KR101620013B1 - Composition for controlling plant disease comprising niclosamide as effective component and uses thereof - Google Patents

Abstract

The present invention relates to a plant disease control composition comprising niclosamide or a pesticidally acceptable salt thereof as an active ingredient, a plant disease control agent comprising a step of treating the plant with the composition to inhibit the growth of pathogenic bacteria The present invention relates to a plant disease controlling agent comprising the compound of the present invention as an active ingredient and is useful for controlling rice blight blight, .

Description

[0001] The present invention relates to a composition for inhibiting plant diseases, which comprises nickel chloride as an active ingredient,

The present invention relates to a composition for controlling botanical disease comprising nickel chloride as an active ingredient and a use thereof. More particularly, the present invention relates to a plant disease prevention agent containing niclosamide or a pesticidally acceptable salt thereof as an active ingredient A method for controlling plant diseases, a method for controlling plant diseases, a method for controlling plant diseases, a method for controlling plant diseases, and a method for controlling plant diseases.

Bacterial blight is one of the most serious diseases of rice, and is particularly prevalent in irrigated farming areas and lowland lowland rice growing areas. Bacterial blight disease has three symptoms: leaf blight, kresek (symptom of seeding or wilting stage) and pale yellow leaf symptoms. This disease is often referred to as 'bacterial leaf blight', which means that leaf blight symptoms are the most pronounced and commonly observed symptoms.

The most common symptom of bacterial blight is wilting of leaves, especially of young leaves, because bacterial acne pathogens penetrate into the ductal tissue through bacterial growth in predominantly xylem element. In rice, bacterial blight is caused by rice blast fungus ( Xanthomonas campestris pv. Oryzae ) and causes a great loss of grain yield. Over the past decade, numerous studies have focused on protecting rice from bacterial blight, but this remains unresolved. Therefore, the present inventors have paid attention to a known chemical substance to solve the problem of bacterial blight in rice.

The present inventors have inferred that drugs or chemicals that treat animal diseases can be effectively used to protect plants from attack by pathogens. Thus, the present inventors have selected niclosamide (5-chloro-N- (2-chloro-4-nitrophenyl) -2-hydroxybenzamide), which has been used for treating tapeworm infections in humans and animals since the 1960s. In addition, recent studies have shown that nickel chloride has an antiviral effect against severe acute respiratory syndrome (SARS) virus, anthrax toxin property, and anti-tumor activity. In addition, it is a potent inducer of the LC3-proton autophagosome, an inhibitor of the Wnt / Frizzled pathway, and an inhibitor of the autonomous notch signaling pathway. Moreover, nickel disassociates the oxidative oxidation of mitochondria and slows cell growth.

Korean Patent No. 1055263 discloses a new use of Pseudomonas fluorescens microgul 1895 KACC10072 strain for controlling rice pathogenic fungus, and Korean Patent No. 1363163 discloses a novel use of nalamycin rice blossom The use of the compound of the present invention as an active ingredient and the use thereof are not disclosed.

The present inventors have found that niclosamide, which has been used as a tapeworm antiparasitic agent, inhibits the growth of rice blast fungus, so that the present inventors have found that niclosaride The present inventors completed the present invention by confirming that they effectively inhibited the wilting of rice leaves in the experimental group treated together.

In order to solve the above problems, the present invention provides a plant disease controlling composition comprising niclosamide or a pesticidally acceptable salt thereof as an active ingredient.

In addition, the present invention provides a plant disease control method comprising the step of treating plants with the composition to inhibit the growth of pathogenic bacteria.

The present invention also provides a plant disease controlling agent comprising the above composition.

According to the present invention, a plant disease controlling composition comprising niclosamide of the present invention as an active ingredient is effective for controlling rice blight blight, so that it may be useful for improving the productivity of rice.

Fig. 1 is a graph showing the results of measurement of Xanthomonas campestris pv . oryzae , hereinafter referred to as Xoo ), (A) shows the effect of nickeloside on the growth of two Xoo (B) was the result of confirming the effect of the parthenolide used as the control group on the two Xoo strains, and the result of culturing the strain, PXO99 and 10208 on LB medium containing different concentrations of nickel , (C) are the results of confirming the inhibitory effect of the growth of nickel chloride on the three E. coli strains.
Fig. 2 shows the results of confirming the effect of nickel chloride on the disease response of rice plants by the representative strain Xoo . (A) is a photograph showing 14 days after inoculation of a plant (mock) inoculated with Xoo bacillus alone and a plant (Niclosamide) inoculated with Xoo and nickeloside in a rice variety, Dongjin and Nippon barrel. Position. (B) shows the results of calculating the number of Xoo bacteria from the leaves of Dongjin and Nipponbare on days 4, 8, 12 and 16 after inoculation of Xoo bacterium alone (●) or Xoo / nickeloside mixture (○) .
Figure 3 shows the results of qRT-PCR analysis of the expression levels of pathogen-related genes in the leaves treated with nickeloside and Xoo . ●, normal controls; ○, injured control group; ▼, only group treated with nickel chloride; ▽, Xoo alone treatment group; ■, Xoo and mixed with nickeloside .

In order to achieve the object of the present invention, the present invention provides a plant disease controlling composition comprising niclosamide or a pesticidally acceptable salt thereof as an active ingredient.

In the composition for controlling according to one embodiment of the present invention, the pesticidally acceptable salt of nickel chloride is, for example, a metal salt, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid, Or salts with acidic amino acids, and the like. Suitable metal salts include, for example, alkali metal salts such as sodium salts, potassium salts and the like; Alkaline earth metal salts such as calcium salts, magnesium salts, barium salts and the like; Aluminum salts and the like. Salts with organic bases include, for example, salts with organic bases such as trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N , N-dibenzylethylenediamine, and the like. Salts with inorganic acids may include, for example, salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like. Salts with organic acids may include salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, benzenesulfonic acid, p- toluenesulfonic acid and the like . Salts with basic amino acids may include salts with, for example, arginine, lysine, ornithine, and the like. Salts with acidic amino acids may include salts with, for example, aspartic acid, glutamic acid and the like.

The composition for controlling according to one embodiment of the present invention may further comprise an agrochemically acceptable carrier and / or excipient. The excipients included in the composition of the present invention are those conventionally used in the agricultural field and include, for example, oxides such as diatomaceous earth and slaked lime, phosphates such as apatite, sulfates such as gypsum, clay, kaolin, bentonite, Silica and the like, a filler, an anti-coagulant, a surfactant, an emulsifier, a preservative, and the like. In addition, the compositions of the present invention can be formulated into plants using methods known in the art to allow rapid release, sustained release, and delayed release of the active ingredient. For the formulation, additives such as surfactants, diluents, dispersants, and adjuvants commonly used may be blended with the active ingredient to prepare a wetting agent, a suspension, an emulsion, a emulsion, a mist, a liquid, a dispersing liquid, a granular wetting agent, A liquid wettable powder, a water-swellable granule, a tablet, and the like.

In the controlling composition according to one embodiment of the present invention, the plant bottle may be a bacterial disease such as blight of blight of foliage, root blight disease, ulcer disease, blight disease, but is not limited thereto. The bacterial disease may be, but is not limited to, rice blight blight disease.

The composition for controlling plant diseases according to the present invention may be in the form of, for example, directly sprayable solutions, powders and suspensions or in the form of highly concentrated aqueous, oily or other suspensions, dispersions, emulsions, oily dispersions, pastes, dusts, But is not limited thereto. In addition, the plant disease controlling composition can be used by spraying, spraying, spraying, scattering or swelling. The mode of use depends on the intended purpose, and in all cases the distribution of the composition according to the invention should be as fine and uniform as possible.

The composition for controlling plant diseases of the present invention can be formulated into various forms. The preparation may be prepared, for example, by adding a solvent and / or a carrier. Often, inert additives and surface-active materials, such as emulsifiers or dispersants, are mixed into the formulation. Suitable surface-active materials include, but are not limited to, aromatic sulfonic acids (e.g., lignosulfonic acid, phenol-sulfonic acid, naphthalene- and dibutylnaphthalenesulfonic acid), fatty acids, alkyl- and alkylarylsulfonates, alkyl lauryl ethers, A salt of a fatty alcohol glycol ether, a sulfonate naphthalene and derivatives thereof, a condensate of formaldehyde, a condensate of naphthalene or naphthalene sulfonic acid, a phenol and a formaldehyde Condensates, polyoxyethylene octylphenol ethers, ethoxylated isooctyl-, octyl- or nonylphenol, alkylphenyl or tributylphenyl polyglycol ethers, alkylaryl polyether alcohols, isotridecyl alcohol, fatty alcohol / ethylene oxide condensates , Ethoxylated castor oil, polyoxyethylene alkyl ether or polyoxypropylene, lauryl alcohol Polyglycol ether acetate, sorbitol esters, lignin-sulfite waste liquid, or may be a cellulose, are not limited.

Suitable solid carrier materials are in principle all porous and comprise an agriculturally acceptable carrier such as mineral earths such as silica, silica gel, silicate, talc, kaolin, limestone, limestone, chalk, Fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, vegetable products such as cereal flour, bark powder, wood meal, And nut shell powder), or cellulose powder. The solid carrier may be used alone or in combination of two or more.

The plant disease controlling composition of the present invention can be used for crossing, dipping, foliar spraying, seed sterilization or agricultural equipment disinfection, but is not limited thereto.

The plant disease controlling composition of the present invention can be used as an effective ingredient by mixing nickelcloride alone or in combination with two or more different antimicrobial substances.

The plant disease control composition of the present invention can be mixed with a dispersing agent, a penetrating agent, or a surfactant in order to improve crop absorption and effect.

The present invention also provides a plant disease control method comprising the step of treating plants with the composition of the present invention to inhibit the growth of pathogenic bacteria. The composition of the present invention is a composition for controlling botanical disease comprising nickel chloride as an active ingredient.

The composition of the present invention can be applied to plants by a conventional method. When applied to plants, it may be applied directly to the leaves, stems, branches, roots and seeds of the plants, sprayed or applied to the plants, mixed with the soil or medium used for cultivation in general cultivated soil such as rice fields or fields, The case can be treated on the surface to control the disease. A specific application method is a coating treatment, an immersion treatment, a fumigation treatment or a spraying treatment, for example, the composition can be applied to soil, plant leaves, stems, seeds, flowers or fruits. The composition of the present invention can be used in water or in a suitable medium by dilution for application to plants.

In the control method according to one embodiment of the present invention, the pathogenic bacterium may be, but is not limited to, Xanthomonas campestris pv. Oryzae .

The present invention also provides a plant disease controlling agent comprising the composition of the present invention. The composition of the present invention is a composition for controlling botanical disease comprising nickel chloride as an active ingredient. In the controlling agent of the present invention, the plant disease may be a bacterial disease, but is not limited thereto. The bacterial disease may be, but is not limited to, rice blight blight disease. The solvent, carrier or adjuvant generally used in the formulation of the composition is as described above.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Experimental Method

One. Xoo  Influence of nickel chloride on bacterial growth

(MIC) and minimum inhibitory concentration (MIC) of the two strains of Xanthomonas campestris pv. Oryzae (hereinafter referred to as Xoo ) were investigated. Xoo strain was purchased from RDA (Korea). Xoo strain was cultured at 590 nm to an optical density of 1.0 in a peptone-sucrose liquid medium containing 50 μg / ml of cephalexin (Sigma-Aldrich) as an antibiotic. Thereafter, to examine the effect of nickel chloride on bacterial growth and to determine the minimum inhibitory concentration of nickel chloride, 2 [mu] l of each culture solution was added to a culture medium containing nickel chloride at a concentration of 0 to 50 [mu] g / Lt; / RTI > Parthenolide (Sigma-Aldrich) was also tested for the antimicrobial activity against two Xoo strains of PXO99 and 10208 using the same method as that of nickel . The antibacterial activity of the nitrosamides against the three E. coli strains Top10, Roseeta2 and DH10b was also tested. The E. coli strain was cultured in an LB medium at 590 nm to an optical density of 1, followed by transferring 2 μl of each culture to a medium containing different concentrations of nickel chloride, and culturing. Plates on which bacteria were inoculated were cultured at 37 ° C for 15 hours and then photographed.

2. Inoculation and incidence of pathogens

Two different Japonica rice varieties, Dongjin and Nipponbare, and Xoo strain, PXO99, were used to determine if nickelosamid had an inhibitory effect on the progress of leaf blight of rice. In order to treat the pathogens on rice, the plants were grown in a greenhouse under light conditions at 31 ° C and light conditions at 25 ° C and dark for 12 hours to the booting stage. The PXO99 strain was cultured in a peptone-sucrose liquid medium containing 50 占 퐂 / ml of cephalexin and 50 占 퐂 / ml of nickel chloride, followed by leaf clipping method (Kauffman, HE et al., 1973, Plant Disease Rep. 57: 537-541). After 14 days in the greenhouse, the plants were photographed.

To measure growth of pathogens in the rice treated with nickel chloride , the ends of leaves treated with Xoo strain alone or with nickel chloride alone were cut out from the plant and then ground. Each sample was then suspended in sterile water and plated on a peptone-sucrose medium containing 15 / / ml of cephalexin. Disease levels were calculated by counting the number of colonies every 4 days after inoculation.

3. Analysis of expression levels of pathogen-related genes in rice treated with nickel

The rice strain, Dongjin, infected Xoo bacteria through the front part . Also, a mixture of 50 μg / ml of nickeloside or a mixture of nickeloside and Xoo bacteria was treated through the whole lobe. The untreated group also wound as a control group. Total RNA was extracted from 1 cm of leaves at 1, 0.5, 6, 12, and 24 hours after treatment, and diluted to the same amount by quantitative analysis. The first strand cDNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, USA) with 1 μg of total RNA. The same amount of cDNA was amplified through a quantitative real-time RT-PCR (MyiQ, Bio-Rad) according to the manufacturer's protocol. Then, the template cDNA and the 10 nM gene-specific primer were mixed with 25 μl of iQ SYBR Green Super Mix (Bio-Rad), and the reaction was performed according to the following temperature cycling conditions: 95 ° C for 10 minutes; 45 cycles of 95 ° C for 10 seconds, 60 ° C for 10 seconds, and 72 ° C for 10 seconds. The Ct value of the target gene was normalized to the Ct value of the actin gene and analyzed using iCycler IQ software (Bio-Rad). The experiment was repeated twice. PCR primers were designed using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi), their specificity was cloned into pGEM T-easy vector (Promega, USA) And sequenced using an ABI 3730xl DNA Analyzer (Applied Biosystems, USA). The list of primers used in the present invention is shown in Table 1 below.

Primer information used in real-time qRT-PCR Gene name (5 'to 3') (SEQ ID NO: 5) Reverse direction (5 '- > 3') (SEQ ID NO: OsPR1 TTATCCTGCTGCTTGCTGGT (1) GATGTTCTCGCCGTACTTCC (2) OsPR10 GGCACCATCTACACCATGAA (3) TCGAGCTCGTACTCCACCTT (4) OsWRKY62 AGGATGGGTACCAATGGA (5) ACGAGTTGATGGAGATGGA (6) OsWRKY71 AGCCCAAGATCTCCAAGCTC (7) ACGAGGATCGTGTTGTCCTC (8) Actin TGGCATCTCTCAGCACATTCC (9) TGCACAATGGATGGGTCAGA (10)

Example 1: Preparation of nickel Xoo  Bacterial growth inhibitory effect

In order to evaluate the action effect of nickelosamid on bacterial blight, the inhibitory activity against the growth of Xoo bacteria was verified. For this purpose, two Xoo strains, PXO99 and 10208 , were used. As a result, the growth of both bacterial strains was completely inhibited at a concentration of 5 μg / ml of chylosamide (FIG. 1A). In addition, as a control, a sesquiterpene lactone system known as an anticancer agent, parthenolide, was tested, which did not inhibit the growth of two Xoo bacteria (Fig. 1B). To confirm this result, the effect of the nitrosamides on the growth of three E. coli strains, Top10, Rosseta2 and DH10b, as gram negative control bacteria was tested. As a result, it was confirmed that nickel chloride did not affect the growth of the three E. coli strains at a concentration of 50 μg / ml (FIG. 1C).

Example 2 Inhibitory Effect of Nicklosamide on Bacterial Blight of Rice

The functional role of nickel chloride in the inhibition of bacterial blight in rice was examined. For this experiment, two rice varieties, Dongjin and Nipponbare, were grown in the growth chamber for 4 weeks and then used for pathogen and nickeloside treatment. As a result of observing the phenotype of the rice treated with the pathogen ( Xoo strain) and the nickel chloride mixture, leaf wilting was not observed in the leaves of the two rice varieties treated with the pathogen and the nitrosamide, In rice varieties, leaf wilting was observed to be fairly widespread (FIG. 2A). Next, the level of bacterial growth was determined in the rice treated with nickel chloride and the leaves of untreated rice. As a result, it was confirmed that the growth of Xoo bacteria was significantly inhibited in the leaves of rice treated with the pathogens, compared with the rice treated with only the pathogens without treating with the nucleoside (Fig. 2B).

Example 3. Effect of Nickeloside on the expression of defense-related genes

We have confirmed that nickelosamides inhibit leaf wilting caused by Xoo infection, so we have confirmed that this inhibitory effect of nickeloside protects Xoo infected plants through the induction of pathogen-associated gene expression in plants. For this purpose, rice varieties were treated with nickel chloride , Xoo and nickeloside / Xoo . In addition, the control plants were scarred because they were injected into the leaf clipping of the leaves when treated with the nitrosamides or pathogens. Total RNA was extracted from leaf samples of treated plants and transcript levels of four pathogen-associated genes PR1 , PR10 , WRKY62 and WRKY71 were confirmed by real-time quantitative RT-PCR. As a result, it was confirmed that Xoo infection induces all of the expression of the four genes. Expression of PR1 and PR10 increased for the first 6 hours after treatment, then gradually decreased to the basal level, and the expression of WRKY62 and WRKY71 increased for the first 30 minutes after treatment and then rapidly decreased to the basal level. Nickelosamine alone treatment also slightly induced the expression of the four genes, with confirmed transcript levels being similar to gene expression levels in the wound control controls, indicating that gene expression was induced by wounding, . It was also observed that the levels of expression of the four pathogen-associated genes in the clozamid / Xoo treated samples were restored to the levels confirmed in the wound control controls (FIG. 3).

<110> SNU R & DB FOUNDATION <120> Composition for controlling plant disease comprising niclosamide          as effective components and uses thereof <130> PN14137 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 ttatcctgct gcttgctggt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gatgttctcg ccgtacttcc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ggcaccatct acaccatgaa 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tcgagctcgt actccacctt 20 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 aggatgggta ccaatgga 18 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 acgagttgat ggagatgga 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 agcccaagat ctccaagctc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 acgaggatcg tgttgtcctc 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 tggcatctct cagcacattc c 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tgcacaatgg atgggtcaga 20

Claims (8)

A composition for inhibiting blight of rice blossom blight comprising niclosamide or a pesticidally acceptable salt thereof as an active ingredient. The composition according to claim 1, further comprising a pesticidally acceptable carrier or excipient. delete delete A method for controlling blight of rice blast fungus comprising treating the plant with the composition of claim 1 or 2 to inhibit the growth of Xanthomonas campestris pv. Oryzae . delete A composition for preventing blight of rice blight of blight comprising the composition of claim 1 or 2. The composition according to claim 7, which is formulated by a wetting agent, a suspension, an emulsion, an emulsion, a mist, a liquid, a dispersing liquid, a granulating agent, a granule, a powder, a liquid wettable powder, Rice blight blight prevention agent.

Images