KR101413105B1 - Cosmetic composition with anti-UV and anti-wrinkle effect from Caragana sinica Rehder - Google Patents

Abstract

The present invention relates to a cosmetic composition for preventing skin damage and improving wrinkles caused by ultraviolet rays containing an extract of Bombyx mori, wherein the Bombyx mori extract of the present invention can prevent skin damage due to ultraviolet rays, The elasticity can be improved.

Description

Technical Field [0001] The present invention relates to a cosmetic composition for preventing skin damage and improving wrinkles caused by ultraviolet rays containing an extract of Bombyx mori,

The present invention relates to a cosmetic composition for preventing skin damage and improving wrinkles caused by ultraviolet rays containing a bamboo shoot extract.

Various skin aging phenomena occur in the dermis and epidermis that make up the skin. Skin aging can be classified into intrinsic aging (natural aging) and extrinsic aging, and photoaging including ultraviolet rays and heat is known as a representative extrinsic aging agent.

Endogenous aging is characterized by aging phenomena such as fine lines, dryness of the skin and reduced elasticity when the skin is not exposed to sunlight. Exogenous aging (photoaging) is more severe than endogenous aging and promotes endogenous aging Feature.

UVB refers to ultraviolet rays in the region of 290 to 320 nm, and is the shortest wavelength of ultraviolet light that causes skin blackening, burns, inflammation, and erythema. Recently, interest in UVA-induced aging of the longer wavelength region (320 to 377 nm) is rising. UVA has a longer wavelength than UVB and reaches the dermis deep into the skin, causing the death of fibroblasts, increasing collagenase activity of fibroblasts, reducing collagen production, and promoting skin elasticity reduction and wrinkling It is known.

Caragana sinica Rehder is a leguminous plant that grows in Korea and China, originating from the roots of oriental or other oriental plants. The height is about 2 m and the upward-directed bough spreads in all directions. The stem is grayish brown and the thorns gather and there are five ridges. Leaves are alternate phyllotaxis, odd numbered pinnate leaves, and small leaves are 4 oval. The small leaf has a length of 8 to 17 cm and the leaf of 12 to 18 cm is called a microphylla (var. Megalantha). Carbohenol A (resveratrol trimer), (+) - isoampelopson F (resveratrol dimer), caraphenol B (resveratrol dimer), caraphenol C (resveratrol dimer and the like. The oligosiloxane has been reported to contain oligostilbene. (Hong-Feng Luo et al., Tetrahedron, 57, 4849, 2001). Major efficacy is known to be effective in tonic, diuretic, rheumatism, arthritis, major depression, back pain, acute mastitis, tinnitus, bones and neuralgia.

Korean Patent Laid-Open Publication No. 10-2011-0108029 discloses a method for producing fermented fermented extract of Fermented Beetle with a microorganism and a cosmetic composition containing the fermented extract. Quot ;, which is free from irritation to the skin and is safe and has no problem of inducing skin diseases, exhibits a whitening effect by inhibiting the activity of tyrosinase, And can be used as a skin anti-aging cosmetic composition. However, the above-mentioned document does not disclose 'effect of preventing damage to skin due to ultraviolet rays and effect of improving wrinkles'.

Accordingly, the present invention provides a cosmetic composition for preventing skin damage and improving wrinkles caused by ultraviolet rays using a bamboo shoot.

Also, the present invention provides a cosmetic composition for preventing skin damage caused by ultraviolet rays, which comprises an extract of Bombyx mori as an active ingredient. At this time, the extract is preferably a hot water or ethanol extract. According to the following experiment, the bamboo shoot extract of the present invention promoted the proliferation of keratinocyte cells, thus confirming the effect of strengthening the skin barrier. In addition, it was confirmed that the extract of Bombyx mori extract of the present invention promotes Tgase-1 expression and promotes keratinocyte differentiation of keratinocytes. In addition, it was confirmed that the bamboo shoot extract of the present invention has an effect of protecting keratinocytes from ultraviolet rays.

On the other hand, the present invention provides a cosmetic composition for improving wrinkles, which comprises an extract of angiospermum ethanol as an active ingredient. According to the following experiment, it was confirmed that the ethanol extract of bamboo shoots of the present invention has an effect of improving wrinkles and elasticity by promoting fibroblast proliferation. In addition, it has been confirmed that the ethanol extract of Curcuma chinensis of the present invention promotes the expression of fibroblast collagen and has the effect of improving the wrinkles and elasticity of skin from ultraviolet rays.

On the other hand, it was confirmed that the bamboo shoot extract of the present invention is a safe material which does not cause skin irritation when the skin irritation test of the present invention is conducted.

The cosmetic composition of the present invention is not limited to a specific formulation and includes all forms of cosmetics that can be used for cosmetics such as lotion, gel, water-soluble liquid, cream, essence, oil / A makeup base, a foundation, a skin cover, a lipstick, a lip gloss, a face powder, a two-way cake, an eye shadow, a teak collar, And color cosmetic formulations made of eyebrow pencils.

The bioremdola extract of the present invention can prevent skin damage due to ultraviolet rays.

In addition, the ethanol extract of bamboo shrimp of the present invention has the effect of improving wrinkles and improving skin elasticity.

Fig. 1 shows the results of confirming the cell proliferation effect on keratinocytes of Bombyx mori.
FIG. 2 shows the results of confirming the keratinocyte differentiation factor-regulating effect on the keratinocytes of Bongdamoolcho extract.
Fig. 3 shows the result of confirming keratinocyte cell protection effect against UVB of bamboo shoot extract.
FIG. 4 shows the results of confirming the proliferation promoting effect of the extract of Bombyx mori L. on the fibroblasts.
FIG. 5 shows the results of confirming the expression promoting effect of procollagen-1 on the extract of Bombyx mori.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the scope of the present invention is not limited to the following embodiments, and includes modifications of equivalent technical ideas.

[Example 1: Preparation of Bombyx mori extract]

 (1) Preparation of ethanol extract

Dried, and then pulverized again to obtain a powder. Then, 70% (v / v) ethanol was added to the dried material at a ratio of 20 times, and the mixture was extracted for 3 hours. The polymer precipitate and cells were removed using a paper filter paper having a pore size of 1 μm and an extract was obtained. The extract was concentrated using a rotary evaporator (EYELA), and then used in the following experiment.

 (2) Preparation of hot-water extract

In the case of hot water extraction, distilled water was added at a ratio of 20 times with respect to the dry material, and hot water extraction was performed using a hot water bath for 3 hours. The polymer precipitate and cells were removed using a 1 μm pore size paper filter paper to obtain an extract. The extract was concentrated by using a rotary vacuum concentrator and then used in the following experiment.

[Experimental Example 1: Evaluation of skin efficacy against keratinocyte (HaCaT)] [

(1) Evaluation of proliferative activity of keratinocytes, MTT assay

In order to confirm the cytotoxicity of the sample to keratinocytes, keratinocytes (HaCaT) were cultured at a concentration of 1 × 10 ⁵ cells / ml in a 96-well plate, and after 24 hours, The extracts were diluted to a concentration of 10-200 μg / ml. After 24 hours, 20 μl of 5 mg / ml MTT (M2128, Sigma) was added using PBS (phosphate buffer saline) and cultured for 4 hours. Thereafter, the medium was removed, and 100 μl of isopropanol was added to each well. After stirring, the absorbance at 570 nm was measured with an ELISA reader (Perkin Elmer, Victor ³ ).

The cell proliferative activity of bryophytae extracts on keratinocytes was confirmed to be 112% and 107%, respectively. FIG. 1 shows the results of confirming the cell proliferation effect on keratinocytes of Bombyx mori.

From the above results, it can be confirmed that the bamboo shoot extract of the present invention promotes the proliferation of keratinocytes, contributes to skin barrier enhancement, and is free from cytotoxicity.

 (2) Evaluation of keratinocyte differentiation promoting ability of keratinocytes, Transglutaminase-1 RT-PCR]

Transglutaminase-1 (Tgase-1) is a typical exfoliating factor in which keratinocytes increase during keratinization or keratinization. It is known that when the amount of Tgase-1 expressed in keratinocytes is increased, skin barrier is enhanced by promoting keratinization. In this experiment, it was determined whether or not the sample prepared in Example 1 had the ability to promote keratinocyte differentiation of keratinocytes.

For the experiment, keratinocyte cultured plate treated with bamboo shoot extract was washed with PBS, and RNAiso (# 9108, Takara) was added to 10% of the volume of the culture medium and cultured for 5 minutes. Cells were desorbed with a cell scraper and incubated with a chloroform solution of 0.2 times the RNAiso capacity. After centrifugation at 4 ° C and 12,000 × g, only the liquid phase layer of the supernatant was transferred separately, isopropanol was added at a ratio of 0.5 times the RNAiso capacity, and then cultured. RNA was quantitated at 260 nm, and 1 μl of oligo d (T), 4 μl of total RNA (2 μg) and 6.5 μl of DEPC were reacted at 70 ° C for 10 minutes. Then, 4 μl of 5 × incubation buffer, 4 μl of 2.5 mM dNTP, and 0.5 μl of reverse transcriptase were added, and the cDNA was prepared at 42 ° C. for 60 minutes and at 70 ° C. for 15 minutes. Then, 17 μl of distilled water, 1 μl of cDNA, 1 μl of 5'-primer and 1 μl of 3'-primer were added to the PCR premix (bioneer, K-2016) to perform PCR. (Table 1)

The primer sequence used in this experiment gene Primer sequence
(5 ' - > 3 ') PCR reaction temperature () denaturalization Ernie Elling expansion Tgase-1 TGATCGCATCACCCTTGAGT 94 55 72 GTAGATCTCATTGCGGGGGT GAPDH
(PCR control group) TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG

As a result, it was confirmed that the 100 μg / ml ethanol extract of Bombyx mori and the 200 μg / ml hot water extract of Bombyx mori increased Tgase-1 expression. FIG. 2 shows the results of confirming the keratinocyte differentiation factor-regulating effect on the keratinocytes of Bongdamoolcho extract.

Thus, it was confirmed that the extract of Bombyx mori extract of the present invention promotes the expression of Tgase-1, a keratinocyte differentiation factor of keratinocytes, and thus has a skin barrier enhancing effect.

 (3) Evaluation of protective effect of keratinocytes against UVB, MTT assay

The maximum effective concentration of each sample prepared in Example 1 was selected and treated on a 96-well or 35 mm plate for 24 hours. Thereafter, the medium containing the sample was removed, PBS was added, and an ultraviolet lamp (Vilber Lourmat, France) was used at 30 mJ / cm²And the culture medium containing the sample was treated again. After 24 hours, cytotoxicity was assessed by MTT assay.

As a result of the experiment, UVB 30 mJ / cm ² irradiation showed about 14% toxicity compared to non - irradiated group. However, when treated with 100 μg / ml ethanol extract, the cell viability was 113%, and when treated with 200 μg / ml hot water extract, it was 106%. The ethanol extract of 100 μg / ml showed the ability to recover to the level of UV-free control. Fig. 3 shows the result of confirming keratinocyte cell protection effect against UVB of bamboo shoot extract.

Thus, it was confirmed that the bamboo shoot extract of the present invention promotes the proliferation of keratinocytes and has cytoprotective effect against ultraviolet rays.

Experimental Example 2: Evaluation of skin effect on fibroblast (CCD-986sk)

 (1) Evaluation of proliferation of fibroblasts, MTT assay

To confirm the cytotoxicity of the sample of Example 1 against fibroblasts, fibroblasts (CCD-986sk) were cultured at a concentration of 1 × 10 ⁵ cells / ml in a 96-well plate and after 24 hours, Each sample was diluted to a concentration of 10 to 200 μg / ml. After 24 hours, 20 μl of 5 mg / ml MTT (M2128, Sigma) was added using PBS (phosphate buffer saline) and cultured for 4 hours. Then, the medium was removed, and 100 μl of isopropanol was added to each well and stirred. Then, the absorbance at 570 nm was measured with an ELISA reader.

As a result of the experiment, it was confirmed that ethanol extract of 200 ug / ml ethanol extract promoted the proliferation rate of fibroblast by about 17%. Fig. 4 shows the result of confirming the proliferation promoting effect of the ethanol extract of angiospermium on fibroblasts.

Therefore, it was confirmed that the ethanol extract of Curcuma chinensis of the present invention is non-toxic and promotes the proliferation of fibroblasts, and the hydrocortisone extract of the present invention has 1 to 10% cytotoxicity.

(2) Expression promotion of fibroblast collagen expression, Procollagen type-1 ELISA kit

Procollagen-1, produced by fibroblasts, is a precursor of collagen that constitutes the dermis and is known to be reduced by ultraviolet UVA. Therefore, in this experiment, the extract of bryophyta of the present invention prepared in Example 1 And to confirm the protective effect of procollagen-1.

Experiments were performed using an ELISA kit of 'Procollagen Type I C-peptide EIA kit (MK101, Takara)'. The antibody-POD conjugate solution, the sample (the bamboo shoot extract of Example 1), and the standard diluted by the concentration were added to a microplate coated with the antibody and reacted at 37 ° C for 3 hours Respectively. After washing with buffer solution 3 to 4 times, substrate solution was added and reaction was carried out for 15 minutes. For stopping the reaction, stop solution was added and absorbance was measured at 450 nm with an ELISA reader.

As a result, about 69% inhibition of procollagen - 1 production was observed in the fibroblasts when irradiated with UVA 1 J / cm ² . However, when irradiated with 200 μg / ml ethanol extract of bamboo shoots, the effect of promoting procollagen-1 expression was 23% after UV irradiation.

Therefore, it was determined that the extract of bamboo shrimp ethanol extract of the present invention promotes collagen synthesis of fibroblasts, thereby improving wrinkles. FIG. 5 shows the results of stimulating the expression of procollagen-1 in the extract of Bombyx mori.

Experimental Example 3: Assessment of skin irritation induction

In order to evaluate the skin irritation induced by the present invention, the primary stimulation test and the cumulative stimulation test were performed on the human body through a human patch test.

Twenty healthy adults were tested according to the CTFA guidelines (The Cosmetic, Toiletry and Fragrance Association, Inc., Washington, DC, 20036, 1991). After 20 μl of sample was dropped into the Finn chamber, it was applied to the inside of the test arm and fixed with a tape.

The primary skin irritation test was performed for 24 hours, then the patch was removed, and after 4 hours and 24 hours, the skin reaction of the test area was judged.

Assessment of skin irritation induction sample Tested embroidery Judgment result Irritation degree ++ + ± - Cedarwood (ethanol) 20 - - - 20 0 Coral reef (hydrothermal) 20 - - - 20 0 Control group 20 - - - 20 0

<Criteria>
++: Severe, reddish and swollen than around
+: Significantly reddened than surrounding
±: slightly redder than around
-: No erythema or unusual phenomenon
<Formula>

As a result of evaluating the skin irritation test on the human body, it was confirmed that the ethanol extract and hot water extract of the present invention did not induce skin irritation and were safe for skin application.

Production Example 1: Cosmetic preparation containing lotus root extract (lotion)

Cosmetic (lotion) samples were prepared according to the compositions shown in Table 3 below.

Lotion sample composition ingredient
(Content:% by weight) Comparative Example 1 Production Example 1 Purified water to 100 to 100 Ethanol Extract - 0.1 Carboxyvinyl polymer 4 4 Ethyl hydrobenzoate 0.1 0.1 Liquid paraffin 3 3 Vitamin E acetate 0.1 0.1 silicon 0.8 0.8 Ketyl alcohol 0.5 0.5 Sorbitan monostearate One One Polysorbate 60 0.3 0.3 Methylsulfonylpentane 0.2 0.2 Propylene glycol 2 2 Butylene glycol 5 5 Methyl paraben 0.2 0.2 Triethanolamine 0.1 0.1 ETDA-2Na 0.03 0.03

Experimental Example 4: Evaluation of skin elasticity improvement effect

The above Preparation Example 1 and Comparative Example 1 were applied to face for 2 weeks for 20 weeks for 20 weeks, and then skin elasticity was measured using a skin elasticity meter (cutometer, Germany). A sample (Preparation Example 1 or Comparative Example 1) was applied to the left side of the face, and nothing was applied to the right side.

Confirm skin elasticity improvement effect Results after 4 weeks Skin elasticity Production Example 1 0.31 Comparative Example 1 0.15

R_(좌): 좌측 안면의 피부탄력
R_(우): 우측 안면의 피부탄력
<Formula>

R _(left) : skin elasticity of left face
R _(right) : Skin elasticity of right facial

As a result of the experiment, it was confirmed that the skin elasticity was increased when Preparation Example 1 containing the extract of bamboo shoots ethanol was applied compared to Comparative Example 1. [

On the other hand, sensory evaluation was performed on the skin wrinkle improvement and the skin elasticity improvement effect of the above 20 female subjects in their forties. At this time, 5 items were evaluated as 'very good', 'good', 'normal', 'poor' and 'very poor' for the effect of improving the wrinkles and elasticity of the skin.

Wrinkle and elasticity improvement sensory evaluation Evaluation items Sensory evaluation
(Poll) Survey number (persons) Very good
(5 points) good
(4 points) usually
(3 points) Poor
(2 points) Very bad
(1 point) score
total
(Maximum 100, minimum 20) wrinkle improvement Production Example 1 8 4 5 2 One 76 Comparative Example 1 0 One 6 6 7 41 Skin elasticity Production Example 1 6 7 6 0 One 77 Comparative Example 1 0 One 8 7 4 46

As a result of the evaluation, it was confirmed that, in the case of Production Example 1, the wrinkle improvement and skin elasticity as compared with Comparative Example 1 were better.

Claims (3)

A cosmetic composition for preventing skin damage caused by ultraviolet rays, which comprises an extract of Bombyx mori as an active ingredient. The method according to claim 1,
The above-
Wherein the composition is a hydrothermal extract or an ethanol extract. A cosmetic composition for improving wrinkles characterized by containing an extract of Angelica keisca as an active ingredient.

Images