KR101408304B1 - Method for Preparing 2,3-butanediol from Commercial carbon source by Transformed Klebsiella pneumoniae - Google Patents

Abstract

The present invention relates to a process for preparing a 2,3-butanediol, and more particularly, to a process for producing 2,3-butanediol, comprising: (a) inactivating a nucleotide sequence encoding a wabG of Kepsilaella; (b) preparing a recombinant vector by inserting a nucleotide sequence encoding acetolactate decarboxylase and a nucleotide sequence encoding acetolactate synthase into an expression vector; (c) introducing the recombinant vector into the Klebsiella to prepare a transformed Klebsiella; (d) culturing the transformed Krepsiella in a culture medium to produce 2,3-butanediol; And (e) obtaining the 2,3-butanediol. The method for producing 2,3-butanediol using the transformed Klebsiella . According to the present invention, 2,3-butanediol can be produced economically using an industrial carbon source which is more economical than the conventional art.

Description

Method for Preparing 2,3-butanediol from Commercial Carbon Source by Transformed Klebsiella pneumoniae Using a Transformed Krebsiella pneumoniae [

The present invention relates to a process for the production of 2,3-butanediol from industrial carbon sources using a transformed Klebsiella lunomycota.

Due to global warming and lack of crude oil reserves, biomass conversion processes and strategies for producing fuels and chemicals from renewable raw materials using biological methods are being developed globally. For example, 2,3-butanediol (BDO) is an economically important raw material that is widely used as a feedstock for chemical feedstocks, liquid fuels, and biosynthetic bases. The dehydration reaction can convert 2,3-BDO to methyl ethyl ketone, which is used as an additive in liquid fuels, and 2,3-BDO can be converted to 1,3-butadiene, an essential element of synthetic rubber. have. Biological production of industrially available 2,3-BDO is accomplished using the Aerobacter aerogenes , Klebsiella pneumoniae) and has been achieved by the 2,3-BDO biosynthetic pathway of some micro-organisms containing poly miksa Bacillus (Bacillus plymyxa). Klebsiel has a broad substrate spectrum and culture adaptability and is reported to produce 2,3-BDO efficiently. Krebsia is a promising microorganism for 2,3-BDO biosynthesis, but has disadvantages such as Klebsiella toxicity, low productivity, isomer isolation and expensive carbon source requirements such as glucose.

However, Klebsiella pneumoniae has opportunistic infectivity and is a major cause of hospital infection. It causes pneumonia through respiratory infections and causes bacteremia, urinary tract infections, and wound infections. Removing the virulence of Klebsiella, which causes these various diseases, will be safe for use in 2,3-butanediol production. Capsulpolysaccharide, Lipopolysacchardie, and Fili are the main pathogenic agents of Klebsiella. Of these, lipopolysaccharide is one of the constituents of the outer membrane, has endotoxin, and protects Krebscheiler from various chemical attacks.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop a method for producing 2,3-butanediol using economical and biological methods to overcome the energy crisis due to the reduction of natural crude oil. As a result, the wabG gene of Krebsiella producing 2,3-butanediol was inactivated, and nucleolide and acetolactate synthase encoding acetolactate decarboxylase were inactivated, And a 2,3-butanediol using an industrial carbon source. The present invention has been completed based on this finding.

Accordingly, an object of the present invention is to provide a process for producing 2,3-butanediol.

Another object of the present invention is to provide 2,3-butanediol.

According to one aspect of the present invention, the present invention provides a process for preparing a 2,3-butanediol using a transformed Klebsiella comprising the steps of:

(a) inactivating a nucleotide sequence encoding a wabG of Kepsilaella;

(b) preparing a recombinant vector by inserting a nucleotide sequence encoding acetolactate decarboxylase and a nucleotide sequence encoding acetolactate synthase into an expression vector;

(c) introducing the recombinant vector into the Klebsiella to produce a transformed Klebsiella.

(d) culturing the transformed Krepsiella in a culture medium to produce 2,3-butanediol; And

(e) obtaining the 2,3-butanediol.

The present inventors have sought to develop a method for producing 2,3-butanediol using economical and biological methods to overcome the energy crisis due to the reduction of natural crude oil. As a result, the wabG gene of Krebsiella producing 2,3-butanediol was inactivated, and nucleolide and acetolactate synthase encoding acetolactate decarboxylase were inactivated, Was introduced, and 2,3-butanediol was prepared by using an industrial carbon source.

The process for preparing 2,3-butanediol of the present invention will be described in detail as follows:

Step (a): deactivation of wabG

First, the nucleotide sequence encoding the wabG of Klebsiella species is inactivated. The wabG is involved in the core biosynthesis of lipopolysaccharide, which is one of the components constituting the outer membrane of Krebs cell.

The wabG to be inactivated was found and identified in various Klebsiella . In the following examples, wabG of Kepsiella annumi of the first sequence of SEQ ID NO: 2 is exemplified, but various wabGs are included in the present invention. For example, GenBank accession number JN377744 ( Klebsiella pneumoniae ), Accession No. NC_013508 ( Edwardsiella tarda ), accession number A6RW62 ( Botryotinia fuckeliana), access number NC_014378 (Acetohalobium arabaticum) and access number JH417870 (Yokenella The wabG disclosed regensburgei) may be inactivated in the subject invention.

The term " inactivation " as used herein in reference to wabG refers to modifications in the genomic lobes of wabG that result in transcription or translation of the gene or impairment of activity of the gene product . Such genetic modification may include not only inactivation of the wabG coding sequence but also inactivation of its promoter. The specific inactivation of only the gene of interest in the yeast genome is possible by mutation through substitution, insertion, deletion, or a combination thereof in all or at least one subdomain of the coding gene. For example, deletion of a gene and insertion of a heterogenous sequence into a gene can be accomplished by truncation of a gene, nonsense mutation, frameshift mutation, missense mutation, etc. . Specific deactivation of these genes can be accomplished through methods established in the art.

The term " deletion " as used herein in reference to wabG has the meaning of including all deletion mutations that disrupt the function of wabG . For example, deletion of the wabG gene includes both partial deletion or complete deletion of the wabG coding sequence.

Deletion of such wabG coding sequences can be accomplished through a variety of mutagenesis methods known in the art. For example, deletion of the wabG coding sequence can be carried out by PCR mutagenesis and cassette mutagenesis (Sambrook, J. et al., Molecular Cloning . A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001)).

Preferably, the Klebsiella is named Klebsiella < RTI ID = 0.0 > pneumonia , Klebsiella < RTI ID = 0.0 > oxytoca), keurep when Yes in Ella clematis (Klebsiella granulomatis) or keurep when Ella Terry agent or press (Klebsiella terigena , more preferably, Klebsiella pneumoniae, or Klebsiella oxytocar , and even more preferably Klebsiella pneumoniae.

Preferably, the Klebsiella mutant strain inactivating the wabG gene lacks a capsule polysaccharide.

According to a preferred embodiment of the present invention, the Klebsiella mutant strain in which the wabG gene of the present invention is deleted has a less uniform cluster structure and deletion of the capsular polysaccharide as compared with the Klebsiella wild type strain.

Preferably, the nucleotide sequence encoding the wabG is non-pathogenic, called inactivated Klebsiella.

Step (b): Preparation of recombinant vector

Two acetolactate decarboxylase nucleotide sequence and acetolactate synthase encoding (acetolactate decarboxylase) in a second step, when keurep Ella for the manufacture of a mes o-2,3- butane diol according to the invention ( acetolactate synthase) is inserted into an expression vector to prepare a recombinant vector.

The enzymes to be introduced into Klebsiella in the present invention are acetolactate decarboxylase and acetolactate synthase. Preferably, the nucleotide sequence encoding the acetolactate decarboxylase is SEQ ID NO: 2, and the nucleotide sequence encoding the acetolactate synthase is SEQ ID NO: 3.

The nucleotide sequence used in the present invention is interpreted to include a nucleotide sequence that exhibits substantial identity to the nucleotide sequence in addition to the above-mentioned sequence. The above substantial identity is determined by aligning the nucleotide sequence of the present invention with any other sequence as much as possible and analyzing the aligned sequence using algorithms commonly used in the art to obtain a minimum of 80% Homology, more preferably at least 90% homology, and most preferably at least 95% homology. Alignment methods for sequence comparison are well known in the art. Various methods and algorithms for alignment are described by Smith and Waterman, Adv . Appl . Math. 2: 482 (1981) ; Needleman and Wunsch, J. Mol . Bio . 48: 443 (1970); Pearson and Lipman, Methods in Mol . Biol . 24: 307-31 (1988); Higgins and Sharp, Gene 73: 237-44 (1988); Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc . Acids Res . 16: 10881-90 (1988); Huang et al., Comp. Appl . BioSci . 8: 155-65 (1992) and Pearson et al., Meth . Mol . Biol . 24: 307-31 (1994). The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol . Biol. 215: 403-10 (1990)) is accessible from National Center for Biological Information (NBCI) It can be used in conjunction with sequence analysis programs such as blastx, tblastn and tblastx. BLSAT is available at http://www.ncbi.nlm.nih.gov/BLAST/. A method for comparing sequence homology using this program can be found at http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html.

The genes are introduced into the expression vector and expressed in E. coli. As used herein, the term "expression vector" is a linear or circular DNA molecule consisting of a fragment encoding a polypeptide of interest operably linked to an additional fragment provided in the transcription of the expression vector. Such additional fragments include promoter and termination coding sequences. The expression vector also includes at least one replication origin, at least one selection marker, a polyadenylation signal, and the like. Expression vectors are generally derived from plasmid or viral DNA, or contain both elements.

The vector system of the present invention can be constructed through various methods known in the art, and specific methods for this are disclosed in Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001) This document is incorporated herein by reference.

Each nucleotide sequence encoding enzymes involved in the production of the meso -2,3-butanediol of the present invention can be inserted into an expression vector operably linked to an expression control sequence. The term 'operably linked to' as used herein means that one nucleic acid fragment is combined with another nucleic acid fragment so that its function or expression is affected by other nucleic acid fragments. Also, an " expression control sequence " means a DNA sequence that regulates the expression of a nucleic acid sequence operably linked to a particular host cell. Such regulatory sequences include promoters for initiating transcription, any operator sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation.

The vector of the present invention can typically be constructed as a vector for expression. When the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (such as a tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pL ^貫 promoter, pR ^貫 promoter, rac5 Promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, and T7 promoter), a ribosome binding site for initiation of detoxification, and a transcription / translation termination sequence. Promoter and operator site of the E. coli tryptophan biosynthetic pathway (Yanofsky, C., J. Bacteriol., 158: 1018-1024 (1984)) when E. coli (e.g. HB101, BL21, ) And the left promoter of phage lambda (pL ^lambda promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet., 14: 399-445 (1980)).

The vectors that can be used in the present invention include plasmids such as pUC18, pTrc99A, pSTV28, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79 , such as pIJ61, pLAFR1, pHV14, pET22b, pGEX series, pET series and pUCP19), phage (such as λgt4? B,? -charon,?? z1 and M13) However, it is preferable to use pUC18 in an improved manner.

The expression vector of the present invention includes the promoter sequence and the nucleotide sequence of the gene to be expressed (structural gene), and it is preferable that the sequences are linked in the order of 5'-3 '.

Preferably, the expression vector is operatively linked to a la c promoter sequence, a nucleotide sequence encoding acetolactate decarboxylase, and a nucleotide sequence encoding acetolactate synthase.

On the other hand, the vector of the present invention includes, as a selection marker, an antibiotic resistance gene commonly used in the art, for example, ampicillin, gentamicin, carbinicillin, chloramphenicol, streptomycin, kanamycin, And resistance genes for tetracycline.

According to a preferred embodiment of the present invention, the selectable marker used in the present invention is kanamycin.

The vector of the present invention includes a ribosomal binding site (RBS) and an essential part for enzyme expression so that the acetolactate decarboxylase gene and the acetolactate synthase gene have an enzyme over-expression function and have a minimum length It is preferable that only the nucleotide sequence be inserted as a sequence in terms of reducing the metabolic burden of the host cell. According to a preferred embodiment of the present invention, the present invention uses a kanamycin resistance gene introduced into pUC18.

Step (c): Preparation of transformed Krebsiella

Then, the recombinant vector of step (b) is introduced into Klebsiella in which the nucleotide sequence encoding wabG of step (a) is inactivated to prepare a transformed Klebsiella.

Methods for delivering the vector of the present invention into a host cell can be carried out using a CaCl ₂ method (Cohen, SN et al., Proc . Natl . Acac. Sci . USA , 9: 2110-2114 SN et al, Proc Natl Acac Sci USA, 9: 2110-2114 (1973); and Hanahan, D., J. Mol Biol, 166:....... 557-580 (1983)) and electroporation method (Dower, WJ et al., Nucleic Acids Res . , 16: 6127-6145 (1988)).

Klebsiella, which can be transformed by a recombinant vector comprising a nucleotide sequence encoding an acetolactate decarboxylase of the present invention and a nucleotide sequence encoding an alcohol dihydrogenase, comprises a nucleotide sequence encoding wabG Inactivated Klebsiella lunomycetes include Klebsiella oxytoca, in which the nucleotide sequence encoding wabG is inactivated, Klebsiella granulomatis, in which the nucleotide sequence encoding wabG is inactivated, or the nucleotide sequence encoding wabG But is not limited to, an inactivated Klebsiella terrigenase.

Step (d): Preparation of 2,3- butanediol

The transformed Krepsiella of the present invention is cultured in a culture medium to prepare 2,3-butanediol.

One of the main characteristics of the present invention is that the culture medium comprises a carbon source, a nitrogen source and an energy source, and the carbon source is at least one carbon source selected from the group consisting of cassava, molasses and glycerol.

According to a preferred embodiment, the culture medium of the invention comprises cassava, sugar and / or glycerol, more preferably 10-200 g / l carbon source as the carbon source. Klebsiella pneumoniae has a metabolic pathway Well - developed strains, different pathways are activated in anaerobic and aerobic conditions. When cultured under anaerobic conditions, 1,3-PDO (1,3-propanediol) is mainly produced from glycerol via 3-HPA (3-Hydroxypro), and 2,3-BDO is produced through pyruvic acid Production. This is the most significant difference from the fact that when glucose is cultured as a carbon source, it hardly produces 1,3-PDO.

Step (e): yield of 2,3-butane diol

Finally, a meso -2,3-butanediol prepared by culturing the transformed E. coli of the present invention is obtained.

According to a preferred embodiment of the present invention, the yield of 2,3-butanediol prepared by the meso -butane diol production process of the present invention is 0.2-0.4.

According to another aspect of the present invention there is provided a 2,3-butanediol produced by the process of the present invention.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

The features and advantages of the present invention are summarized as follows:

(a) Preparation of non-pathogenic Klebsiella , introduction of acetolactate carboxylase and acetolactate synthase into Klebsiella , production of meso -2,3- Butanediol. ≪ / RTI >

(b) The recombinant E. coli of the present invention can be produced in a culture medium containing an industrial carbon source to produce more economical 2,3-butanediol and can be used more safely through non-pathogenic Klebsiella.

(c) It is expected that mass production of 2,3-butanediol, which is a platform compound which will be a useful base in the chemical industry, through a biological production method will have great advantages in terms of environmentally and economically.

FIG. 1 is a schematic diagram showing the removal process of the wabG gene.
FIG. 2 shows the result of electrophoresis of KCTC 2242 in the absence of the wabG gene in Klebsiella pneumoniae.
3 shows the production route of 2,3-butanediol (2,3-BDO) by Krebshiella.
Figure 4 shows the metabolic pathway according to the substrate of Krebs.
5 shows a vector map obtained by introducing the kanamycin gene into the pUC18 vector. The vector into which the kanamycin gene was introduced was named pUC18K.
6 shows a map of a recombinant vector into which the budB and budA genes are introduced into the pUK18C vector. pSB4.
Fig. 7 shows the result of culturing the KCTC 2242 wabG glycerol stock solution in Krebshiella pneumoniae as a carbon source.
Figure 8 shows that KCTC 2242 wabG :: pUC18K :: budB :: budA Glycerol stock solution was added as a carbon source, followed by discontinuous culture.
Figure 9 shows that KCTC 2242 wabG in Klebsiella pneumoniae The result of non-continuous culture with molasses added as a carbon source is shown.
Figure 10 shows that KCTC 2242 wabG in Klebsiella pneumoniae The results are shown in the case of discontinuous cultivation by adding carbazole as a carbon source.
11 shows the result of fermentation in which KCTC 2242 wabG was cultured in Klebsiella pneumoniae discontinuously by adding 80 g / L glycerol stock solution as a carbon source.
12 shows the result of fermentation of KCTC 2242 wabG :: pUC18K :: budB :: budA in a non-continuous culture with KCTC 2242 by adding 80 g / L glycerol stock solution as a carbon source.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example 1: wabG  Gene deletion

Linear gene production

Primers (Table 1) having a base sequence of FRP (Flip-Recombinase Targets) of 34 bp (base pair) and chloramphenicol of 20 bp on both sides and a pKOV plasmid having a chloramphenicol resistant base sequence were used as a template for polymerase chain reaction PCR) was performed to prepare a cassette (FCF) having FRT-chloramphenicol-FRT. Chloramphenicol is an antibiotic resistance protein to confirm homologous recombination, and FRT knock-out the target gene and then deletion of the chloramphenicol gene (FIG. 1). The polymerase chain reaction conditions for preparing FCF were as follows: 95 ° C for 5 minutes, followed by 95 ° C for 30 seconds, 66 ° C for 55 seconds, and 72 ° C for 60 seconds. After insertion of the FCF having the nucleotide sequence of 891 bp into the T-vector, PCR was carried out using a primer (Table 1) having a 50 bp base sequence complementary to the start and end portions of wabG and a base sequence homologous to FRT (WFCFW) for the deletion of the wabG gene. The reaction conditions were 95 ° C for 5 minutes, followed by 95 ° C for 30 seconds, 65.2 ° C for 60 seconds, and 72 ° C for 60 seconds. The obtained WFCFW has a base sequence of 991 bp.

primer order FCF Forward GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTGAGACGTTGATCGGCACGT FCF reverse direction GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCATTCAGGCGTAGCACCAGGC WFCFW Forward (2242) ATGAGTAAATTCAGGCTGGCTCTGGTGCGGCAGAAGTACCGCCCGGACGGGAAGTTCCTATTCTCTAGAA WFCFW Reverse (2242) TTAATTCACCAGATCCTGATAAAGAGAAAGCAGCTGGGTTGAGAGTCGCTGAAGTTCCTATACTTTCTAG WFCFW Forward (1686, 43863) ATGAGTAAATTCAGGCTGGCTCTGGTACGCCAGAAGTATCGCCCGGACGGGAAGTTCCTATTCTCTAGAA WFCFW Reverse (1686, 43863) TTATTTCACCAAATCCTGATAGAGGGAGAGCAGCTGCGCCGAGAGACGTTGAAGTTCCTATACTTTCTAG

Homologous recombination  To increase efficiency Red Lambda ( Red lambda ) Recombination

PRedET, a plasmid expressing alpha, beta and gamma proteins, which prevents degradation of the linear gene introduced into the cell and enhances homologous recombination efficiency, was used (Daiguan Yu, Hilary M. Ellis, E-Chiang Lee, Nancy A. Jenkins, Neal G. Copeland, and Donald L. Court, PNAS May 23, 2000 vol 97, No. 11, 5978-5983). These pRedET plasmids were used to transform pRedET into wild Klebsiella to produce mutants. For this purpose, Klebsiella pneumoniae , KCTC 2242) were cultured at 37 ° C and optical density (600 nm) until the concentration reached 0.2-0.3, and ethylendiamine acetic acid (EDTA) was added to the total amount of liquid LB medium to 0.7 mM. When ethylenediamine acetic acid is added, the efficiency of the electroporation method becomes high (Fournet-Fayard, S., B. joly, and C. Forestier J. Microbiol Meth, 1995. 24: p.49-54). The cultured Klebsiella pneumoniae was washed three times with cold sterilized water containing 10% glycerol to remove impurities. To the final wash, Klebsiella pneumoniae in cold sterilized water was added with 150 ng pRedET Were mixed and placed in a cooled cuvette for electroporation, and 1.8 kV and 5 msec pulses were applied. After culturing at 30 DEG C for one hour, the cells were plated on solid LB medium containing tetracycline (3 mu g / mL) and cultured at 30 DEG C for 16 hours. The reason for culturing in LB medium containing tetracycline at 30 ° C is because the pRedET plasmid has tetracycline resistance and is replicated at 30 ° C. Next, Krepsiella transformed with pRedET plasmid was added to liquid LB medium to express alpha, beta and gamma proteins and cultured until the optical density at 600 nm reached a value of 0.2-0.3. At this time, L-arabinose (L-arbinose) corresponding to 0.5% was added to the total amount of the liquid LB medium. Then, 150 ng of WFCFW was mixed with pRedET in the same manner as in the transformation, and electroporation was performed under the above conditions. After culturing at 37 占 폚 for 3 hours, the cells were plated on solid LB medium containing chloramphenicol (20 占 퐂 / ml) and cultured at 37 占 폚 for 16 hours. After culturing in a liquid medium containing chloramphenicol (20 μg / ml), chloramphenicol grown in chloramphenicol medium was again subjected to genomic DNA extraction using a genomic DNA extraction kit and mutagenesis was confirmed by polymerase chain reaction .

FRT - chloramphenicol - FRT Fruit of

A 707-Flpe plasmid (Thomas Schlake and Jurgen Bode 'Biochemistry 1994, 33, 12746-12751) expressing a flippase recombinant enzyme was used for the deletion of FRT-chloramphenicol-FRT inserted in mutation in Klebsiella pneumoniae Respectively. After transforming pRedET with Krebsiella nymoniee, Krebsiella pneumoniae inserted with the 707-Flpe plasmid and WFCFW was transformed and cultured at 30 ° C for one hour. Then, tetracycline (3 μg / ml) . ≪ / RTI > The 707-Flpe was cultured at 30 ° C for 16 hours because it replicates at 30 ° C. The mutant clones were grown in 1 ml of LB medium without antibiotics and incubated for 3 hours. The mutant is cultured again at 37 DEG C for 16 hours in the cultured Krepsiella nemonyi because the flippase recombinase is expressed at 37 < 0 > C. A portion of the mutation in the cultured Krebshiella pneumoniae was cultured in liquid LB medium containing chloramphenicol, and then it was confirmed that it did not grow, and genomic DNA was extracted using a genomic DNA extraction kit. The polymerase chain reaction confirmed the deletion of the chloramphenicol resistance gene (Fig. 2).

Example  2: beha  Gene and budB  Gene introduction

The KCTC 2242 wabG was fermented to the Krebshiella pneumoniae prepared in Example 1, and KCTC 2242 wabG :: pUC18K :: budB : pUC18K was added to Krebsiella pneumoniae having the highest productivity of 2,3-butanediol (BDO) : budA was selected. And amplified using a primer designed to specifically amplify only the target genes. The genes budA is 780 bp, was amplified by budB size of 1536bp. Each of the polymerase chain reactions was performed at 95 ° C under the usual reaction conditions (10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 2 mM MgSO ₄ , Taq DNA polymerase (DaKaRa) 1 (denaturation), 66 [deg.] C / 30 sec (annealing) and 72 [deg.] C for 1 min Lt; 0 > C / 1 min (elongation). As a final step, the cells were reacted at 95 ° C / 1 min (denaturation), 66 ° C / 1 min (annealing) and 72 ° C / 5 min (elongation) for stable elongation. After PCR, the amplified DNA was purified on 0.8% agarose gel, purified and used for T-vector cloning. The recombinant plasmids pGEM-T :: budA and pGEM-T :: budB and pGEM-T :: budA :: budB were constructed by ligating to pGEM-T easy vector (DaKaRa, Japan). The recombinant plasmids were transformed in Escherichia coli ( E. coli DH5a competent cells, RBS) to prepare transformants. The recombinant plasmids pGEM-T :: budA , pGEM-T :: budB and pGEM-T :: budA :: budB PUC18K, a shuttle vector of Escherichia coli and Klebsiella, was reacted with restriction enzymes in a 37 ° C water bath for about 2 hours. The pUC18K used here was prepared by cloning a gene resistant to kanamycin into the pET28a vector and inserting it into pUC18 vector. Each of the DNA fragments was digested with the restriction enzymes listed above, and the recombination plasmid was completed by ligation at 16 ° C using T4 ligase (Dakara) to the multicloning site of the pUC18K vector Respectively. In each step, E. coli DH5a competentcell (RBS) was transformed with E. coli , and the recombinant plasmid was extracted and treated with the restriction enzyme at the original insertion site. And electrophoresis on 0.8% agarose gel for comparison.

The amplified product was introduced into pUC18K vector using restriction enzymes to prepare pUC18K :: budA :: budB . budB encodes acetolactate synthase, which converts pyruvic acid to acetolactate, and budA , which encodes acetolactate decarboxylase, which converts acetolactate to acetone ( 3 to 6).

Example  3: Carbon source  2,3- BDO  Physiological studies on production

Glucose, which is a carbon source widely used in laboratories, is not an optimal carbon source in terms of economy because of high efficiency substrate and high unit cost to produce 2,3-butanediol. In order to be used as an industrial carbon source, it is necessary to have low productivity and high productivity. Glycerol is one of the most commonly used carbon sources for industrial use. In particular, crude glycerol is an industrial waste and is a carbon source that is cheaper than purified glycerol as well as glucose. Klebsiella pneumoniae is a well-developed glycerol metabolic pathway, and its pathway is activated when anaerobic and aerobic. When cultured under anaerobic conditions, 1,3-PDO (1,3-propanediol) is mainly produced from glycerol via 3-HPA (3-Hydroxypropionaldehyde) and 2,3-BDO is mainly produced through pyruvic acid in aerobic condition. This is the most significant difference from the fact that when glucose is cultured as a carbon source, it produces little 1,3-PDO. In the case of Escherichia coli, the glycerol absorption capacity is lower than that of Krebsiella. In the case of aerobic condition, the glycerol metabolic pathway operates. In the anaerobic state, if the pH is lowered, glycerol absorption is possible but it takes a long time to grow. In addition to glycerol, starchy biomass cassava (Sigma Aldrich) and carbohydrate biomass (molasses, GS Caltex) can be used as industrial carbon sources. When cassava is used as a carbon source, it contains a large amount of glucose, and 2,3-BDO can be produced as much as when glucose is used as a carbon source. However, since the viscosity of starchy base is high, it is difficult to carry out fermentation by adding a large amount of glucose. When used as a carbon source, the production yield of 2,3-BDO is lower than that of glucose and there is a disadvantage that many organic acids are produced.

Carbonic  However, BDO  production

Fermentation experiments were carried out using industrial carbon sources to confirm the utility of KCTC 2242 wabG :: pUC18K :: budB :: budA in Klebsiella pneumoniae as an industrial strain. The medium composition of the fermentation experiment was as shown in Table 2 and was carried out in a 5 L fermenter with a medium volume of 2 L at 200 rpm and pH 5.5 (fixed) in a non-continuous culture method. First, non - continuous culture was carried out by using glycerol stock solution which is low in price and high in industrial process as carbon source. The medium composition and culture conditions were the same as those of the conventional non-continuous culture, and glycerol stock solution was added at a concentration of 40 g / L. Growth was measured at OD (optical density) of 600 ㎚ for 12 hours at 12-14, which is similar to the case of using glucose as a carbon source. Analysis of the fermentation samples by HPLC (High Performance Liquid Chromatography) showed that 2,3-BDO of about 13-16 g / L was produced, consuming all of the carbon source in 12-18 hours as shown in FIG. This corresponds to a yield of about 0.34-0.40 g / g, which is similar to the result of culturing glucose with a carbon source. Compared with strains that did not transform the recombinant vector with the budA and budB genes and transformed with the transformed strains, the productivity of 2,3-BDO of the vector-inserted strains was further improved, similar to the case of using glucose as a carbon source . These results indicate that the improved strain can produce 2,3-BDO by industrial carbon source as an industrial strain.

ingredient Concentration (g / L) Yeast extract 5 K ₂ HPO ₄ 2.9 KH ₂ PO ₄ 11.3 (NH4) ₂ SO ₄ 6.6 MgSO ₄ .7H ₂ O 0.25 FeSO ₄ .7H ₂ O 0.05 ZnSO ₄ .7H ₂ O 0.001 MnSO ₄ .7H ₂ O 0.001 CaCl ₂ .2H ₂ O 0.001 Carbon source 100

Next, fermentation experiments of KCTC 2242 wabG :: pUC18K :: budB :: budA were carried out on Krebs celiac pneumonia by adding molasses, a saccharide-based biomass, as a carbon source. KCTC 2242 wabG was used in Klebsiella pneumoniae to determine whether 2,3-BDO production was possible through molasses. The experiment proceeded to non-continuous culture and the conditions were the same as described. As a result, molasses consumed about 25 g / L of carbon source for 48 hours and produced 8 g / L 2,3-BDO, and the yield was about 0.32% (FIG. 9). In the case of the glycerol stock solution, the carbon source added for 12-18 hours was completely consumed and 2,3-BDO was produced, whereas the molar ratio of the carbon source added for 48 hours Only half were consumed. Finally, the fermentation was carried out under the same conditions using carbazole, a starch biomass, as a carbon source. As a result of the fermentation, Kabasah consumed about 17 g / L of carbon source for 48 hours and produced 4 g / L 2,3-BDO, and the yield was about 0.24% (FIG. 10). These results were relatively low in terms of productivity and yield than molasses. Therefore, the glycerol stock solution which can be consumed in a short period of time in terms of economy can be said to be more effective than KCTC 2242 wabG :: pUC18K :: budB :: budA for the fermentation of Klebsiella pneumoniae .

Krebscheiler Nimonie KCTC  2242 wabG :: pUC18K :: budB :: beha Of 2,3- BDO  Increase production efficiency

As a result of the fermentation of KCTC 2242 wabG :: pUC18K :: budB :: budA on Krebshiella pneumoniae using various industrial carbon sources, the efficiency similar to the 2,3-BDO production efficiency when glucose is used as the carbon source of the glycerol stock solution Respectively. To increase the productivity of 2,3-BDO, the concentration of the glycerol stock solution was increased to 80 g / L, and the same strain was cultured under the same conditions for non-continuous cultivation, and the productivity was ascertained (FIGS. 11 and 12). Experimental results were analyzed by HPLC. The results showed that the carbon source was consumed in 42-48 hours, the yield of 2,3-BDO was 31-34 g / L, and the yield was 0.38-0.42%. It was confirmed that the productivity was similar to that of the fermentation with glucose added, and that 80 g / L of the glycerol stock solution did not inhibit the growth and thus the yield was increased. Through this process, fermentation will be carried out by using a larger amount of glycerol stock solution to ascertain the maximum production amount and optimize culture conditions using an industrial carbon source.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Industry-University Cooperation Foundation Sogang University <120> Method for Preparing 2,3-butanediol from Commercial carbon source          by Transformed Klebsiella pneumoniae <130> PN120261 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 1128 <212> DNA <213> Klebsiella pneumoniae wabG <400> 1 atgagtaaat tcaggctggc tctggtgcgg cagaagtacc gcccggacgg cggcgcagaa 60 cggtttgtct cccgcgcgct ggaagccctc gacagcagtc atctgcaact gaacgtcatc 120 acccgcgaat ggcaggggcc ggtgaaaccg gactggcaga tccatatctg taacccacgt 180 aaatgggggc gcatcagccg cgagcgcggc tttgccaacg ccgcgcgcgc gctctggcag 240 cgcgagtcct tcgacctggt gcagagccat gaacgtattc ccggctgcga tctctaccgc 300 gctggcgatg gcgttcatcg ccgctggctg cagcagcgct cgcgcatttt accggcctgg 360 aaaagccgcc tgctgttcgc cgaccgttac caccgctacg tcatgcaggc ggagcgcgag 420 atgtatgaag actcacacct gcgcggggtg atctgcaacg ccgagatgat caagcgcgag 480 atcatcgaag actttggcct gccggcggag aagatccacg ttatttataa cgccattgat 540 aaccagcgct tcctgccgcc ggacgaagag acctttgccg ccttacgcgc caaatggcag 600 ctaccgctgc aggcgacctg cctgatctac gtcggctccg gctttgagcg caaggggctg 660 gcggcggcga tccgcgccat cgctcccacc gatcgctacc tgctggtggt cggcaaagat 720 aaggatcagc ctcgctatca ggcgctggcg aagagcctga actgtgaagc gcgggtgcgc 780 ttcttcggca tgcagtcgga gacattgccc ttctatcaaa tggccgatgg tctgttgctg 840 ccgaccctct acgatccgtt ccccaacgtc atcctcgagg caatggcctg cggtctgccg 900 gtgatcacca ctaccggctg cggcggggcg gagtttatcg tcgacggcca caacggttac 960 gtctgcgacg ctctggatat cccggcgcta cagcaggcgg taatggccct gcccgcgcgc 1020 gcgctgggct ccgcgcaagg cggtcacgcc cgcgagcgca ttatggcctg caccagcgag 1080 cgactctcaa cccagctgct ttctctttat caggatctgg tgaattaa 1128 <210> 2 <211> 780 <212> DNA <213> Klebsiella pneumoniae budA <400> 2 atgaatcatt ctgctgaatg cacctgcgaa gagagtctat gcgaaaccct gcgggcgttt 60 tccgcgcagc atcccgagag cgtgctctat cagacatcgc tcatgagcgc cctgctgagc 120 ggggtttacg aaggcagcac caccatcgcc gacctgctga aacacggcga tttcggcctc 180 ggcaccttta atgagctgga cggggagctg atcgccttca gcagtcaggt ctatcagctg 240 cgcgccgacg gcagcgcgcg caaagcccag ccggagcaga aaacgccgtt cgcggtgatg 300 acctggttcc agccgcagta ccggaaaacc tttgaccatc cggtgagccg ccagcagctg 360 cacgaggtga tcgaccagca aatcccctct gacaacctgt tctgcgccct gcgcatcgac 420 ggccatttcc gccatgccca tacccgcacc gtgccgcgcc agacgccgcc gtaccgggcg 480 atgaccgacg tactcgacga tcagccggtg ttccgcttta accagcgcga aggggtgctg 540 gtcggcttcc ggaccccgca gcatatgcag gggatcaacg tcgccgggta tcacgagcat 600 tttattaccg atgaccgcaa aggcggcggt cacctgctgg attaccagct cgaccacggg 660 gtgctgacct tcggcgaaat tcacaagctg atgatcgacc tgcccgccga cagcgcgttc 720 ctgcaggcta atctgcatcc cgataatctc gatgccgcca tccgttccgt agaaagttaa 780                                                                          780 <210> 3 <211> 1584 <212> DNA <213> Klebsiella pneumoniae budB <400> 3 atgaaaacac gaaaaattgg actggctaac tatctggcct acggcgcggg cgattttctc 60 ggcgccggca cgacggcgtt aaccgccgca tggctgctct acttttacac gaccttttgc 120 ggactgaccc cgattgaggc cacgcttatt tttgctgccg cccgcgtgct ggacgcggtg 180 gtaagcccgc tgatgggctt tctcaccgat aactttggca ccacctggct tggtaagcgc 240 ttcggccgca gaaaattctt tattctgctc ggcatcccct gcgtattcag ctattcagcg 300 atgtgggtcg gcgagatggg cttctggtac tacctggcga cctatctgct gtttgatatg 360 gtctatacca tgattctggt gccctatgag acgctggtgc cggagatgac cgatgacttt 420 cgcgatgtc gcctccttcc tgccggggat ccttctctcc tggctcggca aagataatgc cagctcgttc 540 ttctatgcca gtctggtgtt ctcggtgctg tgcgcggtga tgctgactct ggtctggtgt 600 ttcacctggg aacgaccgcg ggaggcgtgg tcggaagcgg ccctgcgggc ggaagcggaa 660 aaacaaaact taacccttgc tcagagcctc aatcgcctgg tgattgagct gagttctacg 720 ctgcggataa aaattttccg ccagcacctc ggcatgtatc tggggggcta tatcgcccag 780 gacgtcttca atgccgtgtt tacctattac gtggtctttg ttctgatgca ggaagccgcc 840 gtcgcctcga acctgctggg gacgatggcc atcttccagt ttattgcggt aatcgccatg 900 atcccgctgt gcattcgttt tggccccgcg ccgtcgtacc gcatggtggt ggtcctgttt 960 ggcctgagct cactctccta cgcgctgctc tattacgccg gactgagcga cgtctattcc 1020 ttattgctgc tcatctctgc tgtcgccgga ctgggacgcg gcgggataaa ttacgtaccg 1080 tggaatacct acacctatat tgccgacgtc gacgaagcga tcaccggcca gcgccgggag 1140 gggatttttg ccggcatcat gactctgacc cgcaaagcct cgcaggcggg ggcggtgatg 1200 ctggtgggga tcattatgca gttgtcgggg tttgtttccg ggcaaaaaat acagcctgaa 1260 ggggtcagcc ataccattct gctgatcctc agcgtcggca ctctggtggt gttagcctgc 1320 ggcttcctcg tctcgctgcg cttcaaactc aacctgcaca cccacagcgt cctgcgcagc 1380 gagaccctca gaatgcgcga gctcggctac gctcagtcgg aacagaccag tgcggaacac 1440 cgtgcggtgg tcgagctgct ggcggggatg ccttacgact gtctgtgggg caataacaat 1500 attggctatc tgaatcgtca taaacctgct gccccggcgc tcattaaggg cggcgctttg 1560 aattcgacat atacccgagg ttaa 1584

Claims (9)

A process for preparing 2,3-butanediol using a transformed Klebsiella comprising the steps of:
(a) inactivating a nucleotide sequence encoding a wabG of Kepsilaella;
(b) preparing a recombinant vector by inserting a nucleotide sequence encoding acetolactate decarboxylase and a nucleotide sequence encoding acetolactate synthase into an expression vector;
(c) introducing the recombinant vector into the Klebsiella to produce a transformed Klebsiella.
(d) culturing the transformed Krepsiella in a culture medium to produce 2,3-butanediol; And
(e) obtaining the 2,3-butanediol.
The method of claim 1, wherein said Krebsia is Klebsiella pneumonia , Klebsiella &lt; RTI ID = 0.0 &gt; as oxytoca), keurep when Ella Yeah press Matisse (Klebsiella granulomatis or Klebsiella terigena. &lt; Desc / Clms Page number 13 &gt;
2. The method of claim 1, wherein the nucleotide sequence encoding wabG of step (a) is the first sequence of the sequence listing and the nucleotide sequence encoding the acetolactate decarboxylase of step (b) is the second sequence of SEQ ID NO: , And the nucleotide sequence encoding acetolactate synthase is SEQ ID No. 3.
The method of claim 1, wherein said capsule polysaccharide is not present.
The method according to claim 1, wherein said Krebsia is non-pathogenic.
The recombinant vector according to claim 1, wherein the recombinant vector is characterized in that it is operatively linked to a lac promoter sequence, a nucleotide sequence encoding acetolactate decarboxylase, and a nucleotide sequence encoding acetolactate synthase How to.
The method according to claim 1, wherein the culture medium of step (d) comprises a carbon source, a nitrogen source, and an energy source, and the carbon source includes at least one carbon source selected from the group consisting of cassava, molasses and glycerol How to.
8. The method of claim 7, wherein the culture medium comprises glycerol at 50-100 g / l.
delete

Images