KR100861383B1 - DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related Microsatellites of SLC6A18 Gene - Google Patents

Abstract

The present invention is SLC6A18 It relates to the polymorphism of the gene and the DNA typing kit and diagnostic kit for the disease associated with the gene, more specifically, the polymorphic cow in the SLC6A18 gene, a neutral amino acid transporter, which can be used as a personal identification marker. The present invention relates to a satellite, a primer set for detecting polymorphism, a DNA typing kit using the primer set, and a diagnostic kit for SLC6A18 gene-related diseases.

Since SLC6A18- MS1, SLC6A18- MS2, SLC6A18- MS4, SLC6A18- MS5, and SLC6A18- MS6 of the present invention are transmitted through meiosis according to the Mendelian heredity, paternity, kinship identification or forensic evaluation of the individual by DNA typing It can be effectively used for the diagnosis of disease susceptibility by amplifying the SLC6A18- MS4 region and comparing the population frequency of rare alleles with those of normal individuals.

SLC6A18, polymorphic polysaccharide, DNA typing, hypertension, Parkinson's disease

Description

DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related Microsatellites of SLC6A18 Gene

Figure 1 shows the position and orientation of the SLC6A18 gene located on human chromosome 5, showing the SLC6A18 gene on the 5p15.3 chromosome, showing the structure of the SLC6A18 gene and the location of the so-called (minisatellite, MS) in the gene. Schematic diagram.

Figure 2 is an electrophoretic picture showing the polymorphism of SLC6A18- MS1.

FIG. 3 is an electrophoretic photograph showing polymorphism of SLC6A18- MS2.

4 is an electrophoretic photograph showing the polymorphism of SLC6A18- MS4.

FIG. 5 is an electrophoretic photograph showing polymorphism of SLC6A18- MS5. FIG.

FIG. 6 is an electrophoretic photograph showing the polymorphism of SLC6A18- MS6.

FIG. 7 is an electrophoretic photograph showing that SLC6A18- MS1, SLC6A18- MS2, SLC6A18- MS4, SLC6A18- MS5, and SLC6A18- MS6 are genetically transmitted between parents and offspring. The first and last lanes are size markers. GF or GM means grandfather or grandmother, F or M means father or mother, and DNA samples of offspring are indicated as C1 and C2.

The present invention relates to the polymorphism of the SLC6A18 gene and DNA typing kit and diagnostic kit using the same. More specifically, the SLC6A18 is a neutral amino acid transporter that can be used as a personal identification marker. It relates to a polymorphic so called polymorphism in the gene, a primer set for detecting the polymorphic so called polymorphism, a DNA typing kit using the primer set and a diagnostic kit for SLC6A18 gene-related diseases.

In the vertebrate genome, the genes encoding the membrane proteins form one of the largest groups. In humans and mice, membrane proteins make up more than 10% of all genes, including G-protein receptors, kinase receptors, ion channels and solute carriers. Among the membrane proteins, a solute carrier (SLC) regulates sugar, amino acids, nucleotides and inorganic ions to pass through the cell membrane passively or actively. Currently there are 43 different groups of solute carriers (SLC), among which the proteins of the SLC6 group serve as specific carriers of neurotransmitters, amino acids and osmolytes. Neurotransmitters in the nervous system regulate many physiological phenomena. In particular, they are involved in various pathological processes of the brain in relation to the brain and are associated with diseases such as Parkinson's disease, depression, epilepsy and drug abuse. The SLC6 group is subdivided into four categories: gamma-aminobutyric acid (GABA), monoamine (monoamine), amino acid (amino acid) and orphan.

SLC6A18 (solute carrier family 6, member 18) is located on 5p15.3 region with the corresponding group and the olpan, SLC6A19 (solute carrier family 6, member 19) , and SLC6A20 (solute carrier family 6, member 20). Polymorphism of the neurotransmitter dopamine-related gene has been reported to be associated with hypertension (Mikano Sato, et al., Hypertension 36: 183, 2000). SLC6A18 and SLC6A19 are highly expressed in the whole brain, which may affect diseases related to several neurotransmitters. Recently, SNPs ( monopolymorphism ) in other genes of the SLC6 group have been reported to be associated with hypertension (Koh Ono, et al., Hypertens Res. 26 (9): 685, 2003).

Tandem repeat (TR) sequences, on the other hand, account for more than 10% of the human genome, are responsible for various diseases and are very important factors in the regulation and evolution of gene expression. TR sequences are divided into monomorphic ones with only one allele and polymorphic ones with two or more alleles depending on their length. Polymorphic so-called repeat sequences have important significance as genomic markers that can be used for human genome mapping in early genome research.

Therefore, in the art, the analysis of TR in a very structurally complex gene, the discovery of polymorphic so-called polymorphisms, and research on the relationship with diseases have become very important research fields, and there is an urgent need for continuous development.

Therefore, the present inventors have analyzed the location of polymorphic solitary (minisatellite (MS)) of SLC6A18 as a result of diligent efforts to discover TR analysis and polymorphic so-called somaticity in the gene and to study the association with the polymorphic so-called disease. It has been confirmed that some of the so-called melodies are transmitted through meiosis according to the Mendelian heredity, thus completing the present invention.

After all, the main object of the present invention is to provide a polymorphic minisatellites that can be used as a personal identification marker and a primer set for detecting the polymorphic soot.

Another object of the present invention is to provide a DNA typing kit and a DNA typing method useful for paternity identification, kinship identification or forensic evaluation of an individual using the primer set.

Another object of the present invention to provide a diagnostic kit of SLC6A18- related diseases using the primer set.

In order to achieve the above object, the present invention (a) is represented by the nucleotide sequence of SEQ ID NO: 1SLC6A18(solute carrier family 6, member 18) Polymorphism of the promoter region of a geneSLC6A18-MS1 (SLC6A18-ministallite1); (b) represented by the nucleotide sequence of SEQ ID NO: 2SLC6A18Polymorphism, so called polymorphism, intron 1 region in the geneSLC6A18-MS2 (SLC6A18-ministallite2); (c) represented by the nucleotide sequence of SEQ ID NO: 4SLC6A18Polymorphism, so called polymorphism, intron 1 region in the geneSLC6A18-MS4 (SLC6A18-ministallite4); (d) represented by the nucleotide sequence of SEQ ID NO: 5SLC6A18Polymorphic so called polymorphism in the intron 5 region in the geneSLC6A18-MS5 (SLC6A18-ministallite5); And (e) the nucleotide sequence of SEQ ID NO: 6SLC6A18Polymorphic so called polymorphism in the intron 7 region in the geneSLC6A18-MS6 (SLC6A18-polystaltic minisatellites for personal identification markers selected from the group consisting of (ministallite6).

The present invention also relates to the polymorphic so-called SLC6A18- MS1 of the promoter region of the SLC6A18 gene, the polymorphic so- called SLC6A18- MS2 of the intron 1 region in the SLC6A18 gene, and the polymorphic isotonic region of the intron 1 region in the SLC6A18 gene. SLC6A18 -MS4, intron (intron) polymorphism in the 5 region small satellite SLC6A18 -MS5 and intron (intron) any one of the small satellite is selected from the group consisting of the polymorphic small satellite SLC6A18 -MS6 of seven times in the region in the SLC6A18 gene SLC6A18 gene Provided is a primer set for polymorphic so-called polymorphism detection.

In the present invention, the primer set is (a) a polymorphic so-called SLC6A18- MS1 primer set for detecting a promoter region of the SLC6A18 gene, which is represented by the nucleotide sequences of SEQ ID NOs: 9 and 10; (b) a primer set for detecting polymorphic so-called SLC6A18- MS2 of intron 1 region in the SLC6A18 gene, represented by the nucleotide sequences of SEQ ID NOs: 11 and 12; (c) a primer set for detecting the polymorphic so-called SLC6A18- MS4 of the intron 1 region in the SLC6A18 gene, represented by the nucleotide sequences of SEQ ID NOs: 15 and 16; (d) a set of primers for detecting the polymorphic so-called SLC6A18- MS5 of intron 5 region in the SLC6A18 gene, represented by the nucleotide sequences of SEQ ID NOs: 17 and 18; And (e) SLC6A18 , represented by the nucleotide sequences of SEQ ID NOs: 19 and 20. It may be characterized in that it is selected from the group consisting of a set of primers for detecting polymorphic so-called SLC6A18- MS6 of intron 7 region in the gene.

The present invention also provides SLC6A18- MS1 of SEQ ID NO: 1, SLC6A18 -MS2 of SEQ ID NO: 2, SLC6A18 -MS4 of SEQ ID NO: 4, SLC6A18 -MS5 of SEQ ID NO: 5, and SLC6A18 -MS6 of SEQ ID NO: 6, including the primer set. It provides a DNA typing kit for polymorphic so-called detection selected from the group consisting of.

The present invention also comprises the steps of (a) using genomic DNA extracted from the tissue of a subject as a template, and performing a DNA polymerase chain reaction (PCR) using the kit; And (b) separating the PCR product by electrophoresis to identify one selected from the group consisting of SLC6A18- MS1, SLC6A18- MS2, SLC6A18- MS4, SLC6A18- MS5, and SLC6A18- MS6. Provide a method.

In the present invention, the DNA typing method may be used for paternity identification, kinship identification or forensic emotion of an individual.

The present invention also provides a primer set for detecting polymorphic so-called SLC6A18- MS4 in the intron 1 region of the SLC6A18 gene, represented by the nucleotide sequences of SEQ ID NOs: 15 and 16, DNA polymerase and dNTPs (dGTP, dCTP, dATP). And dTTP) provides a diagnostic kit for SLC6A18 related diseases.

In the present invention, the SLC6A18- related disease may be characterized as Parkinson's disease or hypertension.

Hereinafter, the present invention will be described in detail.

SLC6A18 is located on 5p15.3 region with its olpan the group, and SLC6A19 and SLC6A20. Since SLC6A18 is highly expressed in the whole brain, it appears to affect diseases related to several neurotransmitters. Such SLC6 has a number of tandem repeat (TR) sequences.

FIG. 1 shows the band structure of human chromosome 5 by MAP Viewer of NCBI website. FIG. 1 shows the SLC6A18 gene on the 5p15.3 chromosome and the structure of the SLC6A18 gene and the so- called (minisatellite (MS)) gene. It shows the location of. Exons were marked with black lines and the locations of the so-called (minisatellite) detected by the Tandem Repeats Finder Program are marked with an asterisk (*).

The structural characteristics of the SLC6A18 (NC_000005 REGION: 1278470..1299303) gene were analyzed using BLAST, and SLC6A18 was composed of 12 exons of about 20 Kb in size and the location of the chain repeat region was 1 in the promoter region and within the gene. 5 and 2 downstream.

In addition, among the chain repeat regions, which can be used as personal identification markers, are SLC6A18- MS1, SLC6A18- MS2, SLC6A18- MS4, SLC6A18- MS5 and SLC6A18- MS6, which exhibit polymorphic so-called polymorphisms, and the parent of an individual using DNA typing. Confirmation, blood count or diagnosis of related diseases is possible.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1 Structural Analysis of SLC6A18 Gene and Polymorphism Analysis of So-called (minisatellite, MS)

Structural characteristics of the SLC6A18 (NC_000005 REGION: 1278470..1299303) gene were analyzed using BLAST. The location number of the indices shown in Table 1 shows the result of analysis in NC_000005 REGION. Examine the exon and intron regions present in the promoter region and open reading frame (ORF), determine the location of tandem repeats (TR) in each region, The repeating sequence size was analyzed for the location of so-called (minisatellite, MS) of about 10 ~ 100bp.

As a result, SLC6A18 was composed of 12 exons of about 20Kb in size, and the location of the chain repeat region was 1 in the promoter region, 5 in the gene and 2 downstream as shown in Table 1.

The polymorphic so called polymorphisms of the eight so-called (minisatellite, MS, Table 1) present in the SLC6A18 gene were analyzed using PCR. The base sequences of the primers used for PCR analysis are shown in Table 2 below.

Tandem repeat (TR) in the SLC6A18 gene SEQ ID NO: So-called (minisatellite) Indices location Repeat size Representative copy number Representative size (bp) SEQ ID NO: 1 SLC6A18 -MS1 1276671-1276892 Promoter 72 3.1 221 SEQ ID NO: 2 SLC6A18 -MS2 1280072-1280306 Intron 1 15 16.1 234 SEQ ID NO: 3 SLC6A18 -MS3 1282333-1282473 Intron 1 50 2.8 140 SEQ ID NO: 4 SLC6A18 -MS4 1282315-1282838 Intron 1 36 14.0 523 SEQ ID NO: 5 SLC6A18 -MS5 1282847-1283295 Intron 5 37 12.1 448 SEQ ID NO: 6 SLC6A18 -MS6 1291318-1291587 Intron 7 30 9.0 269 SEQ ID NO: 7 SLC6A18 -MS7 1295501-1295715 Downstream 40 5.3 214 SEQ ID NO: 8 SLC6A18 -MS8 1300333-1300530 Downstream 97 2.0 197

SEQ ID NO: order SEQ ID NO: 1 TTCCTACGGACAGGTCACCTCCGCTTTGCATGGAAGAATCTGGATGCTTACATTAAACTGGTGTTCTGAGAG SEQ ID NO: 2 ACGCCTTGCCCGCCG SEQ ID NO: 3 ATTCACAGAAAACCCTCTCATCTCCTCTCCCCTAAACACAGAAACCCTCA SEQ ID NO: 4 CTCACGGTGCAGGCTGGAGGGGAGGGAAGAGGGGCT SEQ ID NO: 5 GGGGCCTCAGGAAAGAGGTCAGGTTTGGAGTGAGCCT SEQ ID NO: 6 CGTCCACACGATCCCAACAGGGGCAGGAGG SEQ ID NO: 7 GAGCCCACAGCAGGGGAAGCTGCCCACCTAAGCGTGTCCC SEQ ID NO: 8 CAGAGCCTGGAGGGTGGAGTGGAGGGAGGGGTGCTTCCCCAAAGGAAAGCCTCCAGAAGCCAAAGCAACAGCTGCGTTCCATGGTGTCACCAACTCA

Primers used to detect polymorphisms Polymorphic enamel primer SEQ ID NO: Sequence SLC6A18 - MS1 SLC6A18 - MS1 F SEQ ID NO: 9 atcgcagccaaaggcagtcg SLC6A18 - MS1 R SEQ ID NO: 10 ggggtgctggaagggacgat SLC6A18 - MS2 SLC6A18 - MS2 F SEQ ID NO: 11 ctttacccaccaacgccttgttc SLC6A18 - MS2 R SEQ ID NO: 12 tgcaggcgcttagcaatggtaact SLC6A18 - MS3 SLC6A18 - MS3 F SEQ ID NO: 13 tgcagccgctgtaccacaga SLC6A18 - MS3 R SEQ ID NO: 14 cgaagggaaagatttggggaga SLC6A18 - MS4 SLC6A18 - MS4 F SEQ ID NO: 15 cgaagccactactgcgggatg SLC6A18 - MS4 R SEQ ID NO: 16 cagggccaggctcccatgt SLC6A18 - MS5 SLC6A18 - MS5 F SEQ ID NO: 17 ctgggctgcctggtggtcag SLC6A18 - MS5 R SEQ ID NO: 18 cctgccccagaccgaagtcc SLC6A18 - MS6 SLC6A18 - MS6 F SEQ ID NO: 19 ctaccagtgccgccctgtcac SLC6A18 - MS6 R SEQ ID NO: 20 tcatggccctggttcccaaac SLC6A18 - MS7 SLC6A18 - MS7 F SEQ ID NO: 21 aagcacgtgcaccgctaccc SLC6A18 - MS7 R SEQ ID NO: 22 tgcaggacggagggacgaag SLC6A18 - MS8 SLC6A18 - MS8 F SEQ ID NO: 23 ggtgagatgctcccccttcaga SLC6A18 - MS8 R SEQ ID NO: 24 cgcccttggcagtgtttgct

Using genomic DNA extracted from the blood of 100 adult males and females, the MS3 (minisatellite3) region in intron 1 region, the MS7 (minisatellite7) region in downstream region, and the 8 TRs present in the SLC6A18 gene and Allele aspects of the MS8 (minisatellite8) site were compared using PCR.

Genomic DNA was subjected to standard PCR conditions (50mM Tris-HCl, pH 9.0), 50mM MgCl ₂ , 0.2mM dTTP, 0.2mM dCTP, 0.2mM dGTP and 0.2mM dATP, final volume 50 μl. A primer 14, SLC6A18- MS7 was amplified using primers SEQ ID NOs: 21 and 22, and SLC6A18- MS8 using primers SEQ ID NOs: 23 and 24.

PCR analysis of DNA samples was performed using Promega GoTaq Flexi DNA polymerase (Promega) with 100 ng of genomic DNA as a template. The conditions of the cycle were heat treated once at 94 ° C for 2 minutes for SLC6A18- MS3, SLC6A18- MS7 and SLC6A18- MS8, followed by 30 cycles of 45 seconds at 94 ° C, 20 seconds at 60 ° C and 30 seconds at 72 ° C. The last extension step was then extended at 72 ° C. for 7 minutes.

The PCR product was injected into 1.5% SeaKem LE agarose gel for SLC6A18- MS3, SLC6A18- MS7 and SLC6A18- MS8 and analyzed by electrophoresis (1 volt / cm) in TAE buffer. As a result, SLC6A18- MS3, SLC6A18- MS7, and SLC6A18- MS8 exhibited a monomorphism , and therefore cannot be used as personal identification markers.

Genomic DNA extracted from the blood of 100 adult males and females was used to locate SLC6A18- MS1 located in the promoter region, SLC6A18- MS2 located in the region 1 and intron 1 among the 8 TRs present in the SLC6A18 gene. Alleles of SLC6A18- MS4, SLC6A18- MS5 located in intron 5 region and SLC6A18- MS6 located in region 7 were compared using PCR.

Genomic DNA was subjected to standard PCR conditions (50mM Tris-HCl, pH 9.0), 50mM MgCl ₂ , 0.2mM dTTP, 0.2mM dCTP, 0.2mM dGTP and 0.2mM dATP, final volume of 50 μl. 10 primer, SLC6A18- MS2 is SEQ ID NO: 11 and 12, SLC6A18- MS4 is SEQ ID NO: 15 and 16, SLC6A18- MS5 is SEQ ID NO: 17 and 18, SLC6A18- MS6 is SEQ ID NO: 19 and 20 Amplification using primers.

PCR analysis of DNA samples was performed using Promega GoTaq Flexi DNA polymerase (Promega) with 100 ng of genomic DNA as a template. The conditions of the cycle were heat treated once for 2 minutes at 94 ° C for SLC6A18- MS1, SLC6A18- MS4 and SLC6A18- MS6, followed by 30 cycles of 45 seconds at 94 ° C, 20 seconds at 60 ° C and 30 seconds at 72 ° C. The last extension step was then extended at 72 ° C. for 7 minutes.

SLC6A18- MS2 was subjected to one heat treatment at 94 ° C. for 2 minutes, followed by 30 cycles of 45 seconds at 94 ° C., 20 seconds at 60 ° C. and 45 seconds at 72 ° C., then the last elongation step was 7 minutes at 72 ° C. Extended. After SLC6A18- MS5, one heat treatment at 94 ° C. for 2 minutes, followed by 30 cycles of 45 seconds at 94 ° C. and 20 seconds at 60 ° C. and 60 seconds at 72 ° C., followed by a final stretching step of 7 minutes at 72 ° C. Extended.

The PCR product was injected into 1% SeaKem LE agarose gel for SLC6A18- MS4 and SLC6A18- MS5, 1.5% SeaKem LE agarose gel for SLC6A18- MS2 and SLC6A18- MS6, and SLC6A18- MS1 2% SeaKem LE agarose gel Afterwards, it was analyzed by electrophoresis (1 volt / cm) in TAE buffer. As a result, all of them showed polymorphism so-called that it can be used as a personal identification marker. Therefore, the following further analysis was performed by increasing the population (Tables 3 to 16). In this case, N is the number of alleles, and each person has two alleles, which is twice the number of samples.

(1) SLC6A18- MS1 (minisatellite 1)

As a result of 300 normal subjects, four alleles of about 270, about 340, about 410, and about 490 bp were identified. (Table 3, Figure 2). Figure 2 shows the polymorphic so-called, various bands appeared in all samples (1-25).

Polymorphic So-called Analysis of SLC6A18- MS1 Repeat Unit × Repeat Number N value (total: 600) ** frequency 72 × 2 97 0.162 72 × 3 277 0.462 72 × 4 16 0.027 72 × 5 210 0.350

** Calculated as "frequency = N value / total N value", if the value is less than 0.01, it is a rare polymorphic so called.

(2) SLC6A18- MS2 (minisatellite 2)

As a result of 300 normal subjects, three alleles of about 300 bp, 330 bp and 350 bp were identified, indicating that the repeat units of 15 bp were repeated 13, 15 and 16 times (Table 4, FIG. 4). 3). Figure 3 shows the polymorphic so called, various bands appeared in the sample (1 ~ 24).

Polymorphic So-called Analysis of SLC6A18- MS2 Repeat Unit × Repeat Number N = 600 ** frequency 15 × 13 274 0.457 15 × 15 107 0.178 15 × 16 219 0.365

** Calculated as "frequency = N value / total N value", if the value is less than 0.01, it is a rare polymorphic so called.

(3) SLC6A18 - MS4 (minisatellite 4)

As a result of 300 normal subjects, four alleles of about 580, about 620, about 800 and about 830 bp were identified, indicating that the 36 bp repeating units were repeated 13, 14, 19 and 20 times. (Table 5, Figure 4). Figure 4 shows the polymorphic so called, various bands appeared in the sample (1 ~ 25).

Polymorphic So-called Analysis of SLC6A18- MS4 Repeat Unit × Repeat Number N = 600 ** frequency 36 × 13 17 0.028 36 × 14 560 0.933 36 × 19 4 0.007 36 × 20 19 0.032

** Calculated as "frequency = N value / total N value", if the value is less than 0.01, it is a rare polymorphic so called.

(4) SLC6A18- MS5 (minisatellite 5)

As a result of the investigation of 100 normal people, 21 alleles of 231-1156bp size were identified, which represented a repeated size of 37bp repeating table (Table 6, FIG. 5). Figure 5 shows the polymorphic so-called, various bands came out in all of the samples (1-25).

Polymorphic So-called Analysis of SLC6A18 - MS5 Repeat Unit × Repeat Number N = 200 ** frequency 37 × 4 5 0.025 37 × 5 One 0.005 37 × 6 2 0.010 37 × 9 4 0.020 37 × 10 5 0.025 37 × 11 13 0.065 37 × 12 87 0.435 37 × 13 15 0.075 37 × 14 17 0.085 37 × 15 4 0.020 37 × 16 One 0.005 37 × 17 4 0.020 37 × 18 15 0.075 37 × 19 8 0.040 37 × 20 3 0.015 37 × 21 5 0.025 37 × 22 4 0.020 37 × 23 2 0.010 37 × 26 One 0.005 37 × 28 One 0.005 37 × 29 3 0.015

** Calculated as "frequency = N value / total N value", if the value is less than 0.01, it is a rare polymorphic so called.

(5) SLC6A18- MS6 (minisatellite 6)

In 300 normal subjects, four alleles of about 320, 350, 380, and 410 bp were identified. (Table 7, FIG. 6). Figure 6 shows the polymorphic so called, various bands appeared in the sample (1-25).

Polymorphic So-called Analysis of SLC6A18- MS6 Repeat Unit × Repeat Number N = 600 ** frequency 30 × 7 21 0.035 30 × 8 206 0.343 30 × 9 371 0.618 30 × 10 2 0.003

** Calculated as "frequency = N value / total N value", if the value is less than 0.01, it is a rare polymorphic so called.

Example 2: Determining the Genetic Delivery of Polymorphic Sociability (minisatellite, MS) through meiosis

Mendel's process of transferring the genetic traits from the father to the offspring, one by one, is called Mendel's genetic law, which enables paternity between parents and offspring. Alleles in the tandem repeats (TR) region consisted of two alleles inherited from the parent, confirming that they are transmitted to the offspring through meiosis. Genomic DNA was extracted from the blood of grandparents, parents, and offspring, and the alleles of SLC6A18-MS1, SLC6A18- MS2, SLC6A18- MS4, SLC6A18- MS5 and SLC6A18- MS6 were extracted using PCR in the same manner as in Example 1. Confirmed.

As a result, as shown in FIG. 7, SLC6A18- MS1, SLC6A18- MS2, SLC6A18- MS4, SLC6A18- MS5, and SLC6A18- MS6 were confirmed to be correctly genetically transferred through meiosis between parents and offspring. It is inherited by Mendel's law and indicates that it can be used as an efficient marker for identification, paternity, kinship, or forensic emotions, and DNA typing markers can be used to determine whether the same disease occurs in a family. It means you can investigate.

Example 3 Determination of Correlation with Parkinson's Disease in SLC6A18- MS1, SLC6A18- MS2, SLC6A18- MS4, SLC6A18- MS5, and SLC6A18- MS6 Regions

Reported that the structural characteristics of tandem repeats (TR) are involved in the expression of genes, the report is centered on h-Ras. In the present invention, in order to investigate the effect on the gene expression of the TR region of the SLC6A18 gene, the genomic DNA of a normal person and Parkinson's patient is extracted and subjected to PCR in the same manner as in Example 1 to obtain a haplotype pattern between the normal person and Parkinson's patient ( haplotype pattern) was analyzed.

(1) SLC6A18- MS1

300 normal and 237 Parkinson's patients were analyzed for the SLC6A18- MS1 site. In the analysis of Parkinson's patients, four alleles of about 270, 340, 410, and 490 bp were identified, representing 72, 2, 3, 4, and 5 repeated units. (Table 8).

Parkinson's disease specific polymorphism so-called analysis of SLC6A18- MS1 Normal people Parkinson's disease Repeat Unit × Repeat Number N = 600 Frequency N = 474 Frequency 72 × 2 97 0.162 88 0.186 72 × 3 277 0.462 247 0.521 72 × 4 16 0.027 6 0.013 72 × 5 210 0.350 133 0.281

(2) SLC6A18- MS2 (minisatellite 2)

300 normal and 237 Parkinson's patients were analyzed for the SLC6A18 - MS2 site. In the analysis of Parkinson's patients, three alleles of about 300 bp, 330 bp, and about 350 bp were identified, indicating that 15 bp repeat units were repeated in 13, 15, and 16 times (Table 9).

Parkinson's disease-specific polymorphism soot analysis of SLC6A18- MS2 Normal people Parkinson's disease Repeat Unit × Repeat Number N = 600 Frequency N = 474 Frequency 15 × 13 274 0.457 204 0.430 15 × 15 107 0.178 95 0.200 15 × 16 219 0.365 175 0.370

(3) SLC6A18- MS4 (minisatellite 4)

300 normal and 237 Parkinson's patients were analyzed for the SLC6A18 - MS4 site. In Parkinson's analysis, six alleles of about 580, about 620, about 650, about 800, about 830, and about 1050 bp were identified. , Repeated 20 and 26 times in size (Table 10). Comparison of the frequency of occurrence of the rare alleles (No. 15, 19, and 26) between normal and patient in this area showed an increase from 0.7% to 1.4%, two-fold for those with genetic rareities in this area. The risk of abnormalities was found to increase.

Parkinson's disease specific polymorphism so-called analysis of SLC6A18- MS4 Normal people Parkinson's disease Repeat Unit × Repeat Number N = 600 Frequency N = 474 Frequency 36 × 13 17 0.028 11 0.023 36 × 14 560 0.933 443 0.935 36 × 15 ㆍ ㆍ One 0.002 36 × 19 4 0.007 4 0.008 36 × 20 19 0.032 13 0.028 36 × 26 ㆍ ㆍ 2 0.004

(4) SLC6A18- MS6 (minisatellite 6)

300 normal and 237 Parkinson's patients were analyzed for the SLC6A18- MS6 site. In the analysis of Parkinson's patients, four alleles of about 320, 350, 380, and 410 bp were identified, indicating that 30 bp repeat units were repeated 7, 8, 9 and 10 times. (Table 11).

Parkinson's disease specific polymorphism so-called analysis of SLC6A18- MS6 Normal people Parkinson's disease Repeat Unit × Repeat Number N = 600 Frequency N = 474 Frequency 30 × 7 21 0.035 22 0.046 30 × 8 206 0.343 169 0.357 30 × 9 371 0.618 281 0.593 30 × 10 2 0.003 2 0.004

Example 4 Determination of Correlation with Hypertension in the SLC6A18- MS1, SLC6A18- MS2, SLC6A18- MS4, SLC6A18- MS5, and SLC6A18- MS6 Regions

Reported that the structural characteristics of tandem repeats (TR) are involved in the expression of genes, the report is centered on h-Ras. In the present invention, in order to investigate the effect on the gene expression of the TR region of the SLC6A18 gene, the genomic DNA of a normal person and Alzheimer's patient was extracted and subjected to PCR in the same manner as in Example 1 to obtain a haplotype pattern between a normal person and a hypertensive patient ( haplotype pattern) was analyzed.

(1) SLC6A18- MS1

300 normal and 205 hypertensive patients were analyzed for the SLC6A18- MS1 site. In the analysis of hypertensive patients, four alleles of about 270, 340, 410, and 490 bp were identified, representing 72, 2, 3, 4, and 5 repeated units. Table 12.

Hypertension specific polymorphism so-called analysis of SLC6A18- MS1 Normal people High blood pressure Repeat Unit × Repeat Number N = 600 Frequency N = 410 Frequency 72 × 2 97 0.162 88 0.215 72 × 3 277 0.462 178 0.434 72 × 4 16 0.027 14 0.034 72 × 5 210 0.350 130 0.317

(2) SLC6A18- MS2 (minisatellite 2)

300 normal and 205 hypertensive patients were analyzed for the SLC6A18- MS2 site. In the analysis of hypertensive patients, three alleles of about 300 bp, about 330 bp, and about 350 bp were identified, indicating that the 15 bp repeat units were repeated 13, 15, and 16 times (Table 13).

Hypertension specific polymorphism so-called analysis of SLC6A18- MS2 Normal people High blood pressure Repeat Unit × Repeat Number N = 600 Frequency N = 410 Frequency 15 × 13 274 0.457 183 0.446 15 × 15 107 0.178 63 0.154 15 × 16 219 0.365 164 0.400

(3) SLC6A18- MS4 (minisatellite 4)

300 normal and 205 hypertensive patients were analyzed for the SLC6A18- MS4 site. In the analysis of hypertensive patients, six alleles of about 580, about 620, about 650, about 800, about 830, and about 1050 bp were identified, which consisted of 13, 14, 15, and 19 repeats of 36 bp. , Repeated 20 and 26 times in size (Table 14). The frequency of occurrence of rare alleles (Nos. 15 and 19) in normal subjects and patients, respectively, increased from 0.7% to 2.4%. Statistical analysis of this value showed that the odds ratio (OR) was 3.725 (95% confidence interval) and the P value was 0.018. This means that the risk of developing hypertension increases by 3.7 times or more with rare forms.

Hypertension specific polymorphism so-called analysis of SLC6A18- MS4 Normal people High blood pressure Repeat Unit × Repeat Number N = 600 Frequency N = 410 Frequency 36 × 13 17 0.028 15 0.037 36 × 14 560 0.933 373 0.910 36 × 15 ㆍ ㆍ One 0.002 36 × 19 4 0.007 9 0.022 36 × 20 19 0.032 12 0.029

(4) SLC6A18- MS6 (minisatellite 6)

300 normal and 205 hypertensive patients were analyzed for the SLC6A18- MS6 site. In the analysis of hypertensive patients, four alleles of about 320, 350, 380, and 410 bp were identified, indicating that 30 bp repeat units were repeated 7, 8, 9 and 10 times. Table 15.

Hypertension specific polymorphism so-called analysis of SLC6A18- MS6 Normal people High blood pressure Repeat Unit × Repeat Number N = 600 Frequency N = 410 Frequency 30 × 7 21 0.035 16 0.039 30 × 8 206 0.343 150 0.366 30 × 9 371 0.618 243 0.593 30 × 10 2 0.003 One 0.002

Example 5 Correlation Analysis of Rare Allele Retention and Hypertension in the SLC6A18- MS4 Region

We analyzed the rare allele and susceptibility to disease occurrence, which occur in less than 1% of the normal population. The patterns in which the alleles appeared were divided, and the patterns consisting of common alleles were compared to C / C, and the patterns having at least one or more rare alleles were divided by R / −.

As a result, as shown in Table 16, the SLC6A18- MS4 showed about 2 times higher R /-pattern than normal in Parkinson's patients and about 3.8 times higher than normal in hypertensive patients. Therefore, it was found that the rare allele of SLC6A18- MS4 showed about 2 times more susceptibility to Parkinson than normal and about 3.8 times more susceptible to hypertension than normal.

These results suggest that SLC6A18- MS4 is an important marker for investigating susceptibility to diseases such as Parkinson's and hypertension and can be used as an important data for predictive diagnosis.

Comparison of Rare Allele Patterns of SLC6A18- MS4 Between Normals and Diseases Normal people Parkinson Hypertension patients pattern N % N % N % SLC6A18 -MS4 C / C 296 98.7 230 97.0 195 95.1 R /- 4 1.3 7 3.0 10 4.9

C: common allele, R: rare allele,

-: common allele or rare allele

As described in detail above, the polymorphic so-called SLC6A18- MS1, SLC6A18- MS2, SLC6A18- MS4, SLC6A18- MS5, and SLC6A18- MS6 in the SLC6A18 gene according to the present invention are transferred through meiosis according to the Mendelian inheritance. DNA typing can be used effectively for paternity, kinship, or forensic assessment of individuals, and by amplifying the SLC6A18- MS4 region, the susceptibility to disease can be diagnosed by comparing the population frequency of rare alleles with normal individuals.

The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Dong-A University Research Foundation For Industry-Academy Cooperation <120> DNA Typing Kits and Diagnostic Kits for Detecting Diseases          Related Microsatellites of SLC6A18 Gene <130> P06-B293 <160> 24 <170> KopatentIn 1.71 <210> 1 <211> 72 <212> DNA <213> Homo sapiens <400> 1 ttcctacgga caggtcacct ccgctttgca tggaagaatc tggatgctta cattaaactg 60 gtgttctgag ag 72 <210> 2 <211> 15 <212> DNA <213> Homo sapiens <400> 2 acgccttgcc cgccg 15 <210> 3 <211> 50 <212> DNA <213> Homo sapiens <400> 3 attcacagaa aaccctctca tctcctctcc cctaaacaca gaaaccctca 50 <210> 4 <211> 36 <212> DNA <213> Homo sapiens <400> 4 ctcacggtgc aggctggagg ggagggaaga ggggct 36 <210> 5 <211> 37 <212> DNA <213> Homo sapiens <400> 5 ggggcctcag gaaagaggtc aggtttggag tgagcct 37 <210> 6 <211> 30 <212> DNA <213> Homo sapiens <400> 6 cgtccacacg atcccaacag gggcaggagg 30 <210> 7 <211> 40 <212> DNA <213> Homo sapiens <400> 7 gagcccacag caggggaagc tgcccaccta agcgtgtccc 40 <210> 8 <211> 97 <212> DNA <213> Homo sapiens <400> 8 cagagcctgg agggtggagt ggagggaggg gtgcttcccc aaaggaaagc ctccagaagc 60 caaagcaaca gctgcgttcc atggtgtcac caactca 97 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS1 Forward Primer <400> 9 atcgcagcca aaggcagtcg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS1 Reverse Primer <400> 10 ggggtgctgg aagggacgat 20 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS2 Forward Primer <400> 11 ctttacccac caacgccttg ttc 23 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS2 Reverse Primer <400> 12 tgcaggcgct tagcaatggt aact 24 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS3 Forward Primer <400> 13 tgcagccgct gtaccacaga 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS3 Reverse Primer <400> 14 cgaagggaaa gatttgggga ga 22 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS4 Forward Primer <400> 15 cgaagccact actgcgggat g 21 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS4 Reverse Primer <400> 16 cagggccagg ctcccatgt 19 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS5 Forward Primer <400> 17 ctgggctgcc tggtggtcag 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS5 Reverse Primer <400> 18 cctgccccag accgaagtcc 20 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS6 Forward Primer <400> 19 ctaccagtgc cgccctgtca c 21 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS6 Reverse Primer <400> 20 tcatggccct ggttcccaaa c 21 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS7 Forward Primer <400> 21 aagcacgtgc accgctaccc 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS7 Reverse Primer <400> 22 tgcaggacgg agggacgaag 20 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS8 Forward Primer <400> 23 ggtgagatgc tcccccttca ga 22 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A18-MS8 Reverse Primer <400> 24 cgcccttggc agtgtttgct 20  

Claims (8)

Polymorphic minisatellites for personal identification markers selected from the group consisting of: (a) SLC6A18 represented by the nucleotide sequence of SEQ ID NO: 1 (solute carrier family 6, member 18) Polymorphism of the promoter region of the gene so-called SLC6A18- MS1 ( SLC6A18- ministallite1); (b) the polymorphic so-called SLC6A18- MS2 ( SLC6A18- ministallite2) of the intron 1 region in the SLC6A18 gene represented by the nucleotide sequence of SEQ ID NO: 2; (c) SLC6A18 represented by the nucleotide sequence of SEQ ID NO: 4 Polymorphic so-called SLC6A18- MS4 ( SLC6A18- ministallite4) of intron 1 region in the gene; (d) the polymorphic so-called SLC6A18- MS5 ( SLC6A18- ministallite5) of the intron 5 region in the SLC6A18 gene represented by the nucleotide sequence of SEQ ID NO: 5; And (e) Polymorphic so-called SLC6A18- MS6 ( SLC6A18- ministallite6) in the intron 7 region in the SLC6A18 gene represented by the nucleotide sequence of SEQ ID NO: 6. Primer set for polymorphic so-called detection for personal identification markers, characterized in that it is selected from the group consisting of: (a) a primer set for detecting polymorphic so-called SLC6A18- MS1 of the promoter region of the SLC6A18 gene, represented by the nucleotide sequences of SEQ ID NOs: 9 and 10; (b) a primer set for detecting polymorphic so-called SLC6A18- MS2 of intron 1 region in the SLC6A18 gene, represented by the nucleotide sequences of SEQ ID NOs: 11 and 12; (c) a primer set for detecting the polymorphic so-called SLC6A18- MS4 of the intron 1 region in the SLC6A18 gene, represented by the nucleotide sequences of SEQ ID NOs: 15 and 16; (d) a set of primers for detecting the polymorphic so-called SLC6A18- MS5 of intron 5 region in the SLC6A18 gene, represented by the nucleotide sequences of SEQ ID NOs: 17 and 18; And (e) A primer set for detecting the polymorphic so-called SLC6A18- MS6 of the intron 7 region in the SLC6A18 gene, which is represented by the nucleotide sequences of SEQ ID NOs: 19 and 20. delete The group consisting of SLC6A18 -MS6 of paragraph 2 of SEQ ID NO: 1 comprising the primer set SLC6A18 -MS1, SEQ ID NO: 2 in SLC6A18 -MS2, SEQ ID NO: 4 of SLC6A18 -MS4, SEQ ID NO: 5 and SEQ ID NO: 6 of SLC6A18 -MS5 DNA typing kit for detection of polymorphic so called polymorphism. DNA typing method comprising the following steps: (A) using the genomic DNA extracted from the tissue of the individual as a template, and performing a DNA polymerase chain reaction (PCR) using the kit of claim 4; And (b) SLC6A18 (solute carrier family 6, member 18) represented by the nucleotide sequence of SEQ ID NO: 1 by separating the PCR product by electrophoresis Polymorphism of the promoter region of the gene so-called SLC6A18- MS1 ( SLC6A18- ministallite1); Polymorphic so-called SLC6A18- MS2 ( SLC6A18- ministallite2) of the intron 1 region in the SLC6A18 gene represented by the nucleotide sequence of SEQ ID NO: 2; Polymorphic so-called SLC6A18- MS4 ( SLC6A18- ministallite4) of the intron 1 region in the SLC6A18 gene represented by the nucleotide sequence of SEQ ID NO: 4; Polymorphic so-called SLC6A18- MS5 ( SLC6A18- ministallite5) of the intron 5 region in the SLC6A18 gene represented by the nucleotide sequence of SEQ ID NO: 5; And a polymorphic so-called SLC6A18- MS6 ( SLC6A18- ministallite6) in the intron 7 region in the SLC6A18 gene represented by the nucleotide sequence of SEQ ID NO: 6. 6. The method of claim 5, wherein said DNA typing method is used for paternity, blood, or forensic assessment of an individual. Polynucleotides of the intron 1 region of the SLC6A18 gene, represented by the nucleotide sequences of SEQ ID NOs: 15 and 16, include primer sets for the detection of polymorphic so-called SLC6A18- MS4, DNA polymerases and dNTPs (dGTP, dCTP, dATP and dTTP) Diagnostic kit of SLC6A18 related disease. The method of claim 7, wherein the SLC6A18 Diagnosis kit of SLC6A18 related disease, characterized in that the disease is Parkinson's disease or hypertension.

Images