KR100861384B1 - DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Microsatellites of SLC6A19 Gene - Google Patents

Abstract

The present invention relates to the polymorphism of the SLC6A19 gene and DNA typing kit and diagnostic kit using the same. More specifically, the SLC6A19 is a neutral amino acid transporter that can be used as a personal identification marker. It relates to a polymorphic so called polymorphism in the gene, a primer set for detecting the polymorphic so called polymorphism, a DNA typing kit using the primer set and a diagnostic kit for SLC6A19 gene-related diseases.

Since SLC6A19- MS1, SLC6A19- MS4, and SLC6A19- MS7 of the present invention are transmitted through meiosis according to the Mendelian heredity, DNA typing thereof can be effectively used for paternity identification, kinship identification, or forensic emotion of an individual . Disease susceptibility can be diagnosed by amplifying the MS1 and SLC6A19- MS7 regions to compare the population frequency of the rare alleles with normal individuals.

SLC6A19, Polymorphic Enzyme, DNA Typing, Hypertension, Alzheimer's, Disease Diagnosis

Description

DNA Typing Kits and Diagnostic Kits for Detecting Diseases Related to Microsatellites of SLC6A19 Gene}

Figure 1 shows the position and orientation of the SLC6A18 gene located on human chromosome 5, showing the SLC6A19 gene on the 5p15.3 chromosome, showing the structure of the SLC6A19 gene and the location of the so-called (minisatellite (MS)) in the gene. Schematic diagram.

FIG. 2 is an electrophoretic photograph showing polymorphism of SLC6A19- MS1.

Figure 3 is an electrophoretic picture showing the polymorphism of SLC6A19- MS4.

4 is an electrophoretic photograph showing the polymorphism of SLC6A19- MS7.

FIG. 5 is an electrophoretic photograph showing that SLC6A19- MS1, SLC6A19- MS4, and SLC6A19- MS7 are genetically transmitted between parent and offspring. The first and last lanes are size markers. GF or GM means grandfather or grandmother, F or M means father or mother, and DNA samples of offspring are indicated as C1 and C2.

The present invention relates to the polymorphism of the SLC6A19 gene and DNA typing kit and diagnostic kit using the same. More specifically, the present invention relates to a neutral amino acid transporter, which can be used as a personal identification marker. The present invention relates to a polymorphic so called polymorphism in the SLC6A19 gene, a primer set for detecting the polymorphic soot polysaccharide , a DNA typing kit using the primer set, and a diagnostic kit for SLC6A19 gene related diseases.

In the vertebrate genome, the genes encoding the membrane proteins form one of the largest groups. In humans and mice, membrane proteins make up more than 10% of all genes, including G-protein receptors, kinase receptors, ion channels and solute carriers. Among the membrane proteins, a solute carrier (SLC) regulates sugar, amino acids, nucleotides and inorganic ions to pass through the cell membrane passively or actively. Currently there are 43 different groups of solute carriers (SLC), among which the proteins of the SLC6 group serve as specific carriers of neurotransmitters, amino acids and osmolytes. Neurotransmitters in the nervous system regulate many physiological phenomena. In particular, they are involved in various pathological processes of the brain in relation to the brain and are associated with diseases such as Parkinson's disease, depression, epilepsy and drug abuse. The SLC6 group is subdivided into four categories : gamma-aminobutyric acid (GABA), monoamine (monoamine), amino acid (amino acid) and orphan.

SLC6A19 (solute carrier family 6, member 18) corresponds to the allan group, SLC6A18 (solute carrier family 6, member 18) And SLC6A20 (solute carrier family 6, member 20) at 5p15.3. Polymorphism of the neurotransmitter dopamine-related gene has been reported to be associated with hypertension (Mikano Sato, et al., Hypertension 36: 183, 2000). SLC6A18 and SLC6A19 are highly expressed in the whole brain, which may affect diseases related to several neurotransmitters. Mutations in the SLC6A19 gene are known to cause Hartnup disorder (Heng F Seow, et al., Nature genetics 36 (9): 1003-1007, 2004), and recently other genes in the SLC6 family. SNPs (monobasic polymorphisms) have been reported to be associated with hypertension (Koh Ono, et al., Hypertens Res. 26 (9): 685, 2003).

Tandem repeat (TR) sequences, on the other hand, account for more than 10% of the human genome, are responsible for various diseases and are very important factors in the regulation and evolution of gene expression. TR sequences are divided into monomorphic ones with only one allele and polymorphic ones with two or more alleles depending on their length. Polymorphic so-called repeat sequences have important significance as genomic markers that can be used for human genome mapping in early genome research.

Therefore, in the art, the analysis of TR in a very structurally complex gene, the discovery of polymorphic so-called polymorphisms, and research on the relationship with diseases have become very important research fields, and there is an urgent need for continuous development.

Accordingly, the present inventors have analyzed the location of the polymorphic solitary (minisatellite (MS)) of SLC6A19 as a result of diligent efforts to discover TR analysis and polymorphic so-called somaticity in the gene and to study the association with the polymorphic so-called disease. It has been confirmed that some of the so-called melodies are transmitted through meiosis according to the Mendelian heredity, thus completing the present invention.

After all, the main object of the present invention is to provide a polymorphic minisatellites that can be used as a personal identification marker and a primer set for detecting the polymorphic soot.

Another object of the present invention is to provide a DNA typing kit and a DNA typing method useful for paternity identification, kinship identification or forensic evaluation of an individual using the primer set.

Still another object of the present invention is to provide a diagnosis kit of a disease for diagnosing SLC6A19- related diseases using the primer set.

In order to achieve the above object, the present invention (a) polymorphic so-called SLC6A19 -MS1 ( SLC6A19 -ministallite1) of the promoter region of the SLC6A19 (solute carrier family 6, member 19) gene represented by the nucleotide sequence of SEQ ID NO: 1 ); (b) SLC6A19 represented by the nucleotide sequence of SEQ ID NO: 4 Polymorphic so-called SLC6A19- MS4 ( SLC6A19- ministallite4) in the intron 9 region in the gene; And (c) a polymorphic so-called SLC6A19- MS7 ( SLC6A19- ministallite7) in the intron 18 region in the SLC6A19 gene represented by the nucleotide sequence of SEQ ID NO: 7. provide minisatellites).

The invention also relates to the polymorphic so-called SLC6A19- MS1, SLC6A19 of the promoter region of the SLC6A19 gene. Polymorphic so-called SLC6A19- MS4 and SLC6A19 in intron 9 region in the gene Provided is a primer set for detecting one of the so-called polymorphic so-called polymorphisms selected from the group consisting of the polymorphic so-called SLC6A19- MS7 of the intron 18 region in the gene.

In the present invention, the primer set comprises: (a) a primer set for detecting polymorphic so-called SLC6A19- MS1 of a promoter region of the SLC6A19 gene, represented by the nucleotide sequences of SEQ ID NOs: 8 and 9; (b) a set of primers for detecting the polymorphic so-called SLC6A19- MS4 of the intron 9 region in the SLC6A19 gene represented by the nucleotide sequences of SEQ ID NOs: 14 and 15; And (c) a polymorphic so-called SLC6A19- MS7 detection primer set in the intron 18 region in the SLC6A19 gene represented by the nucleotide sequences of SEQ ID NOs: 20 and 21. .

The present invention also provides a DNA typing kit for detecting polymorphic so-called polymorphism selected from the group consisting of SLC6A19- MS1 of SEQ ID NO: 1, SLC6A19 -MS4 of SEQ ID NO: 4, and SLC6A19 -MS7 of SEQ ID NO: 7 comprising the primer set. to provide.

The present invention also comprises the steps of (a) using genomic DNA extracted from the tissue of a subject as a template, and performing a DNA polymerase chain reaction (PCR) using the kit; And (b) separating the PCR product by electrophoresis to identify one selected from the group consisting of SLC6A19- MS1, SLC6A19- MS4, and SLC6A19- MS7.

In the present invention, the DNA typing method may be used for paternity identification, kinship identification or forensic emotion of an individual.

The present invention, also SLC6A19, SEQ ID NO: 8 and a promoter, SLC6A19 gene represented by the base sequence of 9 (promotor) represented by the base sequence of the polymorphic small satellite SLC6A19 -MS1 primer sets for the detection or SEQ ID NO: 20 and 21 in the region Provided are diagnostic kits for SLC6A19- related diseases, including primer sets for detecting polymorphic so-called SLC6A19- MS7 in the intron 18 region of the gene, DNA polymerase and dNTPs (dGTP, dCTP, dATP and dTTP).

In the present invention, the SLC6A19 Related diseases may be characterized as being Alzheimer's or hypertension.

Hereinafter, the present invention will be described in detail.

SLC6A19 is located on 5p15.3 region with its olpan the group, and SLC6A18 and SLC6A20. SLC6A18 and SLC6A19 are highly expressed in the whole brain, which may affect diseases related to several neurotransmitters. Such SLC6 has a number of tandem repeat (TR) sequences.

FIG. 1 shows the band structure of human chromosome 5 by MAP Viewer of NCBI website. FIG. 1 shows the SLC6A19 gene on the 5p15.3 chromosome, the structure of the SLC6A19 gene and the so- called (minisatellite (MS)) gene. It shows the location of. Exons were marked with black lines and the locations of the so-called (minisatellite) detected by the Tandem Repeats Finder Program are marked with an asterisk (*).

Structural characteristics of the SLC6A19 (NC_000005 REGION: 1254766..1275019) gene were analyzed using BLAST, and SLC6A19 was composed of 21 exons of approximately 20 Kb in size and the location of the chain repeat region was 2 in the promoter region and within the gene. There were five.

In addition, among the chain repeat regions, SLC6A19- MS1, SLC6A19- MS4, and SLC6A19- MS7, which can be used as personal identification markers, can be used as personal identification markers. Diagnosis is possible.

SLC6A19 of the present invention has a high association with hypertension and also has characteristics for Alzheimer's. In particular, those with rare alleles in the SLC6A19- MS7 region had a P = 0.04, a 2.5 times higher risk of hypertension, and could be used as an important genetic disease diagnosis marker. Alzheimer's rare alleles have about two times the risk of developing them and their correlations can be considered.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1 Structural Analysis of SLC6A19 Gene and Polymorphism Analysis of So-called Minisatellite (MS)

Structural characteristics of the SLC6A19 (NC_000005 REGION: 1254766..1275019) gene were analyzed using BLAST. The location number of the indices shown in Table 1 shows the result of analysis in NC_000005 REGION. Examine the exon and intron regions present in the promoter region and open reading frame (ORF), determine the position of tandem repeats (TR) in each region, and then repeat The location of the so-called (minisatellite (MS)) having a sequence size of about 10 to 100 bp was analyzed.

As a result, SLC6A19 consisted of 21 exons of about 20 Kb in size, and the positions of the chain repeat regions were two in the promoter region and five in the gene, as shown in Table 2.

The polymorphic so called polymorphisms of the seven so-called (minisatellite, MS, Table 1) present in the SLC6A19 gene were analyzed by PCR. The base sequences of the primers used for PCR analysis are shown in Table 2 below.

Tandem repeat (TR) in the SLC6A19 gene SEQ ID NO: So-called (minisatellite) Indices location Repeat size Representative copy number Representative size (bp) SEQ ID NO: 1 SLC6A19 -MS1 1250024-1250974 Promoter 16 59.6 950 SEQ ID NO: 2 SLC6A19 -MS2 1251491-1253016 Promoter 14 108.9 1525 SEQ ID NO: 3 SLC6A19 -MS3 1262694-1262748 Intron 9 26 2.1 54 SEQ ID NO: 4 SLC6A19 -MS4 1263290-1263380 Intron 9 45 2.0 90 SEQ ID NO: 5 SLC6A19 -MS5 1264866-1265275 Intron 10 73 2.2 409 SEQ ID NO: 6 SLC6A19 -MS6 1266089-1266206 Intron 11 46 2.5 117 SEQ ID NO: 7 SLC6A19 -MS7 1272276-1272614 Intron 18 43 7.9 338

SEQ ID NO: order SEQ ID NO: 1 TTGGGTACTGTGGGAG SEQ ID NO: 2 CTCTCTGTCTCTCT SEQ ID NO: 3 CTCCCTCTCTCTTCCTCTCTCTCTCT SEQ ID NO: 4 GGCAGGCATGTGCCAGGAAGGTGTGAGCCGGGAAGGCGTGTACAG SEQ ID NO: 5 TGTGTGCTGTGTGTGTACATGCATGTGCGTGCATGTGAGCAGTGTGTGCATCTGAGCATGTGTGCTGTGTGTG SEQ ID NO: 6 GCCCCCCTCCCCACCCATCCCACATACCCAGCCGCCCGCAGGCCCT SEQ ID NO: 7 GCAGCCCCCGGGCGTGTGAACAGCTCTGTCCCCGGCCGTGCGT

Primers used to detect polymorphisms Polymorphic enamel primer SEQ ID NO: Sequence SLC6A19 - MS1 SLC6A19- MS1 F SEQ ID NO: 8 gggtgctgcaggatttgggta SLC6A19- MS1 R SEQ ID NO: 9 tcaggcccagcattcgtatatgt SLC6A19 - MS2 SLC6A19- MS2 F SEQ ID NO: 10 cctgggccagccactgactc SLC6A19- MS2 R SEQ ID NO: 11 cgagcacagcgcagattgga SLC6A19 - MS3 SLC6A19- MS3 F SEQ ID NO: 12 gcagagcccacaccctctcg SLC6A19- MS3 R SEQ ID NO: 13 ggggacagctaggcaggatgg SLC6A19 - MS4 SLC6A19 - MS4 F SEQ ID NO: 14 gctgcactgggcaggtgaga SLC6A19 - MS4 R SEQ ID NO: 15 tggctgggatgggctactcc SLC6A19 - MS5 SLC6A19 - MS5 F SEQ ID NO: 16 tgtgtgcatgcatggggtgt SLC6A19 - MS5 R SEQ ID NO: 17 cgtgcacatgaacacaggcaca SLC6A19 - MS6 SLC6A19 - MS6 F SEQ ID NO: 18 gcagcctgtgaggccctgtc SLC6A19 - MS6 R SEQ ID NO: 19 atatgggggcggggcatgt SLC6A19 - MS7 SLC6A19 - MS7 F SEQ ID NO: 20 catggcaatggtgccacctg SLC6A19 - MS7 R SEQ ID NO: 21 tgaggaatgtccccaggcaga

Using genomic DNA extracted from the blood of 100 adult men and women, the MS2 (minisatellite2) site in the promoter region, the MS3 (minisatellite3) site in the intron 9 region, intron, among the 7 TRs present in the SLC6A19 gene Alleles of the MS5 (minisatellite5) site located in region 10 (intron) and the MS6 (minisatellite6) site located in region 11 were compared using PCR.

Genomic DNA was subjected to standard PCR conditions (50 mM Tris-HCl (pH 9.0), 50 mM MgCl ₂ , 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP and 0.2 mM dATP, final volume 50 μl) to confirm that SLC6A19- MS2 was identified by SEQ ID NO: 10 and Amplification was carried out using primers 11, SLC6A19- MS3 using primers SEQ ID NOs: 12 and 13, SLC6A19- MS5 primers SEQ ID NOs: 16 and 17, and SLC6A19- MS6 primers SEQ ID NOs: 18 and 19.

PCR analysis of DNA samples was performed using Promega GoTaq Flexi DNA polymerase (Promega) with 100 ng of genomic DNA as a template. The conditions of the cycle were heat treated once at 94 ° C. for 2 minutes for SLC6A19- MS2, SLC6A19- MS3 and SLC6A19- MS6, followed by 30 cycles of 30 seconds at 94 ° C, 20 seconds at 65 ° C and 30 seconds at 72 ° C. The last extension step was then extended at 72 ° C. for 7 minutes. For SLC6A19- MS5, one heat treatment was performed at 94 ° C. for 2 minutes, followed by 30 cycles of 45 seconds at 94 ° C. and 2 minutes at 68 ° C., followed by a final extension of 7 minutes at 72 ° C.

The PCR product was injected into 1.5% SeaKem LE agarose gel for SLC6A19- MS3, 1% SeaKem LE agarose gel for SLC6A19- MS2, SLC6A19- MS5 and SLC6A19- MS6, and electrophoresis in TAE buffer ( 1 volt / cm). As a result, SLC6A19- MS2, SLC6A19- MS3, SLC6A19- MS5, and SLC6A19- MS6 exhibited monomorphism , and thus cannot be used as personal identification markers.

Genomic DNA extracted from the blood of 100 adult males and females was used to locate SLC6A19- MS1 located in the promoter region, SLC6A19- MS4 located in the region 9 and intron 18, among the 7 TRs present in the SLC6A19 gene. Allele aspects of SLC6A19- MS7 were compared using PCR.

SLC6A19- MS1 genomic DNA under standard PCR conditions (50 mM Tris-HCl (pH 9.0), 50 mM MgCl 2, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP and 0.2 mM dATP, final volume 50 ㎕) is SEQ ID NO: The primers 8 and 9, SLC6A19- MS4 were amplified using the primers SEQ ID NOs: 14 and 15, and the SLC6A19- MS7 primers SEQ ID NOs: 20 and 21.

PCR analysis of DNA samples was performed using Promega GoTaq Flexi DNA polymerase (Promega) with 100 ng of genomic DNA as a template. The conditions of the cycle were heat treated once for 2 minutes at 94 ° C for SLC6A19- MS1, SLC6A19- MS4 and SLC6A19- MS7, followed by 30 cycles of 30 seconds at 94 ° C, 20 seconds at 65 ° C and 30 seconds at 72 ° C. The last extension step was then extended at 72 ° C. for 7 minutes.

The PCR product was injected into 2% SeaKem LE agarose gel for SLC6A19- MS1, 2.5% SeaKem LE agarose gel for SLC6A19- MS4, and 1.5% SeaKem LE agarose gel for SLC6A19- MS7, and then Analysis was carried out by electrophoresis (1 volt / cm). As a result, all of them showed polymorphism so-called that it can be used as a personal identification marker. Therefore, the following further analysis was carried out by increasing the population (Tables 3 to 12). In this case, N is the number of alleles, and each person has two alleles, which is twice the number of samples.

(1) SLC6A19- MS1 (minisatellite 1)

As a result of 300 normal subjects, four alleles of about 830bp, 960bp, about 1000bp, and about 1030bp were identified, indicating that the 16bp repeat units were repeated 49, 57, 60 and 61 times. So-called affinity was confirmed (Table 3, FIG. 2). Figure 2 shows the polymorphic so called, various bands appeared in the sample (1 ~ 19).

Polymorphic So-called Analysis of SLC6A19 - MS1 Repeat Unit × Repeat Number N = 600 ** frequency 16 × 49 168 0.280 16 × 57 2 0.003 16 × 60 182 0.303 16 × 61 248 0.413

** Calculated as "frequency = N value / total N value", if the value is less than 0.01, it is a rare polymorphic so called.

(2) SLC6A19- MS4 (minisatellite 4)

As a result of 300 normal subjects, two alleles of about 210 bp and about 230 bp were identified, which showed that the 45 bp repeating unit was repeated 2 and 2.5 times, thereby confirming the polymorphic so called (Table 4, FIG. 3). . Figure 3 shows the polymorphic so called, various bands appeared in the sample (1 ~ 19).

Polymorphic So-called Analysis of SLC6A19- MS4 Repeat Unit × Repeat Number N = 600 ** frequency 45 × 2 248 0.413 45 × 2.5 352 0.587

** Calculated as "frequency = N value / total N value", if the value is less than 0.01, it is a rare polymorphic so called.

(3) SLC6A19- MS7 (minisatellite 7)

As a result of 300 normal subjects, five alleles of about 320bp, about 360bp, about 400bp, about 450bp, and about 660bp were identified, which means that the repeat units of 43bp were 6, 7, 8, 9 and 14 times. Polymorphic enantiomer was confirmed (Table 5, Fig. 4). Figure 4 shows the polymorphic so called, various bands appeared in the sample (1 ~ 29).

Polymorphic So-called Analysis of SLC6A19- MS7 Repeat Unit × Repeat Number N = 600 Frequency 43 × 6 8 0.013 43 × 7 One 0.002 43 × 8 584 0.973 43 × 9 One 0.002 43 × 14 6 0.010

** Calculated as "frequency = N value / total N value", if the value is less than 0.01, it is a rare polymorphic so called.

Example 2: Determining the Genetic Delivery of Polymorphic Sociability (minisatellite, MS) through meiosis

Mendel's process of transferring the genetic traits from the father to the offspring, one by one, is called Mendel's genetic law, which enables paternity between parents and offspring. Alleles in the tandem repeats (TR) region consisted of two alleles inherited from the parent, confirming that they are transmitted to the offspring through meiosis. Genomic DNA was extracted from blood of grandparents, parents, and offspring, and the alleles of SLC6A19- MS1, SLC6A19- MS4, and SLC6A19- MS7 were confirmed using PCR in the same manner as in Example 1.

As a result, as shown in FIG. 5, SLC6A19- MS1, SLC6A19- MS4, and Both SLC6A19- MS7 genes were correctly transmitted through meiosis between parents and offspring. It is inherited by Mendel's law and indicates that it can be used as an efficient marker for identification, paternity, kinship, or forensic emotions, and DNA typing markers can be used to determine whether the same disease occurs in a family. It means you can investigate.

Example 3 Determination of Association with Alzheimer's Disease in the SLC6A19- MS1, SLC6A19- MS4, and SLC6A19- MS7 Regions

Reported that the structural characteristics of tandem repeats (TR) are involved in the expression of genes, the report is centered on h-Ras. In the present invention, in order to investigate the effect on the gene expression of the TR region of the SLC6A19 gene, the genomic DNA of a normal person and Alzheimer's patient was extracted and subjected to PCR in the same manner as in Example 1 to obtain a haplotype pattern between a normal person and an Alzheimer's patient ( haplotype pattern) was analyzed.

(1) SLC6A19- MS1 (minisatellite 1)

300 normal and 86 Alzheimer's patients were analyzed for the SLC6A19- MS1 site. In the analysis of Alzheimer's patients, four alleles of about 800bp, about 830bp, about 960bp, about 1000bp and about 1030b799bp, 983bp, 1000bp and 1017bp were identified, which means that the repeat units of 16bp were 49, 56 and 60 times. And repeated 61 times, confirming the polymorphic so called (Table 6). As a result, it was confirmed that the frequency of occurrence of rare alleles increased from 0.3% to 0.6% compared to normal people. In other words, in the Alzheimer's group of patients, the risk is about two times higher.

SLC6A19 - Alzheimer's Disease Specific Polymorphism So-called Analysis of MS1 Normal people Alzheimer's disease Repeat Unit × Repeat Number N = 600 Frequency N = 172 Frequency 16 × 49 168 0.280 45 0.262 16 × 57 2 0.003 One 0.006 16 × 60 182 0.303 48 0.279 16 × 61 248 0.413 78 0.453

(2) SLC6A19- MS4 (minisatellite 4)

300 normal and 86 Alzheimer's patients were analyzed for the SLC6A19- MS4 site. In the analysis of Alzheimer's patients, two alleles of size 209 and 231 bp were identified, indicating that the 45 bp repeat unit was repeated 2 and 2.5 times, confirming the polymorphic so called (Table 7).

Alzheimer's disease-specific polymorphism so-called analysis of SLC6A19 - MS4 Normal people Alzheimer's disease Repeat Unit × Repeat Number N = 600 Frequency N = 172 Frequency 45 × 2 248 0.413 71 0.413 45 × 2.5 352 0.587 101 0.587

(3) SLC6A19 - MS7 (minisatellite 7)

300 normal and 86 Alzheimer's patients were analyzed for the SLC6A19- MS7 site. In the analysis of Alzheimer's patients, four alleles of about 320bp, about 360bp, about 400bp, and about 660bp were identified, indicating that 43bp repeat units were repeated 6, 7, 8, and 14 times. Satellites were identified (Table 8). Comparison of the frequency of occurrence of the rare alleles (Nos. 7, 9, 14) between normal and patient in this area showed an increase from 1.4% to 2.9%, twice as high as those with genetic rare features in this area. The risk of abnormalities was found to increase.

Alzheimer's Disease-Specific Polymorphism So-called Analysis of SLC6A19 - MS7 Normal people Alzheimer's disease Repeat Unit × Repeat Number N = 600 Frequency N = 172 Frequency 43 × 6 8 0.013 4 0.023 43 × 7 One 0.002 One 0.006 43 × 8 584 0.973 163 0.948 43 × 9 One 0.002 ㆍ ㆍ 43 × 14 6 0.010 4 0.023

Example 4 Determination of Association with Hypertension in the SLC6A19- MS1, SLC6A19- MS4, and SLC6A19- MS7 Regions

Reported that the structural characteristics of tandem repeats (TR) are involved in the expression of genes, the report is centered on h-Ras. In the present invention, in order to investigate the effect on the gene expression of the TR region of the SLC6A19 gene, the genomic DNA of a normal person and Alzheimer's patient was extracted and subjected to PCR in the same manner as in Example 1 to obtain a haplotype pattern between a normal person and a hypertensive patient ( haplotype pattern) was analyzed.

(1) SLC6A19- MS1 (minisatellite 1)

Rare alleles of SLC6A19- MS1 increase susceptibility to hypertension. 300 normal and 205 hypertensive patients were analyzed for the SLC6A19- MS1 site. In the analysis of hypertensive patients, four alleles of about 820, 800, 980, 1000, and 1020 bp were identified, with 16, 48, 49, 56, 60, and 61 repeats. It was found to be repeated, confirming the polymorphic so called. In particular, samples of hypertensive patients found 48 repeated hypertension specific alleles that did not appear in normal subjects. Thus, it was found that the rare allele is associated with hypertension (Table 9).

Hypertension specific polymorphism so-called analysis of SLC6A19- MS1 Normal people High blood pressure Repeat Unit × Repeat Number N = 600 Frequency N = 410 Frequency 16 × 48 ㆍ ㆍ 2 0.005 16 × 49 168 0.280 127 0.310 16 × 57 2 0.003 2 0.005 16 × 60 182 0.303 104 0.254 16 × 61 248 0.413 175 0.427

(2) SLC6A19- MS4 (minisatellite 4)

300 normal and 205 hypertensive patients were analyzed for the SLC6A19- MS4 site. In the analysis of hypertensive patients, two alleles of about 210 bp and about 230 bp were identified, which showed that the 45 bp repeating unit was repeated 2 and 2.5 times, thereby confirming the polymorphic polymorphism (Table 10).

Hypertension specific polymorphism so-called analysis of SLC6A19- MS4 Normal people High blood pressure Repeat Unit × Repeat Number N = 600 Frequency N = 410 Frequency 45 × 2 248 0.413 166 0.405 45 × 2.5 352 0.587 244 0.595

(3) SLC6A19- MS7 (minisatellite 7)

300 normal and 205 hypertensive patients were analyzed for the SLC6A19- MS7 site. In analysis of hypertensive patients, four alleles of about 320 bp, about 360 bp, about 400 bp, and about 660 bp were identified, indicating that 43 bp repeat units were repeated 6, 7, 8, and 14 times. Satellites have been identified (Table 11). In other words, the frequency of occurrence of rare alleles in normal subjects and patients increased from 1.4% to 3.2%. Statistical analysis of the values showed that the odds ratio (OR) was 2.423 (95% confidence interval), and the P value was significantly 0.04. In other words, it can be seen that the risk increases more than twice when the rare type is present.

Hypertension specific polymorphism so-called analysis of SLC6A19- MS7 Normal people High blood pressure Repeat Unit × Repeat Number N = 600 Frequency N = 410 Frequency 43 × 6 8 0.013 8 0.020 43 × 7 One 0.002 5 0.012 43 × 8 584 0.973 389 0.949 43 × 9 One 0.002 ㆍ ㆍ 43 × 14 6 0.010 8 0.020

Example 5: Analysis of association of Alzheimer's and hypertension in SLC6A19- MS7 region

We analyzed rare alleles and susceptibility to disease occurrence, which occur in less than 1% of the normal population. The patterns in which the alleles appeared were divided, and the patterns consisting of common alleles were compared to C / C, and the patterns having at least one or more rare alleles were divided by R / −.

As a result, as shown in Table 12, in the case of SLC6A19- MS7, the R /-pattern in Alzheimer's and hypertension patients was two times higher than normal. Therefore, it was found that the rare allele of SLC6A19- MS7 was more than twice as sensitive to Alzheimer's and hypertension than normal.

From the above results, SLC6A19- MS7 is an important marker to investigate the susceptibility to diseases such as Alzheimer's and hypertension, it can be seen that it can be used as an important data for predictive diagnosis.

Comparison of patterns of genotypes with one or more rare alleles of SLC6A19- MS7 between normal and disease Normal people Alzheimer's Patients Hypertension patients SLC6A19 -MS7 C / C 292 97.3 81 94.2 192 93.7 R /- 8 2.7 5 5.8 13 6.3

C: common allele, R: rare allele,

-: common allele or rare allele

As described in detail above, the polymorphic so-called SLC6A19- MS1, SLC6A19- MS4, and SLC6A19- MS7 in the SLC6A19 gene according to the present invention are transmitted through meiosis according to the Mendelian inheritance, thereby identifying the paternity of the individual by DNA typing, It can be effectively used for blood clarification or forensic emotions, and by amplifying the SLC6A19 -MS1 and SLC6A19 -MS7 regions, the frequency of rare alleles can be compared to normal individuals to diagnose disease susceptibility to diseases. Investigators can predict the likelihood of disease development and use it in advanced methods of preventive medicine. It can also be an important resource for the selection of the appropriate drug based on differences in each genotype.

The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Dong-A University Research Foundation For Industry-Academy Cooperation <120> DNA Typing Kits and Diagnostic Kits for Detecting Diseases          Related to Microsatellites of SLC6A19 Gene <130> P07-B011 <160> 21 <170> KopatentIn 1.71 <210> 1 <211> 16 <212> DNA <213> Homo sapiens <400> 1 ttgggtactg tgggag 16 <210> 2 <211> 14 <212> DNA <213> Homo sapiens <400> 2 ctctctgtct ctct 14 <210> 3 <211> 26 <212> DNA <213> Homo sapiens <400> 3 ctccctctct cttcctctct ctctct 26 <210> 4 <211> 45 <212> DNA <213> Homo sapiens <400> 4 ggcaggcatg tgccaggaag gtgtgagccg ggaaggcgtg tacag 45 <210> 5 <211> 73 <212> DNA <213> Homo sapiens <400> 5 tgtgtgctgt gtgtgtacat gcatgtgcgt gcatgtgagc agtgtgtgca tctgagcatg 60 tgtgctgtgt gtg 73 <210> 6 <211> 46 <212> DNA <213> Homo sapiens <400> 6 gcccccctcc ccacccatcc cacataccca gccgcccgca ggccct 46 <210> 7 <211> 43 <212> DNA <213> Homo sapiens <400> 7 gcagcccccg ggcgtgtgaa cagctctgtc cccggccgtg cgt 43 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS1 Forward Primer <400> 8 gggtgctgca ggatttgggt a 21 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS1 Reverse Primer <400> 9 tcaggcccag cattcgtata tgt 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS2 Forward Primer <400> 10 cctgggccag ccactgactc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS2 Reverse Primer <400> 11 cgagcacagc gcagattgga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS3 Forward Primer <400> 12 gcagagccca caccctctcg 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS3 Reverse Primer <400> 13 ggggacagct aggcaggatg g 21 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS4 Forward Primer <400> 14 gctgcactgg gcaggtgaga 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS4 Reverse Primer <400> 15 tggctgggat gggctactcc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS5 Forward Primer <400> 16 tgtgtgcatg catggggtgt 20 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS5 Reverse Primer <400> 17 cgtgcacatg aacacaggca ca 22 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS6 Forward Primer <400> 18 gcagcctgtg aggccctgtc 20 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS6 Reverse Primer <400> 19 atatgggggc ggggcatgt 19 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS7 Forward Primer <400> 20 catggcaatg gtgccacctg 20 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC6A19-MS7 Reverse Primer <400> 21 tgaggaatgt ccccaggcag a 21  

Claims (8)

Polymorphic minisatellites for personal identification markers selected from the group consisting of: (a) the polymorphic so-called SLC6A19- MS1 ( SLC6A19- ministallite1) of the promoter region of the SLC6A19 (solute carrier family 6, member 19) gene represented by the nucleotide sequence of SEQ ID NO: 1; (b) the polymorphic so-called SLC6A19- MS4 ( SLC6A19- ministallite4) of the intron 9 region in the SLC6A19 gene represented by the nucleotide sequence of SEQ ID NO: 4; And (c) polymorphic so-called SLC6A19- MS7 ( SLC6A19- ministallite7) of the intron 18 region in the SLC6A19 gene represented by the nucleotide sequence of SEQ ID NO: 7. Primer set for polymorphic so-called detection for personal identification markers, characterized in that it is selected from the group consisting of: (a) a primer set for detecting polymorphic so-called SLC6A19- MS1 of a promoter region of the SLC6A19 gene, represented by the nucleotide sequences of SEQ ID NOs: 8 and 9; (b) a set of primers for detecting the polymorphic so-called SLC6A19- MS4 of the intron 9 region in the SLC6A19 gene represented by the nucleotide sequences of SEQ ID NOs: 14 and 15; And (c) A primer set for detecting the polymorphic so-called SLC6A19- MS7 of intron 18 region in the SLC6A19 gene, which is represented by the nucleotide sequences of SEQ ID NOs: 20 and 21. delete A DNA typing kit for polymorphic so called detection selected from the group consisting of SLC6A19- MS1 of SEQ ID NO: 1, SLC6A19- MS4 of SEQ ID NO: 4, and SLC6A19 -MS7 of SEQ ID NO: 7 comprising the primer set of claim 2. DNA typing method comprising the following steps: (A) using the genomic DNA extracted from the tissue of the individual as a template, and performing a DNA polymerase chain reaction (PCR) using the kit of claim 4; And (b) polymorphic so-called SLC6A19- MS1 ( SLC6A19- ministallite1) of the promoter region of the SLC6A19 (solute carrier family 6, member 19) gene represented by the nucleotide sequence of SEQ ID NO: 1 by electrophoresis. ; Polymorphic so-called SLC6A19- MS4 ( SLC6A19- ministallite4) of the intron 9 region in the SLC6A19 gene represented by the nucleotide sequence of SEQ ID NO: 4; And a polymorphic so-called SLC6A19- MS7 ( SLC6A19- ministallite7) in the intron 18 region in the SLC6A19 gene represented by the nucleotide sequence of SEQ ID NO: 7. 6. The method of claim 5, wherein said DNA typing method is used for paternity, blood, or forensic assessment of an individual. SEQ ID NO: 8, and polymorphism of the promoter (promotor) in the area, SLC6A19 gene represented by the base sequence of 9 cows satellite SLC6A19 -MS1 detection primer set or SEQ ID NO: intron (intron in the SLC6A19 gene, represented by the nucleotide sequences of 20 and 21 A diagnostic kit for SLC6A19- related diseases comprising a primer set for detecting polymorphic so- called SLC6A19- MS7 in region 18, a DNA polymerase and dNTP (dGTP, dCTP, dATP and dTTP). The method of claim 7, wherein the SLC6A19 SLC6A19, characterized in that the disease involved is Alzheimer's or hypertension Related Disease Diagnosis Kits.

Images