KR101493392B1 - Sensitivity enhancement of bioreporter strains using serum complement - Google Patents

Abstract

The present invention relates to a technique for enhancing the sensitivity of a bio-reporter strain using a serum complement.

Description

[0002] Sensitivity enhancement of bioreporter strains using serum complement,

The present invention relates to a technique for enhancing the sensitivity of a bio-reporter strain using a serum complement.

Through industrial activities, we emit vast quantities of pollutants every day and also produce new kinds of chemicals. However, an accurate analysis of the effects of these substances on living organisms is yet to be made, and toxicological analyzes of these emissions are urgently required. Conventional chemical analysis methods used to detect chemical toxins provide information on the concentration of toxic substances, but they do not provide information on toxicity that directly affects life. To overcome these shortcomings of chemical analysis, bioreporter technology using biological mediators.

Detection of chemical toxins using bio-reporters can be useful for environmental toxicity analysis because it can perform toxicity-based analysis that has a direct effect on living organisms. Various environmental biopo reporters such as fish, rodents, seaweed, and bacteria have been developed and used. Among them, bioreporters using recombinant light emitting bacteria have attracted attention. Because recombinant DNA technology uses a promoter that is specific to specific toxins, it is possible to produce recombinant light-emitting bacteria using various promoters, and the luminescent bacteria thus produced can be used for environmental pollution monitoring systems that detect water quality, soil and air pollution Or may be used to detect a variety of chemical toxicants, such as genotoxins, oxidative radicals, and phenolic compounds.

In this regard, Korean Patent Laid-Open Publication No. 2003-0040923 provides a recombinant light-emitting bacterial E. coli DH5 @ / pSodaLux (EBHJ1) for detection of harmfulness associated with oxidative damage, and Korean Patent Registration No. 10-0470960 discloses that katG :: luxCDABE And recA :: GFPuv4 genes simultaneously to detect both genetic damage and oxidative damage. Domestic patent registration No. 10-0355757 discloses that the luminescent microorganism is a soil using bacterial GC2 (lac :: luxCDABE) Toxicity detection technology for pollutants is provided.

Thus, bacterial bio-reporters generate a detectable signal by the action of a promoter activated by a specific stimulus, so it is important that a chemical capable of activating the promoter is introduced into the cell. Generally, the cell membrane has selective permeability There is a limit to the ability of chemicals outside of cells to migrate into cells. Thus, the selective sensitivity of such cell membranes ultimately lowers the detection sensitivity of bioreporters.

Accordingly, the present invention provides a technique for enhancing the sensitivity of a bacterial bio-reporter, and has found a novel use of a serum complement that enhances the sensitivity and reactivity of a bio-reporter strain, thereby completing the present invention.

It is an object of the present invention to provide a technique for enhancing the sensitivity of a bioreporter strain using serum complement.

More specifically, one object of the present invention is to provide a composition for enhancing the sensitivity of a bioreporter strain comprising a serum complement.

It is another object of the present invention to provide a method for enhancing the sensitivity of a bioreporter strain, comprising the step of treating the composition with a bioreporter strain.

It is another object of the present invention to provide a composition for detecting a chemotherapy drug in blood comprising a vector transformed with a vector comprising a recA promoter and a reporter gene operably linked to the promoter .

It is another object of the present invention to provide a microfluidic chip for detecting an anticancer chemotherapeutic agent in blood, which comprises the above composition.

The present invention is based on the discovery that serum complement significantly enhances the sensitivity and responsiveness of a bioraphoter strain and is characterized by providing a novel use of serum complement to enhance the sensitivity and responsiveness of the bioraphoter strain.

More specifically, in the present invention, chemical substances inducing a signal of a bioporter are limited to enter into cells due to selective permeability of the cell membrane of the bio-reporter strain, thereby overcoming the problem that the detection sensitivity of the bio-reporter strain is ultimately inferior A technique for enhancing the sensitivity and reactivity of a bioreporter strain using serum complement is provided.

According to the present invention, when a serum complement is added to a culture solution containing a bio-reporter strain, pores are formed in the cell membrane due to serum complement activity, so large-sized chemical substances can be easily introduced into cells through the cell membrane , The introduced chemicals can increase the expression of the intracellular luminescent gene, so that even a small amount of chemical substance can be detected quickly and accurately.

In a specific embodiment of the present invention, when a gene-damaging substance is added to a culture medium of a bio-reporter strain that detects a gene-damaging substance (for example, mitomycin C (MMC)), under the condition that serum is present, And the increase in the reactivity of the genetically damaging substance concentration was 120 times or more. In addition, the above-mentioned increase in the reactivity was not observed in serum in which all of the complement activation pathways were inactivated by treatment at 56 ° C, indicating that the increase in the reactivity of the bioraphore strains was due to complement activation. It has also been found that using the sera treated at 50 占 폚 induces a more stable and higher level of reactivity (although the amount of serum is required more as the alternative complement activation pathway is eliminated). In the present specification, the serum treated at 50 캜 was referred to as "treated serum ".

As a result of experiments using a staining sample (POPO-3) that can not pass through the cell membrane and real-time quantitative PCR, intracellular influx of large-sized extracellular molecules was increased under the condition of the treated serum, As the gene expression was induced, the reactivity of the bioreporter was increased. Furthermore, it has been confirmed that the addition of serum increases the reactivity and sensitivity of the bioraphore strains to various chemical substances and various bio-reporter strains, and it has been confirmed that the sensitivity of detection of genetic damage substances and oxidative damage substances is enhanced .

Taken together, these results indicate that serum complement can be used to enhance the reactivity and sensitivity of the bioraphore strains. In order to detect the concentration of the chemotherapeutic agent present in the blood, the bio-reporter strain is applied to a lab-on-a-CD device such as a point-of-care detecting device such as a microfluidic chip You can try.

Hereinafter, the present invention will be described in more detail.

In one aspect, the present invention relates to a composition for enhancing the sensitivity of a bioreporter strain comprising a serum complement.

The present invention also relates to a method of enhancing the sensitivity of a bioreporter strain, comprising the step of treating said composition with a bioreporter strain.

In the present invention, the term "bio-reporter " refers to a substance or device that detects and measures specific information from a sample and converts the value into useful signals readable by an observer. Generally, (Eg, genes, enzymes, antigens, antibodies, biochemicals, hormones, receptors, etc.) and electrochemical changes in the reaction of substances to be analyzed in the sample, changes in thermal energy, changes in fluorescence or color And is configured in combination with a conversion device

The term "bioreporter strain" in the present invention refers to a genetically modified strain into which the above-described bioreporter system is introduced. Preferably, the bioreporter strain of the present invention is a recombinant strain transformed with a vector comprising an inducible promoter activated under a specific stress or a specific stimulation condition and a reporter gene operably linked to the promoter, wherein a specific stress or specific stimulus May be a strain that produces a recognizable signal such as fluorescence or luminescence as expression of the reporter gene is increased by the activation of the promoter in the presence of the condition.

Examples of the specific stress or specific stimulation conditions include, but are not limited to, genotoxins, oxidative radicals, phenolic compounds, pesticides, and the like. The use of a bio-reporter strain enables rapid detection of the presence of specific stress-inducing substances or specific irritants in the sample, and the harmfulness and toxicity thereof.

As used herein, the term "inducible promoter " refers to a promoter that induces expression of a gene operably linked to a promoter under the specific stress or under specific stimulation conditions only. Preferably, the promoter is a recA gene which is activated in the presence of a gene-damaging substance, or a katG or sodA gene promoter which is activated in the presence of an oxidative stress-inducing substance, but the scope of the present invention is not limited thereto.

The term "reporter gene" in the present invention refers to a gene capable of visually confirming the expression thereof by expressing bioluminescence, fluorescence or color development upon gene expression, for example, Photinus sp. Or Phyrophourus sp. But are not limited to, a lux gene derived from the luc gene, Vibrio fisheri or Photorhabdus luminescens, Rluc gene derived from Renila reniformis, and a gfp gene derived from Aequorea Victoria or Renilla reniformis. Preferably, the lux CDABE gene can be used as a reporter gene.

 In the present invention, the term "luxCDABE" refers to a gene complex composed of luxC, luxD, luxA, luxB, and luxE, and has been reported as an operon present in Vibrio fisheri or Photorhabdus luminescens. In the present invention, luxCDABE gene can be obtained by synthesizing or isolating or purchasing it in an organism. For example, pDEW201 (Dupont Co., USA; FIG. 11) having luxCDABE can be purchased and used , But is not limited thereto.

In one preferred embodiment, the bio-reporter strain of the present invention may be a bio-reporter strain that detects a gene-damaging substance.

For example, a bioreporter strain that detects a gene-damaging agent may be a recombinant strain transformed with a vector comprising a recA promoter and a reporter gene operably linked downstream of the promoter. As the reporter gene, luxCDABE can be used, but is not limited thereto.

The recA promoter is characterized in that promoter activity is induced and increased when DNA damage or DNA replication is interrupted by genotoxins such as ultraviolet (UV) or mutagenic genes. Therefore, Can be used in a biosensor for detecting a gene-damaging substance. More specifically, when the recA promoter is fused with a reporter gene (for example, lux gene) and introduced into a strain, the activity of the recA promoter of the strain is induced in an environment exposed to a gene damaging substance, A fluorescence detection signal is generated. Thus, the presence or the presence of the gene damage substance in the sample can be easily detected and quantified. Therefore, strains into which the recA promoter and reporter gene fusions are introduced can be used to determine the degree of risk for toxic chemicals causing gene damage.

In a specific embodiment of the present invention, a recombinant E. coli MG1655-derived recA gene promoter (SEQ ID NO: 13) and a fusion construct of lux CDABE operon derived from Vibrio fischeri, as a bio-reporter strain, coli MG1655 / pRec3 was used, which was named 'Rec3' in the present specification. A detailed method of producing the strain is described in the literature previously reported by the present inventors (Lee, S., Mitchell, R. J., 2012. J. Biotechnol. 157 (4), 598-604).

Examples of the gene damaging substance that can be detected by the bioreactor strain of the present invention include mitomycin C, ethidium bromide, cisplatin, and the like, but the present invention is not limited thereto.

In another preferred embodiment, the bio-reporter strain of the present invention may be a bio-reporter strain that detects oxidative damage substances.

For example, a bioreporter strain that detects an oxidative damage substance can be a recombinant strain transformed with a vector comprising a sodA promoter or katG promoter, and a reporter gene operably linked downstream of the promoter. As the reporter gene, luxCDABE can be used, but is not limited thereto.

The sodA promoter is a promoter located upstream of a gene encoding SOD (superoxide dismutase), which is the most essential enzyme in defense and recovery against oxidative stress, and its activity is induced and increased under oxidative stress conditions And can be used in a biosensor for detecting oxidative damage substances contained in a sample.

The katG promoter is also characterized in that its activity is induced and increased under oxidative stress conditions, and thus it can be used in a biosensor for detecting oxidative damage substances contained in a sample.

More specifically, when the sodA promoter or the katG promoter is fused with a reporter gene (for example, a lux gene) and introduced into a strain, the promoter activity of the strain is induced in an environment exposed to an oxidative damage substance, A detectable signal such as luminescence or fluorescence is generated, so that the presence or the presence of the oxidative damage substance in the sample can be easily detected and quantified. Thus, strains into which sodA or katG promoter and reporter gene fusions are introduced can be used to determine the degree of risk for toxic chemicals causing oxidative damage.

 In a specific embodiment of the present invention, a pDEWMCS plasmid is introduced by introducing various restriction enzyme sites into pDEW201 as a bioreporter strain for detecting oxidative damage substances, and the expression of katG or sodA in the upstream of the lux gene contained in the pDEWMCS plasmid A bioreporter strain obtained by inserting the promoter region (SEQ ID NO: 15, SEQ ID NO: 17) into recombinant plasmids pSDK and pSDS and introducing them into E. coli MG1655 was used.

Examples of oxidative damages that can be detected by the bioreactor strain of the present invention include, but are not limited to, benzyl viologen or hydrogen peroxide.

The host strain of the biosensor of the present invention is not particularly limited, but it is preferably a Gram negative strain, more preferably an E. coli strain.

In the present invention, measurement of luminescence or fluorescence of a bioreporter strain can be performed using all optical measuring instruments, for example, photomultipliers, charge coupled devices, luminometers, photometers, fiber optic cables, liquid scintillation counters, and the like.

In order to solve the problem that the sensitivity of the detection of the bacteriophage strain is low due to the limitation in the introduction of the chemical substances that induce the signal of the bioreporter into the cell due to the selective permeability of the cell membrane of the bioreporter strain, Characterized in that the serum complement is treated when the sample is reacted with the strain.

In the present invention, the serum complement forms a pore in the cell membrane of the bioraphoter strain, whereby chemicals (for example, gene damage substances or oxidative damage substances) that are present extracellularly through the pores migrate into the cytoplasm through the cell membrane .

For example, in the present invention, the serum complement may be used in a form contained in serum.

According to a specific embodiment of the present invention, when the serum was treated with whole serum, the bio-reporter reaction was maximized when 4 μl of serum was added. When the serum was added in a larger amount, And the reaction of the bio-reporter strain was decreased. In addition, in the case of sera from which the alternative pathway in the complement activation pathway was removed by treatment with serum at 50 ° C, the bio-reporter reaction was maximized when 20-50 μl of serum was added, Which is about twice as high as that in the case of addition of.

Therefore, in the present invention, it is possible to use the serum complement in the whole serum state, but in order to induce a more stable and high reaction in the bio-reporter strain, it is more preferable to use the serum treated at 50 ° C In the present invention, the serum treated at 50 캜 was named "treated serum").

Preferably, the concentration of the serum complement in the present invention can be appropriately determined by those skilled in the art depending on the type and concentration of the bioraphotter strain, the kind and concentration of the chemical to be treated, and the like. Based on the experimental results of the present invention, the serum complement can be used in a range of 2 to 100 μl when 100 μg / L of the gene-damaging substance MMC is used, and 2 to 40 μl when used as the whole serum is used as the treated serum , It is preferable to use about 8 to 100 쨉 l, but this is only a representative example, and the present invention is not limited thereto.

On the other hand, in the present invention, it was confirmed that the serum complement improves the reactivity and sensitivity of the bacteriophage. Therefore, in order to detect the concentration of the anticancer chemotherapeutic agent present in the blood, on-a-CD device such as a microfluidic chip.

Accordingly, in another aspect, the present invention relates to a composition for detecting an anticancer chemotherapeutic agent in blood comprising a vector transformed with a vector comprising a recA promoter and a reporter gene operably linked to the promoter.

In another aspect, the present invention provides a microfluidic chip for detecting an anticancer chemotherapeutic agent in blood, which comprises the above composition.

The anticancer chemotherapeutic agent means a chemical-based anticancer agent that inhibits the proliferation of cancer cells by inhibiting gene synthesis and cell metabolism of cancer cells. Examples of such chemotherapeutic agents include, but are not limited to, mitomycin C, cisplatin, and the like.

In the specific examples of the present invention, it has been confirmed that the sensitivity of the bio-reporter strain to detect the chemotherapeutic agents in the sample is significantly increased in the presence of serum. Therefore, in order to detect the concentration of the chemotherapeutic agent present in the blood, Can be devised. In addition, since the sensitivity of the bio-reporter strains to blood is very high, a lab-on-a-CD device such as a point-of-care detecting device such as a microfluidic chip, It is possible to immobilize the strain and treat the blood sample with the apparatus to quickly detect the concentration of the chemotherapeutic agent present in the blood.

In a preferred embodiment, such a detection system can be an integrated and automated device that is both a blood serum separation step, mixing the serum with the culture, a heat treatment step, and detecting bioluminescence. Accordingly, when the blood sample is supplied to the apparatus, serum is automatically separated from the blood in the apparatus, the separated serum is treated with heat at about 50 ° C, the treated serum reacts with the bioraphotter strain, A series of steps for detecting bioluminescence from a reporter strain can be done quickly in one device. Implementations of such devices may be applied to the present invention with reference to centrifugal microfluidic platform technology known in the art.

The present invention provides a technique for enhancing the sensitivity and reactivity of a bioreporter strain using a serum complement, thereby being useful for evaluating the harmfulness of a genetic damaging substance or an oxidative damaging substance that can cause a fatal damage to an ecosystem have.

Figure 1 (A) shows the bioluminescence signal over time in the presence of 100 ppb MMC (w / 100 ppb MMC) and control in the presence of Rec 3 strain medium, respectively, and their relative bioluminescence (RBL) are also shown. (B) represents the time required for RBL having a value of 2 or more according to the MMC concentration.
FIG. 2 (A) shows the bioluminescence BL according to various serum and MMC treatment conditions, FIG. 2 (B) shows the relative bioluminescence RBL with time, FIG. 2 Relative fold induction (RFI) at each time under serum treatment conditions of concentration, and (D) shows the semi-log plot of (B).
FIG. 3 shows the bioluminescence according to the serum treatment concentration in the presence or absence of MMC.
FIG. 4 shows the relative bioluminescence according to serum treatment concentration in whole serum, serum treated at 50.degree. C., and serum condition treated at 56.degree.
FIG. 5 shows relative fold induction according to the serum treatment concentration in whole serum, serum treated at 50.degree. C., and serum condition treated at 56.degree.
Figure 6 shows the effect of serum treated at 50 ° C on the viability of the strain.
FIG. 7 shows that when Rec 3 strain was incubated with POPO-3, (A) shows the bright field image of the strain in the absence of serum treated at 50 ° C, (B) shows the presence of the treated serum (C) shows fluorescence image of the strain under the absence of the treated serum, and (D) shows fluorescence image of the strain in the presence of the treated serum.
FIG. 8 shows the relative bioluminescence according to MMC concentration at the control (LB), the serum treated at 50 ° C, and the serum condition treated at 56 ° C.
FIG. 9 shows the results of confirming the expression level of recA in Escherichia coli strain and the expression level of sodA gene in Escherichia coli strains under serum and benzyl viologen treatment conditions under serum and MMC treatment conditions by real-time quantitative PCR, respectively.
Figure 10 shows the relative bioluminescence according to MMC concentration in the control (LB), positive blood serum and human serum conditions.
Fig. 11 shows a cleavage map of the pDEW201.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Microbial Culture

The bacterial strains and over-plasmids used in the present invention are shown in Table 1 below. The bacteria were stored at -80 ° C. with 20% glycerol and the bacteria were cultured in Luria-Bertani (LB, Difco, USA) -agar medium containing 50 μg / ml of ampicillin for 16 hours . One colony from this medium was inoculated into a sterile LB liquid medium containing 50 mu g / ml ampicillin and then cultured. After incubation overnight, the cells were diluted in fresh LB liquid medium containing ampicillin at a ratio of 1: 100 and cultured at an absorbance of 0.1-0.15 at 600 nm. Absorbance was measured using BioPhotometer Plus (Eppendorf, Germany). Human serum (AB Male, Sigma-Aldrich, USA) treated at 50 ° C or 56 ° C for 30 minutes was treated to the medium, and then the chemicals described in Example 3 were treated. All the above procedures were carried out at 30 ° C.

Strain or plasmid Related features Strain E. coli BL21 (DE3) F - ompT hsdSB ( rB - mB -) gal dCM ( DE3 ) E. coli MG1655 F-lambda- ilvG - rfb- 50 rph -1 Plasmid pRec3 recA :: luxCDABE , pUCD615 pDEW201 Promoterless luxCDABE expression plasmid, Amp ^R pDEWMCS Modified pDEW201 plasmid, MCS containing restriction sites for EcoR I, Not I, Xho I, BamH I, Xma I, Xba I, EcoR V and Kpn I; Amp ^R pSDK katG :: luxCDABE , pDEWMCS pSDS sodA :: luxCDABE , pDEWMCS

** pRec3 above is described in Yaguchi, T., Lee, S., Choi, WS, Kim, D., Kim, T., Mitchell, RJ, Takayama, S., 2010. Analyst 135 (11), 2848-2852 Quoted from

Example  2. Plasmid preparation

The plasmids used in the present invention are shown in Table 1 above. After digesting restriction enzymes EcoRI and KpnI with pDEW201 (Du Pont), restriction enzymes EcoRI, NotI, XhoI, BamHI, XmaI, XbaI, EcoRV and KpnI were inserted into pDEW201 to obtain plasmid pDEWMCS made. The katG and sodA gene promoter sites derived from E. coli BL21 (DE3) (RBC Bioscience) were amplified using the primers described in Table 2 below. In the amplification product, the katG and sodA promoter regions were cut into BamHI and KpnI or EcoRI and BamHI, respectively, and then the amplification product was inserted into the upstream of the lux operon in pDEWMCS. The obtained gene construct was introduced into E. coli DH5α using electroporation and E. coli DH5α introduced with the gene construct in LB medium containing ampicillin (100 mg / ml) Respectively. In all of the luminescence experiments herein, E. coli MG1655 was used as a host.

primer Base sequence SEQ ID NO: Plasmid construction MCS1 AATTCGCGGCCGCTCGAGGATCCCGGGTCTAGATATCGGTAC One MCS2 TTAAGCGCCGGCGAGCTCCTAGGGCCCAGATCTATAGCCATG 2 KS1 GTCCGGATCCGGACATAATCAAAAAAGC 3 KS2 CTGATGGTACCGTCATTTGCCAGTGGC 4 SA1 CCGTTGTCGAATTCCTGGCAATCACG 5 SA2 CTCATATTCGGATCCAGTATTGTCGGG 6

Example  3. Preparation of chemicals

In the present invention, the following chemicals were prepared according to the type of promoter: mitomycin C (MMC) (Sigma-Aldrich, USA), ethidium bromide (EtBr) (Sigma-Aldrich, USA) for the recA promoter; For the sodA promoter, a benzyl viologen (Sigma-Aldrich, USA) was prepared; For the katG promoter, hydrogen peroxide (Sigma-Aldrich, USA) was prepared. The materials were dissolved in distilled water and sterilized using a 0.22 μM filter.

Example  4. Bioluminescence ( Bioluminescence ) And Survivability ( viability ) evaluation

100 .mu.l of the culture was added to a 96-well microplate (Greiner, USA) containing LB medium or human serum and incubated for 4 hours every 20 minutes using a GloMax Multi + detection system (Promega, USA) Bioluminescence was measured.

Effects on Serum Concentration Before mixing the culture with serum, MMC was pre-treated at a concentration of 100 μg / L in Rec 3 culture medium, and the final concentration was adjusted to 50-100 μg / L according to the amount of serum to be mixed . As a control, a mixture of serum was used in a Rec3 culture medium in which MMC was not pretreated. To determine the limit of detection (LOD), chemicals were serially diluted in serum or liquid medium in wells prior to the addition of Rec3 medium.

In order to evaluate the viability of E. coli, 100 쨉 L of LB medium, 40 의 of serum treated at 50 째 C or 40 의 of serum treated at 56 째 C were added to each well of a 96-well plate. Then, 100 μl of E. coli culture solution having an absorbance (OD) of 0.15 was added to the wells and cultured at 30 ° C for 2 hours with intermittent shaking. For the measurement of the bioluminescence, 100 μl was obtained from the culture solution, and 10 μl was obtained for the viability evaluation. For the evaluation of viability, each sample was sequentially diluted with LB liquid medium and plated on an LB agar culture dish containing ampicillin. After overnight incubation at 30 ° C, the number of colony-forming units (CFU) produced was measured.

Example  5. Fluorescence

Each sample was observed using an inverted epi-fluorescent microscope (Olympus IX71) and observed at X10 and X20 magnifications, respectively. The fluorescence intensity was determined according to the excitation / emission spectrum of POPO-3, and fluorescence images were taken using Metamorph Image Suite (v 7.07, Molecular Devices, USA).

Example  6. Real-time quantitative PCR  analysis ( Real - time quantitative PCR 분석 )

RT-qPCR analysis was performed using bacterial strain E. coli MG1655. One colony was inoculated on LB agar plates as described in Example 1, incubated overnight, and grown in 3 ml LB liquid medium until absorbance at 600 nm wavelength reached 0.8. This culture was diluted in a fresh liquid medium at a ratio of 1:25 and cultured until the absorbance was 0.1 to 0.15. Then, 10 ml of the culture was transferred into a flask, and 10 ml of sterilized LB or 4 ml of serum at 50 ° C was added to give a final concentration of MMC of 100 μg / L and a concentration of benzyl viologen of 1 mg / L. After incubation for 40 min, RNA was extracted from 5 ml samples using ChargeSwitch RNA Purification Kit from Invitrogen (USA). RNA purification, cDNA synthesis and RT-qPCR were performed as previously reported (Lee, S., Mitchell, RJ, 2012. J. Biotechnol. 157 (4), 598-604) The primers were listed in Table 3 below. The standard concentrations of each gene were calculated using 16s rRNA concentration, and the levels of recA and sodA RNA in each sample were compared with the control group LB to observe the expression level.

RT - qPCR  For analysis primer E. coli Base sequence SEQ ID NO: 16s For AATAAATCATAACTTGACGTCATCCCCACCT 7 16s Rev AATAAATCATAAGAATGTGCCTTCGGGAACC 8 recA For AATAAATCATAATTGCTCAGCAGCAACTCAC 9 recA Rev AATAAATCATAACGGCGAACTGGTTGACCT 10 sodA For AATAAATCATAACCATGGAAATCCACCACACCA 11 sodA Rev AATAAATCATAAAGAACAGGCTGTGGTTAGCGT 12

Example  7. Centrifugal System ( centrifugal system )

Sheep blood was purchased from KOMED (Korea) and used immediately. In the experiments herein, positive blood was used instead of human blood. Serum was separated from blood at 4000 g. After separating the blood, serum samples were transferred to test tubes and MMC was added to a final concentration of 0.25, 1 or 10 μg / L. For the experiment, a culture medium of the strain was prepared in the same manner as in Example 1, 200 μl of the culture medium was added to 80 μl of MMC-containing serum, incubated at room temperature (25 ° C.) for 2 hours and rotated at 40 g . After 2 hours, the bioluminescence was measured using a Glomax 20/20 Luminometer (Promega, USA).

Example  8. Data Analysis

Each experiment was performed independently three times, using Origin Pro 8 or SigmaPlot v. Data plots were obtained using 11, and analyzed using Excel. The data are shown as average values, and the standard deviation is shown using the error bars in the graph. Relative bioluminescence (RBL) is the bioluminescence of a sample containing MMC at the same time divided by the bioluminescence of the control group (Equation 1), relative fold induction , RFI) is the ratio of the RBL of a sample in which serum is present at the same time point to the RBL of a sample in which LB is present (Equation 2).

Experiment result

1. Serum is a genetic material that has been exposed to mitomycin C genotoxin ) Enhances the response of the bio-reporter.

The inventors have previously produced E. coli MG1655 / pRec3 containing the recA gene promoter derived from E. coli MG1655 and the fusion construct of luxCDABE operon derived from Vibrio fischeri (Lee, S., Mitchell, RJ , 2012. J. Biotechnol. 157 (4), 598-604), which is referred to herein as 'Rec3'. First, the response of Rec3 was observed in the culture medium containing mitomycin C (MMC). At 100 μg / L of MMC, a significant response was obtained from the culture medium over about 100 minutes, ie, bioluminescence (BL) was induced twice or more as compared with the control (FIG. 1A). Also, as the concentration of MMC decreased, it took more time for the reaction to increase rapidly. For example, treatment with 16 μg / L of MMC took more than 3 hours to observe the reaction (FIG. 1B). These results indicate that the bio-reporter strain must be cultured for a longer time to detect low concentrations of MMC. This is due to the slow migration of MMC in passing through the cell membrane as MMC rapidly reacts with free genomic DNA under reducing conditions (Gu, MB, Min, J., LaRossa, RA, 2000. J. Biochem. Biophys Methods 45 (1), 45-56). Human serum was added to the test culture with MMC to determine whether migration through the cell membrane is a limiting factor and to be able to enhance the activity of the bioreporter strain. When the bio-reporter strain was activated, the serum complement system formed a pore of about 10 nm in diameter in the cell membrane, and this pore size allowed relatively large organic molecules to stably enter the cells.

As shown in FIG. 2, it was found that addition of serum had a strong influence on both the intensity of the relative reaction and the reaction time of the bio-reporter strain. When 2 ㎕ or more of serum was added, the relative intensity of the reaction was significantly increased compared to the sample without addition of serum. The relative relative bioluminescence (RBL), ie, the ratio of the bioluminescence induced in the culture medium supplemented with serum at the same time point and the control group, was 891 when 4 μl of serum was added, RBL was only 12 (Figure 2B). This effect was more pronounced in relative fold induction (RFI), defined as the ratio between RBL values (FIG. 2C). For example, when 4 μl of serum was added to MMC at a concentration of 100 μg / L for 2 hours, the RBL value was 377 when the serum was added and the RBL value when the serum was not added was 3.2 , The RFI value was about 120. At least a portion of the causes of this dramatic increase in response may be due to less bioluminescence signal when serum was treated in control medium without MMC (FIG. 2A and FIG. 3). As shown in FIG. 2B, the addition of more than 4 μl of serum, in addition to the loss of viability and the degree of stress to be experienced, may result in osmotic pressure and cell death due to the presence of serum complement, The degree of bioluminescence was varied.

In addition, we observed that the addition of serum added not only a larger relative response but also a faster reaction of the bioraphore strains. As shown in FIG. 2D, it was found that when the serum was added at 4 μl or more, the time until the RBL doubled was reduced to half. This indicated that, in the presence of serum, a faster reaction was observed, as well as a stronger response pattern. This increased response is clearly shown in the semi-log graph in FIG. 2D, indicating that the RBL value in all samples is increased. As the amount of serum was gradually increased from 0 to 4 μl, the slope was increased. When 4 μl or more was added, the reaction curve became almost the same.

From these results, the present inventors concluded that by adding a small amount of human serum, by increasing the amount of MMC introduced into the cytoplasm, the reaction of the bacteria can be maximized, and the addition of more amount does not have a greater effect I could.

2. Serum On complement  When heat-denatured Rec3 Enhanced Show the reaction  Do not.

The complement system is part of the immune system and requires a large amount of protein to remove the antigen. When the complement system is activated, the membrane attack complex (MAC) is created and the target cells are lysed through pore formation. Although some biochemical signaling pathways are known to activate the complement system, activation by gram-negative bacteria is known to be due to the classical pathway of complement activation or alternative pathway. Pseudomonas aeruginosa activates the complement system by the classical complement activation pathway, and E. coli activates the complement system by both signaling pathways.

In order to determine whether the reaction was enhanced by the complement system in the present invention, sera from which the effect of the alternative complement activation pathway was removed at 50 ° C and treated at 56 ° C to inactivate both complement activation pathways were prepared . As shown in FIG. 4, when the serum was treated with 100 μg / L of MMC as shown in FIG. 4, the maximum RBL value of Rec3 was obtained. Its RFI value is shown in Fig. When serum was treated at 50 ° C, RBL showed the highest value (600-800) when 20-50 μl of serum was added. When treated with the same amount of serum, the BL value was about twice that of the whole serum (i.e., untreated serum) treated with 4 쨉 l of the LB medium exposed to MMC, that is, the serum was not added The BL value was compared with the BL value in the case that In addition, not only was the response higher than that of the whole serum treated, but also the response was stable and the error for each experiment was decreased. However, due to the lack of an alternative complement activation pathway, larger amounts of serum were required to reach the maximal response (Fig. 2B). From the above experimental results, it was found that 40 가 was appropriate, and then the experiment was carried out using 40 의 of serum. In addition, the sensitivity of the Rec3 bio-reporter strain was increased when serum was added, and the limit of detection (LOD) when measured for 3 hours was 0.07 / / L. This is 430 times lower than the control alone used in the present invention and is at least 7 times lower than the limit of detection (LOD) measured by conventional HPLC analysis (Carlucci et al. 1999; 2006; Tjaden et al., 1982). In contrast, when 100 μg / L of MMC and serum treated at 56 ° C were added, the RBL values were similar to the RBL values measured in the medium without serum, indicating that the response of the bioreporter strain was increased Indicating that it is due to complement activation.

In conclusion, we have found in the present invention that the reaction of bioreporters is rather reduced when too much serum is added. The maximum response in the absence of serum treatment was shown when only 4 [mu] l of serum was added, and the greater the amount of serum added, the more metabolic activity was lost (Fig. 3). Treatment of the serum with an alternative complement activation pathway at 50 ° C required higher amounts of serum to achieve the same level of response from MMC.

In order to evaluate the effect of treated serum on survival, the number of colonies formed after treatment with 40 ㎕ of serum for 2 hours was observed to be 6.7 times lower for serum treated at 50 캜. In contrast, in the case of the serum treated at 56 ° C, complement activation was completely eliminated and there was no decrease in the number of E. coli, indicating that the serum does not have a particularly detrimental effect on E. coli culture. In the case of the serum treated at 50 ° C, the viable E. coli number decreased but the maximum BL value of the response to MMC was similar (FIG. 2A). These results suggest that the response to MMC is due to the stronger cell responses.

3. Serum Complement POPO -3 to pass through the cell membrane.

POP3-3 is a staining sample that can not pass through the cell membrane, indicating that the stronger Rec3 response is due to the activation of the serum complement. Rec 3 was incubated with POPO-3 in the presence or absence of serum treated at 50 ° C to see if large molecules could enter the strain through the pores and bind genomic DNA in the cells. The bright field image and fluorescence image show the appearance of intact bacteria even after incubation in the presence of the treated serum, indicating cell aggregation rather than the control image (FIG. 7). Similarly, the presence of whole cells showing fluorescence in the presence of treated serum indicates that the cell membrane is still intact. In the control group, the fluorescence signal was very weak due to the failure of POPO-3 to pass through the biofilm (Fig. 7C). When serum was present, POPO-3 penetrated into the cell and interfered with cellular DNA, (Fig. 7D). Because POPO-3 binds dsDNA, fluorescence increases 1000-fold (Clark and Sepaniak 1993), and MMC also binds dsDNA (Metzler 1986), leading to SOS response, including increased expression of recA in E. coli.

4. Adding serum MMC For Rec3 The sensitivity of Increase .

As described above, when serum is added, MMC can pass through the cell membrane. Therefore, the present inventors conducted the following experiment to confirm that the limit of detection (LOD) of the bioreporter strain is reduced to MMC . MMC concentration-dependent experiments were performed, and the effect of each case was determined by comparing the treated medium supplemented with the treated medium to the non-supplemented control medium (FIG. 8). When the serum treated at 56 ° C was added, there was no significant difference from the control group in which the serum was not added. From this, it was found that complement activation was required to increase the reaction. Also, the minimum concentration for indicating the limit of detection (LOD), that is, the RBL value of 2 or more, was about 60 μg / L of MMC after the treatment for 2 hours as described above (Table 4). When treated as above for a longer time of 3 hours, the detection limit was reduced to 30 μg / L. Assuming that the same plasmid is used in other species of E. coli with a detection limit of 5 μg / L (Min et al., 1999), the above values may be high, but this may be due to species differences.

In contrast, when serum treated at 50 ° C was added, the detection limit was very low as treated with 0.56 μg / L of MMC for 2 hours. It was also 110 times more sensitive than the control. When treated for 3 hours, the detection limit decreased to 0.07 ㎍ / L and the sensitivity increased 430 times as compared with the control. This is due to the fact that the detection limits of human MMCs are lower than those of previous studies using 1 μg / L of MMC and HPLC analysis (Carlucci et al., 1999; Tjaden et al., 1982).

5. If serum is present Mitomycin  C-induced recA  Expression is further increased.

Up to now, it has become clear that activated serum complement enhances the reactivity and sensitivity of the Rec3 bioluminescent bio-reporter strain. However, it has been reported that lux-based bioluminescence is associated with the oxidation of riboflavin and aliphatic aldehydes and has been reported to utilize complicated biochemistry. According to conventional reports, when the biofilm is disturbed by phenol compounds, luxCDABE gene Induced "false-induction " Therefore, to confirm that the expression of the gene is induced by the conditions set in the present invention, we performed real-time quantitative PCR on the medium 40 minutes after the initial exposure to the test conditions to evaluate recA expression.

The amount of RNA expression was observed after adding serum to E. coli, a gram-negative organism, or by adding serum treated at 50 ° C. As shown in FIG. 9, when serum was added, the E. coli recA gene showed an average 5.1-fold higher expression level ("serum" group) in cells treated with 100 μg / L MMC. This is three times more than in serum-free culture medium ("LB" group), indicating that the strain reacts strongly with MMC in the presence of serum. On the other hand, recA expression was induced by MMC, whereas in the absence of MMC ("Serum control"), the expression of recA was similar to that of LB control group. In conclusion, although serum itself did not induce an increase in recA expression, it stimulates the response to MMC.

Similar results were obtained for benzyl viologen, which produces superoxide radicals and induces oxidative stress. As a result, the expression level of sodA gene was also increased in the presence of serum. The expression of mRNA in the culture medium alone ("LB") without serum was increased by 2.8-fold, but the expression of mRNA was increased 4.4-fold when serum was added ("serum" From these results, it can be seen that the formation of pores in the serum complement makes it possible for more compounds to enter the cytoplasm and stimulates the expression of the target gene.

6. In the presence of serum, other genetic damage and Oxidative  The response induced by the damaging material also increases.

Since it was confirmed that the sensitivity and reactivity to MMC were rapidly increased by treating the serum, experiments were conducted to confirm whether the response to various other stresses was increased by the serum. All experiments were carried out by adding 40 μg of serum treated at 50 ° C. The detection limit (LOD) values for each chemical listed in Table 1 are listed in Table 4.

chemical substance Molecular Weight Solubility
(mg / ml) Promoter LOD value Increased sensitivity LB Serum (50 degrees) Genotoxins MMC (ug / L) 334.3 8.4 recA 62.5 0.56 112 times EtBr (ug / L) 394.3 40 recA Not detected 140 Cisplatin (mg / L) 301.1 One recA 2.97 0.56 5.3 times Oxidative stress H ₂ O ₂ (mg / L) 34.0 Miscible katG 0.09 3.12 BV (mg / L) 409.4 > 20 sodA 0.12 0.07 1.7 times

In addition to MMC, the response of Rec3 to various genotoxins such as cisplatin and ethidium bromide (EtBr) was observed. Detection of MMC by Rec3 in the presence of serum was very sensitive and showed a detection limit (LOD) of 0.07 μg / L over 3 hours, 430 times more sensitive than the medium alone.

EtBr, a DNA intercalator, is larger in size than MMC and is reported to be lower in EtBr (RBL 10) -derived response than MMC (RBL 1000). In this experiment, EtBr was not detected in the Rec3 strain under serum-free conditions (Table 4). However, in the presence of serum, EtBr was detected at a concentration of 140 μg / L or more.

Next, oxidative stress induced by H2O2 and benzyol viologen (BV) was measured using a strain containing fused fusion of katG or sodA promoter with lux operon in pDEWMCS. BV is a paraquat derivative that catalyzes the production of superoxide radicals and is known to induce the expression of SoxRS regulon including the sodA gene in E. coli. As a result of evaluating the oxidative stress induced by BV, strains containing sodA promoter fusions in the presence of serum complement showed 1.7 times lower LOD than in the absence of serum, Respectively. When H ₂ O ₂ was detected by a strain containing katG :: lux fusion, there was no significant change from the viewpoint of LOD, but it took a shorter time until a similar reaction occurred. When 100 μg / L H2O2 was added, the RBL value reached 14 in 20 minutes when serum was added, but it took 1 hour for RBL to reach 2 in the absence of serum.

7. In the blood MMC  Centrifugation for detection Microfluidic  system( Centrifugal  Microfluidic System )

Since the activation of the serum complement improves the sensitivity of the bio-reporter strain to genotoxin, the present inventors have developed a chemotherapy agent sensor by combining centrifugal microfluidic or Lab-on-a-CD Respectively. The Lab-on-a-CD platform is used in a variety of applications, particularly in medical and clinical diagnostics, and in biological analysis. Microfluidic systems are well-suited for use in biological samples. In addition, it is possible to perform multiple analysis and simultaneous detection easily in an integrated system using a microfluidic CD, and since a microfluidic CD-based immunoassay uses a chemiluminescent enzyme, It is possible to manufacture microfluidic CDs using bio-reporters. Therefore, a centrifugal microfluidic platform has been developed as an automated system for detecting the concentration of drug used in various chemotherapeutic regimens such as MMC in the blood using the bioluminescent strain Rec3 of the present invention.

In the present invention, blood was separated using a table-top centrifuge tube system and a microfluidic CD system. A method of treating an automated blood sample comprising separating plasma or serum from whole blood using a centrifugal microfluidic platform has been reported in the past (Amasia and Madou 2010; Haeberle et al. 2006. In the present invention, In place of the samples, the blood was centrifuged at 4000 g to separate the serum and treated with MMC at concentrations of 0.25, 1, and 10 μg / L, respectively. Existing pharmacokinetic studies Based on the results of Highley et al., 2006, Paroni et al., 1997), the concentration was selected and the serum was then added to Rec3 culture medium. After incubation for 2 hours at 40 g in a centrifuge, The luminescence was measured (Figure 10). A human serum sample, untreated as a reference material for comparison with positive blood serum results, was used. , Which means that the used protocol, g-force, does not significantly affect E. coli cells or serum complement activity. The microfluidic CD system can be used for blood serum separation , Mixing the serum with the culture, heat treating, and detecting the bioluminescence are all integrated and automated and can be used to detect MMC in the blood sample.

<110> UNIST Academy-Industry Research Corporation <120> Sensitivity enhancement of bioreporter strains using serum          complement <130> DPP20132016KR <160> 18 <170> Kopatentin 1.71 <210> 1 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> MCS1 primer <400> 1 aattcgcggc cgctcgagga tcccgggtct agatatcggt ac 42 <210> 2 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> MCS2 primer <400> 2 ttaagcgccg gcgagctcct agggcccaga tctatagcca tg 42 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> KS1 primer <400> 3 gtccggatcc ggacataatc aaaaaagc 28 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> KS2 primer <400> 4 ctgatggtac cgtcatttgc cagtggc 27 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SA1 primer <400> 5 ccgttgtcga attcctggca atcacg 26 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SA2 primer <400> 6 ctcatattcg gatccagtat tgtcggg 27 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 16s forward primer <400> 7 aataaatcat aacttgacgt catccccacc t 31 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 16s reverse primer <400> 8 aataaatcat aagaatgtgc cttcgggaac c 31 <210> 9 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> recA forward primer <400> 9 aataaatcat aattgctcag cagcaactca c 31 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> recA reverse primer <400> 10 aataaatcat aacggcgaac tggttgacct 30 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> sodA forward primer <400> 11 aataaatcat aaccatggaa atccaccaca cca 33 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> sodA reverse primer <400> 12 aataaatcat aaagaacagg ctgtggttag cgt 33 <210> 13 <211> 269 <212> DNA <213> Artificial Sequence <220> <223> promoter <220> <221> -10_signal <222> (86) <220> <221> -35_signal &Lt; 222 > (108) <400> 13 cgctttctgt ttgttttcgt cgatagccat ttttactcct gtcatgccgg gtaataccgg 60 atagtcaata tgttctgttg aagcaattat actgtatgct catacagtat caagtgtttt 120 gtagaaattg ttgccacaag gtctgcaatg catacgcagt agcctgacga cgcaccgcat 180 cacggtcgcc gctgaagcat tcccgccggg taatgccttc accgcgggca gtggcaaaag 240 caaaccagac ggtgccgaca ggcttctct 269 <210> 14 <211> 1062 <212> DNA <213> Artificial Sequence <220> <223> recA gene <400> 14 ttaaaaatct tcgttagttt ctgctacgcc ttcgctatca tctacagaga aatccggcgt 60 tgagttcggg ttgctcagca gcaactcacg tactttcttc tcgatctctt tcgcggtttc 120 cgggttatct ttcagccagg cagtcgcatt cgctttaccc tgaccgatct tctcaccttt 180 gtagctgtac cacgcgcctg ctttctcgat cagcttctct tttacgccca ggtcaaccag 240 ttcgccgtag aagttgatac cttcgccgta gaggatctgg aattcagcct gtttaaacgg 300 cgcagcgatt ttgttcttca ccactttcac gcgggtttcg ctacccacca cgttttcgcc 360 ctctttcacc gcgccgatac gacggatgtc gagacgaaca gaggcgtaga atttcagcgc 420 gttaccaccg gtagtggttt ccgggttacc gaacatcaca ccaattttca tacggatctg 480 gttgatgaag atcagcagcg tgttggactg cttcaggtta cccgccagct tacgcatcgc 540 ctggctcatc atacgtgccg caaggcccat gtgagagtcg ccgatttcgc cttcgatttc 600 cgctttcggc gtcagtgccg ccacggagtc aacgacgata acgtctactg cgccagaacg 660 cgccagggcg tcacagattt ccagtgcctg ctcgccggtg tccggctggg agcacagcag 720 gttgtcgata tcgacgccca gtttacgtgc gtagattggg tccagcgcgt gttcagcatc 780 gataaacgca caggttttac cttcacgctg cgctgcggcg atcacctgca gcgtcagcgt 840 ggttttaccg gaagattccg gtccgtagat ttcgacgata cggcccatcg gcagaccacc 900 tgccccaagc gcgatatcca gtgaaagcga accggtagag atggtttcca catccatgga 960 acggtcttca cccaggcgca tgatggagcc tttaccaaat tgtttctcaa tctggcccag 1020 tgctgccgcc aacgctttct gtttgttttc gtcgatagcc at 1062 <210> 15 <211> 230 <212> DNA <213> Artificial Sequence <220> <223> promoter <220> <221> -10_signal &Lt; 222 > (134) .. (139) <220> <221> -35_signal (110). (117) <400> 15 gtccgaattc ggacataatc aaaaaagctt aattaagatc aatttgatct acatctcttt 60 aaccaacaat atgtaagatc tcaactatcg catccgtgga ttaattcaat tataacttct 120 ctctaacgct gtgtatcgta acggtaacac tgtagagggg agcacattga tgagcacgtc 180 agacgatatc cataacacca cagccactgg caaatgcccg ttccatcagg 230 <210> 16 <211> 2181 <212> DNA <213> Artificial Sequence <220> <223> KagG gene <400> 16 atgagcacgt cagacgatat ccataacacc acagccactg gcaaatgccc gttccatcag 60 ggcggtcacg accagagtgc gggggcgggc acaaccactc gcgactggtg gccaaatcaa 120 cttcgtgttg acctgttaaa ccaacattct aatcgttcta acccactggg tgaggacttt 180 gactaccgca aagaattcag caaattagat tactacggcc tgaaaaaaga tctgaaagcc 240 ctgttgacag aatctcaacc gtggtggcca gccgactggg gcagttacgc cggtctgttt 300 attcgtatgg cctggcacgg cgcggggact taccgttcaa tcgatggacg cggtggcgcg 360 ggtcgtggtc agcaacgttt tgcaccgctg aactcctggc cggataacgt aagcctcgat 420 aaagcgcgtc gcctgttgtg gccaatcaaa cagaaatatg gtcagaaaat ctcctgggcc 480 gacctgttta tcctcgcggg taacgtggcg ctagaaaact ccggcttccg taccttcggt 540 tttggtgccg gtcgtgaaga cgtctgggaa ccggatctgg atgttaactg gggtgatgaa 600 aaagcctggc tgactcaccg tcatccggaa gcgctggcga aagcaccgct gggtgcaacc 660 gagatgggtc tgatttacgt taacccggaa ggcccggatc acagcggcga accgctttct 720 gcggcagcag ctatccgcgc gaccttcggc aacatgggca tgaacgacga agaaaccgtg 780 gcgctgattg cgggtggtca tacgctgggt aaaacccacg gtgccggtcc gacatcaaat 840 gtaggtcctg atccagaagc tgcaccgatt gaagaacaag gtttaggttg ggcgagcact 900 tacggcagcg gcgttggcgc agatgccatt acctctggtc tggaagtagt ctggacccag 960 acgccgaccc agtggagcaa ctatttcttc gagaacctgt tcaagtatga gtgggtacag 1020 acccgcagcc cggctggcgc aatccagttc gaagcggtag acgcaccgga aattatcccg 1080 gatccgtttg atccgtcgaa gaaacgtaaa ccgacaatgc tggtgaccga cctgacgctg 1140 cgttttgatc ctgagttcga gaagatctct cgtcgtttcc tcaacgatcc gcaggcgttc 1200 aacgaagcct ttgcccgtgc ctggttcaaa ctgacgcaca gggatatggg gccgaaatct 1260 cgctacatcg ggccggaagt gccgaaagaa gatctgatct ggcaagatcc gctgccgcag 1320 ccgatctaca acccgaccga gcaggacatt atcgatctga aattcgcgat tgcggattct 1380 ggtctgtctg ttagtgagct ggtatcggtg gcctgggcat ctgcttctac cttccgtggt 1440 ggcgacaaac gcggtggtgc caacggtgcg cgtctggcat taatgccgca gcgcgactgg 1500 gatgtgaacg ccgcagccgt tcgtgctctg cctgttctgg agaaaatcca gaaagagtct 1560 ggtaaagcct cgctggcgga tatcatagtg ctggctggtg tggttggtgt tgagaaagcc 1620 gcaagcgccg caggtttgag cattcatgta ccgtttgcgc cgggtcgcgt tgatgcgcgt 1680 caggatcaga ctgacattga gatgtttgag ctgctggagc caattgctga cggtttccgt 1740 aactatcgcg ctcgtctgga cgtttccacc accgagtcac tgctgatcga caaagcacag 1800 caactgacgc tgaccgcgcc ggaaatgact gcgctggtgg gcggcatgcg tgtactgggt 1860 gccaacttcg atggcagcaa aaacggcgtc ttcactgacc gcgttggcgt attgagcaat 1920 gacttcttcg tgaacttgct ggatatgcgt tacgagtgga aagcgaccga cgaatcgaaa 1980 gagctgttcg aaggccgtga ccgtgaaacc ggcgaagtga aatttacggc cagccgtgcg 2040 gatctggtgt ttggttctaa ctccgtcctg cgtgcggtgg cggaagttta cgccagtagc 2100 gatgcccacg agaagtttgt taaagacttc gtggcggcat gggtgaaagt gatgaacctc 2160 gaccgtttcg acctgctgta a 2181 <210> 17 <211> 195 <212> DNA <213> Artificial Sequence <220> <223> promoter <220> <221> -10_signal &Lt; 222 > (132) .. (137) <220> <221> -35_signal &Lt; 222 > (111) .. (118) <400> 17 ccgttgtcga tttactggca atcacggcat taagtgggtg atttgcttca catctcgggc 60 attttcctgc aaaaccatac ccttacgaaa agtacggcat tgataatcat tttcaatatc 120 atttaattaa ctataatgaa ccaactgctt acgcggcatt aacaatcggc cgcccgacaa 180 tactggagat gaata 195 <210> 18 <211> 621 <212> DNA <213> Artificial Sequence <220> <223> The sODA gene <400> 18 atgagctata ccctgccatc cctgccgtat gcttacgatg ccctggaacc gcacttcgat 60 aagcagacca tggaaatcca ccacaccaaa caccatcaga cctacgtaaa caacgccaac 120 gcggcgctgg aaagcctgcc agaatttgcc aacctgccgg ttgaagagct gatcaccaaa 180 ctggaccagc tgccagcaga caagaaaacc gtactgcgca acaacgctgg cggtcacgct 240 aaccacagcc tgttctggaa aggtctgaaa aaaggcacca ccctgcaggg tgacctgaaa 300 gcggctatcg aacgtgactt cggctccgtt gataacttca aagcagaatt tgaaaaagcg 360 gcagcttccc gctttggttc cggctgggca tggctggtgc tgaaaggcga taaactggcg 420 gtggtttcta ctgctaacca ggattctccg ctgatgggtg aagctatttc tggcgcttcc 480 ggcttcccga ttatgggcct ggatgtgtgg gaacatgctt actacctgaa attccagaac 540 cgccgtccgg actacattaa agagttctgg aacgtggtga actgggacga agcagcggca 600 cgttttgcgg cgaaaaaata a 621

Claims (15)

A composition for promoting sensitivity to the detection of a genetic damaging substance or an oxidative damaging substance of a bioreactor strain, comprising a serum serum contained in whole serum or serum treated at 50 캜,
The bio-reporter strain detecting the gene-damaging substance is an E. coli strain transformed with a vector comprising a recA promoter and a reporter gene operably linked to the promoter,
Wherein the bio-reporter strain detecting oxidative damage material is an E. coli strain transformed with a vector comprising a sodA promoter or katG promoter, and a reporter gene operably linked to the promoter,
Wherein the gene damaging agent is mitomycin C, ethidium bromide, or cisplatin, and
Wherein the oxidative damage material is benzyl viologen or hydrogen peroxide.
delete delete 2. The composition of claim 1, wherein the reporter gene is LuxCDABE.
delete delete delete delete delete delete 15. A method for treating a bacterium, comprising the step of treating a composition of claim 1 or 4 with a bioreporter strain,
As a method for enhancing sensitivity to the detection of genetic or oxidative damage substances of a bio-reporter strain,
The bio-reporter strain detecting the gene-damaging substance is an E. coli strain transformed with a vector comprising a recA promoter and a reporter gene operably linked to the promoter,
Wherein the bio-reporter strain detecting oxidative damage material is an E. coli strain transformed with a vector comprising a sodA promoter or katG promoter, and a reporter gene operably linked to the promoter,
Wherein the gene damaging agent is mitomycin C, ethidium bromide, or cisplatin, and
Wherein the oxidative damage material is a benzyl viologen or hydrogen peroxide. delete delete delete delete

Images