaaataa 870 <210> 9 <211> 870 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (2) of the enzyme protein of SEQ ID          NO: 7 <400> 9 atgaagcacg gcatctacta cgcatactgg gagcaggagt gggcagcaga ctacaagcgc 60 tacgttgaga aggcagcaaa gctgggcttc gacatcctgg aggttggcgc agcaccactg 120 ccagactact ccgcacagga ggttaaggag ctgaagaagt gcgcagacga caacggcatc 180 cagctgaccg caggctacgg cccagcattc aaccacaaca tgggctcctc cgacccaaag 240 atccgcgagg aggcactgca gtggtacaag cgcctgttcg aggttatggc aggcctggac 300 atccacctga tcggcggcgc actgtactcc tactggccag ttgacttcgc aaccgcaaac 360 aaggaggagg actggaagca ctccgttgag ggcatgcaga tcctggcacc aatcgcatcc 420 cagtacggca tcaacctggg catggaggtt ctgaaccgct tcgagtccca catcctgaac 480 acctccgagg agggcgttaa gttcgttacc gaggttggca tggacaacgt taaggttatg 540 ctggacacct tccacatgaa catcgaggag tcctccatcg gcgacgcaat ccgccacgca 600 ggcaagctgc tgggccactt ccacaccggc gagtgcaacc gcatggttcc aggcaagggc 660 cgcaccccat ggcgcgagat cggcgacgca ctgcgcgaga tcgagtacga cggcaccgtt 720 gttatggagc cattcgttcg catgggcggc caggttggct ccgacatcaa ggtttggcgc 780 gacatctcca agggcgcagg cgaggaccgc ctggacgagg acgcacgccg cgcagttgag 840 ttccagcgct acatgctgga gtggaagtaa 870

Claims (16)

A composition for preparing brownie comprising 30 to 60 parts by weight of wheat flour, 10 to 30 parts by weight of edible oil, 3 to 15 parts by weight of cocoa powder and 10 to 50 parts by weight of saccharide based on 100 parts by weight of the total solid content of the composition for preparing brownies,
Wherein the saccharide is a mixed sugar syrup or a powder produced from the mixed sugar syrup, and the mixed sugar syrup is a mixture of a sucrose epimerase, a strain of the strain producing the enzyme, a culture of the strain, Wherein the composition for the production of a sciatica comprising at least one member selected from the group consisting of the above-mentioned crushed product or an extract of the cultured product is used in an amount of 2 to 55 parts by weight, based on 100 parts by weight of the total solid content of the mixed sugar, , 30 to 80 parts by weight of fructose, 2 to 60 parts by weight of glucose and 0 to 15 parts by weight of oligosaccharide. delete The method of claim 1, wherein the saccharide comprises psicose,
And at least one saccharide selected from the group consisting of sugar, fructose, and starch syrup. delete delete delete The composition of claim 1, wherein the composition further comprises an egg component selected from the group consisting of whole egg, egg white, and egg yolk. The composition according to claim 1, wherein the brownie made from the composition for making brownie has a moisture content of 15% or more and a water activity of 0.78 to 0.8. The composition according to claim 1, which is a composition for producing a molded brownie prepared by compounding, molding and firing the composition for making brownie. delete The composition according to claim 1, wherein the composition further comprises at least one component selected from the group consisting of eggs, emulsifiers, swelling agents, chocolate, cocoa powder, indigestible dextrin, protein powder, vitamins, minerals, Composition. The composition according to claim 1, wherein the wheat flour is at least one selected from the group consisting of force, gravity, strength, millability, and a mixture thereof. The composition according to claim 1, wherein the edible oil is at least one selected from the group consisting of vegetable oil, animal oil, margarine, butter, shortening, and mixtures thereof. A kneaded product for preparing brownies, which is prepared by uniformly blending the composition for preparing brownies according to any one of claims 1, 3, 7 to 9, and 11 to 13. A brownie prepared by molding and firing a kneaded product prepared by uniformly blending the composition for making brownie according to any one of claims 1 to 13, and a kneading composition according to any one of claims 11 to 13. 16. The brownie according to claim 15, wherein the brownie has a moisture content of 15% or more and a water activity of 0.78 to 0.8.

Images