KR101747285B1 - Recombinant Microorganism for Producing 1,3-Propanediol Without Ability of Producing 2,3-Butanediol - Google Patents

Abstract

The present invention relates to a gene encoding glucosyltransferase involved in lipopolysaccharide biosynthesis in a microorganism having 1,3-propanediol-producing ability, a gene encoding lactate dehydrogenase, and a gene encoding α- And a recombinant microorganism having the ability to produce 1,3-propanediol in which a gene encoding Lefoxylase is deleted and dhaT operon and folate dihydroketone are over-expressed.
INDUSTRIAL APPLICABILITY According to the present invention, it is possible to produce 1,3-propanediol which can be used in various industrial fields such as polymer monomers, medical industry, industrial resin, etc. from glycerol with high efficiency without producing 2,3-butanediol as a by-product.

Description

{Recombinant Microorganism for Producing 1,3-Propanediol Without Ability of Producing 2,3-Butanediol} <br> <br> <br> Patents - stay tuned to the technology Recombinant Microorganism for Producing 1,3-Propanediol 2,3-

The present invention relates to a gene encoding glucosyltransferase involved in lipopolysaccharide biosynthesis in a microorganism having 1,3-propanediol-producing ability, a gene encoding lactate dehydrogenase, and a gene encoding? -Acetolactate dicarboxylic acid And a recombinant microorganism having the ability to produce 1,3-propanediol in which a gene encoding Lefoxylase is deleted and dhaT operon and folate dihydroketone are over-expressed.

 1,3-Propanediol is an industrially versatile chemical having properties such as monomers for synthesis of polymers, medical drugs, and industrial resins. As a result, the market for 1,3-propanediol is rapidly expanding every year and attention is paid to various industries. Production of 1,3-propanediol through petrochemical processes and microbial fermentation is known, and production using petrochemical processes has been the mainstream. However, interest in the production of 1,3-propanediol through microbial fermentation is growing due to environmental problems caused by the use of fossil fuels, economic problems due to burden limits, and international problems arising from the bias of stores.

In addition, due to the development of the biodiesel industry, the production of glycerol as a by-product of biodiesel production has led to a massive decline in glycerol prices. Since glycerol is used as a representative carbon source necessary for 1,3-propanediol production by microbial fermentation, economical efficiency of 1,3-propanediol production through microbial fermentation using glycerol as an economical raw material is increasing.

On the other hand, optimization of fermentation conditions and manipulation of microbial metabolic circuits are mainly carried out to improve the productivity of certain metabolites through microbial fermentation. Among them, in order to understand metabolic pathways and roles of microorganisms from the viewpoint of metabolic engineering, Overexpressing genes and removing specific genes on the microbial genome is the most fundamental approach in the field of metabolic engineering.

Microorganisms produce several byproducts simultaneously, including the desired metabolites in the fermentation process. The production of these by-products reduces the yield and productivity of the desired product, restricts access to the necessary elements for production, and inhibits cell growth during overproduction. Therefore, efforts to remove byproducts in microbial fermentation are accompanied by efforts to find genes involved in the production of certain byproducts based on genomics and to remove them from the genome through gene removal techniques Is used. Studies have been conducted to clone and overexpress genes related to production directly or indirectly based on a plasmid in order to enhance the productivity of the desired product, thereby activating the metabolic pathway as a target product.

The 1,3-propanediol producing strain simultaneously produces by-products such as 2,3-butanediol, acetic acid, succinic acid, ethanol, lactic acid and 3-hydroxypropionic acid in the fermentation process. These by-products also cause a great deal of difficulty in classifying and refining 1,3-propanediol. Particularly, 2,3-butanediol has a boiling point similar to that of 1,3-propanediol and has similar physical properties, requiring a large economic cost for the classification and refining of 1,3-propanediol, which accounts for more than 50% (ZL Xiu and AP Zeng, Appl Microbiol Biotechnol, 78, 917. 2008). Production of such by-products not only reduces the yield of 1,3-propanediol production but also causes side effects such as reducing the amount of the ingredients to be used for production of 1,3-propanediol and progressing the acidification of the medium. Accordingly, various efforts have been made to eliminate the by-product production of the 1,3-propanediol producing strain.

Among them, studies have been conducted in which the production route of 1,3-propanediol is improved by removing the production route of lactic acid or ethanol in the strain producing 1,3-propanediol (G Yang et al ., Appl Microbiol Biotechnol 73: 1017, 2007; YZ Y Zhang et al., Metabolic Engineering 8: 578, 2006), overexpression of the dhaT operon enhances the productivity of 1,3-propanediol (see, for example, Jang et al., Biotechnology and Bioenginee ring, 104 R (J Hao et al, J Ind Microbiol Biotechnol 35: 735, 2008; MY Seo et al, Appl Microbiol Biotechnol, 84:.. 527, 2009), to remove only the by-product 2,3-butanediol production 1,3 (Zhang et al., Appl Biochem Biotechnol, 168: 116, 2012), which improves the productivity of propanediol.

However, these efforts failed to achieve the goal by improving the productivity of 1,3-propanediol, the target metabolite, as well as the productivity of various by-products. In addition, the removal of the 2,3-butanediol production-related gene greatly inhibited the growth of the cells. Thus, the productivity of the target metabolite, 1,3-propanediol, was also decreased and the productivity of various by- Also improved. In addition, the desired product, 1,3-propanediol, is produced through a glycerol reduction metabolic pathway and consumes NADH as a constituent. However, until now there has been no attempt to supply NADH by genetic means.

In addition, the existing 1,3-propanediol producing strain, Klebsiella pneumoniae, has a limitation in that it is industrially used as a pathogenic strain. The production of chemicals using pathogens is limited in their use, but requires a great deal of economic cost since complete sterilization of the strain is required after fermentation.

Accordingly, the present inventors have made extensive efforts to develop a method for producing 1,3-propanediol more economically. As a result, it has been found that the pathogenic property of the strain is eliminated in Klebsiella pneumoniae, a 1,3-propanediol producing strain, When the production of 2,3-butanediol is removed and the genes involved in 1,3-propanediol production and the genes involved in production of 1,3-propanediol are over-expressed, , The yield of 2-propanediol was remarkably improved, and the present invention was completed.

It is an object of the present invention to provide a recombinant microorganism for the production of 1,3-propanediol which is metabolically engineered to improve the yield of 1,3-propanediol.

Another object of the present invention is to provide an economical method for producing 1,3-propanediol using the recombinant microorganism for producing 1,3-propanediol.

In order to accomplish the above object, the present invention provides a microorganism having 1,3-propanediol-producing ability, a gene encoding glucosyltransferase involved in lipopolysaccharide biosynthesis, a gene encoding lactate dehydrogenase, A recombinant microorganism having the ability to produce 1,3-propanediol in which a gene coding for? -acetolactate decarboxylase is deleted, and in which dhaT operon and folate dihydrogenase are overexpressed is provided.

(A) culturing the recombinant microorganism having the ability to produce 1,3-propanediol to produce 1,3-propanediol; And (b) obtaining the 1,3-propanediol thus produced.

INDUSTRIAL APPLICABILITY According to the present invention, it is possible to produce 1,3-propanediol which can be used in various industrial fields such as polymer monomers, medical industry, industrial resin, etc. from glycerol with high efficiency without producing 2,3-butanediol as a by-product.

1 is a schematic representation of a gene involved in the 2,3-butanediol production metabolic pathway of a strain of Klebsiella nymonis.
FIG. 2 shows the fermentation results of oil-field culture under microaerophilic conditions of the KMK-11 strain of the present invention, wherein the X-axis represents time (h) and the Y-axis represents concentration (g / L).
FIG. 3 shows by-products produced during the fermentation of oil in the microbial fermentation condition of the KMK-11 strain of the present invention, wherein the X axis represents time (h) and the Y axis represents concentration (g / L).
FIG. 4 shows the fermentation results of the oil fermentation under anaerobic conditions of the KMK-11BT strain of the present invention, wherein the X axis represents time (h) and the Y axis represents concentration (g / L).
FIG. 5 shows the by-products produced during the fermentation of the oil fermentation under the anaerobic conditions of the KMK-11BT strain of the present invention, wherein the X axis represents time (hour) and the Y axis represents concentration (g / L).
FIG. 6 shows a metabolic circuit of the 1,3-propanediol producing strain in which the metabolic circuit developed in the present invention is processed. In FIG. 6, the X mark denotes the deleted gene, the red arrow denotes the overexpressed homologous gene, A purple box means an expressed foreign gene.

In the present invention, the production of 2,3-butanediol, which requires much cost in the process of classification and purification of 1,3-propanediol, is completely eliminated The recombinant Klebsiella pneumoniae strains produced simultaneously with lactic acid, ethanol, acetic acid, succinic acid and the like were reduced by anaerobic fermentation, and the recombinant strains were compared with the wild type and the conventionally developed strains And excellent 1,3-propanediol yield and productivity (Fig. 6).

Therefore, in one aspect, the present invention relates to a gene encoding glucosyltransferase involved in lipopolysaccharide biosynthesis, a gene encoding lactate dehydrogenase, and a gene encoding glucosyltransferase in a microorganism having 1,3- The present invention relates to a recombinant microorganism having the ability to produce 1,3-propanediol in which a gene coding for? -acetolactate decarboxylase has been deleted and dhaT operon and folate dehydrogenase have been overexpressed.

In one embodiment of the present invention, as the monocycle for producing 1,3-propanediol, creepsiella annum monocytogenes was used, and the inhibitory effect of lipopolysaccharide , To delete the wabG gene in the wab operon.

Further, in order to inhibit the production of lactate which is a by-product of 1,3-propanediol, a gene (ldhA) encoding lactate dehydrogenase was deleted.

In addition, in order to suppress the production of 2,3-butanediol, which is a by-product, which is physically similar in physical property to 1,3-propanediol and causes difficulties in purification, The gene (budA) was deleted.

Further, in order to improve the flow of the glycerol reduction metabolic pathway and improve the productivity of 1,3-propanediol, the folate mde dehydrogenase gene (fdh), dhaB operon and dhaT operon were cloned into plasmids and overexpressed, respectively.

In another aspect, the present invention provides a method for producing 1,3-propanediol, comprising: (a) culturing a recombinant microorganism having the ability to produce 1,3-propanediol to produce 1,3-propanediol; And (b) obtaining the 1,3-propanediol obtained above.

In one embodiment of the present invention, the recombinant strain KMK-11TF was used to produce 67 g / L of 1,3-propanediol at 26 hours of fermentation for 26 hours of fermentation, Is the highest level of 1,3-propanediol productivity and production rate produced by this strain. In addition, the byproducts produced in the fermentation of the oil - added fermentation were greatly reduced compared to those in the microaerophilic condition. Succinic acid, a major by-product in micro-aerobic conditions, was produced at 4 g / L, a 75% decrease. Also, pyruvic acid was not completely produced. In micro aerobic condition, ethanol of 13 g / L was slightly increased to 16 g / L and production of acetic acid was slightly increased to 6 g / L.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these embodiments.

Example 1: Development of a mutant strain in which wabG gene, ldhA gene and budA gene were removed

Lipopolysaccharide, which is formed on the cell membrane among factors causing pathogenicity of Klebsiella nymonii, contributes greatly to pathogenic transmission (SG Jung et al., Appl Microbiol Biotechnol, 97: 1997, 2013). This lipopolysaccharide consists of gene expression in the wab operon, of which the wabG gene plays a central role. Therefore, the wabG gene (Genbank: AEK00461.1) was removed from the strain genome on Klebsiella pneumoniae to eliminate the host of the production strain, and Klebsiella pneumoniae was named KMK-01.

For the removal of the wabG gene and other subsequent genes, the lambda red recombination method was used (Jung et al. Applied and environmental microbiology 80 (19), 6195-6203, 2014) A strain of Klebsiella pneumoniae KCTC 2242 was used.

A recombinant Lambda red method was used to remove the wabG gene in E. coli. First, the expression vector of the enzyme exo, gamma, and beta to prevent the degradation of the linear gene introduced into the cell and to increase the efficiency of homologous recombination was transformed into a strain of Klebsiella pneumoniae prepared as competent cells . A tetracycline resistant pRedET vector with the BAD promoter was used in the present invention and the transformation was confirmed. Next, a linear gene for homologous recombination was prepared. A pKD4 vector with FRT-kanamycin-FRT cassette was used as the template. A total of 70 base pairs for polymerizing the homologous 50 base pairs on both sides of the homologous recombination site, wbG gene, and the FRT-kanamycin-FRT cassette of pKD4 used as a template, a total of 70 base pairs, And Polymerase Chain Reaction (PCR) to generate a linear gene to remove the wabG gene. Kanamycin is an anti-drug for confirming successful homologous recombination, and the FRT site removes the anti-drug to remove other genes after the target gene is removed.

The next step was to cultivate Klebsiella pneumoniae at 30 캜 in which pRedET vector was transformed. The pRedET vector is a temperature-sensitive vector. When the temperature exceeds 37 ° C, the pRedET vector loses its activity and is cultured at 30 ° C. After 1 hour of incubation, when the OD600 was about 0.1, the red lambda recombinase expression of pRedET was induced with 10% of arabinose (L-arabinose). When the OD600 reached about 0.6, the cells were transformed into competent cells for electroporation and transformed into a linear gene. The cells were cultured in LB medium at 37 占 폚 for 1 hour, spread on LB solid medium supplemented with 12.5 mg / ml of kanamycin, and cultured for 12 hours. Two primers were made to confirm the success of homologous recombination. The homologous 20-24 base pairs on both sides of the wabG gene were named wabG_con_A and _B. When these two primers were used for colony PCR, homologous recombination was confirmed through the length of the PCR product.

Lactic acid is produced as a major by-product in the fermentation of the wild-type Klebsiella pneumoniae. In addition to being competitive with 1,3-propanediol in the use of NADH required for production, excessive production of lactic acid leads to inhibition of cell growth by inducing acidification of the fermentation medium, The ldhA gene (GenBank: AEJ97914.1) was removed from KMK-01 strain in the prepared Krebshiella pneumoniae and named KMK-02 in Krebsiella pneumoniae.

A recombinant Lambda red was also used to remove the ldhA gene of KMK-01. First, the expression vector of the enzyme exo, gamma, and beta to prevent the degradation of the linear gene introduced into the cell and to increase the efficiency of homologous recombination was transformed into a strain of Klebsiella pneumoniae prepared as competent cells . A tetracycline resistant pRedET vector with the BAD promoter was used in the present invention and the transformation was confirmed. Next, a linear gene for homologous recombination was prepared. A pKD4 vector with FRT-kanamycin-FRT cassette was used as the template. A total of 70 base pairs for polymerizing 50 homologous base pairs of ldhA gene to Klebsiella pneumoniae, homologous recombination site, and the FRT-kanamycin-FRT cassette of pKD4 used as a template, a total of 70 base pairs, And Polymerase Chain Reaction (PCR) to generate a linear gene to remove the ldhA gene. Kanamycin is an anti-drug for confirming successful homologous recombination, and the FRT site removes the anti-drug to remove other genes after the target gene is removed.

In the next step, KMK-01 strain, in which pRedET vector was transformed, was cultured at 30 ° C. The pRedET vector is a temperature-sensitive vector. When the temperature exceeds 37 ° C, the pRedET vector loses its activity and is cultured at 30 ° C. After 1 hour of incubation, when the OD600 was about 0.1, the red lambda recombinase expression of pRedET was induced with 10% of arabinose (L-arabinose). When the OD600 reached about 0.6, the cells were transformed into competent cells for electroporation and transformed into a linear gene. The cells were cultured in LB medium at 37 占 폚 for 1 hour, spread on LB solid medium supplemented with 12.5 mg / ml of kanamycin, and cultured for 12 hours. Two primers were made to confirm the success of homologous recombination. The homologous 20-24 base pairs on both sides of the ldhA gene were named ldhA con_A and _B. When these two primers were used for colony PCR, homologous recombination was confirmed through the length of the PCR product.

Since 2,3-butanediol produced as a by-product consumes 18% of the carbon flow of the glycerol ingested and also requires a large amount of cost for the separation and purification of 1,3-propanediol after fermentation, 2,3-butanediol production is eliminated , The budA gene was removed.

A recombinant Lambda red was also used to remove the budA gene of KMK-02. First, the expression vector of the enzyme exo, gamma, and beta to prevent the degradation of the linear gene introduced into the cell and to increase the efficiency of homologous recombination was transformed into a strain of Klebsiella pneumoniae prepared as competent cells . A tetracycline resistant pRedET vector with the BAD promoter was used in the present invention and the transformation was confirmed. Next, a linear gene for homologous recombination was prepared. A pKD4 vector with FRT-kanamycin-FRT cassette was used as the template. A total of 70 base pairs for polymerizing 50 homologous base pairs on both sides of the budA gene to Klebsiella pneumonia, which is a homologous recombination site, and the FRT-kanamycin-FRT cassette of pKD4 used as a template, And a linear gene for the removal of the budA gene was constructed using Polymerase Chain Reaction (PCR). Kanamycin is an anti-drug for confirming successful homologous recombination, and the FRT site removes the anti-drug to remove other genes after the target gene is removed.

The KMK-02 strain, which was confirmed to have a pRedET vector transformed into the next step, was cultured at 30 ° C. The pRedET vector is a temperature-sensitive vector. When the temperature exceeds 37 ° C, the pRedET vector loses its activity and is cultured at 30 ° C. After 1 hour of incubation, when the OD600 was about 0.1, the red lambda recombinase expression of pRedET was induced with 10% of arabinose (L-arabinose). When the OD600 reached about 0.6, the cells were transformed into competent cells for electroporation and transformed into a linear gene. The cells were cultured in LB medium at 37 占 폚 for 1 hour, spread on LB solid medium supplemented with 12.5 mg / ml of kanamycin, and cultured for 12 hours. Two primers were made to confirm the success of homologous recombination. The homologous 20-24 base pairs on both sides of the budA gene were named budA con_A and _B. When these two primers were used for colony PCR, homologous recombination was confirmed through the length of the PCR product.

The gene that produces 2,3-butanediol is a bud operon as shown in Fig. Since acetolactate is an amino acid, isoleucine and a precursor necessary for the production of valine, the budB gene is not removed. When the budC gene is removed, acetoin is produced in excess of 2,3-butanediol, . The budA gene (AEJ98545.1) was removed from KMK-02 strain and designated KMK-11.

The primers used in the present invention are shown in Table 2, and the mutant recombinant strains and genetic characteristics developed in the present invention are shown in Table 3.

In the present invention, the primer sequence used for gene removal and cloning Primer name Primer sequence  ( 5 '- &gt; 3 ') wabG _FKF_fw
(SEQ ID NO: 4) Gt ; wabG _FKF_rv
(SEQ ID NO: 5) TTCCGCGCCGCCGCCCGGCAGGCCATCGATAACAAACAATATGCGCATCG GTCCATATGAATATCCTCCT wabG _con_A
(SEQ ID NO: 6) TTCCGGGAACACTACATCGT wabG _con_B
(SEQ ID NO: 7) CCGAGATAGGAGGCAGAGAA ldhA _FKF_fw
(SEQ ID NO: 8) ATTATTTTAAATATGCTACCGTGACGGTATAATCACTGGAGAAAAGTCTT GTGTAGGCTGGAGCTGCTTC ldhA _FKF_rv
(SEQ ID NO: 9) GATTATCTGAATGTGCTCCCCCCGGGAGAGGAGCACAAAAGGGAAAGGCA GTCCATATGAATATCCTCCT ldhA _con_A
(SEQ ID NO: 10) GAATTAGGATTAGCACCCTCTCA ldhA _con_B
(SEQ ID NO: 11) CCAAGCCAGTGTAACGGTATC budA _FKF_fw
(SEQ ID NO: 12) Gt ; budA _FKF_rv
(SEQ ID NO: 13) GCGCCGTGCGCCCACTGGCGTACCGGATACTGTTTGTCCATGTGACCCCC CCTCCTTAGTTCCTATTCC buda _con_A
(SEQ ID NO: 14) ACGGAGGCTGTGAAATACCC buda _con_B
(SEQ ID NO: 15) TTCGTGGCGTACCGGAATA pZS21_ dhaB _fw
(SEQ ID NO: 16) TTT AAGCTT ATGAAAAGATCAAAACGATTTGC pZS21_ dhaB _rv
(SEQ ID NO: 17) TTT ACGCGT CCGTTTAATTCGCCTGACC pZS21_ fdh _fw
(SEQ ID NO: 18) TAT AAGCTT ATGAAAATTGTTCTGGTGCTG pZS21_ fdh _rv
(SEQ ID NO: 19) ATA CCCGGG TTATTTTTTATCGTGTTTACCGTACG pZA31_ dhaT _fw
(SEQ ID NO: 20) TTT AAGCTT ATGGCGGGCGACAAAATA pZA31_ dhaT _rv
(SEQ ID NO: 21) AAA GGATCC TCAAGCGCAAGCATCAGG

^a Underlined sequences are the homologous sequence with the target genes of K. pneumoniae. ^b Restriction sites highlighted in bold

The recombinant strains KMK-01, KMK-02, KMK-11 and wild-type crepicillinum mononuclear cells were cultured to confirm production of 1,3-propanediol and production of by-products.

The flask culture was carried out in a 250 ml Erlenmeyer flask containing 50 ml fermentation broth and performed at 37 ° C and 250 rpm. In addition, fermentation using a fermenter was carried out in a 3 L fermenter containing 1 L of fermentation broth and maintained at pH 7 using 5 M NaOH and performed at 300 rpm. For micro aerobic fermentation, 0.2 vvm of air was injected and 0.2 vvm of nitrogen gas was injected during anaerobic fermentation.

The composition of the fermentation medium used in this Example and the following Examples was 3 g KH2PO4, 6.8 g Na2HPO4, 0.75 g KCl, 5.35 g (NH4) 2SO4, 0.28 g Na2SO4, 0.26 g MgSO4 .7H2O, 0.42 g citric acid, 5 g yeast extract, 10 g Casamino Acids, 1 ml each of Fe and Trace element solutions, and the ingredients of each solution are shown in Table 4. Glycerol and mannitol, which were used as carbon sources, were included in the fermentation medium with controlled concentrations as needed. All reagents used in the medium composition were purchased from Sigma-Aldrich.

Byproducts such as glycerol, sorbitol, gluconate and glucose, including lactic acid, succinic acid, pyruvic acid, acetic acid, ethanol, and 3-hydroxypropionic acid, produced by the metabolic process, including 1,3-propanediol, The operating conditions and the mobile phase are shown in Table 5.

HPLC operating conditions and mobile phase for metabolite analysis subject Condition HPLC model  Waters HPLC1500 series column Sugar SH1011 column (Shodex, Japan) Flow rate 0.6 ml / min Injection volume 10ul Mobile phase 5 mM sulfuric acid Oven temperature 60 ° C Operating time 25 minutes

As a result, as shown in Table 6, the KMK-01 strain in which the wabG gene was removed improved glycerol intake and 1,3-propanediol productivity by about 50% as compared with the wild type strain. Most of the byproducts were not significantly different, but lactic acid productivity decreased by about 50%. In addition, the KMK-02 strain in which the ldhA strain was removed produced almost no lactic acid, and the yield of 1,3-propanediol was improved by about 40%, but the yield did not significantly increase. These results were attributed to the discontinuation of lactic acid production and the acidification of the fermentation medium was reduced as compared with the parent species, which resulted in cell growth and metabolic activation.

In the case of the KMK-11 strain in which the budA gene was additionally removed, the production of 1,3-propanediol was reduced by about 50% as compared with the wild type, but the production of 2,3-butanediol was completely eliminated.

The results of the flask culture of the mutant strains developed in the present invention are shown in Table 6.

Example 2: Fermentation of oil in a micro aerobic condition of strain KMK-11

Since 2,3-butanediol production of KMK-11 strain was completely eliminated in the flask fermentation, the productivity of 1,3-propanediol was improved through fermentation under oil aerobic conditions. As shown in Fig. 2, 47.26 g / L of 1,3-propanediol was produced in the culture for 42 hours, and production of 2,3-butanediol was still stopped.

The results of the production of by-products in this fermentation are shown in FIG. 3. The acetic acid starts to be rapidly produced at the early stage of fermentation and gradually decreased after the production of about 6 g / L. Succinic acid was produced as a major byproduct of about 20 g / L, and pyruvic acid and ethanol were produced at 13 g / L, respectively.

Example 3: Production of recombinant microorganisms overexpressing polmate dehydrogenase, dhaB operon and dhaT operon

Since NADH used in the production of 1,3-propanediol is produced in the glycerol oxidizing zone society, 1,3-propanediol production is also reduced when the flow is reduced to the glycerol oxidizing zone society. Therefore, the present inventors tried to overcome this problem by expressing the folate dihydrogenase of Candida boidinii strain. Polmate dihydrogen AIDS converts NAD + to NADH in the process of converting folate to carbon dioxide using folate as a substrate, so NADH produced can be used to produce 1,3-propanediol.

In addition, dhaB operon and dhaT operon related to 1,3-propanediol production were cloned into pZS31MCS and pZA31MCS plasmids, respectively, in order to improve the flow of the glycerol reduction metabolic pathway and improve 1,3-propanediol productivity.

In order to select a plasmid capable of expressing the strain in Klebsiella pneumoniae, a green fluorescent protein was cloned into various plasmids used in Escherichia coli to try to express the gene in a strain of Rbcyella nemony. As a result, It was confirmed that pZA31MCS (EXPRESSYS, Germany) and pZS21MCS (EXPRESSYS, Germany) plasmids were expressed smoothly, and was used to overexpress a specific gene in Klebsiella pneumoniae.

The template for the dhaB operon and dhaT operon gene for cloning was a chromosome of KCTC2242 in Klebsiella pneumoniae. A Wizard Genomic DNA Purification Kit (Promega, Wis., USA) was used to extract chromosomes of KCTC2242 strain in Klebsiella pneumoniae. Chromosomes of Candida boidinii strains were used for the template of Polmate dihydrogenase, and also Wizard Genomic DNA Purification Kit (Promega, WI, USA) was used.

First, dhaB operon (SEQ ID NO: 1) was amplified by PCR at an annealing temperature of 63 degrees using pZS21_dhaB_fw and pZS21_dhaB_rv primers. PCR was performed using Phusion DNA polymerase (NEB, MA, USA), and the combination followed the product instructions. The amplified dhaB operon gene and pZS21MCS vector were digested with HindIII and MluI restriction enzymes and ligated using DNA Ligation Kit Mighty Mix (TaKaRa Bio Inc., Shiga, Japan). DH5a E. coli was used for amplification and cloning confirmation of the recombinant gene, and cloning was confirmed by DNA sequencing.

The dhaT operon (SEQ ID NO: 2) was amplified by PCR using the pZA31_dhaT_fw and pZA31_dhaT_rv primers at an annealing temperature of 66 ° C. PCR was performed using Phusion DNA polymerase (NEB, MA, USA), and the combination followed the product instructions. The amplified dhaT operon gene and pZA31MCS vector were digested with HindIII and BamHI restriction enzymes and ligated using DNA Ligation Kit Mighty Mix (TaKaRa Bio Inc., Shiga, Japan). DH5a E. coli was used for amplification and cloning confirmation of the recombinant gene, and cloning was confirmed by DNA sequencing.

The polmenitic dehydrogenase gene (SEQ ID NO: 3) was amplified by PCR at an annealing temperature of 65 degrees using pZS21_fdh_fw and pZS21_fdh_rv primers. PCR was performed using Phusion DNA polymerase (NEB, MA, USA), and the combination followed the product instructions. The amplified polmate dihydrogenase gene and the pZS21MCS vector were ligated using DNA Ligation Kit Mighty Mix (TaKaRa Bio Inc., Shiga, Japan) after digesting the gene using HindIII and BamHI restriction enzymes. DH5a E. coli was used for amplification and cloning confirmation of the recombinant gene, and cloning was confirmed by DNA sequencing.

KNK-11F, KNK-11TF, and KNK-11BT were prepared by cloning the prepared plasmid into KMK-11 strain.

Example 4: Expression of genes involved in the production of 1,3-propanediol and fermentation of oil-feed cultures under anaerobic conditions

Glycerol is used in the cell through the oxidation-oxidation pathway and through the reduction metabolic pathway. Since succinic acid, pyruvic acid, ethanol, and acetic acid produced in Example 2 are all produced through the oxidation pathway, it is necessary to reduce the flow to the glycerol oxidation pathway society. In the glycerol oxidizing zone society, fermentation under anaerobic condition was proceeded because oxygen was present in the presence of oxygen, anaerobic fermentation was inhibited in glycerol oxidizing society, and the reductive metabolism circuit was activated.

Table 7 shows the flask culture results of strains expressing fdh, dhaB operon, and dhaT operon in KMK-11 strain.

The sole fermentation of Polmate dihydrogen AIDS did not significantly affect the production of 1,3-propanediol compared to the control. However, when expressed with the dhaT operon, the productivity of 1,3-propanediol increased by about 22%. On the other hand, when the dhaB operon and the dhaT operon were co-expressed, the productivity of 1,3-propanediol was reduced by about 58%. The 1,3-propanediol is converted to 3-hydroxypropionaldehyde by the dhaB operon, which is again converted to 1,3-propanediol by the dhaT operon. 3-Hydroxypropionaldehyde, a precursor of 1,3-propanediol, is highly toxic to cells as an antimicrobial agent. When dhaB operon is expressed, the inhibition of cell growth is expected due to the accumulation of 3-hydroxypropionaldehyde, whereas the expression of dhaT operon relaxes the inhibition of cell growth by rapid conversion before accumulation of 3-hydroxypropionaldehyde Seems to have done.

In order to produce 1,3-propanediol at high concentration, the fermentation of oil-field culture was carried out under anaerobic condition. The strains were KMK-11BT strain, which showed a good phenotype in the flask culture. As shown in Fig. 4, 67 g / L of 1,3-propanediol was produced in the fermentation for 26 hours. This is the highest level of 1,3-propanediol productivity and production rate produced in 2,3-butanediol-depleted strains to date.

As shown in FIG. 5, the byproducts produced in the fermentation of this oil price fermentation were greatly reduced as compared with that in the micro aerobic condition as shown in the graph below. Succinic acid, a major by-product in micro-aerobic conditions, was produced at 4 g / L, a 75% decrease. Also, pyruvic acid was not completely produced. In micro aerobic condition, ethanol of 13 g / L was slightly increased to 16 g / L and production of acetic acid was slightly increased to 6 g / L.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will readily appreciate that many modifications are possible in the exemplary embodiments without materially departing from the novel teachings and advantages of this invention. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Korea University Research & Business Foundation <120> Recombinant Micororganism for Producing 1,3-Propanediol Without          Ability of Producing 2,3-Butanediol <130> P15-B295 <160> 21 <170> Kopatentin 2.0 <210> 1 <211> 4529 <212> DNA <213> Artificial Sequence <220> <223> dhaB operon <400> 1 atgaaaagat caaaacgatt tgcagtactg gcccagcgcc ccgtcaatca ggacgggctg 60 gcccggtg tcagtaaaag tggacaacgg tctgatcgtc gagctggacg gcaaacgccg ggaccagttt 180 gacatgatcg accgatttat cgccgattac gcgatcaacg ttgagcgcac agagcaggca 240 atgcgcctgg aggcggtgga aatagcccgc atgctggtgg atattcacgt cagtcgggag 300 gagatcattg ccatcactac cgccatcacg ccggccaaag cggtcgaggt gatggcgcag 360 atgaacgtgg tggagatgat gatggcgctg cagaagatgc gtgcccgccg gaccccctcc 420 aaccagtgcc acgtcaccaa tctcaaagat aatccggtgc agattgctgc tgacgccgcc 480 gaggccggga tccgcggctt ctcagaacag gagaccacgg tcggtatcgc gcgctatgcg 540 ccgtttaacg ccctggcgct gttggtcggt tcgcagtgcg gccgccccgg cgttttgacg 600 cagtgctcgg tggaagaggc caccgagctg gagctgggca tgcgtggctt aaccagctac 660 gccgagacgg tgtcggtcta cggcaccgaa gcggtattta ccgacggcga tgatactccg 720 tggtcaaagg cgttcctcgc ctcggcctac gcctcccgcg ggttgaaaat gcgctacacc 780 tccggcaccg gatccgaagc gctgatgggc tattcggaga gcaagtcgat gctctacctc 840 gaatcgcgct gcatcttcat taccaaaggc gccggggttc aggggctgca aaacggcgcg 900 gtgagctgta tcggcatgac cggcgctgtg ccgtcgggca ttcgggcggt gctggcggaa 960 aacctgatcg cctctatgct cgacctcgaa gtggcgtccg ccaacgacca gactttctcc 1020 cactcggata ttcgccgcac cgcgcgcacc ctgatgcaga tgctgccggg caccgacttt 1080 attttctccg gctacagcgc ggtgccgaac tacgacaaca tgttcgccgg ctcgaacttc 1140 gatgcggaag attttgatga ttacaacatc ctgcagcgtg acctgatggt tgacggcggc 1200 ctgcgtccgg tgaccgaggc ggaaaccatt gccattcgcc agaaagcggc gcgggcgatc 1260 caggcggttt tccgcgagct ggggctgccg ccaatcgccg acgaggaggt ggaggccgcc 1320 acctacgcgc acggtagcaa cgagatgccg ccgcgtaacg tggtggagga tctgagtgcg 1380 gtggaagaga tgatgaagcg caacatcacc ggcctcgata ttgtcggcgc gctgagccgc 1440 agcggctttg aggatatcgc cagcaatatt ctcaatatgc tgcgccagcg ggtcaccggc 1500 gattacctgc agacctcggc cattctcgat cggcagttcg aggtggtgag tgcggtcaac 1560 gacatcaatg actatcaggg gccgggcacc ggctatcgca tctctgccga acgctgggcg 1620 cggtattcct 1680 gtgcaacaga caacccaaat tcagccctct tttaccctga aaacccgcga gggcggggta 1740 gcttctgccg atgaacgcgc cgatgaagtg gtgatcggcg tcggccctgc cttcgataaa 1800 caccagcatc acctctgat cgatatgccc catggcgcga tcctcaaaga gctgattgcc 1860 ggggtggaag aagaggggct tcacgcccgg gtggtgcgca ttctgcgcac gtccgacgtc 1920 tcctttatgg cctgggatgc ggccaacctg agcggctcgg ggatcggcat cggtatccag 1980 tcgaagggga ccacggtcat ccatcagcgc gatctgctgc cgctcagcaa cctggagctg 2040 ttctcccagg cgccgctgct gacgctggaa acctaccggc agattggcaa aaacgccgcg 2100 cgctatgcgc gcaaagagtc accttcgccg gtgccggtgg tgaacgatca gatggtgcgg 2160 ccgaaattta tggccaaagc cgcgctattt catatcaaag agaccaaaca tgtggtgcag 2220 gacgccgagc ccgtcaccct gcacgtcgac ttagtaaggg agtgaccatg agcgagaaaa 2280 ccatgcgcgt gcaggattat ccgttagcca cccgctgccc ggagcatatc ctgacgccta 2340 ccggcaaacc attgaccgat attaccctcg agaaggtgct ctctggcgag gtgggcccgc 2400 aggatgtgcg gatctcctgc cagacccttg agtaccaggc gcagattgcc gagcagatgc 2460 agcgccatgc ggtggcgcgc aatttccgcc gcgcggcgga gcttatcgcc attcctgacg 2520 agcgcattct ggctatctat aacgcgctgc gcccgttccg ctcctcgcag gcggagctgc 2580 tggcgatcgc cgacgagctg gagcacacct ggcatgcgac agtgaatgcc gcctttgtcc 2640 gggagtcggc ggaagtgtat cagcagcggc ataagctgcg taaaggaagc taagcggagg 2700 tcagcatgcc gttaatagcc gggattgata tcggcaacgc caccaccgag gtggcgctgg 2760 cgtccgacga cccgcaggcg agggcgtttg ttgccagcgg gatcgtcgcg acgacgggca 2820 tgaaagggac gcgggacaat atcgccggga ccctcgccgc gctggagcag gccctggcga 2880 aaacaccgtg gtcgatgagc gatgtctctc gcatctatct taacgaagcc gcgccggtga 2940 ttggcgatgt ggcgatggag accatcaccg agaccattat caccgaatcg accatgatcg 3000 gtcataaccc gcagacgccg ggcggggtgg gcgttggcgt ggggacgact atcgccctcg 3060 ggcggctggc gacgctgccg gcggcgcagt atgccgaggg gtggatcgta ctgattgacg 3120 acgccgtcga tttccttgac gccgtgtggt ggctcaatga ggcgctcgac cgggggatca 3180 acgtggtggc ggcgatcctc aaaaaggacg acggcgtgct ggtgaacaac cgcctgcgta 3240 aaaccctgcc ggtggtagat gaagtgacgc tgctggagca ggtccccgag ggggtaatgg 3300 cggcggtgga agtggccgcg ccgggccagg tggtgcggat cctgtcgaat ccctacggga 3360 tcgccacctt cttcgggcta agcccggaag agacccaggc catcgtcccc atcgcccgcg 3420 ccctgattgg caaccgttca gcggtggtgc tcaagacccc gcagggggat gtgcagtcgc 3480 gggtgatccc ggcgggcaac ctctacatta gcggcgaaaa gcgccgcgga gaggccgatg 3540 tcgccgaggg cgcggaagcc atcatgcagg cgatgagcgc ctgcgctccg gtacgcgaca 3600 tccgcggcga accgggcact cacgccggcg gcatgcttga gcgggtgcgc aaggtaatgg 3660 cgtccctgac cgaccatgag atgagcgcga tatacatcca ggatctgctg gcggtggata 3720 cgtttattcc gcgcaaggtg cagggcggga tggccggcga gtgcgccatg gaaaatgccg 3780 tcgggatggc ggcgatggtg aaagcggatc gtctgcaaat gcaggttatc gcccgcgaac 3840 tgagcgcccg actgcagacc gaggtggtgg tgggcggcgt ggaggccaac atggccatcg 3900 ccggggcgtt aaccactccc ggctgtgcgg cgccgctggc gatcctcgac ctcggcgccg 3960 gctcgacgga tgcggcgatc gtcaacgcgg aggggcagat aacggcggtc catctcgccg 4020 gggcggggaa tatggtcagc ctgttgatta aaaccgagct gggcctcgag gatctttcgc 4080 tggcggaagc gataaaaaaa tacccgctgg ccaaagtgga aagcctgttc agtattcgtc 4140 acgagaatgg cgcggtggag ttctttcggg aagccctcag cccggcggtg ttcgccaaag 4200 tggtgtacat caaggagggc gaactggtgc cgatcgataa cgccagcccg ctggaaaaaa 4260 ttcgtctcgt gcgccggcag gcgaaagaga aagtgtttgt caccaactgc ctgcgcgcgc 4320 tgcgccaggt ctcacccggc ggttccattc gcgatatcgc ctttgtggtg ctggtgggcg 4380 gctcatcgct ggactttgag atcccgcagc ttatcacgga agccttgtcg cactatggcg 4440 tggtcgccgg gcagggcaat attcggggaa cagaagggcc gcgcaatgcg gtcgccaccg 4500 ggctgctact ggccggtcag gcgaattaa 4529 <210> 2 <211> 2639 <212> DNA <213> Artificial Sequence <220> <223> dhaT operon <400> 2 atggcgggcg acaaaataac gctgacaaaa ataaagcaag ccaaccgaat ggtaatagtt 60 ttttactatc gccccctact gactattcgc gccagcgtta tcctggtgcg ggagagaatg 120 atgaacaaga gccaacaagt tcagacaatc accctggccg ccgcccagca aatggcggcg 180 gcggtggaaa aaaaagccac tgagatcaac gtggcggtgg tgttttccgt ggttgaccgc 240 ggaggcaaca cgctgcttat ccagcggatg gacgaggcct tcgtctccag ctgcgatatt 300 tccctgaata aagcctggag cgcctgcagc ctgaagcaag gtacccatga aattacgcca 360 gcggtccagc caggacaatc tctgtacggt ctgcagctta ccaaccaaca gcgaattatt 420 atttttggcg gcggcctgcc agttattttt aatgagcagg taattggcgc cgtcggcgtt 480 agcggcggta cggtcgagca ggatcaatta ttagcccagt gcgccctgga ttgtttttcc 540 gcattataac ctgaagcgag aaggtatatt atgagctatc gtatgtttga ttatctggtg 600 ccaaacgtta acttttttgg ccccaacgcc atttccgtag tcggcgaacg ctgccagctg 660 ctggggggga aaaaagccct gctggtcacc gacaaaggcc tgcgggcaat taaagatggc 720 gcggtggaca aaaccctgca ttatctgcgg gaggccggga tcgaggtggc gatctttgac 780 ggcgtcgagc cgaacccgaa agacaccaac gtgcgcgacg gcctcgccgt gtttcgccgc 840 gaacagtgcg acatcatcgt caccgtgggc ggcggcagcc cgcacgattg cggcaaaggc 900 atcggcatcg ccgccaccca tgagggcgat ctgtaccagt atgccggaat cgagaccctg 960 accaacccgc tgccgcctat cgtcgcggtc aataccaccg ccggcaccgc cagcgaggtc 1020 acccgccact gcgtcctgac caacaccgaa accaaagtga agtttgtgat cgtcagctgg 1080 cgcaacctgc cgtcggtctc tatcaacgat ccgctgctga tgatcggtaa accggccgcc 1140 ctgaccgcgg cgaccgggat ggatgccctg acccacgccg tagaggccta tatctccaaa 1200 gcgctaacc cggtgacgga cgccgccgcc atgcaggcga tccgcctcat cgcccgcaac 1260 ctgcgccagg ccgtggccct cggcagcaat ctgcaggcgc gggaatacat ggcctatgcc 1320 tctctgctgg ccgggatggc tttcaataac gccaacctcg gctacgtgca cgccatggcg 1380 caccagctgg gcggcctgta cgacatgccg cacggcgtgg ccaacgctgt cctgctgccg 1440 catgtggcgc gctacaacct gatcgccaac ccggagaaat tcgccgatat cgctgaactg 1500 atggggaaa atatcaccgg actgtccact ctcgacgcgg cggaaaaagc catcgccgct 1560 atcacgcgtc tgtcgatgga tatcggtatt ccgcagcatc tgcgcgatct gggggtaaaa 1620 gagaccgact tcccctacat ggcggagatg gctctgaaag acggcaatgc gttctcgaac 1680 ccgcgtaaag gcaacgagca ggagattgcc gcgattttcc gccaggcatt ctgagtgtta 1740 acgaggggac cgtcatgtcg ctttcaccgc caggcgtacg cctgttttac gatccgcgcg 1800 ggcaccatgc cggcgccatc aatgagctgt gctgggggct ggaggagcag ggggtcccct 1860 gccagaccat aacctatgac ggaggcggtg acgccgctgc gctgggcgcc ctggcggcca 1920 gaagctcgcc cctgcgggtg ggtattgggc tcagcgcgtc cggcgagata gccctcactc 1980 atgcccagct gccggcggac gcgccgctgg ctaccggaca cgtcaccgat agcgacgatc 2040 atctgcgtac gctcggcgcc aacgccgggc agctggttaa agtcctgccg ttaagtgaga 2100 gaaactgaat gtatcgtatc tatacccgca ccggggataa aggcaccacc gccctgtacg 2160 gcggcagccg catcgagaaa gaccatattc gcgtcgaggc ctacggtacc gtcgatgaac 2220 tgatatccca gctgggcgtc tgctacgcca cgacccgcga cgccgggctg cgggaaagcc 2280 tgcaccatat tcagcagacg ctgttcgtgc tgggggctga actggccagc gatgcgcggg 2340 gcctgacccg cctgagccag acgatcggcg aagaggagat caccgccctg gagcggctta 2400 tcgaccgcaa tatggccgag agcggcccgt taaaacagtt cgtgatcccg gggaggaatc 2460 tcgcctctgc ccagctgcac gtggcgcgca cccagtcccg tcggctcgaa cgcctgctga 2520 cggccatgga ccgcgcgcat ccgctgcgcg acgcgctcaa acgctacagc aatcgcctgt 2580 cggatgccct gttctccatg gcgcgaatcg aagagactag gcctgatgct tgcgcttga 2639 <210> 3 <211> 1095 <212> DNA <213> Artificial Sequence <220> <223> fdh1 <400> 3 atgaagatcg ttttagtctt atatgatgct ggtaagcacg ctgctgatga agaaaaatta 60 tatggttgta ctgaaaataa attaggtatt gctaattggt taaaagatca aggtcatgaa 120 ctaattacta cttctgataa agaaggtgaa acaagtgaat tggataaaca tatcccagat 180 gctgatatta tcatcaccac tcctttccat cctgcttata tcactaagga aagacttgac 240 aaggctaaga acttaaaatc agtcgttgtc gctggtgttg gttctgatca cattgattta 300 gattatatta atcaaacagg taagaaaatc tcagtcctgg aagttacagg ttctaatgtt 360 gtctctgttg ctgaacacgt tgtcatgacc atgcttgtct tggttagaaa tttcgttcca 420 gcacatgaac aaattattaa ccacgattgg gaggttgctg ctatcgctaa ggatgcttac 480 gatatcgaag gtaaaactat cgctaccatt ggtgctggta gaattggtta cagagtcttg 540 gaaagattac tcccatttaa tccaaaagaa ttattatact acgattatca agctttacca 600 aaagaagctg aagaaaaagt tggtgctaga agagttgaaa atattgaaga attagttgct 660 caagctgata tcgttacagt taatgctcca ttacacgcag gtacaaaagg tttaattaat 720 aaggaattat tatctaaatt taaaaaaggt gcttggttag tcaataccgc aagaggtgct 780 atttgtgttg ctgaagatgt tgcagcagct ttagaatctg gtcaattaag aggttacggt 840 ggtgatgttt ggttcccaca accagctcca aaggatcacc catggagaga tatgagaaat 900 aaatatggtg ctggtaatgc catgactcct cactactctg gtactacttt agacgctcaa 960 acaagatacg ctgaaggtac taaaaatatt ttggaatcat tctttaccgg taaatttgat 1020 tacagaccac aagatattat cttattaaat ggtgaatacg ttactaaagc ttacggtaaa 1080 cacgataaga aataa 1095 <210> 4 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gatttaatcc ctaccgacgc ggtcatcgcg gcggcgaaaa aggtactggc gtgtaggctg 60 gagctgcttc 70 <210> 5 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ttccgcgccg ccgcccggca ggccatcgat aacaaacaat atgcgcatcg gtccatatga 60 atatcctcct 70 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ttccgggaac actacatcgt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ccgagatagg aggcagagaa 20 <210> 8 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 attattttaa atatgctacc gtgacggtat aatcactgga gaaaagtctt gtgtaggctg 60 gagctgcttc 70 <210> 9 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gattatctga atgtgctccc cccgggagag gagcacaaaa gggaaaggca gtccatatga 60 atatcctcct 70 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gaattaggat tagcaccctc tca 23 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ccaagccagt gtaacggtat c 21 <210> 12 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 gtcaacattt atttaacctt tcttatattt gttgaacgag gaagtggtat gtgtaggctg 60 gagctgcttc 70 <210> 13 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gcgccgtgcg cccactggcg taccggatac tgtttgtcca tgtgaccccc cctccttagt 60 tcctattcc 69 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 acggaggctg tgaaataccc 20 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ttcgtggcgt accggaata 19 <210> 16 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 tttaagctta tgaaaagatc aaaacgattt gc 32 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 tttacgcgtc cgtttaattc gcctgacc 28 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 tataagctta tgaaaattgt tctggtgctg 30 <210> 19 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 atacccgggt tattttttat cgtgtttacc gtacg 35 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 tttaagctta tggcgggcga caaaata 27 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 aaaggatcct caagcgcaag catcagg 27

Claims (7)

In a microorganism having 1,3-propanediol-producing ability, a gene encoding glucosyltransferase involved in lipopolysaccharide biosynthesis, a gene encoding lactate dehydrogenase, and a gene encoding? -Acetolactate decarboxylase The genes coding for the azo have been deleted, and the dhaT operon and Candida boidinii, ancylobacter aquaticus, Ceriporiopsis subvermispora, Moraxella (Moraxella spp.), wherein the polymethicone dehydrogenase derived from a strain selected from the group consisting of Paracoccus sp. and Thiobacillus sp. is overexpressed and the dhaB operon is not overexpressed , 3-propanediol.
2. The recombinant microorganism according to claim 1, wherein the microorganism is clopsiella annum.
The dhaT operon according to claim 1, wherein the dhaT operon is derived from a strain selected from the group consisting of Klebsiella pneumoniae, klebsiella oxytoca, and clostridium butyrricum Recombinant microorganism.
delete A process for preparing 1,3-propanediol comprising the steps of:
(a) culturing the recombinant microorganism of any one of claims 1 to 3 to produce 1,3-propanediol; And
(b) obtaining the resulting 1,3-propanediol.
6. The method according to claim 5, wherein the culture of step (a) uses glycerol as a carbon source.
6. The method according to claim 5, wherein the culture in step (a) is ash fermentation or oil fermentation.

Images