KR101588119B1 - 63 DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Polymorphic Microsatellites of 63 Gene - Google Patents

63 DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Polymorphic Microsatellites of 63 Gene Download PDF

Info

Publication number
KR101588119B1
KR101588119B1 KR1020140058990A KR20140058990A KR101588119B1 KR 101588119 B1 KR101588119 B1 KR 101588119B1 KR 1020140058990 A KR1020140058990 A KR 1020140058990A KR 20140058990 A KR20140058990 A KR 20140058990A KR 101588119 B1 KR101588119 B1 KR 101588119B1
Authority
KR
South Korea
Prior art keywords
slc6a3
seq
gene
primer set
dna
Prior art date
Application number
KR1020140058990A
Other languages
Korean (ko)
Other versions
KR20150131770A (en
Inventor
임선희
김원태
이세라
노윤길
Original Assignee
동아대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 동아대학교 산학협력단 filed Critical 동아대학교 산학협력단
Priority to KR1020140058990A priority Critical patent/KR101588119B1/en
Publication of KR20150131770A publication Critical patent/KR20150131770A/en
Application granted granted Critical
Publication of KR101588119B1 publication Critical patent/KR101588119B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10Modifications characterised by
    • C12Q2525/151Modifications characterised by repeat or repeated sequences, e.g. VNTR, microsatellite, concatemer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 SLC6A3(solute carrier family 6[dopamine], member 3) 유전자의 다형성 소위성과 이를 이용한 DNA 타이핑 키트 및 상기 유전자 관련 질병의 진단키트에 관한 것으로, 보다 상세하게는 개인 식별 마커로 사용할 수 있는 도파민 수송체(dopamine transporter)인 SLC6A3 유전자 내의 다형성 소위성, 상기 다형성 소위성 검출용 프라이머 세트, 상기 프라이머 세트를 이용한 DNA 타이핑 키트 및 SLC6A3 유전자 관련 질병의 진단키트에 관한 것이다. 본 발명에 따른 SLC6A3 유전자 내의 다형성 소위성 SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9은 멘델리안 유전에 따라 감수분열을 통해 전달되므로, 이를 DNA 타이핑함으로써 개체의 친자 확인, 혈연 확인 또는 법의학적 감정에 효과적으로 사용할 수 있다. 또한, SLC6A3-MS9 다형성 소위성 영역에서 7번 반복되는 대립형질을 가지는 경우 고혈압에 대하여 그 감수성이 정상인보다 약 2배 이상 높게 나타남에 따라, SLC6A3-MS9 다형성 소위성은 고혈압 같은 질병에 대한 감수성을 조사하는 중요한 마커로서 예측진단에 중요한 자료로 유용하게 사용될 수 있다.The present invention relates to a polynomial so-called SLC6A3 gene (solute carrier family 6 [dopamine], member 3) gene, a DNA typing kit using the same, and a diagnostic kit for the gene related disease, and more particularly, It relates to a transporter (dopamine transporter) in SLC6A3 DNA typing kit using the polymorphic small satellite, the polymorphism detection primer set for small satellite, the primer set in the gene, and diagnostic kits of the SLC6A3 gene associated disease. Since the polymorphic small satellites SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8 and SLC6A3- MS9 in the SLC6A3 gene according to the present invention are transmitted through meiosis according to the Mendelian genetic makeup, It can be used effectively for forensic feelings. In addition, SLC6A3 -MS9 polymorphic allele with a small case that is repeated seven times in the satellite area appear, depending on its sensitivity against high blood pressure for more than 2 times higher than normal, SLC6A3 -MS9 polymorphism called castle investigate the susceptibility to diseases such as hypertension, As an important marker, can be useful as an important data for predictive diagnosis.

Description

SLC6A3 유전자의 다형성 소위성과 이를 이용한 DNA 타이핑 키트 및 상기 유전자 관련 질병의 진단키트{DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Polymorphic Microsatellites of SLC6A3 Gene}(DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Polymorphic Microsatellites of SLC6A3 Gene)

본 발명은 SLC6A3(solute carrier family 6[dopamine], member 3) 유전자의 다형성 소위성과 이를 이용한 DNA 타이핑 키트 및 상기 유전자 관련 질병의 진단키트에 관한 것으로, 보다 상세하게는 개인 식별 마커로 사용할 수 있는 도파민 수송체(dopamine transporter)인 SLC6A3 유전자 내의 다형성 소위성, 상기 다형성 소위성 검출용 프라이머 세트, 상기 프라이머 세트를 이용한 DNA 타이핑 키트 및 SLC6A3 유전자 관련 질병의 진단키트에 관한 것이다.The present invention relates to a polynomial so-called SLC6A3 gene (solute carrier family 6 [dopamine], member 3) gene, a DNA typing kit using the same, and a diagnostic kit for the gene related disease, and more particularly, SLC6A3 , a dopamine transporter A DNA typing kit using the primer set, and a diagnostic kit for SLC6A3 gene related diseases.

척추동물의 게놈(genome)에 있어서, 막 단백질을 암호화하는 유전자는 가장 큰 그룹 중에 하나를 이룬다. 인간과 쥐의 경우, 막 단백질들은 전체 유전자의 10% 이상을 차지하고, 그 종류로는 G-단백질 수용체, 키나아제 수용체, 이온 채널 및 solute carrier 등이 있다. 상기 막 단백질 중, solute carrier(SLC)는 당, 아미노산, 뉴클레오티드 및 무기 이온이 수동적 또는 능동적으로 세포막을 통과하도록 조절한다. 현재 solute carrier(SLC)는 51개의 다른 군들이 존재하며, 이들 중에, SLC6 군의 단백질은 신경전달물질(neurotransmitter), 아미노산 및 오스모라이트(osmolyte, 침투압 조절 물질)의 특이적인 운반체 역할을 한다. 신경시스템에서 신경전달물질(neurotransmitter)은 생리학적인 여러 현상을 조절한다. 특히, 이들은 뇌와 관련하여 뇌의 여러 병리학적 과정에 포함되며, 파킨슨병, 우울증, 간질 및 약물남용과 같은 질병에 연관되어 있다. 상기 SLC6 군은 GABA(gamma-aminobutyric acid), 모노아민(monoamine), 아미노산(amino acid) 및 올판(orphan) 의 4가지로 소분류된다. In vertebrate genomes, genes encoding membrane proteins form one of the largest groups. In humans and mice, membrane proteins account for more than 10% of the total genes, including G-protein receptors, kinase receptors, ion channels and solute carriers. Of the membrane proteins, solute carriers (SLC) regulate the passage of sugar, amino acids, nucleotides and inorganic ions passively or actively through the cell membrane. Currently, there are 51 different groups of solute carriers (SLCs), of which the protein of the SLC6 group serves as a specific carrier for neurotransmitters, amino acids and osmolytes. Neurotransmitters in the nervous system control many physiological phenomena. In particular, they are involved in several pathological processes of the brain in relation to the brain and are associated with diseases such as Parkinson's disease, depression, epilepsy and drug abuse. The SLC6 group is subdivided into four groups of GABA (gamma-aminobutyric acid), monoamine, amino acid and orphan.

SLC6A3 은 모노아민 그룹에 해당하고, SLC6A19SLC6A20과 함께 5p15.3 부위에 위치하고 있다. SLC6A3은 뇌에서 높은 발현을 보이므로, 여러 신경전달물질과 관련된 질병에 영향을 미칠 것으로 보인다. 최근 연구에 따르면, SLC6 군의 다른 유전자 내의 SNP(단일염기다형성)가 고혈압과도 관련되어 있음이 보고되었다(Koh Ono, et al., Hypertens Res . 26(9):685-689, 2003). SLC6A3 And it is available for the monoamine groups, located in the 5p15.3 region with SLC6A19 and SLC6A20. SLC6A3 is highly expressed in the brain and is likely to affect many neurotransmitter related diseases. Recent studies have shown that SNPs (single nucleotide polymorphisms) in other genes of the SLC6 group are also associated with hypertension (Koh Ono, et al., Hypertens Res . 26 (9): 685-689, 2003).

한편, 인간의 게놈에서 약 45% 정도의 많은 부분을 차지하고 있는 반복서열 (repeated sequence)은 새로운 유전자의 발생과 다양성의 변이를 포함한 전체 게놈의 진화를 이해하는데 중요한 역할을 하며, 이 영역에서의 변이는 여러 난치병과 높은 연관성을 지닌다. 다양한 반복서열 중 연쇄반복(tandem repeat, TR) 서열은 인간 유전체의 10% 이상을 차지하고, 다양한 질병의 원인이 되며 유전자 발현의 조절 및 진화에서 매우 중요한 요소이다. 연쇄반복 서열은 그 길이에 따라 모든 사람에서 하나의 대립형질(allele)만을 가진 단형성(monomorphic)과 2개 이상의 대립형질(allele)을 가지고 사람마다 다르게 나타나는 다형성(polymorphic)으로 구분된다. 이러한 연쇄반복 서열에 속하는 다형성 소위성(Polymorphic Microsatellites)은 그 길이가 주로 10 ~ 100 bp의 반복단위를 지니고 반복횟수에 따라 수 백 bp에서 약 20 kb 이상에 이르기까지 다양한 길이를 나타낸다. 이 반복서열은 주로 유전자 조절영역과 인트론 부분에 존재하며 Mucin 유전자와 같이 엑손에 존재하여 그 기능에 중요한 역할을 수행하는 경우도 있다. 이러한 다형성 소위성은 그 길이에 따른 다형성이 매우 높아 두 개 이상의 대립형질을 갖는 마커로 사용이 가능하여 유전체 연구의 유전자 지도 마커(genetic mapping marker)로 널리 사용되고 있으며, 이 외에도 친자확인이나 법의학 마커로 유용하게 사용될 수 있다.On the other hand, the repeated sequence, which accounts for about 45% of the human genome, plays an important role in understanding the evolution of the entire genome, including the generation of new genes and variations in diversity, Is highly associated with several incurable diseases. Of the various repeat sequences, the tandem repeat (TR) sequence accounts for more than 10% of the human genome, is responsible for a variety of diseases, and is an important factor in the regulation and evolution of gene expression. Sequence repeats are divided into monomorphic individuals with only one allele in each person according to their length and polymorphic individuals with two or more alleles that differ from person to person. Polymorphic Microsatellites belonging to this chain repeating sequence have various lengths ranging from several hundred bp to about 20 kb or more depending on the number of repetition, having a length of mainly 10 to 100 bp. This repeating sequence is mainly present in the gene regulatory region and the intron portion, and may exist in the exon such as the Mucin gene, and may play an important role in its function. These polymorphic so-called polymorphisms are highly polymorphic in length and can be used as markers with two or more alleles. They are widely used as genetic mapping markers in genomic research. In addition, they are useful as paternity markers or forensic markers Lt; / RTI >

따라서 당업계에는 구조적으로 매우 복잡한 유전자 내의 연쇄반복(tandem repeat, TR) 분석 및 다형성 소위성의 발견 및 질병과의 관련성에 대한 연구가 매우 중요한 연구 분야로 자리 잡았으며, 현재 지속적인 발전이 절실히 요구되고 있는 실정이다. Therefore, in the field of the art, the study of the tandem repeat (TR) analysis in the structurally very complex gene, the discovery of the polymorphic sociopaths and the relation with the disease has become a very important research field, and the continuous development is urgently required It is true.

이에 본 발명자들은 친자확인이나 법의학 마커로 유용하게 사용될 수 있는 특정 유전자 내의 다형성 소위성 규명과 더불어 이들의 질병과의 관련성을 연구하기 위하여 예의 노력하였으며, 그 결과 도파민 수송체로 알려진 SLC6A3 유전자의 다형성 소위성의 위치를 분석하였고, 상기 다형성 소위성 중 일부가 멘델리안 유전에 따라 감수분열을 통해 전달된다는 것을 확인하고, 본 발명을 완성하게 되었다.Therefore, the present inventors have made intensive efforts to investigate the relationship between these diseases and polymorphonuclear satellites in specific genes that can be useful as paternity identification or forensic markers. As a result, SLC6A3 The location of the polymorphic so-called gene in the gene was analyzed, and it was confirmed that some of the polymorphic satellites were transferred through meiosis according to the Mendelian genetic make-up, thereby completing the present invention.

한국등록특허 제10-0861383호Korean Patent No. 10-0861383 한국등록특허 제10-0861384호Korean Patent No. 10-0861384

따라서 본 발명의 주된 목적은 개인 식별 마커로 사용 가능한 다형성 소위성 검출용 프라이머 세트를 제공하는데 있다.It is therefore a principal object of the present invention to provide a set of primers for detection of polymorphic satellites usable as a personal identification marker.

본 발명의 다른 목적은 상기 프라이머 세트를 이용하여 개체의 친자 확인, 혈연 확인 또는 법의학적 감정에 유용한 DNA 타이핑 키트를 제공하는데 있다.It is another object of the present invention to provide a DNA typing kit which is useful for identification of a parent, identification of a blood vessel, or forensic feeling of an individual using the primer set.

본 발명의 또 다른 목적은 상기 프라이머 세트를 이용하여 개체의 친자 확인, 혈연 확인 또는 법의학적 감정에 유용한 DNA 타이핑 방법을 제공하는데 있다.Another object of the present invention is to provide a method of DNA typing which is useful for identification of a parent, identification of blood, or forensic emotion of an individual using the primer set.

본 발명의 또 다른 목적은 상기 프라이머 세트를 이용하여 SLC6A3 관련 질병의 진단키트를 제공하는데 있다.It is still another object of the present invention to provide a primer set comprising the SLC6A3 And to provide a diagnostic kit for a related disease.

상기 목적을 달성하기 위하여, 본 발명은 (ⅰ) 서열번호 11 및 12의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 3번 영역의 다형성 소위성 SLC6A3-MS1 검출용 프라이머 세트; (ⅱ) 서열번호 17 및 18의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 4번 영역의 다형성 소위성 SLC6A3-MS4 검출용 프라이머 세트; (ⅲ) 서열번호 25 및 26의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 8번 영역의 다형성 소위성 SLC6A3-MS8 검출용 프라이머 세트; 및 (ⅳ) 서열번호 27 및 28의 염기서열로 표시되는, SLC6A3 유전자 내의 엑손(exon) 15번 영역의 다형성 소위성 SLC6A3-MS9 검출용 프라이머 세트로 구성된 군에서 선택되는 개인 식별 마커용 다형성 소위성 검출용 프라이머 세트를 제공한다.(I) a primer set for detecting an intron 3 region of the SLC6A3 gene, which is represented by the nucleotide sequence of SEQ ID NOs: 11 and 12, for the detection of a polymorphonuclear SLC6A3- MS1; (Ii) a primer set for detection of the intron 4 region of the SLC6A3 gene, represented by the nucleotide sequences of SEQ ID NOS: 17 and 18, for the detection of the polymorphonuclear SLC6A3- MS4; (Iii) a primer set for detection of the intron 8 region of the SLC6A3 gene, represented by the nucleotide sequences of SEQ ID NOS: 25 and 26, for the detection of the polymorphonuclear SLC6A3- MS8; And (iv) a primer set for detection of the polymorphonuclear SLC6A3- MS9 of the exon 15 region in the SLC6A3 gene, represented by the nucleotide sequences of SEQ ID NOS: 27 and 28, A primer set for detection is provided.

본 발명은 또한, 상기 프라이머 세트를 포함하는 서열번호 1의 SLC6A3-MS1, 서열번호 4의 SLC6A3-MS4, 서열번호 8의 SLC6A3-MS8 및 서열번호 9의 SLC6A3-MS9로 구성된 군에서 선택되는 다형성 소위성 검출을 위한 DNA 타이핑 키트를 제공한다.The present invention also relates to a polynucleotide selected from the group consisting of SLC6A3- MS1 of SEQ ID NO: 1, SLC6A3- MS4 of SEQ ID NO: 4, SLC6A3- MS8 of SEQ ID NO: 8 and SLC6A3- MS9 of SEQ ID NO: A DNA typing kit for satellite detection is provided.

본 발명은 또한, 개체의 조직으로부터 추출된 게놈 DNA를 주형으로 하고, 상기의 프라이머 세트를 사용하여 PCR을 수행하는 단계; 및 상기 PCR 산물을 전기영동으로 분리하여 서열번호 1의 SLC6A3-MS1, 서열번호 4의 SLC6A3-MS4, 서열번호 8의 SLC6A3-MS8 및 서열번호 9의 SLC6A3-MS9로 구성된 군에서 선택되는 다형성 소위성을 검출하는 단계를 포함하는 DNA 타이핑 방법을 제공한다.The present invention also provides a method for amplifying a nucleic acid comprising the steps of: performing PCR using a genomic DNA extracted from a tissue of a subject as a template and using the above primer set; And separating the PCR product by electrophoresis into a polymorphic subsatellite selected from the group consisting of SLC6A3- MS1 of SEQ ID NO: 1, SLC6A3- MS4 of SEQ ID NO: 4, SLC6A3- MS8 of SEQ ID NO: 8, and SLC6A3- MS9 of SEQ ID NO: And detecting the DNA in the DNA.

본 발명의 일실시예에 있어서, 상기 검체는 혈액, 머리카락, 타액, 표피, 정액, 질 채취물, 분리된 세포, 조직샘플, 비듬 및 유골로 구성된 군으로부터 선택된 1종 이상일 수 있다.In one embodiment of the present invention, the specimen may be at least one selected from the group consisting of blood, hair, saliva, epidermis, semen, quality samples, separated cells, tissue samples, dandruff and ashes.

본 발명의 일실시예에 있어서, 상기 DNA 타이핑 방법은 개체의 친자 확인, 혈연 확인 또는 법의학적 감정에 사용될 수 있다.In one embodiment of the present invention, the DNA typing method can be used for paternity identification, blood donation confirmation, or forensic medical evaluation of an individual.

본 발명은 또한, 서열번호 27 및 28의 염기서열로 표시되는, SLC6A3 유전자 내의 엑손(exon) 15번 영역의 다형성 소위성 SLC6A3-MS9 검출용 프라이머 세트를 포함하는 SLC6A3 관련 질병 진단키트를 제공한다.The present invention also provides an SLC6A3- related disease diagnostic kit comprising a primer set for detecting a polymorphonuclear SLC6A3-MS9 of an exon 15 region in the SLC6A3 gene represented by the nucleotide sequences of SEQ ID NOS: 27 and 28.

본 발명의 일실시예에 있어서, 상기 SLC6A3 관련 질병은 고혈압일 수 있다.In one embodiment of the present invention, the SLC6A3 A related disease can be hypertension.

본 발명에 따른 SLC6A3 유전자 내의 다형성 소위성 SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9은 멘델리안 유전에 따라 감수분열을 통해 전달되므로, 이를 DNA 타이핑함으로써 개체의 친자 확인, 혈연 확인 또는 법의학적 감정에 효과적으로 사용할 수 있다. 또한, SLC6A3-MS9 다형성 소위성 영역에서 7번 반복되는 대립형질을 가지는 경우 고혈압에 대하여 그 감수성이 정상인보다 약 2배 이상 높게 나타남에 따라, SLC6A3-MS9 다형성 소위성은 고혈압 같은 질병에 대한 감수성을 조사하는 중요한 마커로서 예측진단에 중요한 자료로 유용하게 사용될 수 있다.Since the polymorphic small satellites SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8 and SLC6A3- MS9 in the SLC6A3 gene according to the present invention are transmitted through meiosis according to the Mendelian genetic makeup, It can be used effectively for forensic feelings. In addition, SLC6A3 -MS9 polymorphic allele with a small case that is repeated seven times in the satellite area appear, depending on its sensitivity against high blood pressure for more than 2 times higher than normal, SLC6A3 -MS9 polymorphism called castle investigate the susceptibility to diseases such as hypertension, As an important marker, can be useful as an important data for predictive diagnosis.

도 1은 인간 5번 염색체에 위치하는 SLC6A3 유전자의 위치 및 방향을 나타내는 개략도이다. 5p15.3 염색체상의 SLC6A3 유전자를 도식한 그림과 SLC6A3 유전자의 구조 및 유전자 내의 소위성(minisatellite, MS)의 위치를 보여주고 있다. 엑손(exon)은 검은색 선으로 표시하였고, Tandem Repeats Finder Program에 의해 검출된 소위성(minisatellite)의 위치를 별표(*)로 표시하였다.
도 2는 SLC6A3-MS1의 다형성 소위성(polymorphic minisatellites)을 보여주는 전기영동 사진이다.
도 3은 SLC6A3-MS4의 다형성 소위성(polymorphic minisatellites)을 보여주는 전기영동 사진이다.
도 4는 SLC6A3-MS8의 다형성 소위성(polymorphic minisatellites)을 보여주는 전기영동 사진이다.
도 5는 SLC6A3-MS9의 다형성 소위성(polymorphic minisatellites)을 보여주는 전기영동 사진이다.
도 6은 SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9 이 부모와 자손 간에 있어서 유전적으로 전달되는 것을 보여주는 전기영동 사진이다. 첫 번째 및 마지막 레인은 사이즈 마커이다. GF 또는 GM은 할아버지 또는 할머니를 의미하고, F 또는 M은 아버지 또는 어머니를 의미하며, 자손의 DNA 샘플은 C1 및 C2로 나타내었다.
1 is a schematic diagram showing the position and direction of the SLC6A3 gene located on the chromosome 5 of human. Small satellite in a schematic the SLC6A3 gene on chromosome 5p15.3 picture structure and genes of the SLC6A3 gene shows the location of the (minisatellite, MS). The exon is indicated by a black line, and the location of the minisatellite detected by the Tandem Repeats Finder Program is indicated by an asterisk (*).
Figure 2 is an electrophoresis image showing polymorphic minisatellites of SLC6A3- MS1.
Figure 3 is an electrophoresis photograph showing polymorphic minisatellites of SLC6A3- MS4.
Figure 4 is an electrophoresis image showing polymorphic minisatellites of SLC6A3- MS8.
Figure 5 is an electrophoresis image showing polymorphic minisatellites of SLC6A3- MS9.
Figure 6 is an electrophoresis image showing that SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8 and SLC6A3- MS9 are genetically transferred between parent and offspring. The first and last lanes are size markers. GF or GM means grandfather or grandmother, F or M means father or mother, and descendants DNA samples are labeled C1 and C2.

본 발명은 개인 식별 마커의 용도로 사용할 수 있는 SLC6A3 유전자 관련 다형성 소위성(polymorphic minisatellites)을 제공함에 그 특징이 있다.The present invention relates to the use of SLC6A3 Gene-related polymorphic minisatellites.

본 발명에서 용어 ‘소위성(minisatellite)’은 약 10 ~ 100 bp개의 뉴클레오티드로 이루어진 기본 단위가 동일한 방식으로 수차례 반복되어 있는 서열을 의미하며, 이러한 구조를 ‘연쇄반복서열(tandem repeat sequences)’이라고 부른다.The term " minisatellite " in the present invention means a sequence in which a basic unit consisting of about 10 to 100 bp nucleotides is repeated several times in the same manner, and this structure is referred to as 'tandem repeat sequences' .

본 발명에서 용어 ‘다형성(polymorphism)’이란 하나의 유전자 좌위(locus)에 두 가지 이상의 대립유전자(allele)가 존재하는 경우를 의미한다.The term " polymorphism " in the present invention means a case where two or more alleles exist in one locus.

본 발명에서 용어 ‘다형성 소위성(polymorphic minisatellites)’이란 연쇄반복 서열에 해당하는 소위성이 모든 사람에서 2개 이상의 대립형질(allele)을 가지고 사람마다 다르게 나타나는 다형성을 갖는 것을 의미한다.The term " polymorphic minisatellites " in the present invention means that the bovine satellite corresponding to a chain repeat sequence has at least two alleles in all persons and has a polymorphism that differs from person to person.

본 발명에서 용어 ‘대립유전자(allele)’는 상동염색체의 동일한 유전자 좌위(locus) 위에 존재하는 한 유전자의 여러 타입을 말한다.The term " allele " in the present invention refers to various types of a gene existing on the same locus of a homologous chromosome.

상기 SLC6A3(solute carrier family 6[dopamine], member 3) 유전자는 SLC6 군에서 모노아민 그룹에 해당하고, SLC6A19SLC6A20과 함께 Homo sapiens chromosome 5p15.3 부위에 위치하고 있다. SLC6A3은 뇌에서 높은 발현을 보이므로, 여러 신경전달물질과 관련된 질병에 영향을 미칠 것으로 예상되고 있다.remind The SLC6A3 (solute carrier family 6 [dopamine], member 3) gene corresponds to the monoamine group in the SLC6 group and is located in the homo sapiens chromosome 5p15.3 region with SLC6A19 and SLC6A20 . Since SLC6A3 shows high expression in the brain, it is expected to affect diseases associated with various neurotransmitters.

본 발명자들은 개인 식별 마커로 이용할 수 있는 다형성 소위성 규명을 위하여, 먼저 상기와 같은 특징을 갖는 SLC6A3 유전자에 초점을 맞추어 이의 유전자 구조적 특징을 BLAST를 이용하여 분석하였으며, 그 결과 SLC6A3 유전자 내에 10개의 소위성이 존재함을 최초로 규명하면서 이들을 각각 SLC6A3-MS1, SLC6A3-MS2, SLC6A3-MS3, SLC6A3-MS4, SLC6A3-MS5, SLC6A3-MS6, SLC6A3-MS7, SLC6A3-MS8, SLC6A3-MS9 및 SLC6A3-MS10으로 명명하였으며, 이들의 염기서열을 서열번호 1 내지 10으로 표시하였다. The present inventors focused on the SLC6A3 gene having the above characteristics and analyzed its gene structural features using BLAST. As a result, 10 genes in the SLC6A3 gene in each of these SLC6A3 -MS1, SLC6A3 -MS2, SLC6A3 -MS3 , SLC6A3 -MS4, SLC6A3 -MS5, SLC6A3 -MS6, SLC6A3 -MS7, SLC6A3 -MS8, SLC6A3 -MS9 and SLC6A3 -MS10 clarify that while the first satellite is present And their nucleotide sequences are shown in SEQ ID NOS: 1 to 10.

또한, 본 발명자들은 상기 총 10개의 소위성 중 개인 식별 마커로 사용할 수 있는 다형성 여부를 자세히 분석하였으며, 그 결과 상기 소위성 중 SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9에서 다형성이 나타나는 것을 확인하였으며, 동시에 이들 모두 멘델리안 유전에 따라 감수분열을 통해 전달되는 것을 확인할 수 있었다.In addition, the present inventors have analyzed in detail the polymorphic whether that can be used as the total of 10 cows of the satellite personal identification markers, so that the predetermined polymorphism in -MS1 SLC6A3, SLC6A3 -MS4, SLC6A3 and SLC6A3 -MS8 -MS9 of satellite And at the same time, they were transferred through meiosis according to the Mendelian genus.

따라서 본 발명은 (a) 서열번호 1의 염기서열로 표시되는 SLC6A3 유전자 내의 인트론(intron) 3번 영역의 다형성 소위성 SLC6A3-MS1 (SLC6A3-ministallite1); (b) 서열번호 4의 염기서열로 표시되는 SLC6A3 유전자 내의 인트론(intron) 4번 영역의 다형성 소위성 SLC6A3-MS4 (SLC6A3-ministallite4); (c) 서열번호 8의 염기서열로 표시되는 SLC6A3 유전자 내의 인트론(intron) 8번 영역의 다형성 소위성 SLC6A3-MS8 (SLC6A3-ministallite8); 및 (d) 서열번호 9의 염기서열로 표시되는 SLC6A3유전자 내의 엑손(exon) 15번 영역의 다형성 소위성 SLC6A3-MS9 (SLC6A3-ministallite9)로 이루어진 군으로부터 선택되는 개인 식별 마커로의 용도를 가진 다형성 소위성을 제공한다.Accordingly, the present invention provides a recombinant vector comprising (a) SLC6A3 represented by the nucleotide sequence of SEQ ID NO: 1 Intron 3 region of the gene polymorphic satellite SLC6A3- MS1 ( SLC6A3 -ministallite1); (b) an intron 4 region of the SLC6A3 gene represented by the nucleotide sequence of SEQ ID NO: 4, the polymorphonuclear SLC6A3- MS4 ( SLC6A3- administerallite4); (c) SLC6A3 represented by the nucleotide sequence of SEQ ID NO: 8 Polynucleotides SLC6A3- MS8 ( SLC6A3- vermallite8) in intron 8 region of the gene; And (d) a polymorphic polynucleotide having a use as a personal identification marker selected from the group consisting of the polynucleotide SLC6A3- MS9 ( SLC6A3- administerallite9) of the exon 15 region in the SLC6A3 gene represented by the nucleotide sequence of SEQ ID NO: Provide small satellites.

이하, 본 발명에서는 간략하게 서열번호 1의 염기서열로 표시되는 SLC6A3 유전자 내의 인트론(intron) 3번 영역의 다형성 소위성을 ‘SLC6A3-MS1’로, 서열번호 4의 염기서열로 표시되는 SLC6A3 유전자 내의 인트론(intron) 4번 영역의 다형성 소위성을 ‘SLC6A3-MS4’로, 서열번호 8의 염기서열로 표시되는 SLC6A3 유전자 내의 인트론(intron) 8번 영역의 다형성 소위성을 ‘SLC6A3-MS8’로, 서열번호 9의 염기서열로 표시되는 SLC6A3유전자 내의 엑손(exon) 15번 영역의 다형성 소위성을 ‘S LC6 A3-MS9’로 각각 약칭한다.Hereinafter, in the present invention, SLC6A3 represented by the nucleotide sequence of SEQ ID NO: 1 The polynucleotide of the intron 3 region of the gene was designated as ' SLC6A3- MS1', the intron 4 region of the SLC6A3 gene represented by the nucleotide sequence of SEQ ID NO: 4 was designated as ' SLC6A3- MS4' , SLC6A3 represented by the nucleotide sequence of SEQ ID NO: 8 Introns (intron) 8 times the area of the polymorphic small exon (exon) polymorphism small satellite of 15 regions in the satellite to the 'SLC6A3 -MS8', SLC6A3 gene represented by the base sequence of SEQ ID NO: 9 in the genes' S LC6 A3 - MS9 ', respectively.

본 발명의 상기 다형성 소위성(SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9로 이루어진 군으로부터 선택된 1종 이상의 다형성 소위성)은 개인 식별 마커로서 DNA 타이핑을 통한 개체의 친자 확인, 혈연 확인 또는 법의학적 감정 등에 유용하게 사용될 수 있다.
The at least one polymorphic satellite of the present invention (at least one polymorphic satellite selected from the group consisting of SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8 and SLC6A3- MS9) of the present invention is a person identification marker, Confirmation or forensic medical feelings.

본 발명은 또한, 상기 다형성 소위성(SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9로 이루어진 군으로부터 선택된 1종 이상의 다형성 소위성)을 검출할 수 있는 프라이머 세트를 제공한다.The present invention also provides a primer set capable of detecting the polymorphic satellites (at least one polymorphic satellite selected from the group consisting of SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8 and SLC6A3- MS9).

본 발명에서 상기 "프라이머"는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있으나, 일반적으로 15 내지 30개의 염기로 구성된다. 프라이머 서열은 주형과 완전하게 상보적일 필요는 없으나, 주형과 혼성화할 정도로 충분히 상보적이어야 한다.In the present invention, the term "primer " refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The appropriate length of the primer may vary depending on the purpose of use, but is generally comprised of 15 to 30 bases. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.

본 발명에 있어서, 프라이머로서 이용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)을 포함할 수 있거나 또는 삽입 물질(intercalating agent)을 포함할 수 있다.In the present invention, the oligonucleotide used as a primer may also include a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or And may include an intercalating agent.

한편, 본 발명에서 제공하는 프라이머 세트는 상기 다형성 소위성(SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9로 이루어진 군으로부터 선택된 1종 이상의 다형성 소위성)을 특이적으로 검출 또는 진단할 수 있도록 고안된 정방향과 역방향의 프라이머이다. On the other hand, the primer set provided in the present invention can be used to specifically detect or diagnose the polymorphic satellites (at least one polymorphic satellite selected from the group consisting of SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8 and SLC6A3- MS9) It is a forward and reverse primer designed to allow for

본 발명의 일실시예에 있어서, 상기 프라이머 세트는 (ⅰ) 서열번호 11 및 12의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 3번 영역의 다형성 소위성 SLC6A3-MS1 검출용 프라이머 세트; (ⅱ) 서열번호 17 및 18의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 4번 영역의 다형성 소위성 SLC6A3-MS4 검출용 프라이머 세트; (ⅲ) 서열번호 25 및 26의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 8번 영역의 다형성 소위성 SLC6A3-MS8 검출용 프라이머 세트; 및 (ⅳ) 서열번호 27 및 28의 염기서열로 표시되는, SLC6A3 유전자 내의 엑손(exon) 15번 영역의 다형성 소위성 SLC6A3-MS9 검출용 프라이머 세트로 이루어진 군으로부터 선택되는 프라이머 세트일 수 있다.In one embodiment of the present invention, the primer set comprises: (i) a primer set for detection of an intron 3 region of the SLC6A3 gene represented by the nucleotide sequence of SEQ ID NOs: 11 and 12, which is a polymorphic SLC6A3- MS1; (Ii) a primer set for detection of the intron 4 region of the SLC6A3 gene, represented by the nucleotide sequences of SEQ ID NOS: 17 and 18, for the detection of the polymorphonuclear SLC6A3- MS4; (Iii) a primer set for detection of the intron 8 region of the SLC6A3 gene, represented by the nucleotide sequences of SEQ ID NOS: 25 and 26, for the detection of the polymorphonuclear SLC6A3- MS8; And (iv) a primer set for detecting polynucleotides SLC6A3- MS9 of the exon 15 region in the SLC6A3 gene represented by the nucleotide sequences of SEQ ID NOS: 27 and 28.

본 발명의 프라이머 세트는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 상기 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.
The primer set of the present invention can be chemically synthesized using a phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with an analogue, and modification between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

본 발명은 또한, 상기 프라이머 세트를 포함하는 다형성 소위성(SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9로 이루어진 군으로부터 선택된 1종 이상의 다형성 소위성)을 검출을 위한 DNA 타이핑 키트를 제공한다.The present invention also provides a DNA typing kit for detecting a polymorphic satellite ( SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8 and at least one polymorphic satellite selected from the group consisting of SLC6A3- MS9) comprising the primer set to provide.

상기 키트에는 본 발명의 프라이머 세트((ⅰ) 서열번호 11 및 12의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 3번 영역의 다형성 소위성 SLC6A3-MS1 검출용 프라이머 세트; (ⅱ) 서열번호 17 및 18의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 4번 영역의 다형성 소위성 SLC6A3-MS4 검출용 프라이머 세트; (ⅲ) 서열번호 25 및 26의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 8번 영역의 다형성 소위성 SLC6A3-MS8 검출용 프라이머 세트; 및 (ⅳ) 서열번호 27 및 28의 염기서열로 표시되는, SLC6A3 유전자 내의 엑손(exon) 15번 영역의 다형성 소위성 SLC6A3-MS9 검출용 프라이머 세트로 이루어진 군으로부터 선택되는 프라이머 세트)뿐만 아니라 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치가 포함될 수 있다.
(I) a primer set for detecting the intron 3 region of the SLC6A3 gene of the SLC6A3 gene, which is represented by the nucleotide sequence of SEQ ID NOs: 11 and 12, (ii) a primer set for detecting the SLC6A3- (Iii) a primer set for the detection of the polynucleotide SLC6A3-MS4 of the intron 4 region of the SLC6A3 gene represented by the nucleotide sequences of SEQ ID NOS: 25 and 26, represented by the nucleotide sequences of SEQ ID NOS: (Iv) a polynucleotide sequence of an exon 15 region in the SLC6A3 gene, represented by the nucleotide sequences of SEQ ID NOS: 27 and 28, and (iv) a primer set for detecting a polymorphonuclear SLC6A3- A primer set selected from the group consisting of primers set for detection of SLC6A3-MS9), as well as one or more other component compositions, solutions or devices suitable for the assay method.

본 발명은 또한, 1) 검체로부터 추출된 게놈 DNA를 주형으로 하고, 상기 프라이머 세트를 이용하여 DNA 중합효소 연쇄 반응(polymerase chain reaction, 이하 간략하게 ‘PCR’라 약칭함)을 수행하는 단계; 및 2) 상기 PCR 산물을 전기영동으로 분리하여 서열번호 1의 SLC6A3-MS1, 서열번호 4의 SLC6A3-MS4, 서열번호 8의 SLC6A3-MS8 및 서열번호 9의 SLC6A3-MS9로 구성된 군에서 선택되는 다형성 소위성을 검출하는 단계를 포함하는 DNA 타이핑 방법을 제공한다.The present invention also provides a method for preparing a DNA fragment, which comprises: 1) performing a DNA polymerase chain reaction (hereinafter abbreviated as "PCR") using the genomic DNA extracted from a specimen as a template and using the primer set; And 2) SLC6A3 -MS1, SEQ ID NO: SLC6A3 -MS4, polymorphism is selected from the group consisting of SLC6A3 -MS9 of SEQ ID NO: 8 and SEQ ID NO: 9 of the SLC6A3 -MS8 4 of SEQ ID NO: 1 by separating the PCR products by electrophoresis And a step of detecting a small satellite.

본 발명의 DNA 타이핑 방법에서 단계 1은 검체로부터 추출된 게놈 DNA를 주형으로 하여, 상기 프라이머 세트를 이용하여 PCR을 수행함으로써 표적 서열(서열번호 1의 SLC6A3-MS1, 서열번호 4의 SLC6A3-MS4, 서열번호 8의 SLC6A3-MS8 및 서열번호 9의 SLC6A3-MS9로 구성된 군에서 선택되는 다형성 소위성 영역)을 증폭하는 단계이다.Step in DNA typing method of the present invention first is by using the genomic DNA extracted from the sample as a template, performing PCR using the primer set of the target sequence (SEQ ID NO: 1 of the SLC6A3 SLC6A3 -MS1, SEQ ID NO: 4 -MS4, A SLC6A3- MS8 of SEQ ID NO: 8, and a SLC6A 3-MS9 of SEQ ID NO: 9).

상기 검체는 피검자의 검사를 위한 시료로서 세포, 조직(생검 샘플 등), 혈액, 머리카락, 타액, 표피, 혈청, 뇌척수액, 정액, 침, 가래, 소변, 대변, 질 채취물, 분리된 세포, 조직샘플, 비듬, 유골 및 세포 배양액과 같은 표적 핵을 포함할 수 있는 어느 샘플을 제한하지 않고 사용할 수 있다.The specimen can be used as a sample for inspecting a subject such as a cell, a tissue (biopsy sample), blood, hair, saliva, epidermis, serum, cerebrospinal fluid, semen, needle, sputum, urine, feces, Any sample that may contain target nuclei such as samples, dandruff, ashes and cell culture fluids can be used without limitation.

본 발명의 DNA 타이핑 방법에서 단계 2는 상기와 같은 과정을 거쳐 수득한 PCR 증폭 산물을 전기영동으로 분리하여 서열번호 1의 SLC6A3-MS1, 서열번호 4의 SLC6A3-MS4, 서열번호 8의 SLC6A3-MS8 및 서열번호 9의 SLC6A3-MS9로 구성된 군에서 선택되는 다형성 소위성을 검출하는 단계이다.DNA typing methods in step 2 of the present invention is to separate the PCR amplified product obtained by the process as described above to electrophoresis SEQ ID NO: 1 of the SLC6A3 -MS1, of SEQ ID NO: 4 SLC6A3 -MS4, SEQ ID NO: 8 of the SLC6A3 -MS8 And SLC6A3- MS9 of SEQ ID NO: 9 are detected.

PCR 증폭 산물의 식별을 용이하게 하기 위하여, PCR 증폭 산물의 경우 방사성동위원소 또는 형광으로 표지할 수 있다. 표지는 프라이머의 5' 말단에 형광물질이나 동위원소를 부착하여 얻을 수 있고 혹은 PCR 후 3' 말단에 터미날 뉴클레오티딜 트랜스퍼라제(terminal deoxynucleotidyl transferase)의 반응을 이용하여 첨가할 수도 있다. 표지하지 않는 경우에는 전기영동 후 은염색(silver staining)하여 절편을 확인할 수 있다.To facilitate identification of PCR amplification products, PCR amplification products can be labeled with radioactive isotopes or fluorescence. The label may be obtained by attaching a fluorescent substance or an isotope to the 5 'end of the primer, or by adding a terminal deoxynucleotidyl transferase to the 3' end after PCR. If it is not labeled, it can be identified by silver staining after electrophoresis.

전기영동으로 분리한 PCR 증폭 산물은 본 발명의 다형성 소위성(SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9로 이루어진 군으로부터 선택된 1종 이상의 다형성 소위성) 검출을 위해 PCR에 의해 증폭된 DNA 절편의 길이를 측정하는 전기영동 검사나 증폭된 단편의 질량을 측정하는 질량측정기(mass spectrometer)를 이용하는 방법, 보합(hybridization)에 의한 염기서열의 차이를 측정하는 방법 및 염기서열을 직접 결정하는 방법을 이용할 수 있다. 상기 보합을 측정하는 검사의 범주에는 DNA 칩과 같이 특성이 미리 알려진 표준 DNA를 기질의 표면에 부착시킨 후 검체의 DNA와 반응시켜 검체 DNA의 특성을 알아내는 DNA 배열(array) 등이 포함될 수 있다.The PCR amplification product separated by electrophoresis was amplified by PCR for the detection of the polymorphic satellite of the present invention (at least one polymorphic satellite selected from the group consisting of SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8 and SLC6A3- MS9) A method using a mass spectrometer for measuring the mass of the amplified fragment, a method for measuring the difference of the base sequence by hybridization, and a method for directly determining the base sequence Can be used. As the category of the test for measuring the complement, there may be included a DNA array in which a standard DNA known in advance such as a DNA chip is adhered to the surface of a substrate and then reacted with the DNA of the sample to identify the characteristics of the sample DNA .

한편, 본 발명의 다형성 소위성(SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9로 이루어진 군으로부터 선택된 1종 이상의 다형성 소위성) 검출을 위해 검체의 DNA에 부착된 표지를 감지하는 장치나 혹은 DNA 절편을 감지할 수 있도록 처리할 수 있다. 이때 바람직한 탐지 방법으로는 방사성동위원소로 표지된 DNA는 자가방사기록법(autoradiography)과 섬광계수법(scintillation counting methods)이 있으며, 형광으로 표지된 경우에는 어플라이드 바이오시스템즈사의 ABI 자동염기분석기나 히타치사(Hitachi)의 FMBIO와 같은 형광을 감지할 수 있는 장치를 사용하고 아무런 표지가 되지 않은 경우에는 은염색법이 있다.On the other hand, a device for detecting a marker attached to DNA of a specimen for detection of the polymorphic satellite of the present invention (at least one polymorphic satellite selected from the group consisting of SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8 and SLC6A3- MS9) It can be processed to detect me or DNA fragments. As a preferable detection method, there are autoradiography and scintillation counting methods of DNA labeled with radioactive isotope, and when labeled with fluorescence, ABI automatic base analyzer of Applied Biosystems or Hitachi ) FMBIO is used to detect fluorescence, and if there is no label, there is silver staining.

상기와 같은, DNA 타이핑 방법은 개체의 친자 확인, 혈연 확인 또는 법의학적 감정에 유용하게 사용될 수 있다.
The DNA typing method as described above may be useful for paternity confirmation, blood donation confirmation, or forensic medical evaluation of an individual.

본 발명은 또한, 서열번호 27 및 28의 염기서열로 표시되는 SLC6A3 유전자 내의 엑손(exon) 15번 영역의 다형성 소위성 SLC6A3-MS9 검출용 프라이머 세트를 포함하는 SLC6A3 관련 질병 진단용 조성물 또는/및 진단키트를 제공한다.The invention also, SLC6A3 comprising the exon (exon) primers for polymorphism small satellite SLC6A3 -MS9 detection of the 15 regions in the SLC6A3 gene represented by the base sequence of SEQ ID NO: 27 and 28 A related disease diagnosis composition and / or a diagnostic kit.

본 발명의 SLC6A3-MS9는 고혈압에 높은 연관성을 나타내는 것을 실험을 통해 입증되었다.It has been experimentally demonstrated that SLC6A3- MS9 of the present invention has a high correlation with hypertension.

즉, 본 발명의 하기 실시예 4에서는 SLC6A3-MS9 영역의 짧은 대립형질 보유와 고혈압과의 연관성 분석을 위하여, 대립형질의 크기가 일반적인 크기의 대립형질보다 7번 반복되는 대립형질과 질병 발생에 대한 감수성을 분석하였다. 대립형질이 나타나는 패턴을 나누어, 일반 대립형질(common allele)로만 이루어진 패턴을 C/C로 하고, 적어도 하나 이상의 7번 반복되는 대립형질을 가지는 패턴을 S/-로 나누어 비교하였다. 그 결과, SLC6A3 - MS9의 경우 고혈압 환자에서 S/- 패턴이 정상인에 비해 약 2배 정도 높게 나타남에 따라, SLC6A3-MS9의 7번 반복되는 대립형질을 가지는 경우 고혈압 발병 위험도와의 상관관계를 고려할 수 있다.That is, in Example 4 of the present invention, in order to analyze the relationship between short alleles and SLC6A3- MS9 regions of alleles, Sensitivity was analyzed. The pattern in which the alleles appeared was divided and the pattern consisting of only the common allele was regarded as C / C, and the pattern having at least one 7 repeated alleles was divided by S / - and compared. As a result, the S / - pattern of SLC6A3 - MS9 was about 2 times higher than that of normal subjects in hypertensive patients, so the correlation between SLC6A3 - MS9 and 7 repeated alleles of hypertension was considered .

본 발명자들은 상기와 같은 결과를 통해서, SLC6A3-MS9가 고혈압 같은 질병에 대한 감수성을 조사하는 중요한 마커로서 유용하게 사용될 수 있으며, 예측진단에 중요한 자료로 사용될 수 있음을 확인할 수 있었다.The present inventors confirmed that SLC6A3- MS9 can be used as an important marker for investigating the susceptibility to diseases such as hypertension and can be used as important data for predictive diagnosis.

이에, 본 발명에서는 SLC6A3-MS9 검출용 프라이머 세트를 포함하는 고혈압 발병 위험을 예측하거나 진단하기 위한 진단키트를 제공할 수 있다.Accordingly, the present invention can provide a diagnostic kit for predicting or diagnosing the risk of hypertension, including a primer set for detecting SLC6A3- MS9.

본 발명의 키트는 서열번호 9의 염기서열로 표시되는 SLC6A3 유전자 내의 엑손(exon) 15번 영역에 존재하는 다형성 소위성 SLC6A3-MS9에서 7번 반복되는 대립형질을 가지는 패턴 측정을 통해 고혈압 발병 위험을 예측 또는 진단하는데 사용될 수 있다. 상기 키트에는 본 발명의 프라이머 세트(서열번호 27 및 28의 염기서열로 표시되는, SLC6A3 유전자 내의 엑손(exon) 15번 영역의 다형성 소위성 SLC6A3-MS9 검출용 프라이머 세트)뿐만 아니라 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치가 포함될 수 있다.The kit of the present invention is capable of detecting the risk of hypertension by measuring the pattern of alleles repeated seven times in the subpopulation SLC6A3- MS9 present in the region of exon 15 in the SLC6A3 gene represented by the nucleotide sequence of SEQ ID NO: Prediction or diagnosis. The kit includes not only a primer set of the present invention (a primer set for detecting SLC6A3-MS9 of the exon 15 region in the SLC6A3 gene represented by the nucleotide sequences of SEQ ID NOS: 27 and 28) Or other component composition, solution, or device.

예를 들어, 본 발명의 키트는 PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. PCR 키트는, 상기 프라이머 세트 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액 (pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드 (dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수 (DEPC-water) 및 멸균수 등을 포함할 수 있다.For example, the kit of the present invention may be a kit containing essential elements necessary for performing PCR. In addition to the above primer set, the PCR kit can also include enzymes such as test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Taq polymerase and reverse transcriptase, DNases, RNAse inhibitors, DEPC-water (DEPC-water) and sterilized water.

또한, 상기 키트는 안내서를 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 완충액 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨, 및 키트를 포함하는 패키지의 표면상에 설명을 포함할 수 있다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함할 수 있다.
In addition, the kit may include a brochure. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure may include instructions on the surface of a package that includes a brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure may include information that is disclosed or provided through an electronic medium, such as the Internet.

본 발명은 또한, 검체에서 게놈 DNA를 추출하는 단계; 상기 추출된 게놈 DNA를 주형으로 하고, 본 발명에 따른 프라이머 세트를 이용하여 PCR을 수행하여 표적 서열을 증폭하는 단계; 및 상기 증폭 산물을 검출하는 단계를 포함하는 고혈압 발병 위험을 예측하거나 진단하기 위한 정보제공 방법을 제공한다.The present invention also relates to a method for producing a genomic DNA comprising: extracting genomic DNA from a specimen; Amplifying the target sequence by performing PCR using the extracted genomic DNA as a template and using the primer set according to the present invention; And a step of detecting the amplification product. The present invention also provides a method for providing information for predicting or diagnosing the risk of hypertension.

상기 PCR 수행을 통해 증폭된 표적 서열은 검출 가능한 표지 물질로 표지될수 있다. 하나의 구체적 예로서, 상기 표지 물질은 형광, 인광 또는 방사선을 발하는 물질일 수 있으나, 이로 제한되지 않는다. 바람직하게는 상기 표지 물질은 에티디움브로마이드(Ethidium Bromide: EtBr), Cy-5 또는 Cy-3이다. 표적 서열의 증폭시 프라이머의 5′-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이검출 가능한 형광 표지 물질로 표지될 수 있다. 또한, 방사선 물질을 이용한 표지는 PCR 수행 시 32P 또는 35S 등과 같은 방사선 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방산선이 증폭 산물에 혼입되어 증폭 산물이 방사선으로 표지될 수 있다.The target sequence amplified by the PCR may be labeled with a detectable labeling substance. In one specific example, the labeling material can be, but is not limited to, a material that emits fluorescence, phosphorescence, or radiation. Preferably, the labeling substance is Ethidium Bromide (EtBr), Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. In addition, if the radioactive isotope such as 32P or 35S is added to the PCR reaction solution, the amplification product may be synthesized and the radiation may be incorporated into the amplification product and the amplification product may be labeled with the radiation.

상기 증폭된 산물의 검출은 DNA 칩. 겔 전기영동, 방사선 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이로 제한되는 것은 아니다. 증폭 산물을 검출하는 방법 중의 하나로서, 겔 전기영동을 수행할 수 있다. 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5′-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사선 측정 방법은 PCR 수행 시 32P 또는 35S 등과 같은 방사선 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사선 측정기구, 예를 들면, 가이어 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사선을 측정할 수 있다.
Wherein the amplified product is detected by a DNA chip. Such as, but not limited to, gel electrophoresis, radiation measurement, fluorescence measurement, or phosphorescence measurement. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, when the PCR is performed, the radioactive isotope such as 32P or 35S is added to the PCR reaction solution to mark the amplification product, and then the radioactivity is measured using a radiation measuring device such as a Geiger counter or a liquid scintillation counter A liquid scintillation counter can be used to measure radiation.

이하 본 발명을 실시예에 의하여 더욱 상세하게 설명한다. 이들 실시예는 단지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It will be apparent to those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited to these embodiments.

<< 실시예Example 1> 1>

SLC6A3SLC6A3 유전자의 구조적 분석 및  Structural analysis of genes and 소위성(minisatellite, MS)의Of the minisatellite (MS) 다형성 소위성( Polymorphic satellite ( polymorphicpolymorphic minisatellitesminisatellites ) 분석) analysis

SLC6A3(NC_000005.9|NC_000005: 1382905-1455543 Homo sapiens chromosome 5, GRCh37.p2 primary reference assembly) 유전자의 구조적 특징을 BLAST를 이용하여 분석하였다. 하기 표 1에서 보여주는 색인(indices)의 위치번호는 NC_000005 REGION 내에서 분석한 결과를 보여준 것이다. 프로모터 영역과 오픈 리딩 프레임(open reading frame, ORF) 내에 존재하는 엑손(exon) 및 인트론(intron) 영역을 조사하고, 각 영역에 존재하는 연쇄반복(tandem repeats, TR)의 위치를 결정한 다음, 반복되는 서열 크기가 10~100bp 정도의 소위성의 위치를 분석하였다. SLC6A3 (NC_000005.9 | NC_000005: 1382905-1455543 Homo sapiens chromosome 5, GRCh37.p2 primary reference assembly) gene structural features were analyzed using BLAST. The location numbers of the indices shown in Table 1 below are the results of analysis in NC_000005 REGION. Exon and intron regions present in the promoter region and the open reading frame (ORF) are examined, the positions of tandem repeats (TR) existing in the respective regions are determined, And the position of the so-called sequence having a sequence size of about 10 to 100 bp was analyzed.

그 결과, SLC6A3은 약 52Kb 크기의 15개의 엑손으로 이루어져 있었고, 연쇄반복 영역의 위치는 표 1에서 나타낸 바와 같이, 유전자 내에 10개가 존재하였다.As a result, SLC6A3 was composed of 15 exons having a size of about 52 Kb, and the positions of the chain repeat regions were 10 within the gene as shown in Table 1.

SLC6A3 유전자 내에 존재하는 10개의 소위성의 다형성 소위성을 PCR을 이용하여 분석하였다. PCR 분석에서 사용된 프라이머의 염기서열은 하기 표 3에서 나타내었다.
Ten so - called polymorphic satellites in the SLC6A3 gene were analyzed by PCR. The nucleotide sequences of the primers used in the PCR analysis are shown in Table 3 below.

SLC6A3 유전자 내에 존재하는 연쇄반복(tandem repeat, TR) 색인 및 위치 정보 The tandem repeat (TR) index and positional information in the SLC6A3 gene 서열번호SEQ ID NO: 소위성
(minisatellite)
Small satellite
(minisatellite)
색인
(indices)
index
(indices)
위치location 반복 크기
(repeat size)
Repeat size
(repeat size)
대표 복사수
(copy no.)
Copies
(copy no.)
대표
크기(bp)
representation
Size (bp)
서열번호 1SEQ ID NO: 1 SLC6A3-MS1 SLC6A3- MS1 1276671-12768921276671-1276892 인트론3Intron 3 6666 6.86.8 705705 서열번호 2SEQ ID NO: 2 SLC6A3-MS2 SLC6A3- MS2 1280072-12803061280072-1280306 인트론3Intron 3 7373 33 500500 서열번호 3SEQ ID NO: 3 SLC6A3-MS3 SLC6A3- MS3 1282333-12824731282333-1282473 인트론4Intron 4 5858 7.57.5 844844 서열번호 4SEQ ID NO: 4 SLC6A3-MS4 SLC6A3- MS4 1282315-12828381282315-1282838 인트론4Intron 4 7575 13.813.8 11101110 서열번호 5SEQ ID NO: 5 SLC6A3-MS5 SLC6A3- MS5 1282847-12832951282847-1283295 인트론6Intron 6 8383 6.16.1 900900 서열번호 6SEQ ID NO: 6 SLC6A3-MS6 SLC6A3- MS6 1291318-12915871291318-1291587 인트론6Intron 6 109109 2.72.7 562562 서열번호 7SEQ ID NO: 7 SLC6A3-MS7 SLC6A3- MS7 1295501-12957151295501-1295715 인트론6Intron 6 5555 9.59.5 765765 서열번호 8SEQ ID NO: 8 SLC6A3-MS8 SLC6A3- MS8 1300333-13005301300333-1300530 인트론8Intron 8 3030 6.16.1 276276 서열번호 9SEQ ID NO: 9 SLC6A3-MS9 SLC6A3- MS9 1300333-13005301300333-1300530 엑손15Exon 15 4040 10.010.0 750750 서열번호 10SEQ ID NO: 10 SLC6A3-MS10 SLC6A3- MS10 1300333-13005301300333-1300530 엑손15Exon 15 8282 2.62.6 417417

SLC6A3 유전자 내에 존재하는 연쇄반복의 서열Sequences of chain repeats present in the SLC6A3 gene 서열번호SEQ ID NO: 염기서열Base sequence 서열번호 1SEQ ID NO: 1 TGGCCACTACCGTTCAAGGGAGCCATTTCCTCACCCAGGTGCCCAGGGAAGCATCCAGGAGGGGACTGGCCACTACCGTTCAAGGGAGCCATTTCCTCACCCAGGTGCCCAGGGAAGCATCCAGGAGGGGAC 서열번호 2SEQ ID NO: 2 TCCGGACAGACGGTAATATAGAATTATTTAATATGGACCAGATCCACGTGGGAGAAGGCCTTCCAAAGGCAATTCCGGACAGACGGTAATATAGAATTATTTAATATGGACCAGATCCACGTGGGAGAAGGCCTTCCAAAGGCAAT 서열번호 3SEQ ID NO: 3 GGCCAGGCCTGACCTGCACAGTCCTCCCCAGCCAGGCCAGTTCCTCACTGCCCACCCCGGCCAGGCCTGACCTGCACAGTCCTCCCCAGCCAGGCCAGTTCCTCACTGCCCACCCC 서열번호 4SEQ ID NO: 4 GTGGGCAGCAGTGGGTACCCAGCAGCGTGGGCAGCACTGTGGGCAGCGGTGGGTACCCAGCACCATGGGCAGCACGt; 서열번호 5SEQ ID NO: 5 GGATGGATGGGTGGATGGATGATGGGTGGATTGCTGGATGATGGATGGCTGGGTGGATGGATGAATGATAGGTAGGTAGCTGGGGATGGATGGGTGGATGGATGATGGGTGGATTGCTGGATGATGGATGGCTGGGTGGATGGATGAATGATAGGTAGGTAGCTGG 서열번호 6SEQ ID NO: 6 ATCAGGACACCATCATCATGTAGCATGTGGATGGGTCCATGCCTTTCTGAGGGTTATCAGGGTGCTGCCATCATGCAGCATGTGGATGATCCATGCTGTTCTGAGGGTTATCAGGACACCATCATCATGTAGCATGTGGATGGGTCCATGCCTTTCTGAGGGTTATCAGGGTGCTGCCATCATGCAGCATGTGGATGATCCATGCTGTTCTGAGGGTT 서열번호 7SEQ ID NO: 7 GTGTGGATAAGTCCATGCTGTTCTGAGGGTTATCAGGGCGCCGCGGTCATGTTGTGTGTGGATAAGTCCATGCTGTTCTGAGGGTTATCAGGGCGCCGCGGTCATGTTGT 서열번호 8SEQ ID NO: 8 TGTGTCTGTGTGTGTATATTGCATGGTATGTGTGTCTGTGTGTGTATATTGCATGGTATG 서열번호 9SEQ ID NO: 9 AGGAGCGTGTCCTATCCCCGGACGCATGCAGGGCCCCCACAGGAGCGTGTCCTATCCCCGGACGCATGCAGGGCCCCCAC 서열번호 10SEQ ID NO: 10 GCTGCAGTTAGCACAGAGGATGGCTTCCCCATTGCCTTCTGGGGAGGGACACAGAGGACGGCTTCCCCATCGCCTTCTGGCCGCTGCAGTTAGCACAGAGGATGGCTTCCCCATTGCCTTCTGGGGAGGGACACAGAGGACGGCTTCCCCATCGCCTTCTGGCC

다형성 소위성 검출에 사용되는 프라이머 서열Primer sequences used for polymorphic satellite detection 다형성 소위성Polymorphic satellite 프라이머 서열(5'-3')The primer sequence (5'-3 ') 서열번호SEQ ID NO: SLC6A3 -MS1 SLC6A3 - MS1 포워드Forward CTGGGCCTTCGGTGAGCTTGCTGGGCCTTCGGTGAGCTTG 서열번호 11SEQ ID NO: 11 리버스Reverse CCACTGGCCACACTGGCTGACCACTGGCCACACTGGCTGA 서열번호 12SEQ ID NO: 12 SLC6A3 -MS2 SLC6A3 - MS2 포워드Forward TGGGCATCCATTGTCAGTTACCATGGGCATCCATTGTCAGTTACCA 서열번호 13SEQ ID NO: 13 리버스Reverse TGTTCTCATGCTCAGGGCACCTCTGTTCTCATGCTCAGGGCACCTC 서열번호 14SEQ ID NO: 14 SLC6A3 -MS3 SLC6A3 - MS3 포워드Forward TGGGTGTCACTGCGCAAGAATGGGTGTCACTGCGCAAGAA 서열번호 15SEQ ID NO: 15 리버스Reverse CTGGCGAGGGCAGGAAGATGCTGGCGAGGGCAGGAAGATG 서열번호 16SEQ ID NO: 16 SLC6A3 -MS4 SLC6A3 - MS4 포워드Forward TAGAGTTTGCTCGGCCTCATTAGAGTTTGCTCGGCCTCAT 서열번호 17SEQ ID NO: 17 리버스Reverse GCCACAGAAACCAAAAGGAAGCCACAGAAACCAAAAGGAA 서열번호 18SEQ ID NO: 18 SLC6A3 -MS5 SLC6A3 - MS5 포워드Forward GGCTGGCTGGATGTATGGGGCTGGCTGGATGTATGG 서열번호 19SEQ ID NO: 19 리버스Reverse CCATTTCTTTCCTGATTTCTCTTCACCATTTCTTTCCTGATTTCTCTTCA 서열번호 20SEQ ID NO: 20 SLC6A3 -MS6 SLC6A3 - MS6 포워드Forward CGTGGACCCACCCACCTTTCCGTGGACCCACCCACCTTTC 서열번호 21SEQ ID NO: 21 리버스Reverse GCCCTAGCGGGGTCTCCATCGCCCTAGCGGGGTCTCCATC 서열번호 22SEQ ID NO: 22 SLC6A3 -MS7 SLC6A3 - MS7 포워드Forward GGGGACACACTCAGGGGGTTGGGGGACACACTCAGGGGGTTG 서열번호 23SEQ ID NO: 23 리버스Reverse GGCAGCAGACGACTGGTGGAAGGCAGCAGACGACTGGTGGAA 서열번호 24SEQ ID NO: 24 SLC6A3 -MS8 SLC6A3 - MS8 포워드Forward GCACAAATGAGTGTTCGTGCATGTGCACAAATGAGTGTTCGTGCATGT 서열번호 25SEQ ID NO: 25 리버스Reverse CAGGCTGGTCCTGCCCTTCACAGGCTGGTCCTGCCCTTCA 서열번호 26SEQ ID NO: 26 SLC6A3 -MS9 SLC6A3 - MS9 포워드Forward CATTGGAGGATGGGGGTCCTGCATTGGAGGATGGGGGTCCTG 서열번호 27SEQ ID NO: 27 리버스Reverse AGCAAGCAGGCTCGCGGATAAGCAAGCAGGCTCGCGGATA 서열번호 28SEQ ID NO: 28 SLC6A3 -MS10 SLC6A3 - MS10 포워드Forward GTCATGGCTGTCCCCTGCAAGTCATGGCTGTCCCCTGCAA 서열번호 29SEQ ID NO: 29 리버스Reverse GGAGGCTGAGGCAGTTTTTCCAGGAGGCTGAGGCAGTTTTTCCA 서열번호 30SEQ ID NO: 30

100명의 성인 남성과 여성의 혈액으로부터 추출한 게놈 DNA를 이용하여 SLC6A3 유전자 내에 존재하는 10개의 TR 중에서 인트론(intron) 3번 영역에 위치한 MS2(minisatellite2) 부위, 인트론(intron) 4번 영역에 위치한 MS3(minisatellite3) 부위, 인트론(intron) 6번 영역에 위치한 MS5(minisatellite5) 부위, 인트론(intron) 6번 영역에 위치한 MS6(minisatellite6) 부위, 인트론(intron) 6번 영역에 위치한 MS7(minisatellite7) 부위, 3‘ UTR 영역에 위치한 MS10(minisatellite10) 부위의 대립형질 양상을 PCR을 사용하여 비교하였다. Using the genomic DNA extracted from blood of 100 adult males and females, MS2 (minisatellite2) located in the intron 3 region, MS3 (intron 4) located in the intron 4 region among 10 TRs present in the SLC6A3 gene minisatellite3) site located in intron 6 region, MS5 (minisatellite 5) region located in intron 6 region, MS6 (minisatellite 6) region located intron 6 region, MS7 (minisatellite 7) Allelopathic features of the MS10 (minisatellite10) region located in the UTR region were compared using PCR.

게놈 DNA를 표준 PCR 조건(50mM Tris-HCl(pH 9.0), 50mM MgCl2, 0.2mM dTTP, 0.2mM dCTP, 0.2mM dGTP 및 0.2mM dATP, 최종 부피 50㎕)에서 SLC6A3-MS2는 서열번호 13과 14의 프라이머 쌍, SLC6A3-MS3은 서열번호 15와 16의 프라이머 쌍, SLC6A3-MS5는 서열번호 19와 20의 프라이머 쌍, SLC6A3-MS6은 서열번호 21과 22의 프라이머 쌍, SLC6A3-MS7은 서열번호 23과 24의 프라이머 쌍, SLC6A3-MS10은 서열번호 29와 30의 프라이머 쌍을 사용하여 증폭하였다. SLC6A3- MS2 in the standard PCR conditions (50 mM Tris-HCl (pH 9.0), 50 mM MgCl2, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP and 0.2 mM dATP, , SLC6A3- MS3 is a primer pair of SEQ ID NOs: 15 and 16, SLC6A3- MS5 is a primer pair of SEQ ID NOs: 19 and 20, SLC6A3- MS6 is a primer pair of SEQ ID NOs: 21 and 22, SLC6A3- MS7 is a primer pair of SEQ ID NO: And 24 primer pairs, SLC6A3- MS10, were amplified using the primer pairs of SEQ ID NOs: 29 and 30.

DNA 샘플의 PCR 분석은 게놈 DNA 100ng를 주형으로 타카라 G-Taq DNA 폴리머라제(TAKARA G-Taq DNA polymerase, TAKARA), 제넷바이오 Prime Taq DNA 폴리머라제(GENET BIO Prime Taq DNA polymerase, GENET BIO)를 사용하여 수행하였다. 사이클의 조건은 SLC6A3-MS2, SLC6A3-MS3, SLC6A3-MS6, SLC6A3-MS7 및 SLC6A3-MS10의 경우 94℃에서 2분 동안 1회 열처리한 후, 94℃에서 45초, 68℃에서 2분의 30 사이클을 수행한 다음, 마지막 신장 단계는 72℃에서 7분 연장하였고, SLC6A3-MS5의 경우 94℃에서 2분 동안 1회 열처리한 후, 94℃에서 45초, 62℃에서 30초 및 72℃에서 1분의 30 사이클을 수행한 다음, 마지막 신장 단계는 72℃에서 7분 연장하였다. PCR analysis of the DNA samples was performed using TAKARA G-Taq DNA polymerase (TAKARA), Genet Bio Prime Taq DNA polymerase (GENET BIO) with 100 ng of genomic DNA as a template Lt; / RTI &gt; The conditions of the cycle were as follows: SLC6A3- MS2, SLC6A3- MS3, SLC6A3- MS6, SLC6A3- MS7 and SLC6A3- MS10 were heat treated once at 94 ° C for 2 minutes and then 45 seconds at 94 ° C, 30 minutes at 68 ° C After the cycle, the final extension step was extended by 72 minutes at 72 ° C, followed by one heat treatment at 94 ° C for 2 minutes for SLC6A3-MS5, followed by 45 seconds at 94 ° C, 30 seconds at 62 ° C, and 72 ° C After 30 cycles of 1 min, the last extension step was extended by 7 min at 72 &lt; 0 &gt; C.

상기 PCR 산물을 SLC6A3-MS2, SLC6A3-MS3, SLC6A3-MS5, SLC6A3-MS6, SLC6A3-MS7 및 SLC6A3-MS10의 경우, 2% SeaKem LE 아가로스젤에 주입하고, TAE 버퍼에서 전기영동(1볼트/㎝)에 의해 분석하였다. 그 결과, SLC6A3-MS2, SLC6A3-MS3, SLC6A3-MS5, SLC6A3-MS6, SLC6A3-MS7 및 SLC6A3-MS10은 단형성을 나타내었기 때문에 개인 식별 마커로는 사용이 불가능하였다.The PCR product -MS2 SLC6A3, SLC6A3 -MS3, -MS5 SLC6A3, SLC6A3 -MS6, SLC6A3 and SLC6A3 -MS7 For -MS10, 2% SeaKem LE agarose gel and injected into a Ross, electrophoresis (1 volt / in TAE buffer Cm). As a result, SLC6A3- MS2, SLC6A3- MS3, SLC6A3- MS5, SLC6A3- MS6, SLC6A3- MS7, and SLC6A3- MS10 were unusable as individual identification markers because they showed streak formation.

100명의 성인 남성과 여성의 혈액으로부터 추출한 게놈 DNA를 이용하여 SLC6A3 유전자 내에 존재하는 10개의 연쇄반복 중에서 인트론 3번 영역에 위치하는 SLC6A3-MS1, 인트론 4번 영역에 위치하는 SLC6A3-MS4, 인트론 8번 영역에 위치하는 SLC6A3-MS8 및 3‘ UTR 영역에 위치하는 SLC6A3-MS9의 대립형질 양상을 PCR을 사용하여 비교하였다. SLC6A3 to 100 adults by using the genomic DNA extracted from the blood of men and women located in the SLC6A3 -MS1, intron 4 region located in the intron 3 region from 10 chain repeat present in the SLC6A3 gene -MS4, intron 8 the allele pattern of SLC6A3 -MS8 and 3 'SLC6A3 -MS9 positioned UTR region located in the area was compared using PCR.

게놈 DNA를 표준 PCR 조건(50 mM Tris-HCl(pH 9.0), 50 mM MgCl2, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP 및 0.2 mM dATP, 최종 부피 50 ㎕)하에서 SLC6A3-MS1은 서열번호 11과 12의 프라이머, SLC6A3-MS4는 서열번호 17과 18의 프라이머, SLC6A3-MS8는 서열번호 25과 26의 프라이머, SLC6A3-MS9는 서열번호 27와 28의 프라이머를 사용하여 증폭하였다. Standard PCR Conditions Genomic DNA SLC6A3 -MS1 under (50 mM Tris-HCl (pH 9.0), 50 mM MgCl2, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP and 0.2 mM dATP, final volume 50 ㎕) is SEQ ID NO: 11 and the primer 12, SLC6A3 -MS4 is SEQ ID NO primer, SLC6A3 -MS8 17 and 18 are primers, SLC6A3 -MS9 of SEQ ID NO: 25 and 26 were amplified with primers of SEQ ID NOS: 27 and 28.

DNA 샘플의 PCR 분석은 게놈 DNA 100ng를 주형으로 타카라 G-Taq DNA 폴리머라제(TAKARA G-Taq DNA polymerase, TAKARA), 제넷바이오 Prime Taq DNA 폴리머라제(GENET BIO Prime Taq DNA polymerase, GENET BIO)를 사용하여 수행하였다. 사이클의 조건은 SLC6A3-MS1 및 SLC6A3-MS9의 경우 94℃에서 2분 동안 1회 열처리한 후, 94℃에서 45초, 68℃에서 2분의 30 사이클을 수행한 다음, 마지막 신장 단계는 72℃에서 7분 연장하였다. PCR analysis of the DNA samples was performed using TAKARA G-Taq DNA polymerase (TAKARA), Genet Bio Prime Taq DNA polymerase (GENET BIO) with 100 ng of genomic DNA as a template Lt; / RTI &gt; The conditions of the cycle were as follows: SLC6A3- MS1 and SLC6A3- MS9 were heat treated once at 94 ° C for 2 minutes, followed by 30 cycles of 94 ° C for 45 seconds and 68 ° C for 2 minutes, and then the final elongation step was 72 ° C For 7 minutes.

SLC6A3-MS4의 경우 94℃에서 3분 동안 1회 열처리한 후, 94℃에서 30초, 68℃에서 30초 및 72℃에서 2분의 30 사이클을 수행한 다음, 마지막 신장 단계는 72℃에서 7분 연장하였다. SLC6A3-MS8의 경우 94℃에서 2분 동안 1회 열처리한 후, 94℃에서 45초, 70℃에서 1분의 30 사이클을 수행한 다음, 마지막 신장 단계는 72℃에서 7분 연장하였다. SLC6A3- MS4 was subjected to 30 cycles of 94 ° C for 30 seconds, 68 ° C for 30 seconds, and 72 ° C for 2 minutes after 94 ° C heat treatment for 3 minutes, Min. SLC6A3- MS8 was heat treated once at 94 ° C for 2 minutes, followed by 30 cycles of 94 ° C for 45 seconds and 70 ° C for 1 minute, and then the last elongation step was extended at 72 ° C for 7 minutes.

상기 PCR 산물을 SLC6A3-MS1은 1.5% SeaKem LE 아가로스젤에, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9는 2% SeaKem LE 아가로스젤에 주입한 후, TAE 버퍼에서 전기영동(1볼트/㎝)에 의해 분석하였다. 그 결과, 모두 다형성 소위성을 나타내었기 때문에 개인 식별 마커로 사용이 가능함을 알 수 있었다(도 2 내지 5 참조). 따라서 이하, 개체수를 늘려 추가적인 분석을 실시하였다 (표 3~11). 이때 N은 대립형질의 수로, 사람마다 2개의 대립형질을 가지므로 샘플수의 두 배가 된다.
SLC6A3- MS4, SLC6A3- MS4, SLC6A3- MS8 and SLC6A3- MS9 were injected into 2% SeaKem LE agarose gel and then electrophoresed in TAE buffer (1 volt / Cm). As a result, all polymorphic satellites were shown, and thus it was found that they could be used as personal identification markers (see FIGS. 2 to 5). Therefore, additional analyzes were carried out by increasing the number of individuals (Tables 3 to 11). Where N is the number of alleles and has two alleles per person, doubling the number of samples.

<1-1> <1-1> SLC6A3SLC6A3 -- MS1MS1 (( minisatelliteminisatellite 1) 추가 분석 1) Further analysis

정상인 388명을 조사한 결과 약 647bp, 약 713bp 및 약 779bp 크기의 3개의 대립형질이 확인되었으며, 이는 66bp의 반복단위가 6번, 7번 및 8번 반복된 크기로 나타난 것이다 (하기 표 4 및 도 2 참조). 도 2는 SLC6A3-MS1의 다형성 소위성을 나타낸 것이다.
Three normal alleles of about 647 bp, about 713 bp, and about 779 bp were identified as a result of repeating the 388 normal persons, and the 66 bp repeating units were repeated 6, 7, and 8 times (see Table 4 and 2). Figure 2 shows the polymorphic satellite of SLC6A3- MS1.

SLC6A3 -MS1의 다형성 소위성 분석 SLC6A3 - Polymorphonuclear analysis of MS1 반복단위×반복수Repeat unit × Number of repetitions N값(전체:776)N value (total: 776) **횟수(frequency)** frequency 66×666 x 6 1One 0.00130.0013 66×766 × 7 369369 0.47550.4755 66×866 x 8 406406 0.52320.5232

** "횟수(frequency)= N값/전체 N값"으로 계산되며, 그 값이 0.01 미만인 경우 희귀 다형성 소위성에 해당함.
** "frequency = N value / total N value". If the value is less than 0.01, it corresponds to the rare polymorphism.

<1-2> <1-2> SLC6A3SLC6A3 -- MS4MS4 (( minisatelliteminisatellite 4) 추가 분석 4) Further analysis

정상인 375명을 조사한 결과, 약 973bp, 약 1123bp, 약 1198bp, 약 1273bp, 약 1348bp, 약 1423bp, 약 1648bp, 약 1948bp, 약 2023bp, 약 2173bp, 약 2248bp, 약 2323bp, 약 2398bp, 약 2473bp, 및 약 2548bp 크기의 15개의 대립형질이 확인되었으며, 이는 75bp의 반복단위가 11번, 13번 14번, 15번 16번, 17번, 20번 24번, 25번 27번, 28번 29번, 30번, 31번 및 32번 반복된 크기로 나타난 것이다(하기 표 5 및 도 3 참조). 도 3은 SLC6A3-MS4의 다형성 소위성을 나타낸 것이다.
Approximately 973 bp, about 1123 bp, about 1198 bp, about 1273 bp, about 1348 bp, about 1423 bp, about 1648 bp, about 1948 bp, about 2023 bp, about 2173 bp, about 2248 bp, about 2323 bp, about 2398 bp, about 2473 bp, 15 alleles of about 2548 bp were identified, which means that the 75 bp repeating unit was identified as 11, 13, 14, 15, 16, 17, 20, 24, 25, 27, 28, 31, and 32, respectively (see Table 5 and FIG. 3, below). Figure 3 shows polymorphic satellites of SLC6A3- MS4.

SLC6A3 -MS4의 다형성 소위성 분석Polymorph subspecies analysis of SLC6A3 - MS4 반복단위×반복수Repeat unit × Number of repetitions N=750N = 750 **횟수(frequency)** frequency 75×1175 x 11 1One 0.00130.0013 75×1375 x 13 1One 0.00130.0013 75×1475 x 14 320320 0.42670.4267 75×1575 x 15 77 0.00930.0093 75×1675 × 16 8989 0.11870.1187 75×1775 x 17 22 0.00270.0027 75×2075 x 20 66 0.00800.0080 75×2475 x 24 22 0.00270.0027 75×2575 x 25 1One 0.00130.0013 75×2775 × 27 1One 0.00130.0013 75×2875 x 28 1212 0.01600.0160 75×2975 x 29 131131 0.17470.1747 75×3075 x 30 166166 0.22130.2213 75×3175 x 31 1010 0.01330.0133 75×3275 x 32 1One 0.00130.0013

** "횟수(frequency)= N값/전체 N값"으로 계산되며, 그 값이 0.01 미만인 경우 희귀 다형성 소위성에 해당함.
** "frequency = N value / total N value". If the value is less than 0.01, it corresponds to the rare polymorphism.

<1-3> <1-3> SLC6A3SLC6A3 -- MS8MS8 (( minisatelliteminisatellite 8) 추가 분석 8) Further analysis

정상인 388명을 조사한 결과, 약 275bp, 약 305bp, 약 335bp, 약 365bp, 및 약 395bp 크기의 5개의 대립형질이 확인되었으며, 이는 30bp의 반복단위가 6번, 7번, 8번, 9번 및 10번 반복된 크기로 나타난 것이다(하기 표 6 및 도 4 참조). 도 4는 SLC6A3-MS8의 다형성 소위성을 나타낸 것이다.
A total of 388 normal individuals were screened for five alleles of about 275 bp, about 305 bp, about 335 bp, about 365 bp, and about 395 bp, indicating that the 30 bp repeats were 6, 7, 8, (See Table 6 and Fig. 4 below). Figure 4 shows polymorphic satellites of SLC6A3- MS8.

SLC6A3 -MS8의 다형성 소위성 분석Polymorph subspecies analysis of SLC6A3 - MS8 반복단위×반복수Repeat unit × Number of repetitions N=776N = 776 ** 횟수(frequency)** frequency 30×630 x 6 22 0.00260.0026 30×730 × 7 1717 0.02190.0219 30×830 x 8 2626 0.03350.0335 30×930 × 9 710710 0.91490.9149 30×1030 x 10 2121 0.02710.0271

** "횟수(frequency)= N값/전체 N값"으로 계산되며, 그 값이 0.01 미만인 경우 희귀 다형성 소위성에 해당함.
** "frequency = N value / total N value". If the value is less than 0.01, it corresponds to the rare polymorphism.

<1-4> <1-4> SLC6A3SLC6A3 -- MS9MS9 (( minisatelliteminisatellite 9) 추가 분석 9) Further analysis

정상인 388명을 조사한 결과, 약 586bp, 약 626bp, 약 706bp, 약 746bp, 및 약 786bp 크기의 5개의 대립형질이 확인되었으며, 이는 40bp의 반복단위가 6번, 7번, 9번, 10번 및 11번 반복된 크기로 나타난 것이다(하기 표 7 및 도 5 참조). 도 5는 SLC6A3-MS9의 다형성 소위성을 나타낸 것이다.
As a result of investigation of 388 normal persons, five alleles of about 586 bp, about 626 bp, about 706 bp, about 746 bp and about 786 bp were identified, which indicates that 40 bp repeating units were 6, 7, 9, (See Table 7 and Figure 5 below). Figure 5 shows polymorphic satellites of SLC6A3- MS9.

SLC6A3 -MS9의 다형성 소위성 분석Polymorph subspecies analysis of SLC6A3 - MS9 반복단위×반복수Repeat unit × Number of repetitions N=776N = 776 ** 횟수(frequency)** frequency 40×640 × 6 22 0.00260.0026 40×740 × 7 1717 0.02190.0219 40×940 × 9 2626 0.03350.0335 40×1040 x 10 710710 0.91490.9149 40×1140 x 11 2121 0.02710.0271

** "횟수(frequency)= N값/전체 N값"으로 계산되며, 그 값이 0.01 미만인 경우 희귀 다형성 소위성에 해당함.
** "frequency = N value / total N value". If the value is less than 0.01, it corresponds to the rare polymorphism.

<< 실시예Example 2> 2>

감수분열을 통한 다형성 Polymorphism through meiosis 소위성의So-called sex 유전적 전달 측정 Genetic transmission measurement

부계와 모계로부터 그 유전 형질이 자손에게 각각 하나씩 전달되는 과정을 멘델의 유전법칙이라고 하며, 이에 의해 부모와 자손 간의 친자확인이 가능하다. 연쇄반복(tandem repeats, TR) 부위의 대립형질은 부모로부터 물려받은 2개의 대립형질로 구성되어 있어, 이것이 감수분열을 통해 자손에게 전달되는지를 확인하였다. 조부모, 부모, 자손의 혈액으로부터 게놈 DNA를 추출하여 상기 실시예 1과 같은 방법으로 PCR을 이용하여, SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8, 및 SLC6A3-MS9의 대립형질 양상을 확인하였다.The process by which the genetic traits from the paternal and maternal lines are transferred one by one to the offspring is called Mendel's law of genetics, which enables parents to identify their offspring. The alleles of the tandem repeats (TR) region consisted of two alleles inherited from the parents, confirming that this was transmitted to the offspring through meiosis. Genomic DNA was extracted from the blood of grandparents, parents, and offspring, and alleles of SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8, and SLC6A3- MS9 were confirmed by PCR in the same manner as in Example 1 above.

그 결과, 도 6에 나타난 바와 같이, SLC6A3-MS1, SLC6A3-MS4, SLC6A3-MS8 및 SLC6A3-MS9 모두 부모와 자손 간에 감수분열을 통해 유전적으로 정확히 전달되는 것을 확인할 수 있었다. 이는 멘델의 법칙에 의해 유전되며 개체 확인, 친자 확인, 혈연 확인 또는 법의학적 감정에 효율적인 마커로 사용할 수 있다는 것을 나타내고, 이러한 DNA 타이핑 마커(DNA typing marker)를 이용하여 가족에서의 동일 질환 발생 여부를 조사할 수 있다는 것을 의미한다.
As a result, as shown in Fig. 6, it was confirmed that both SLC6A3- MS1, SLC6A3- MS4, SLC6A3- MS8 and SLC6A3- MS9 were genetically transferred through parental and descendant meiosis. It is inherited by Mendel's law and indicates that it can be used as an effective marker for identification, paternity, blood donation, or forensic emotions. Using these DNA typing markers, It means that you can investigate.

<< 실시예Example 3> 3>

SLC6A3SLC6A3 -- MS1MS1 , , SLC6A3SLC6A3 -- MS4MS4 , , SLC6A3SLC6A3 -- MS8MS8  And SLC6A3SLC6A3 -- MS9MS9 영역의 고혈압과의 연관성 측정 Measuring Association with Hypertension in the Region

연쇄반복(tandem repeats, TR)의 구조적 특성이 유전자의 발현에 관여한다는 보고가 h-Ras를 중심으로 보고되었다. 이에 본 발명자들은 SLC6A3유전자의 연쇄반복 영역의 유전자 발현에 미치는 영향을 조사하기 위하여, 하기 실험에서는 정상인과 고혈압 환자의 게놈 DNA를 추출하여 상기 실시예 1과 같은 방법으로 PCR을 수행함으로써 정상인과 고혈압 환자간의 일배체형 패턴(haplotype pattern)을 비교 분석하였다.
A report that the structural characteristics of tandem repeats (TR) are involved in gene expression has been reported mainly in h-Ras. Therefore, in order to investigate the effect of the SLC6A3 gene on the gene expression in the chain repetitive region, genomic DNAs of normal and hypertensive patients were extracted in the following experiment and PCR was performed in the same manner as in Example 1, (Haplotype pattern) were compared and analyzed.

<3-1> <3-1> SLC6A3SLC6A3 -- MS1MS1 (( minisatelliteminisatellite 1) One)

SLC6A3 -MS1 부위에 대하여 정상인 388명 및 고혈압 환자 201명을 분석하였다. 고혈압 환자의 분석 결과에서는 약 449bp, 약 713bp 및 약 779bp 크기의 3개의 대립형질이 확인되었으며, 이는 66bp의 반복단위가 3번, 7번 및 8번 반복된 크기로 나타난 것이다 (하기 표 8 참조).
388 normal subjects and 201 hypertensive patients were analyzed for SLC6A3 - MS1 region. Three alleles of about 449 bp, about 713 bp, and about 779 bp were identified in the analysis of hypertension patients, with 66 bp repeats being repeated 3, 7, and 8 times (see Table 8 below) .

SLC6A3 -MS1의 고혈압 특이적 다형성 소위성 분석 SLC6A3 - MS1 hypertensive specific polymorphic subspecies analysis 정상인Normal 고혈압High blood pressure 반복단위×반복수Repeat unit × Number of repetitions N=776N = 776 횟수(frequency)Frequency N=402N = 402 횟수(frequency)Frequency 66×366 x 3 00 0.00000.0000 1One 0.00250.0025 66×666 x 6 1One 0.00130.0013 00 0.00000.0000 66×766 × 7 369369 0.47550.4755 191191 0.47510.4751 66×866 x 8 406406 0.52320.5232 210210 0.52240.5224

<3-2> <3-2> SLC6A3SLC6A3 -- MS4MS4 (( minisatelliteminisatellite 4) 4)

SLC6A3 -MS4 부위에 대하여 정상인 375명 및 고혈압 환자 200명을 분석하였다. 고혈압 환자의 분석 결과에서는 약 973bp, 약 1123bp, 약 1198bp, 약 1273bp, 약 1348bp, 약 1423bp, 약 1573bp, 약 1648bp, 약 2248bp, 약 2323bp, 약 2398bp 및 약 2473bp 크기의 12개의 대립형질이 확인되었으며, 이는 75bp의 반복단위가 11번, 13번 14번, 15번 16번, 17번 19번, 20번, 28번 29번, 30번 및 31번 반복된 크기로 나타난 것이다(하기 표 9 참조).
375 normal subjects and 200 hypertensive patients were analyzed for the SLC6A3 - MS4 region. In the analysis of hypertension patients, twelve alleles of about 973 bp, about 1123 bp, about 1198 bp, about 1273 bp, about 1348 bp, about 1423 bp, about 1573 bp, about 1648 bp, about 2248 bp, about 2323 bp, about 2398 bp and about 2473 bp, , Which is the repeated size of 75 bp repeating units 11, 13, 14, 15, 16, 19, 20, 28, 29, 30 and 31 (see Table 9 below) .

SLC6A3 -MS4의 고혈압 특이적 다형성 소위성 분석 SLC6A3 - MS4 hypertensive specific polymorphic subspecies analysis 정상인Normal 고혈압High blood pressure 반복단위×반복수Repeat unit × Number of repetitions N=750N = 750 횟수(frequency)Frequency N=400N = 400 횟수(frequency)Frequency 75×1175 x 11 1One 0.00130.0013 1One 0.00250.0025 75×1375 x 13 1One 0.00130.0013 22 0.00500.0050 75×1475 x 14 320320 0.42670.4267 160160 0.40000.4000 75×1575 x 15 77 0.00930.0093 55 0.01250.0125 75×1675 × 16 8989 0.11870.1187 4242 0.10500.1050 75×1775 x 17 22 0.00270.0027 1One 0.00250.0025 75×1975 × 19 00 0.00000.0000 1One 0.00250.0025 75×2075 x 20 66 0.00800.0080 33 0.00750.0075 75×2475 x 24 22 0.00270.0027 00 0.00000.0000 75×2575 x 25 1One 0.00130.0013 00 0.00000.0000 75×2775 × 27 1One 0.00130.0013 00 0.00000.0000 75×2875 x 28 1212 0.01600.0160 1212 0.03000.0300 75×2975 x 29 131131 0.17470.1747 7373 0.18250.1825 75×3075 x 30 166166 0.22130.2213 9595 0.23750.2375 75×3175 x 31 1010 0.01330.0133 55 0.01250.0125 75×3275 x 32 1One 0.00130.0013 00 0.00000.0000

<3-3> <3-3> SLC6A3SLC6A3 -- MS8MS8 (( minisatelliteminisatellite 8) 8)

SLC6A3 -MS8 부위에 대하여 정상인 388명 및 고혈압 환자 201명을 분석하였다. 고혈압 환자의 분석 결과에서는 약 275bp, 약 305bp 및 약 335bp 크기의 3개의 대립형질이 확인되었으며, 이는 30bp의 반복단위가 6번, 7번 및 8번 반복된 크기로 나타난 것이다(하기 표 10 참조).
388 normal and 201 hypertensive patients were analyzed for SLC6A3 - MS8. In the analysis of the hypertensive patients, three alleles of about 275 bp, about 305 bp and about 335 bp were identified, and the 30 bp repeat units were repeated 6, 7 and 8 times (see Table 10 below) .

SLC6A3 -MS8의 고혈압 특이적 다형성 소위성 분석 SLC6A3 - MS8 hypertensive specific polymorphic subspecies analysis 정상인Normal 고혈압High blood pressure 반복단위×반복수Repeat unit × Number of repetitions N=776N = 776 횟수(frequency)Frequency N=402N = 402 횟수(frequency)Frequency 30×630 x 6 154154 0.19850.1985 8787 0.21640.2164 30×730 × 7 616616 0.79380.7938 313313 0.77860.7786 30×830 x 8 33 0.00390.0039 22 0.00500.0050 30×930 × 9 22 0.00260.0026 00 0.00000.0000 30×1030 x 10 1One 0.00130.0013 00 0.00000.0000

<3-4> <3-4> SLC6A3SLC6A3 -- MS9MS9 (( minisatelliteminisatellite 9) 9)

SLC6A3 -MS9 부위에 대하여 정상인 388명 및 고혈압 환자 201명을 분석하였다. 고혈압 환자의 분석 결과에서는 약 586bp, 약 626bp, 약 706bp, 약 746bp, 및 약 786bp 크기의 5개의 대립형질이 확인되었으며, 이는 40bp의 반복단위가 6번, 7번, 9번, 10번 및 11번 반복된 크기로 나타난 것이다(하기 표 11 참조).
388 normal and 201 hypertensive patients were analyzed for SLC6A3 - MS9. In the analysis of hypertension patients, five alleles of about 586 bp, about 626 bp, about 706 bp, about 746 bp, and about 786 bp were identified, indicating that the 40 bp repeat units were 6, 7, 9, 10 and 11 (See Table 11 below).

SLC6A3 -MS9의 고혈압 특이적 다형성 소위성 분석 SLC6A3 - MS9 hypertensive specific polymorphonuclear analysis 정상인Normal 고혈압High blood pressure 반복단위×반복수Repeat unit × Number of repetitions N=776N = 776 횟수(frequency)Frequency N=402N = 402 횟수(frequency)Frequency 40×640 × 6 22 0.00260.0026 1One 0.00250.0025 40×740 × 7 1717 0.02190.0219 1717 0.04230.0423 40×940 × 9 2626 0.03350.0335 99 0.02240.0224 40×1040 x 10 710710 0.91490.9149 368368 0.91540.9154 40×1140 x 11 2121 0.02710.0271 77 0.01740.0174

<< 실시예Example 4> 4>

SLC6A3SLC6A3 -- MS9MS9 영역의 짧은  Short of area 대립형질Allele 보유와 고혈압과의 연관성 분석 Relationship between retention and hypertension

대립형질의 크기가 일반적인 크기의 대립형질보다 7번 반복되는 대립형질과 질병 발생에 대한 감수성을 분석하였다. 대립형질이 나타나는 패턴을 나누어, 일반 대립형질(common allele)로만 이루어진 패턴을 C/C로 하고, 적어도 하나 이상의 7번 반복되는 대립형질을 가지는 패턴을 S/-로 나누어 비교하였다.Alleles were analyzed seven times over alleles and susceptibility to disease development. The pattern in which the alleles appeared was divided and the pattern consisting of only the common allele was regarded as C / C, and the pattern having at least one 7 repeated alleles was divided by S / - and compared.

그 결과, 하기 표 12에 나타난 바와 같이 SLC6A3-MS9의 경우 고혈압 환자에서 S/- 패턴이 정상인에 비해 약 2배 정도 높게 나타났다. 따라서 SLC6A3-MS9의 7번 반복되는 대립형질을 가지는 경우 고혈압에 대하여 그 감수성이 정상인보다 약 2배 이상 높게 나타남을 알 수 있었다. As shown in Table 12, SLC6A3- MS9 showed about 2 times higher S / - pattern in patients with hypertension than normal subjects. Thus, the sensitivity of SLC6A3- MS9 to 7 times repeated alleles was about 2 times higher than that of normal subjects.

상기와 같은 결과를 통해서, SLC6A3-MS9 는 고혈압 같은 질병에 대한 감수성을 조사하는 중요한 마커로서, 예측진단에 중요한 자료로 사용될 수 있음을 알 수 있었다.
These results indicate that SLC6A3- MS9 is an important marker for susceptibility to diseases such as hypertension and can be used as an important data for predictive diagnosis.

정상인과 질병간의 SLC6A3-MS9의 희귀 대립형질 패턴 비교Comparison of rare allelic patterns of SLC6A3- MS9 between normal and disease 정상인Normal 고혈압환자Hypertensive patient 패턴pattern NN %% NN %% SLC6A3-MS9 SLC6A3- MS9 C/CC / C 371371 95.695.6 184184 91.591.5 S/-S / - 1717 4.44.4 1717 8.58.5

C: common allele(일반 대립형질), S: short allele(희귀대립형질), -: common allele(일반 대립형질) 혹은 short allele(희귀대립형질)
C: common allele, S: short allele, -: common allele or short allele,

이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

SLC6A3: solute carrier family 6[dopamine], member 3
SLC: solute carrier
TR: tandem repeat
MS: minisatellite
SLC6A3-MS1: SLC6A3-ministallite1
SLC6A3-MS2: SLC6A3-ministallite2
SLC6A3-MS3: SLC6A3-ministallite3
SLC6A3-MS4: SLC6A3-ministallite4
SLC6A3-MS5: SLC6A3-ministallite5
SLC6A3-MS6: SLC6A3-ministallite6
SLC6A3-MS7: SLC6A3-ministallite7
SLC6A3-MS8: SLC6A3-ministallite8
SLC6A3-MS9: SLC6A3-ministallite9
SLC6A3-MS10: SLC6A3-ministallite10
SLC6A3 : solute carrier family 6 [dopamine], member 3
SLC: solute carrier
TR: tandem repeat
MS: minisatellite
SLC6A3- MS1: SLC6A3-ministallite1
SLC6A3- MS2: SLC6A3-ministallite2
SLC6A3- MS3: SLC6A3-ministallite3
SLC6A3- MS4: SLC6A3-ministallite4
SLC6A3- MS5: SLC6A3-ministallite5
SLC6A3- MS6: SLC6A3-ministallite6
SLC6A3- MS7: SLC6A3-ministallite7
SLC6A3- MS8: SLC6A3-ministallite8
SLC6A3- MS9: SLC6A3-ministallite9
SLC6A3- MS10: SLC6A3-ministallite10

<110> Dong-A University Research Foundation For Industry-Academy Cooperation <120> DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Polymorphic Microsatellites of SLC6A3 Gene <130> PN1404-130 <160> 30 <170> KopatentIn 2.0 <210> 1 <211> 66 <212> DNA <213> SLC6A3-MS1 polynucleotide sequence <400> 1 tggccactac cgttcaaggg agccatttcc tcacccaggt gcccagggaa gcatccagga 60 ggggac 66 <210> 2 <211> 73 <212> DNA <213> SLC6A3-MS2 polynucleotide sequence <400> 2 tccggacaga cggtaatata gaattattta atatggacca gatccacgtg ggagaaggcc 60 ttccaaaggc aat 73 <210> 3 <211> 58 <212> DNA <213> SLC6A3-MS3 polynucleotide sequence <400> 3 ggccaggcct gacctgcaca gtcctcccca gccaggccag ttcctcactg cccacccc 58 <210> 4 <211> 75 <212> DNA <213> SLC6A3-MS4 polynucleotide sequence <400> 4 gtgggcagca gtgggtaccc agcagcgtgg gcagcactgt gggcagcggt gggtacccag 60 caccatgggc agcac 75 <210> 5 <211> 83 <212> DNA <213> SLC6A3-MS5 polynucleotide sequence <400> 5 ggatggatgg gtggatggat gatgggtgga ttgctggatg atggatggct gggtggatgg 60 atgaatgata ggtaggtagc tgg 83 <210> 6 <211> 109 <212> DNA <213> SLC6A3-MS6 polynucleotide sequence <400> 6 atcaggacac catcatcatg tagcatgtgg atgggtccat gcctttctga gggttatcag 60 ggtgctgcca tcatgcagca tgtggatgat ccatgctgtt ctgagggtt 109 <210> 7 <211> 55 <212> DNA <213> SLC6A3-MS7 polynucleotide sequence <400> 7 gtgtggataa gtccatgctg ttctgagggt tatcagggcg ccgcggtcat gttgt 55 <210> 8 <211> 30 <212> DNA <213> SLC6A3-MS8 polynucleotide sequence <400> 8 tgtgtctgtg tgtgtatatt gcatggtatg 30 <210> 9 <211> 40 <212> DNA <213> SLC6A3-MS9 polynucleotide sequence <400> 9 aggagcgtgt cctatccccg gacgcatgca gggcccccac 40 <210> 10 <211> 82 <212> DNA <213> SLC6A3-MS10 polynucleotide sequence <400> 10 gctgcagtta gcacagagga tggcttcccc attgccttct ggggagggac acagaggacg 60 gcttccccat cgccttctgg cc 82 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS1_forward primer <400> 11 ctgggccttc ggtgagcttg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS1_reverse primer <400> 12 ccactggcca cactggctga 20 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS2_forward primer <400> 13 tgggcatcca ttgtcagtta cca 23 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS2_reverse primer <400> 14 tgttctcatg ctcagggcac ctc 23 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS3_forward primer <400> 15 tgggtgtcac tgcgcaagaa 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS3_reverse primer <400> 16 ctggcgaggg caggaagatg 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS4_forward primer <400> 17 tagagtttgc tcggcctcat 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS4_reverse primer <400> 18 gccacagaaa ccaaaaggaa 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS5_forward primer <400> 19 ggctggctgg atgtatgg 18 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS5_reverse primer <400> 20 ccatttcttt cctgatttct cttca 25 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS6_forward primer <400> 21 cgtggaccca cccacctttc 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS6_reverse primer <400> 22 gccctagcgg ggtctccatc 20 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS7_forward primer <400> 23 ggggacacac tcagggggtt g 21 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS7_reverse primer <400> 24 ggcagcagac gactggtgga a 21 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS8_forward primer <400> 25 gcacaaatga gtgttcgtgc atgt 24 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS8_reverse primer <400> 26 caggctggtc ctgcccttca 20 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS9_forward primer <400> 27 cattggagga tgggggtcct g 21 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS9_reverse primer <400> 28 agcaagcagg ctcgcggata 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS10_forward primer <400> 29 gtcatggctg tcccctgcaa 20 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS10_reverse primer <400> 30 ggaggctgag gcagtttttc ca 22 <110> Dong-A University Research Foundation For Industry-Academy Cooperation <120> DNA Typing Kits and Diagnostic Kits for Detecting Diseases          Related to Polymorphic Microsatellites of SLC6A3 Gene <130> PN1404-130 <160> 30 <170> Kopatentin 2.0 <210> 1 <211> 66 <212> DNA <213> SLC6A3-MS1 polynucleotide sequence <400> 1 tggccactac cgttcaaggg agccatttcc tcacccaggt gcccagggaa gcatccagga 60 ggggac 66 <210> 2 <211> 73 <212> DNA <213> SLC6A3-MS2 polynucleotide sequence <400> 2 tccggacaga cggtaatata gaattattta atatggacca gatccacgtg ggagaaggcc 60 ttccaaaggc aat 73 <210> 3 <211> 58 <212> DNA &Lt; 213 > SLC6A3-MS3 polynucleotide sequence <400> 3 ggccaggcct gacctgcaca gtcctcccca gccaggccag ttcctcactg cccacccc 58 <210> 4 <211> 75 <212> DNA &Lt; 213 > SLC6A3-MS4 polynucleotide sequence <400> 4 gtgggcagca gtgggtaccc agcagcgtgg gcagcactgt gggcagcggt gggtacccag 60 caccatgggc agcac 75 <210> 5 <211> 83 <212> DNA <213> SLC6A3-MS5 polynucleotide sequence <400> 5 ggatggatgg gtggatggat gatgggtgga ttgctggatg atggatggct gggtggatgg 60 atgaatgata ggtaggtagc tgg 83 <210> 6 <211> 109 <212> DNA <213> SLC6A3-MS6 polynucleotide sequence <400> 6 atcaggacac catcatcatg tagcatgtgg atgggtccat gcctttctga gggttatcag 60 ggtgctgcca tcatgcagca tgtggatgat ccatgctgtt ctgagggtt 109 <210> 7 <211> 55 <212> DNA &Lt; 213 > SLC6A3-MS7 polynucleotide sequence <400> 7 gtgtggataa gtccatgctg ttctgagggt tatcagggcg ccgcggtcat gttgt 55 <210> 8 <211> 30 <212> DNA <213> SLC6A3-MS8 polynucleotide sequence <400> 8 tgtgtctgtg tgtgtatatt gcatggtatg 30 <210> 9 <211> 40 <212> DNA &Lt; 213 > SLC6A3-MS9 polynucleotide sequence <400> 9 aggagcgtgt cctatccccg gacgcatgca gggcccccac 40 <210> 10 <211> 82 <212> DNA &Lt; 213 > SLC6A3-MS10 polynucleotide sequence <400> 10 gctgcagtta gcacagagga tggcttcccc attgccttct ggggagggac acagaggacg 60 gcttccccat cgccttctgg cc 82 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS1_forward primer <400> 11 ctgggccttc ggtgagcttg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS1_reverse primer <400> 12 ccactggcca cactggctga 20 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS2 forward primer <400> 13 tgggcatcca ttgtcagtta cca 23 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS2_reverse primer <400> 14 tgttctcatg ctcagggcac ctc 23 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS3 forward primer <400> 15 tgggtgtcac tgcgcaagaa 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS3_reverse primer <400> 16 ctggcgaggg caggaagatg 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS4_forward primer <400> 17 tagagtttgc tcggcctcat 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS4_reverse primer <400> 18 gccacagaaa ccaaaaggaa 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS5 forward primer <400> 19 ggctggctgg atgtatgg 18 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS5_reverse primer <400> 20 ccatttcttt cctgatttct cttca 25 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS6 forward primer <400> 21 cgtggaccca cccacctttc 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS6_reverse primer <400> 22 gccctagcgg ggtctccatc 20 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS7_forward primer <400> 23 ggggacacac tcagggggtt g 21 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS7_reverse primer <400> 24 ggcagcagac gactggtgga a 21 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS8_forward primer <400> 25 gcacaaatga gtgttcgtgc atgt 24 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS8_reverse primer <400> 26 caggctggtc ctgcccttca 20 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS9 forward primer <400> 27 cattggagga tgggggtcct g 21 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS9_reverse primer <400> 28 agcaagcagg ctcgcggata 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS10_forward primer <400> 29 gtcatggctg tcccctgcaa 20 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC6A3-MS10_reverse primer <400> 30 ggaggctgag gcagtttttc ca 22

Claims (7)

다음으로 구성된 군에서 선택되는 것을 특징으로 하는 개인 식별 마커용 다형성 소위성 검출용 프라이머 세트:
(ⅰ) 서열번호 11 및 12의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 3번 영역의 다형성 소위성 SLC6A3-MS1 검출용 프라이머 세트;
(ⅱ) 서열번호 17 및 18의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 4번 영역의 다형성 소위성 SLC6A3-MS4 검출용 프라이머 세트;
(ⅲ) 서열번호 25 및 26의 염기서열로 표시되는, SLC6A3 유전자 내의 인트론(intron) 8번 영역의 다형성 소위성 SLC6A3-MS8 검출용 프라이머 세트; 및
(ⅳ) 서열번호 27 및 28의 염기서열로 표시되는, SLC6A3 유전자 내의 엑손(exon) 15번 영역의 다형성 소위성 SLC6A3-MS9 검출용 프라이머 세트.
A primer set for detecting a polymorphic small satellite for a personal identification marker, the primer set being selected from the group consisting of:
(I) a primer set for detection of the intron 3 region of the SLC6A3 gene represented by the nucleotide sequences of SEQ ID NOs: 11 and 12, for the detection of the polymorphonuclear SLC6A3- MS1;
(Ii) a primer set for detection of the intron 4 region of the SLC6A3 gene, represented by the nucleotide sequences of SEQ ID NOS: 17 and 18, for the detection of the polymorphonuclear SLC6A3- MS4;
(Iii) a primer set for detection of the intron 8 region of the SLC6A3 gene, represented by the nucleotide sequences of SEQ ID NOS: 25 and 26, for the detection of the polymorphonuclear SLC6A3- MS8; And
(Iv) A primer set for detecting polynucleotides SLC6A3- MS9 of the exon 15 region in the SLC6A3 gene represented by the nucleotide sequences of SEQ ID NOS: 27 and 28.
제1항의 프라이머 세트를 포함하는 서열번호 1의 SLC6A3-MS1, 서열번호 4의 SLC6A3-MS4, 서열번호 8의 SLC6A3-MS8 및 서열번호 9의 SLC6A3-MS9로 구성된 군에서 선택되는 다형성 소위성 검출을 위한 DNA 타이핑 키트.Claim of SEQ ID NO: 1 comprising the primer set of claim 1 -MS1 SLC6A3, SLC6A3 -MS4 of SEQ ID NO: 4, a small satellite polymorphism detected is selected from the group consisting of SLC6A3 and SLC6A3 -MS8 -MS9 of SEQ ID NO: 9, SEQ ID NO: 8 DNA typing kit for. 검체로부터 추출된 게놈 DNA를 주형으로 하고, 제1항에 따른 프라이머 세트를 이용하여 DNA 중합효소 연쇄 반응(PCR)을 수행하는 단계; 및
상기 PCR 산물을 전기영동으로 분리하여 서열번호 1의 SLC6A3-MS1, 서열번호 4의 SLC6A3-MS4, 서열번호 8의 SLC6A3-MS8 및 서열번호 9의 SLC6A3-MS9로 구성된 군에서 선택되는 다형성 소위성을 검출하는 단계를 포함하는 DNA 타이핑 방법.
Performing a DNA polymerase chain reaction (PCR) using the genomic DNA extracted from the specimen as a template and using the primer set according to claim 1; And
The PCR product was separated by electrophoresis to obtain a polymorphic satellite selected from the group consisting of SLC6A3- MS1 of SEQ ID NO: 1, SLC6A3- MS4 of SEQ ID NO: 4, SLC6A3- MS8 of SEQ ID NO: 8, and SLC6A3- MS9 of SEQ ID NO: And detecting the DNA.
제3항에 있어서,
상기 검체는 혈액, 머리카락, 타액, 표피, 정액, 질 채취물, 분리된 세포, 조직샘플, 비듬, 유골로 구성된 군으로부터 선택된 1종 이상인 것을 특징으로 하는 방법.
The method of claim 3,
Wherein the specimen is at least one selected from the group consisting of blood, hair, saliva, epidermis, semen, quality samples, separated cells, tissue samples, dandruff, and ashes.
제3항에 있어서,
상기 DNA 타이핑 방법은 개체의 친자 확인, 혈연 확인 또는 법의학적 감정에 사용되는 것을 특징으로 하는 방법.
The method of claim 3,
Characterized in that said DNA typing method is used for parental identification of an individual, identification of blood vessels or forensic medical evaluation.
서열번호 27 및 28의 염기서열로 표시되는, SLC6A3 유전자 내의 엑손(exon) 15번 영역의 다형성 소위성 SLC6A3-MS9 검출용 프라이머 세트를 포함하는 SLC6A3 관련 질병인 고혈압 진단키트.A diagnostic kit for hypertension, which is a SLC6A3- related disease comprising a primer set for detecting a polymorphonuclear SLC6A3- MS9 of an exon 15 region in the SLC6A3 gene represented by the nucleotide sequences of SEQ ID NOS: 27 and 28. 삭제delete
KR1020140058990A 2014-05-16 2014-05-16 63 DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Polymorphic Microsatellites of 63 Gene KR101588119B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140058990A KR101588119B1 (en) 2014-05-16 2014-05-16 63 DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Polymorphic Microsatellites of 63 Gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140058990A KR101588119B1 (en) 2014-05-16 2014-05-16 63 DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Polymorphic Microsatellites of 63 Gene

Publications (2)

Publication Number Publication Date
KR20150131770A KR20150131770A (en) 2015-11-25
KR101588119B1 true KR101588119B1 (en) 2016-01-25

Family

ID=54845545

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140058990A KR101588119B1 (en) 2014-05-16 2014-05-16 63 DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Polymorphic Microsatellites of 63 Gene

Country Status (1)

Country Link
KR (1) KR101588119B1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102249934B1 (en) * 2017-12-27 2021-05-10 동아대학교 산학협력단 DNA Typing Kits and Diagnostic Kits for Detecting Cancer using Minisatellites of RB1 Gene
KR102186011B1 (en) * 2019-03-18 2020-12-03 동아대학교 산학협력단 DNA Typing Kits and Diagnostic Kits for Detecting Cancer using Minisatellites of ABL1 Gene

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130267523A1 (en) 2011-11-14 2013-10-10 Pamlab, L.L.C. Assays and methods for selecting a treatment regimen for a subject with depression

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070022710A (en) * 2004-06-04 2007-02-27 노파르티스 아게 Biomarkers for the prediction of responsiveness to clozapine treatment
KR100861383B1 (en) 2007-01-16 2008-10-01 동아대학교 산학협력단 DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related Microsatellites of SLC6A18 Gene
KR100861384B1 (en) 2007-01-16 2008-10-01 동아대학교 산학협력단 DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Microsatellites of SLC6A19 Gene

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130267523A1 (en) 2011-11-14 2013-10-10 Pamlab, L.L.C. Assays and methods for selecting a treatment regimen for a subject with depression

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
GenBank: AY623110.1

Also Published As

Publication number Publication date
KR20150131770A (en) 2015-11-25

Similar Documents

Publication Publication Date Title
CN113614246A (en) Methods and compositions for identifying tumor models
KR101777161B1 (en) A Multiplex SNP marker composition and a method for diagnosis or prediction of canine hip dysplasia using same marker
KR20120011728A (en) SNP Markers Associated with Meat Quantity and Beef Quality in Hanwoo
KR20120043793A (en) Snp for diagnosing hip dysplasia in dog and uses thereof
CN109811043A (en) Gene pleiomorphism detecting method and detection kit based on Taqman-MGB probe
CN110093415A (en) Detect method, kit, primer pair and the probe of CYP3A5 gene
EP1609876B1 (en) Identification of the gene and mutation for progressive rod-cone degeneration in dog and method for testing same
EP2025764A1 (en) Probe for detection of mutation in abl gene and use thereof
KR101588119B1 (en) 63 DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Polymorphic Microsatellites of 63 Gene
Honeyman et al. Development of a snapback method of single-strand conformation polymorphism analysis for genotyping Golden Retrievers for the X-linked muscular dystrophy allele
JP4580924B2 (en) Evaluation method of drug sensitivity by analysis of mu opioid receptor gene
KR102087024B1 (en) Single nucleotide polymorphism marker set for line purity checking and early fixed line selecting in Brassica rapa and uses thereof
KR20170007560A (en) Composition for determining nose phenotype
KR102186011B1 (en) DNA Typing Kits and Diagnostic Kits for Detecting Cancer using Minisatellites of ABL1 Gene
US20050244830A1 (en) Quantitative multiplex amplification on a genomic scale, and applications for detecting genomic rearrangements
KR102249934B1 (en) DNA Typing Kits and Diagnostic Kits for Detecting Cancer using Minisatellites of RB1 Gene
KR101925974B1 (en) Composition for diagnosis of neurofibromatosis comprising long PCR primer set based on genomic DNA
TWI417545B (en) Methods and kits for genotyping molecular markers in pigs
KR20220087096A (en) Primer set for selecting Phytophthora blight resistant pepper and selection method using the same primer set
KR100861384B1 (en) DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Microsatellites of SLC6A19 Gene
KR102438915B1 (en) Methods for detecting target nucleotide sequences Methods and kits for designing and manufacturing probes
CN109415759B (en) Method for producing DNA probe and method for analyzing genomic DNA using DNA probe
CN110343757A (en) A kind of short tandem repeat general probe and its design method and application
EP1660675B1 (en) Polymorphism of the igf2 gene and improving production characteristics of cattle
KR102448654B1 (en) DNA Typing Kits and Diagnostic Kits for Detecting Cancer using Minisatellites of PDCD6 Gene

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20190104

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20200102

Year of fee payment: 5