KR20170077997A - Mixed strain having nematicidal effect against root knot nematode and uses thereof - Google Patents

Abstract

In the present invention, oligo-less nematocides effect excellent AAS robot for the root-knot nematode (Meloidogyne sp.) Which are parasitic on crops, soil spokes La (Arthrobotrys oligospora) NT-21 strain, Streptomyces Abbe reumi subtilis (Streptomyces avermitilis KKY-0217 strain and Paecilomyces lysineus lilacinus ) strain NE-86. Therefore, the mixed strains prepared by mixing the three strains do not inhibit mutual growth, and they exhibit a synergistic effect of inhibiting egg hatching and growth of root-knot nematodes, as compared with the case of using the strains alone, . Therefore, the three kinds of mixed strains of the present invention can be prepared by microorganisms themselves, liquid, granular or powder form, and can be treated in various ways such as seeds, plants, bases and soils, and microorganism preparations It can be very useful.

Description

Mixed strains having nematode effect against root-knot nematodes and uses thereof.

The present invention relates to a mixed strain having a nematode effect against root-knot nematodes and uses thereof.

Meloidogyne spp . Was first found in cucumber rootstocks grown in the UK's greenhouses in the 1850s, with 78 species distributed worldwide. There are all local to the root-knot nematodes of six kinds of forms, root-knot nematode is a problem in crops are peanut root-knot nematode (Meloidogyne arenaria ), carrot root nematode ( Meloidogyne hapla ) and sweet potato root nematodes ( Meloidogyne incognita ). These nematodes have various kinds of crops such as eggplant, potato, watermelon and strawberry as a host, and they are particularly harmful to the facility cultivation complex. Root-knot nematodes (Meloidogyne sp.) In length from 0.1 to habitat anywhere on Earth as a small animal about 1mm and plays an important role in the soil ecosystem of about 400,000 per soil 1m ^2. Among them, 10% are nematodes parasitic to plants and 90% are free-living nematodes. It is also known to cause half of crop damage caused by nematode infection. It is parasitic on roots, stems and leaves of about 700 kinds of crops around the world, blocking nutrient migration pathways and damaging nutrients. Especially, there is a lot of nematode damage caused by the sequence in the facilities. It causes 20 ~ 30% decrease in yield and causes a lot of damage due to secondary infections such as fungi, bacteria and viruses.

The life span of the root-knot nematode is divided into six stages, and the second larva hatched from the egg breaks through the thimble of the root of the plant and infects the plant by absorbing the nutrients of the plant. Plant cells in the parasitic area increase in the number of cells, hypertrophy occurs and lumps form. Giant cells are larger than normal cells and have about 100 nuclei with endoreduplication, which increases chromosomes without meiosis. When the nematode of the nematode enters the roots of the second instar larva, it moves between the cells and reaches the anastomosis. Then, the nematode secretion is released through the cell wall of the plant using the needle connected with the esophagus, Parenchymatous cells are used to ingest nutrients. Fully differentiated giant cells are larger than normal cells and have approximately 100 nucleotides (multinucleates) with an intrinsic replication that increases chromosomes without meiosis. The nematode is administered three times by molt. Sometimes they develop into males and then go out of their roots, but this does not affect reproduction. Pear-shaped females lay eggs and are released to the root surface. In order to reduce or control crop damage caused by nematode infection, there are crop rotation, soil fumigation, soil humidification, use of organic matter, management of mullet management, early sowing and formality. However, these methods affect plant and can not be completely controlled. And resistant varieties are also rare. In addition, chemical control using aldicarb, fenamiphos, and methyl bromide may be performed, but this causes human and environmental pollution problems. Therefore, research using microorganisms is actively under way as a new method for nematode remedy.

Korean Patent Laid-Open Publication No. 2003-0094540 discloses a microbial nematode containing a novel strain having a nematode activity, a method for producing and treating the microbial nematode, and Korean Patent No. 0791983 discloses an anti- Leuces microorganisms and microorganism preparations for controlling plant-derived nematodes containing the same. However, the mixed strains having the nematode effect against the root-knot nematodes of the present invention and their uses have not yet been disclosed.

The present invention is derived by the request as described above, the inventors have raised less root-knot nematode (Meloidogyne sp.) Nematocides effect is excellent AAS robot for parasitic on crops, soil spokes La (Arthrobotrys oligospora) NT-21 strain, Streptomyces Abbe reumi subtilis (Streptomyces avermitilis KKY-0217 strain and Paecilomyces lysineus lilacinus ) strain NE-86. Therefore, it was confirmed that the mixed strains prepared by mixing the above three strains of the present invention had no mutual growth inhibitory ability and showed synergy effect of inhibiting egg hatching and growth of root-knot nematodes than when the strains were used alone , Thereby completing the present invention.

In order to accomplish the above object, the present invention relates to a method for producing an anti- oligospora) strain, Streptomyces Abbe reumi subtilis (Streptomyces avermitilis , and Paecilomyces lilacinus . The present invention also provides a mixed strain for controlling root-knot nematitis .

The present invention also provides a composition for controlling root blight nematitis, which comprises the above-mentioned mixed strain, a culture of the strain, or a concentrate of a culture solution of the strain, and a pesticide acceptable carrier.

In addition, the present invention provides a method for controlling root-knot nematia comprising the step of treating an effective amount of the composition for controlling root-knot nematosis to a plant part, soil or seed.

The present invention also provides a method for preparing a composition for controlling root nodule nematism comprising culturing the mixed strain.

In addition, the present invention provides a composition for preventing or treating infection with root-knot nematia, which comprises the mixed strain, the culture of the strain or a concentrate of the culture medium of the strain and an agrochemically acceptable carrier.

In the present invention, oligo-less nematocides effect excellent AAS robot for the root-knot nematode (Meloidogyne sp.) Which are parasitic on crops, soil spokes La (Arthrobotrys oligospora strain NT-21, Streptomyces avermitilis KKY-0217 strain and Paecilomyces lysineus lilacinus ) strain NE-86. Therefore, the mixed strains prepared by mixing the three strains do not inhibit mutual growth, and they exhibit a synergistic effect of inhibiting egg hatching and growth of root-knot nematodes, as compared with the case of using the strains alone, . Therefore, the three kinds of mixed strains of the present invention can be prepared by microorganisms themselves, liquid, granular or powder form, and can be treated in various ways such as seeds, plants, bases and soils, and microorganism preparations It can be very useful.

1 is oligonucleotide-less Ars robot of the present invention sports La (Arthrobotrys oligospora ) NT-21 strains.
Fig. 2 shows the phylogenetic positions of the strain Streptomyces avermitilis KKY-0217 of the present invention.
Figure 3 is a graphical representation of the results obtained with Paecilomyces < RTI ID = 0.0 > lilacinus ) strain NE-86.
FIG. 4 is a graph showing the activity of the inventive Arthrobotrys oligospora) NT-21 strain (a), Streptomyces Abbe reumi subtilis (Streptomyces avermitilis KKY-0217 strain (b) and Paecilomyces lira sinensis lilacinus ) NE-86 strain (c).
Figure 5 is a graphical representation of the results obtained from the Arthrobotrys < RTI ID = 0.0 > oligospora) NT-21 strain, Streptomyces Abbe reumi subtilis (Streptomyces avermitilis ) KKY-0217 strain, Paecilomyces lysineus lilacinus ) NE-86 strain, and three mixed strains prepared by mixing them.
FIG. 6 is a graph showing the activity of the inventive Arthrobotrys oligospora) NT-21 strain, Streptomyces Abbe reumi subtilis (Streptomyces avermitilis ) KKY-0217 strain, Paecilomyces lysineus lilacinus NE-86 strains, and three mixed strains prepared by mixing them. The control value is the control (%).

In order to accomplish the present invention, the present invention relates to a method for the treatment of arthrobotrys The present invention relates to a mixed strain for controlling root-knot nematitis , which comprises an oligospora strain, a Streptomyces avermitilis strain and a Paecilomyces lilacinus strain.

In the mixed strains for controlling root-knot nematodes according to the present invention, the asbestosolysis oligospora strain is an arthrobotrys with accession number KCTC12879BP oligospora) NT-21 strain, and Streptomyces Abbe reumi subtilis strain of Streptomyces Abbe reumi subtilis (Accession No. KCTC12846BP the Streptomyces avermilitis KKY-0217 strain, Paecilomyces lysineus lilacinus ) strain is a strain of Paecilomyces < RTI ID = 0.0 > lilacinus strain NE-86.

The above-mentioned Arthrobotrys oligospora) NT-21 strain, Streptomyces Abbe reumi subtilis (Streptomyces avermitilis KKY-0217 strain and Paecilomyces lysineus lilacinus NE-86 isolates were isolated from the root-knot nematode soil and were selected as strains with excellent egg hatching and growth inhibition ability of root-knot nematodes. Asda said the robot called Spokane up leased (Arthrobotrys oligospora) NT-21 strain is dated 11 August 2015 (KCTC12879BP) on the Korea Research Institute of Bioscience and Biotechnology, Streptomyces Abe reumi Antilles (Streptomyces avermitilis ) KKY-0217 was deposited at the Korea Biotechnology Research Institute on June 16, 2015 (KCTC12846BP) and Paecilomyces lysineus lilacinus strain NE-86 was deposited with KCTC12880BP on Aug. 11, 2015 at the Korea Research Institute of Bioscience and Biotechnology.

In the above-mentioned mixed strains according to the present invention, the nematode activity is generally caused by a root-knot nematode ( Meloidogyne sp.); Sister nematodes such as Heterodera sp., Globodera sp. And the like; Primateen (Pratylenchus.); Tylenchulus semipenetrans; Radopholus; Ditylenchus; Anguina; It is a live nematode activity against Aphelenchoides, preferably a live nematode activity against the root nematode ( Meloidogyne sp.), But is not limited thereto.

In the mixed strain according to the present invention, the root-knot nematode bacteria are meloidogyne flasks hapla , Meloidogyne < RTI ID = 0.0 > incognita , Meloidogyne < / RTI > arenaria , Meloidogyne javanica , or Meloidogyne fallax , but are not now limited.

The present invention also provides a composition for controlling root blight nematitis, which comprises the above-mentioned mixed strain, a culture of the strain, or a concentrate of a culture solution of the strain, and a pesticide acceptable carrier.

The composition for controlling root-knot nematitis according to the present invention may be in the form of, for example, directly sprayable solutions, powders and suspensions, or in the form of highly concentrated aqueous, oily or other suspensions, dispersions, emulsions, oily dispersions, pastes, dusts, But are not limited thereto.

The root-knot nematode controlling composition of the present invention can be formulated into various forms. The preparation can be prepared, for example, by adding a solvent and / or a carrier. Often, inert additives and surface-active materials, such as emulsifiers or dispersants, are mixed into the formulation. Suitable surface-active materials include, but are not limited to, aromatic sulfonic acids (e.g., lignosulfonic acid, phenol-sulfonic acid, naphthalene- and dibutylnaphthalenesulfonic acid), fatty acids, alkyl- and alkylarylsulfonates, alkyl lauryl ethers, A salt of a fatty alcohol glycol ether, a sulfonate naphthalene and derivatives thereof, a condensate of formaldehyde, a condensate of naphthalene or naphthalene sulfonic acid, a phenol and a formaldehyde Condensates, polyoxyethylene octylphenol ethers, ethoxylated isooctyl-, octyl- or nonylphenol, alkylphenyl or tributylphenyl polyglycol ethers, alkylaryl polyether alcohols, isotridecyl alcohol, fatty alcohol / ethylene oxide condensates , Ethoxylated castor oil, polyoxyethylene alkyl ether or polyoxypropylene, lauryl alcohol Polyglycol ether acetate, sorbitol esters, lignin-sulfite waste liquid, or may be a cellulose, are not limited.

Suitable solid carrier materials are in principle all porous and comprise an agriculturally acceptable carrier such as mineral earths such as silica, silica gel, silicate, talc, kaolin, limestone, limestone, chalk, Fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, vegetable products such as cereal flour, bark powder, wood meal, And nut shell powder), or cellulose powder. The solid carrier may be used alone or in combination of two or more.

The root-knot nematode controlling composition of the present invention can be used for, but is not limited to, a tube-receiving, a leaf-surface spraying, a seed sterilizing, or an agricultural equipment disinfection.

The root-knot nematode controlling composition of the present invention can be mixed with a diffusing agent, a penetrating agent, or a surfactant to enhance plant absorption and effect.

In addition, the present invention provides a method for controlling root-knot nematia comprising the step of treating an effective amount of the composition for controlling root-knot nematosis to a plant part, soil or seed.

As a method for controlling the root-knot nematode, an effective amount of the composition for controlling nematode root can be sprayed or sprayed on a plant part, soil or seed, but is not limited thereto.

The " effective amount " of the present invention can be determined by uniformly diluting the control composition with water to control the root-knot nematode in an amount sufficient to produce beneficial or desired results, and then sprayed onto the plant and arable land using a suitable spraying device such as a power sprayer . When the wettable powder or liquid wettable powder of the present invention is diluted in water, the concentration of the wettable powder or the liquid wettable powder may be adjusted to 10 ⁵ to 10 ¹⁰ cfu / ml so that the effective ingredient may be in a biologically effective range, but is not limited thereto.

The present invention also provides a method for preparing a composition for controlling root nodule nematism comprising culturing the mixed strain.

Any method known in the art can be used for culturing the strain, and the method is not particularly limited.

In addition, the present invention provides a composition for preventing or treating infection with root-knot nematia, which comprises the mixed strain, the culture of the strain or a concentrate of the culture medium of the strain and an agrochemically acceptable carrier.

The composition for preventing or treating infections of root-knot nematodes according to the present invention is particularly useful for the prevention of diseases caused by root-knot nematodes, In particular, since interest in pollution-free and safe agricultural products is increasing and demand is increasing, and the awareness of residual toxicity and environmental pollution due to the use of pesticides is rising, pollution-free safety products Which can greatly contribute to the production of

The composition for preventing or treating infection with root-knot nematodes according to the present invention is a composition for preventing or treating nematode infestation, wherein the nematode-damaged cereals such as wheat, barley, rye, oats, rice, (Such as sugar cane and related crops), sugar beets (such as sugar beets and feed beets), cucumber plants (such as oil, squash, melons), vegetables (such as spinach, lettuce, asparagus, cabbage and brassica, Citrus fruit (such as orange, lemon, grapefruit, Chinese mandarin), fruit (such as apple, pear, plum, peach, almond, cherry, strawberry, raspberry and blackberry) (Eg, cotton, flaxseed, poppy, olive, sunflower seed, coconut, castor oil plant, cocoa seed, peanut), alfalfa, , Hemp, jute), Laura (For example, avocado, cinnamon, camphor), deciduous trees and conifers (for example, timber, chestnut, duck, poplar, birch, fir, larch, pine) (For example, but not limited to, coffee, sugarcane, tea, vine, hops, bananas and natural rubber trees) or to the cultivated soil or seeds of these plants. . On the other hand, in the case where it is necessary to prevent or treat nematode infestation in plant parts, soil, seeds, or where soil purification by removal of nematode is necessary, microorganisms having nematicidal activity of the present invention and / It may be possible to suppress the damage caused by nematodes by administering both microorganisms and chemical insecticides simultaneously.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited thereto.

Materials and methods

One. Root-knot nematodes Meloidogyne  sp.) of  Securing and Identifying

Meloidogyne sp. Isolates were washed with 500 ml of 0.5% sodium hypochlorite solution and 100 g of roots cut to 1 cm from the homogenizer ( Nihonseiki Kaisha LTD.) For 3 minutes at 2000 rpm. Then roots were removed using a 200 mesh sieve, and the eggs collected in a 500 mesh sieve were used in the following examples by irradiating an alumina (number of eggs per ml) under an optical microscope.

Five females of root-knot nematodes were separated from the plants using micro-forceps and washed three times with distilled water. Then, the DNA of the root-knot nematode was isolated using a DNeasy blood and tissue kit (QIAGEN-Inc), amplified using primers shown in Table 1 below, amplified Were identified.

Primers for analysis of root-knot nematode species primer
name SEQ ID NO: The primer sequence (5'-3 ') Specificity and source MI-F One GTGAGGATTCAGCTCCCCAG M. incognita -specific SCAR MI-R 2 ACGAGGAACATACTTCTCCGTCC Far 3 TCGGCGATAGAGGTAAATGAC M. arenaria -specific SCAR Rar 4 TCGGCGATAGACACTACAAACT Fjav 5 GGTGCGCGATTGAACTGAGC M. javanica -specific Rjav 6 CAGGCCCTTCAGTGGAACTATAC JMV1 7 GGATGGCGTGCTTTCAAC M. pills , M. chitwoodi and
M. fallax specific IGS-SCAR JMV2 8 TTTCCCCTTATGATGTTTACCC JMV halpa 9 AAAAATCCCCTCGAAAAATCCACC

2. eelworm  Identification and identification of predatory microorganisms

2kg of soil around the root of the root of the rootstock nematode was observed in the cultivation area where the root necrosis nematode was developed. The microorganism was treated with 2g of 100g soil, The agar medium was placed on the center of the medium, and 50 nematodes were added to the agar medium. The medium was incubated at 25 ° C. and the appearance of predatory microorganisms was observed under a stereomicroscope. Mycelia and microorganisms forming the predator structure were regarded as nematode predatory microorganisms, and spores and microorganisms produced on the medium were separately separated and subcultured in CMA (Corn Meal Agar) medium supplemented with 100 ppm of streptomycin.

3. Isolated eelworm  Investigation of mutual growth of predatory microorganisms

In order to confirm whether the three kinds of microorganisms having the control effect against the separated root-knot nematodes affects mutual growth, Arthrobotrys oligospora) NT-21 strain (a), Streptomyces Abbe reumi subtilis (Streptomyces avermitilis KKY-0217 strain (b) and Paecilomyces lira sinensis lilacinus NE-86 strain (c) was cultivated in a PDA (Potato Dextrose Agar) medium for 5 days at 30 ° C, and the cells were cut into 1 cm ² and inoculated with the above three strains in a new PDA medium. For 3 days to confirm mutual growth inhibition of each strain.

Example  One. To root-knot nematodes  Identification of three microorganisms with anti-microbial effect

Three kinds of microorganisms having a controlling effect on root-knot nematodes were cultured in a PDB (Potato Dextrose Broth) medium for 3 to 5 days. Then, the mycelia grown in the PDB medium were sterilized by sterilized gauze and then sterilized And the mycelium was transferred to a 1.5-ml tube and lyophilized. After the mycelia of the three lyophilized microorganisms were pollinated, only individual genes were extracted, and specific genes were amplified using the primers shown in Table 2 below. The nucleotide sequence of each microbial strain was analyzed by NCBI blast to determine the phylogenetic position. Three microorganisms were identified as Arthrobotrys oligospora) NT-21 strain, Streptomyces Abbe reumi subtilis (Streptomyces avermitilis KKY-0217 strain and Paecilomyces lysineus lilacinus strain NE-86 (Figs. 1 to 3).

The primers used in the present invention Name of the primer Sequence information (5'-3 ') Forward Reverse ITS4 CTT GGT CAT TTA GAG GAA GTA A (SEQ ID NO: 10) TCC TCC GCT TAT TGA TAT GC
(SEQ ID NO: 11)

Example  2. The strain of the three strains of the present invention Mutual  Growth confirmation

As shown in FIG. 4, three strains of the present invention, Arthrobotrys oligospora NT-21 (a), Streptomyces avermitilis KKY-0217 strain (b) And Paecilomyces lilacinus NE-86 strain (c) did not exhibit mutual inhibitory power while growing in the same medium, indicating that the combination of the three strains was effective in the culture and formulation process and even after application to the soil It is considered that there is no problem in commercialization of the three strains by inhibiting growth of each other.

Example  3. Mixed strains of the present invention Root-knot nematode  Confirming egg hatching inhibition effect

In order to determine the predation ability of the nematode of the predatory microorganism on the eggs, a 1.5% water-agar medium was used as a cow borer in the soil, incognita ) 500 eggs were placed and incubated at 25 ℃ for 10 days. Nematode eggs were observed under a dissecting microscope. The strains Arthrobotrys oligospora NT-21, Streptomyces avermitilis KKY-0217 and Paecilomyces lysineus, lilacinus ) NE-86 were cultured in PDB (Potato Dextrose Broth) medium for 3 days, respectively. In this embodiment, the manufacturing number of the cultured microbial cells such that each of the 1 × 10 ⁸ CFU / ㎖ was used 3㎖, the mixed culture is a mix 3㎖ by microorganisms of 1 × 10 ⁸ CFU / ㎖ each 1㎖ Respectively. The control (control) was compared with the nematode of the nematode without the treatment of root - knot nematode. As a result, as shown in Fig. 5, after 10 days of incubation, the number of nematodes was increased by Arthrobotrys oligospora) NT-21 strain, Streptomyces Abbe reumi subtilis (Streptomyces avermitilis KKY-0217 strain and Paecilomyces lysineus lilacinus NE-86), it was confirmed that the mixture of three strains was superior to that of the strains treated with the strain alone, to inhibit egg hatching of root-knot nematodes.

Example  4. Mixed strains of the present invention Root-knot nematode  Identification of growth inhibition effect

Arthrobotrys oligospora strain NT-21, Streptomyces avermitilis strain KKY-0217 and Paecilomyces lilacinus strain NE-86, which have root-knot nematitis control effect, The strains were cultured in PDB (Potato Dextrose Broth) medium for 3 days, respectively. And the number of cultured microbial cells was adjusted to 1 x 10 ⁸ CFU / ml. 300 ml of the cultured microorganisms were used in each test port, and 100 ml of each 1 × 10 ⁸ CFU / ml of the microorganism was mixed, and 300 ml was used for the test. As a result of confirming the root formation after 30 days, as shown in FIG. 6, among the three strains, Streptomyces avermitilis avermitilis KKY-0217 showed the best control rate (69.32%), followed by Paecilomyces lycinus lilacinus strain NE-86 (39.06%) and Arthrobotrys oligospora NT-21 strain (25.36%). There was a significant difference in the control ratio according to the inoculation strain and it was confirmed that the highest control rate (82.16%) was observed in the control strain inoculated with the mixed strains prepared by mixing the three strains.

Korea Biotechnology Research Institute KCTC12879BP 20150811 Korea Biotechnology Research Institute KCTC12846BP 20150616 Korea Biotechnology Research Institute KCTC12880BP 20150811

<110> Korea Research Institute of Bioscience and Biotechnology <120> Mixed strain having nematicidal effect against root knot nematode          and uses <130> PN15248 <160> 11 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gtgaggattc agctccccag 20 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 acgaggaaca tacttctccg tcc 23 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 tcggcgatag aggtaaatga c 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tcggcgatag acactacaaa ct 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggtgcgcgat tgaactgagc 20 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 caggcccttc agtggaacta tac 23 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ggatggcgtg ctttcaac 18 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tttcccctta tgatgtttac cc 22 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 aaaaatcccc tcgaaaaatc cacc 24 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 cttggtcatt tagaggaagt aa 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 tcctccgctt attgatatgc 20

Claims (7)

Arthrobotrys oligospora) strain, Streptomyces Abbe reumi subtilis (Streptomyces avermitilis ) and Paecilomyces lysineus lilacinus ) for the control of root nematode. The method according to claim 1, wherein the asbestosolysis oligospora strain is selected from the group consisting of Arthrobotrys &lt; RTI ID = 0.0 &gt; oligospora) NT-21 strain, and Streptomyces Abbe reumi subtilis strain of Streptomyces Abbe reumi subtilis (Accession No. KCTC12846BP the Streptomyces avermilitis KKY-0217 strain, Paecilomyces lysineus lilacinus ) strain is a strain of Paecilomyces &lt; RTI ID = 0.0 &gt; lilacinus strain NE-86. The method of claim 1, wherein the root-knot nematode was mellow and Ido Guinea Plastic (Meloidogyne hapla), Melo Ido Guinea encoding other cognitive (Meloidogyne incognita , Meloidogyne &lt; / RTI &gt; arenaria , Meloidogyne javanica ) or Meloidogyne fallax ( Meloidogyne fallax ). A composition for controlling root blight nematitis, which comprises a mixed strain according to any one of claims 1 to 3, a culture of the strain or a concentrate of the culture medium of the strain and an agrochemically acceptable carrier. A method for controlling a root-knot nematode comprising the step of treating an effective amount of a composition for controlling root-knot nematism according to claim 4 to a plant part, soil or seed. A method for preparing a composition for controlling root-knot nematitis, which comprises culturing a mixed strain of any one of claims 1 to 3. A composition for preventing or treating infection of a root-knot nematode, comprising a mixed strain of any one of claims 1 to 3, a culture of the strain or a concentrate of the culture medium of the strain and an agrochemically acceptable carrier.

Images