KR101441751B1 - SSR primer derived from Chrysanthemum and use of thereof - Google Patents

Abstract

The present invention relates to a pair of SSR primers having two or more nucleic acid sequences selected from the group consisting of SEQ ID NOS: 1 to 24, and preferably, the primer pair may include those derived from chrysanthemum.

Description

Chrysanthemum-derived SSR primer and its use {SSR primer derived from Chrysanthemum and use of thereof}

The present invention relates to a method of distinguishing a variety of chrysanthemum using SSR primer and SSR primer.

A large amount of genetic resources are being collected every year from most major crops and materials used for breeding. On the other hand, the evaluation of genetic resources has not been done sufficiently. Rapid identification of interspecies and subspecies of collected genetic resources is very important for the management and protection of accurate genetic resources. In addition, identification of genotypes, identification and classification of genotypes, and identification of their relationship are crucial to the conservation of genetic resources, the creation of new varieties, and the improvement of crops.

Recently, the rapid development of molecular biology has led to the development of nucleic acid fingerprinting methods and various DNA markers that enable the study of bio-diversity at the level of DNA (DNA). Through this, it is possible to perform simple and rapid search of useful traits, identification of species of organisms, classification and identification of cultivars, and flexible relationship analysis of group populations with little effect on external environments. Fingerprinting using the previously developed polymerase chain reaction (PCR) can be performed using randomly amplified polymorphic DNA (RAPD), amplified fragment length polymorphic DNA (AFLP) DNA) method, simple sequence repeat (SSR) method, and the like. Among these methods, the RAPD method has a disadvantage that the non-specific PCR products are amplified and thus the reproducibility is poor. The AFLP method is disadvantageous in that the appearance and analysis of bands having poor reproducibility are complicated because they are attracted by the detection of high DNA polymorphism. On the other hand, the SSR method is a method of preparing PCR primers based on the nucleotide sequence information in the microsatellite region, which is a DNA repeat sequence. As a result, it is easy to analyze the supersatellite and has high reproducibility. It is frequently used. Especially, the SSR method has an advantage that it is not affected by the external environment at all. Due to the superiority of SSR method, it is necessary to develop SSR markers for several major crops and raw materials.

Therefore, the present invention analyzes the genetic diversity and flexibility of chrysanthemum using SSR primer pairs, analyzes the genotypes of the chrysanthemum varieties, examines the possibility of classifying them, and proposes an efficient method of classifying the varieties.

The present invention provides an SSR primer pair having two nucleic acid sequences selected from the group consisting of SEQ ID NOS: 1-24.

In addition, the present invention can provide a kit for sorting chrysanthemum varieties containing the SSR primer pair.

In addition, the present invention can provide a method for distinguishing the chrysanthemum varieties using the SSR primer pair.

A "primer" of the present invention comprises a single stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied and can serve as a starting point for the synthesis of a primer extension product. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

The SSR primer pair according to the present invention can effectively detect the DNA polymorphism of chrysanthemum and can be usefully used to prepare a DNA profile of chrysanthemum. In addition, by efficiently evaluating the genetic resources of chrysanthemum, it is possible to effectively perform redundancy analysis and establishment of novelty with existing resources when introducing a new genetic resource.

Fig. 1 is information on 92 cultivated chrysanthemums and 3 wild chrysanthemums used in Experimental Example.
Figure 2 shows the results for seven SSR markers (KNUCRY1 to KNUCRY7) selected for 8 Bulk.
Figure 3 shows the results for seven SSR markers (KNUCRY7 to KNUCRY14) selected for 8 Bulk.
FIG. 4 shows the results of the group number determination in the group structure analysis.
Figure 5 is a phylogram of the 95 chrysanthemum resources of Figure 1.
FIG. 6 shows the result of 88 kinds of cultivated Chrysanthemum varieties classified using a minimum number of SSR primer pairs.

The present invention provides a pair of SSR primers having two nucleic acid sequences selected from the group consisting of SEQ ID NOS: 1-24.

Wherein the SSR primer pair comprises a pair of primers represented by SEQ ID NOS: 1 and 2; A pair of primers represented by SEQ ID NOS: 3 and 4; A pair of primers represented by SEQ ID NOS: 5 and 6; A pair of primers represented by SEQ ID NOS: 7 and 8; A pair of primers represented by SEQ ID NOS: 9 and 10; A pair of primers represented by SEQ ID NOs: 11 and 12; A pair of primers represented by SEQ ID NOS: 13 and 14; A pair of primers represented by SEQ ID NOS: 15 and 16; A pair of primers represented by SEQ ID NOs: 17 and 18; A pair of primers represented by SEQ ID NOs: 19 and 20; A pair of primers represented by SEQ ID NOS: 21 and 22; A primer pair represented by SEQ ID NOS: 23 and 24, and the like.

The SSR primer pair may be derived from chrysanthemum. The chrysanthemum is also called chrysanthemum. Chrysanthemums are widely grown for ornamental purposes, and there are many horticultural varieties. It is 1m high and its bottom is lignified. Leaves are staggered and split into quartz. The flowers bloom at the end of the stem with a double-headed flower. Flowers are yellow, white, red, purple, etc., depending on the variety, size and shape varies according to the variety. Depending on the diameter of the flower, it is called as the big wheel of 18cm or more, the one of 9cm or more of the middle wheel, and the smaller one of it is called the small wheel.

In the present invention, the oligonucleotide used as a primer may also include a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or And may include an intercalating agent.

The present invention can provide a kit for sorting chrysanthemum varieties including the SSR primer pair.

The chrysanthemum cultivar classification kit may further comprise at least one reagent selected from the group consisting of DNA polymerase, dNTPs, and a buffer. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

Further, the present invention provides a method for producing a genomic DNA comprising: extracting genomic DNA from chrysanthemum;

Performing the amplification reaction using the extracted genomic DNA as a template and using the SSR primer pair of claim 1 or 2; And

And a step of detecting the amplification reaction product.

The step of extracting the genomic DNA from the chrysanthemum comprises separating the genomic DNA from the chrysanthemum sample, and the separation method may be a method known in the art. For example, a cetyltrimethyl ammonium bromide reaction (CTAB reaction) may be used, or a wizard prep kit (Promega) may be used. The target sequence can be amplified by performing amplification reaction using the separated genomic DNA as a template and SSR primer pair according to an embodiment of the present invention as a marker. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification amplification system, amplification with strand displacement amplification or Qβ replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

The amplified target sequence may be labeled with a detectable labeling substance. According to another preferred embodiment of the present invention, the labeling substance may be a fluorescent, phosphorescent or radioactive substance, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. The primer pairs used to amplify the target sequence are as described above.

According to another preferred embodiment of the present invention, the detection of the amplification product can be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one method of detecting the amplification product, capillary electrophoresis can be performed. Capillary electrophoresis, for example, can use the ABi Sequencer. In addition, gel electrophoresis can be performed, and gel electrophoresis can utilize agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

According to a preferred embodiment of the present invention, the above-mentioned varieties of chrysanthemum are classified into three types: chrysanthemum, chrysanthemum, chrysanthemum, chrysanthemum, Hwangjeon, Chinmyeong Plum, Shinma, Haejae, Jungheung, Seowin, Gyeongheung, Jungheungchu, Yongma, Jungheung New Year, ST09-173-01, White light, White wire, White horse, Seinomami, Yucca, Zhengzhou, ST09-50-01, ST09-40-02, ST09-149-01, ST09-136-01, ST09-99-02, ST09-99-02, 173-11, Gold Coast, Green Day, Mona Lisa, Shamrock, Anastasia, Artik Queen, Euros, Vesuvio, Stellion, Yes Together, Nice, Royal Ardillo, Yesanuri, Argus, Yes Life, Penny Lane, Lollipop, Yes Smile, Chiro, Yes Day, Frog, Regan Orange, Marvel Orange, Rainbow, Moonlight, Viking, Buffy, Borami, Bimini, Yes Swan, Yesline, Yes Morning Popo ball, bright ball, pop ball ball, pop ball ball, pop ball ball, pop ball ball, pop ball ball, pop ball ball, bright ball, G-20, G-28, Rhododendron, Ulleung chrysanthemum, Kanto chrysanthemum and G-31.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

[ Example ]

Example  One. SSR  Concentrated library

 DNA was extracted from fresh leaves using the Qiagen DNA extraction kit (Qiagen, Hilden, Germany) in the chrysanthemum.

An SSR-enriched library was constructed from the DNA extracted from the chrysanthemum by the modified biotin-streptavidin capture method. Genomic DNA of the chrysanthemum was cut into seven restriction enzymes ( EcoR V , Dra I , Sma I , Pvu I , Alu I , Hae III , and Rsa I) and mixed. The mixed samples were separated by size in 1.4% agarose gel. Fragments ranging from 300 to 1500 bp were extracted from the gel and purified using a gel extraction kit (Qiagen). The purified DNA fragment (1 ug) was ligated with double-stranded adapter molecules (1 ug). Followed by ligation with an adapter (AP11-5'-CTC TTG CTT AGA TCT GGA CTA-3 'and AP-12-5'-TAG TCC AGA TCT AAG CAA GAG CAC A-3'). The adapter-lyzed DNA consists of repeating probes labeled with long (40-45 nucleic acids) biotin [(GA) _20, (CA) ₂₀ , (AT) ₂₀ , (GC) ₂₀ , (AGC) ₁₅ , ₁₅ , (AAG) ₁₅ , (AAC) ₁₅ , (AGG) ₁₅ ]. The hybridized DNA fragment was obtained with streptavidin covered with magnetic beads. The obtained DNA fragments were washed with distilled water, dissolved in 50 μl of distilled water, and then amplified by PCR using an AP11 primer. The amplified DNA fragment was cloned into pGEM-T Easy Vector (Promega).

After the GX FLX analysis, 18.83 Mbp sequence was obtained and the average length of read was 280.06 bp. GX FLX analysis results are shown in Table 1 below.

item Number Raw Wells 126,347 Key Pass Wells 122,228 Passed Filter Wells 67,246 Total Bases 18,830,109 Average length 280.06 Standard Deviation 144.37 Longest read length 741 The shortest read length 40 Medium length read length 290

Example  2. SSR Marker  Selection

100 primers having various motifs were constructed based on the nucleotide sequence obtained in Example 1, and polymorphic markers were selected for analysis of genetic diversity in 92 chrysanthemum cultivars and 3 wild species. The list of chrysanthemums used above is shown in FIG.

In order to reduce the analysis time and cost, polymorphism marker selection was performed by using the proposed BSM (Bulk selection method) to make one bulk by mixing the DNAs of 5 chrysanthemum species in the same amount. In the experiment for selecting polymorphic markers, 8 DNA amplification efficiency and polymorphism of 40 dog breeds were analyzed. The Bulk is shown in Table 2 below.

As a result of amplification with SSR markers produced for 8 chickens of 40 chrysanthemum varieties, KNUCRY7 and others showed a simple band form and showed polymorphism between the bulks and used for genetic analysis of chrysanthemum breeding species (FIG. 2 and FIG. 3).

Through the above process, 12 markers for diversity analysis were finally selected. The selected SSR markers are shown in Table 3 below.

Experimental Example  1. Genetic diversity analysis

Genotype analysis was performed on 92 cultivated chrysanthemums and 3 wild-type chrysanthemums using 12 pairs of SSR markers selected in the above examples. The cultivars of the 95 chrysanthemums are shown in Fig. 1 below.

DNA was extracted from the fresh leaves of 95 chrysanthemums using Qiagen DNA extraction kit (Qiagen, Hilden, Germany). To determine the relative purity or concentration, the concentration of each sample was prepared at 50 ng / μl using NanoDrop ND-1000 (NanoDrop Technologies, Inc., Wilmington, DE, USA).

Denaturation at 94 ° C for 30 seconds with the 12 primer pairs (see Table 3), annealing at 47-55 ° C for 45 seconds, and extension at 72 ° C for 1 minute were repeated 30 times And final amplification was performed for 5 minutes.

The lengths of the fragments were determined using a 3500 Genetic Analyzer (Applied Biosystems), and alleles, rare alleles, specific alleles, genotype no Heterozygosity (H), major allele frequency (MAF), gene diversity (GD) and polymorphic information content (PIC). The results are shown in Table 4 below.

primer  name size( bp ) NA ^a MAF ^b RA ^c SA ^d GD ^e H ^f PIC ^g KNUCRY-10 160-410 4 0.874 2 One 0.229 0.187 0.218 KNUCRY-16 151-500 29 0.382 27 18 0.742 0.236 0.708 KNUCRY-35 160-435 14 0.315 8 5 0.818 0.865 0.797 KNUCRY-58 150-254 5 0.620 One One 0.548 0.759 0.495 KNUCRY-59 134-500 27 0.437 23 11 0.779 0.517 0.767 KNUCRY-75 165-293 4 0.516 One 0 0.621 0.926 0.555 KNUCRY-76 150-286 8 0.817 6 5 0.315 0.367 0.290 KNUCRY-77 257-390 31 0.213 27 12 0.888 0.632 0.879 KNUCRY-84 152-500 35 0.332 30 18 0.843 0.348 0.832 KNUCRY-85 157-268 13 0.403 7 3 0.773 0.682 0.749 KNUCRY-94 160-197 7 0.617 4 One 0.566 0.713 0.524 KNUCRY-98 157-457 23 0.335 19 9 0.824 0.819 0.807 Mean - 16.7 0.488 5 7 0.662 0.588 0.635 ^{a number of} alleles, ^b major allele frequency, ^c Rare allele, ^d Specific allele, ^e genetic diversity, ^f observed heterozygosity, ^g polymorphism information content

As a result of the genetic diversity analysis, a total of 200 alleles were observed in 95 resources. As shown in Table 4, the number of alleles was relatively varied from 4 (KNUCRY-10 and KNUCRY-75) to 35 (KNUCRY-84), and the average number of alleles was 16.7. The distribution of allele frequencies in rare alleles with frequency less than 0.05 was 77.5%, frequency was more than 0.05, intermediate with less than 0.5 was 19.5%, and abundant allele with frequency more than 0.5 was 3%. The specific allele of each marker was 0 to 18 and the rare allele was 1 to 30, and specific allele and rare allele were found to be maximal in KNUCRY-84. The mean observed heterozygosity range of the population was 0.187 to 0.926, with an average of 0.588. The genetic diversity ranged from 0.229 (KNUCRY-10) to 0.888 (KNUCRY-77), with an average of 0.662 and a range of PIC of 0.218 (KNUCRY-10) to 0.879 (KNUCRY-77) .

Experimental Example  2. Group structure analysis

The analysis of the group structure of 95 chrysanthemum resources (see FIG. 1) was carried out using a structure program. The analysis group K was analyzed from 2 to 9, and 200,000 interactions and 100,000 burn- After analyzing the log likelihood value for each K, we determine the group that has the highest log likelihood value. If the log likelihood value for each group does not show the highest value and the log likelihood value In the case of increasing together, Evanno et al. 85 points of 89.4% were classified into three groups and 10 points of 10.6% were confirmed to be genetically incorporated (see FIG. 4). Seventeen of all the ornamental stations (16 points) and the standardized chrysanthemum varieties were included in group 1, and the other standard chrysanthemums (7 points) were included in group 2. Most of the spray chrysanthemums were included in group 2 (27 points), and the other 4 points were included in group 1. Port stops (7 points) and flower beds were included in group 3 (6 points).

As can be seen in Table 5 below, the mean genetic distance in the same group was highest at 0.639 for group 1, while it was lowest at 0.549 for group 3. Among the three groups, group 2 showed the highest heterozygosity and group 3 showed the lowest heterozygosity.

Group name Number of samples Number of alleles Genetic diversity Heterozygosity Polymorphism information content all 95 16.7 0.662 0.588 0.635 Group 1 34 10.2 0.639 0.596 0.608 Group 2 35 9.3 0.614 0.652 0.580 Group 3 16 4.6 0.549 0.397 0.500

GD-based analysis was performed by measuring the shared allele frequencies of 95 varieties. The unrooted phylogram (neighbor-joining tree) used power markers and MEGA4 program, and the unrooted phylograms were classified based on model-based analysis (see FIG. 5).

Experimental Example  3. Minimal SSR Marker  Varieties using set

95 Diversity Analysis In order to search for the breed marker for cultivated chrysanthemum (1 to 88) among the chrysanthemum resources (see FIG. 1), four markers having a high polymorphism (PIC value) were selected from 12 markers showing polymorphism The varietal discriminant power was tested. The four markers selected above are shown in Table 6 below.

primer  name book Ten number Forward sequence book Ten number Reverse sequence KNUCRY-35 5 CCTCGCACTACTTCCAAATGA 6 GGAGATTGTTTGTTCGTATCCTT KNUCRY-77 15 CCCGGTTATCATGTGTATGC 16 CGTATTTAAAGGTTTTCCTTTCG KNUCRY-84 17 CTAGGCTCCTTCAGCCCTCT 18 TCTGGACTAGCCGTCAGTTG KNUCRY-98 23 TCACATCACACATCACTGCAA 24 TGTGTGTGAGGGACACATGA

As shown in the following Table 7, a total of 98 alleles were observed in the genetic diversity analysis of 88 cultivated chrysanthemums using the 4 SSR primer pairs. The number of alleles was KNU-84 at 36 The number of alleles was 20.5 in KNU-98, 31 in KNU-77, and 11 in KNU-35. The average number of alleles was 24.5. The genetic diversity and polymorphism information content (PIC) indicating the genetic diversity of the markers used in the analysis was highest at 0.8938 and 0.8858 in KNU-77.

primer  name Major allele
frequency Number of alleles Genetic diversity Heterozygosity Diversity information content KNU-84 0.3352 36 0.8474 0.3750 0.8373 KNU-98 0.3295 20 0.8220 0.8182 0.8040 KNU-77 0.2188 31 0.8938 0.6625 0.8858 KNU-35 0.3232 11 0.8155 0.8780 0.7941 Average 0.3017 24.5 0.8447 0.6834 0.8303

A phylogenetic tree was constructed and analyzed using the KNU-84 marker, which has the highest allele frequency, genetic diversity, and diversity information (PIC) values for the identification of cultivated chrysanthemum using the SSR primer pair. The analysis was carried out in four steps. KNU-98, KNU-77, and KNU-35 marker were added in order of step.

As a result of 1 step discrimination using KNU-84 marker, 25 out of 88 chrysanthemum resources were identified. In the second step, KNU-98 markers were added, and 34 points, which were not identified in the first step, were identified. 17 points were determined in the third stage using the KNU-77 marker, and 12 points in the fourth stage using the KNU-35 marker. As a result, all of the 88 chrysanthemums could be discriminated using the four polymorphic SSR markers (Fig. 6).

As can be seen from the above Examples and Experimental Examples, the SSR primer pair (marker) according to the present invention can effectively detect DNA polymorphism of chrysanthemum and can be usefully used for preparing a DNA profile of chrysanthemum. In addition, by efficiently evaluating the genetic resources of chrysanthemum, it is possible to effectively perform redundancy analysis and establishment of novelty with existing resources when introducing a new genetic resource.

<110> KONGJU NATIONAL UNIVERSITY INDUSTRY-UNIVERSITY COOPERATION FOUNDATION <120> SSR primer derived from Chrysanthemum and use of thereof <130> 1039189 <160> 24 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Chrysanthemum <400> 1 gtgtcttcat cccaccacca 20 <210> 2 <211> 25 <212> DNA <213> Chrysanthemum <400> 2 tgtgagagag tgagtgtagt gtgag 25 <210> 3 <211> 20 <212> DNA <213> Chrysanthemum <400> 3 tgttcaccca ttcacagctc 20 <210> 4 <211> 24 <212> DNA <213> Chrysanthemum <400> 4 cacatgtatg actaggtgag gtga 24 <210> 5 <211> 21 <212> DNA <213> Chrysanthemum <400> 5 cctcgcacta cttccaaatg a 21 <210> 6 <211> 23 <212> DNA <213> Chrysanthemum <400> 6 ggagattgtt tgttcgtatc ctt 23 <210> 7 <211> 20 <212> DNA <213> Chrysanthemum <400> 7 ggtggaattg ctccttgttg 20 <210> 8 <211> 21 <212> DNA <213> Chrysanthemum <400> 8 ccatcatcaa cacaagcttc a 21 <210> 9 <211> 20 <212> DNA <213> Chrysanthemum <400> 9 cggtcctctc agccttattg 20 <210> 10 <211> 20 <212> DNA <213> Chrysanthemum <400> 10 ggtgtgtgtg tgaaggtgct 20 <210> 11 <211> 20 <212> DNA <213> Chrysanthemum <400> 11 gtggttgagc catttgaggt 20 <210> 12 <211> 22 <212> DNA <213> Chrysanthemum <400> 12 ttggctattg tgatttctac gc 22 <210> 13 <211> 20 <212> DNA <213> Chrysanthemum <400> 13 ttgaggttgt ggaaatgcag 20 <210> 14 <211> 21 <212> DNA <213> Chrysanthemum <400> 14 cgcgttaact ttggtgtttt t 21 <210> 15 <211> 20 <212> DNA <213> Chrysanthemum <400> 15 cccggttatc atgtgtatgc 20 <210> 16 <211> 23 <212> DNA <213> Chrysanthemum <400> 16 cgtatttaaa ggttttcctt tcg 23 <210> 17 <211> 20 <212> DNA <213> Chrysanthemum <400> 17 ctaggctcct tcagccctct 20 <210> 18 <211> 20 <212> DNA <213> Chrysanthemum <400> 18 tctggactag ccgtcagttg 20 <210> 19 <211> 20 <212> DNA <213> Chrysanthemum <400> 19 gaccaacaaa acggaatgct 20 <210> 20 <211> 20 <212> DNA <213> Chrysanthemum <400> 20 gttgtcgtcc gttggctagt 20 <210> 21 <211> 23 <212> DNA <213> Chrysanthemum <400> 21 cattcaggac agtcatacaa gtg 23 <210> 22 <211> 22 <212> DNA <213> Chrysanthemum <400> 22 caacacacac acacacagga at 22 <210> 23 <211> 21 <212> DNA <213> Chrysanthemum <400> 23 tcacatcaca catcactgca a 21 <210> 24 <211> 20 <212> DNA <213> Chrysanthemum <400> 24 tgtgtgtgag ggacacatga 20

Claims (9)

A pair of primers represented by SEQ ID NOS: 5 and 6;
A pair of primers represented by SEQ ID NOS: 15 and 16;
A pair of primers represented by SEQ ID NOs: 17 and 18; And
A pair of SSR primers comprising a pair of primers represented by SEQ ID NOs: 23 and 24; delete The pair of SSR primers according to claim 1, wherein the pair of primers is derived from chrysanthemum. A kit for sorting chrysanthemum varieties, comprising the SSR primer pair of claim 1. [5] The kit for sorting chrysanthemum varieties according to claim 4, wherein the chrysanthemum cultivar classification kit further comprises at least one reagent selected from the group consisting of DNA polymerase, dNTPs, and a buffer. [4] The method of claim 4, wherein the chrysanthemum varieties are selected from the group consisting of the Korean traditional Korean variety, the autumn lady, the river boar, the Korean liliaceae, the Korean chrysanthemum flower, the chrysanthemum flower, ST09-173-01, White light, White line, White horse, Seinomami, Yuka, Zhengzhou, Seiko no Yosse, Longevity yellow, Seino Isami, ST06 -03-01, ST09-148-04, ST09-50-01, ST09-40-02, ST09-149-01, ST09-136-01, ST09-99-02, ST09-173-11, Gold Coast, You can find out how you can find out more about Green Day, Mona Lisa, Shamrock, Anastasia, Artik Queen, Euro, Vesuvio, Stellion, Yes Together, Nice, Royal Ardillo, Yesnuri, Argus, Yes Life, Penny Lane, Bobby, Bobby, Borami, Bimini, Yes Swan, Yesline, Yes Morning, Uno Ivory, Yesstar, Whistle, G-20, G-28, G-28, Green Valley, Lima Honey, Monroe, Peace Angel, Peace Yellow, Peace Pink, Sasquia, Pico Salto, Peace Copper, Passo Red, Gold Droplet, , Ulleung chrysanthemum, Kanto chrysanthemum, and G-31. &Lt; IMAGE &gt; Extracting genomic DNA from chrysanthemum;
Performing the amplification reaction using the extracted genomic DNA as a template and the SSR primer pair of claim 1; And
And detecting the amplification reaction product. [8] The method according to claim 7, wherein the detection of the amplification product is performed by capillary electrophoresis, DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement. 9. The method according to any one of claims 7 to 8, wherein the chrysanthemum varieties are selected from the group consisting of Korean traditional oriental oriental varieties, autumnal ladies, river blooms, Korean white lilies, Korean chrysanthemum flowers, chrysanthemum flowers, , Hwajeongjeon, Cheonhyangmulhwa, Shinma, Haejae, Jungheungseong, Suishin, Daejin, Jeongheungchu, Yongma, Jungheung New Year, ST09-173-01, White light, White wire, White horse, Seinomami, Yucca, Zhengzhou, Longevity Huang, Seino Isami, ST06-03-01, ST09-148-04, ST09-50-01, ST09-40-02, ST09-149-01, ST09-136-01, ST09-99-02, ST09 -173-11, Gold Coast, Green Day, Mona Lisa, Shamrock, Anastasia, Artic Queen, Euros, Vesuvio, Stellion, Yes Together, Nice, Royal Ardillo, Yesanuri, Argus, Yes Life, Penny Lane, , Lollipop, Yes Smile, Chiro, Yes Day, Frog, Regan Orange, Marvel Orange, Rainbow, Moonlight, Viking, Buffy, Borami, Bimini, Yes Swan, Yesline, Yes Morning, Uno Pop ball ball, Bright ball, G-ball, Y-star, Whistle, Green Valley, Limahani, Monroe, Peace Angel, Peace Yellow, Peace Pink, Sasquia, Pico Salto, Peace Copper, 20, G-28, Chrysanthemum, Ulleung chrysanthemum, Kanto chrysanthemum, and G-31.

Images