KR101346261B1 - Sets of primers and TaqMan MGB probes for real-time PCR-based assays to discriminate ginseng cultivars - Google Patents

Abstract

The present invention relates to a primer and a probe set for specifically amplifying DNA fragments related to ginseng varieties by real-time PCR analysis, and more specifically to the specific amplification results of DNA related to the determination of ginseng varieties by real-time PCR analysis It relates to a set of gene specific primers and probes that can be used to quantitatively measure.

Description

Set of primers and TaqMan MGB probes for real-time PCR-based assays to discriminate ginseng cultivars}

The present invention relates to a primer and a probe set for discriminating ginseng varieties by real-time PCR analysis, and more specifically, by genes that can be used to quantitatively measure specific amplification results of DNA related to discrimination of ginseng varieties by real-time PCR analysis. Specific primers and probe sets.

Traditionally, a method that has traditionally been used to measure the expression of genes combines mRNA isolated from analyte with a complementary radioisotope-labeled DNA probe to compare gel images exposed by radioisotopes. Northern blotting assays (Parker and Barnes, 1999) have been mainstream to quantify, but when the amount of mRNA of the target gene expressed by a specific treatment is small, its sensitivity is relatively low, resulting in gene expression between individuals or between treatments. The disadvantage is that the quantitative comparison of quantities cannot be carried out accurately (Melton et al., 1984).

In addition, the reverse transcription polymerase chain reaction (RT-PCR) developed with the development of the PCR reactor method is a method for measuring the relative amount of amplification by making cDNA through PCR-based reverse transcription reaction using mRNA as a template. (Rappolee et al., 1988) has been used as an alternative to the northern blotting method, but has the disadvantage of requiring a lot of time and expertise in cDNA cloning (Bustin, 2000).

Higuchi et al. (1992, 1993) reported that amplification products obtained by PCR reactions using DNA primers and nucleotide sequences and very high complementarity and specificity of target genes to be analyzed are treated with ethidium bromide or other fluorescent dyes. stained with fluorescent dyes so that they can be intercalated into the double helix structure of the DNA amplification product, and then irradiated with ultraviolet light to detect the fluorescence developed by the CCD camera, according to the PCR kinetics model of the PCR reaction. A system for quantitative measurement was devised. Since then, this method has been called "real-time PCR", an analysis system that can be applied to the detection of specific genes and the quantification of mRNA, the primary product of gene expression.

However, this method had a critical weakness in that the products that reacted nonspecifically with the target gene during PCR were detected together, thereby reducing the reproducibility or accuracy of the experimental results. As an alternative to solving this problem, Holland et al. (1991) used DNA cleavage characteristics (5 'to 3' exonuclease activity) from the 5 'to 3' end of Taq DNA polymerase, a polymerase that amplifies DNA in PCR reactions. By using a labeled probe and a pair of PCR primers that specifically bind to the desired gene in the PCR reaction, most of the non-specific products in the conventional real-time PCR reaction are removed and a method of selectively amplifying only the region of the target gene is developed. It was.

In addition, Lee et al. (1993) developed a "fluorogenic probe" labeled with a 5'-reporter fluorescent dye at the 5 'end and a quencher dye attached to the 3' end. A simple real-time PCR reaction was established and two fluorescent dyes, SYBR Green I dye and TaqMan MGB probes, were developed by PE Biosystems to label the fluorogenic probes. Selective detection and quantitative analysis of gene expression levels can be performed more accurately and easily in large quantities.

However, the gel image of Northern blotting using radioisotopes alone cannot quantitatively measure the expression level of the related genes, which means that the differences in the genes between ginseng varieties cannot be accurately determined. There is a limitation that the difference between individuals within the same species cannot be identified in the gene expression level, so it cannot be used in breeding programs to foster new breeds.

In addition, in the report reported by the inventors (In & Kim et al (2005), Genetic relationships of Panax species by RAPD and ISSR analyses, Korean Journal of Medicinal Crop Science, 13, 249-253), This study was conducted to examine the softness and genetic characteristics of RAF and ISSR using the breeze, archaea, whirlwind, gold wind and domestic and international collection species such as Jakyungjong, Hwang Sookjong, Mimachi, Seokjusam, Bamboo Jasam ( P. japonicus ) and American Ginseng. However, it was difficult to distinguish between varieties using these techniques.

These results are characteristic of the technique using a random primer, which is low in reproducibility of the experimental results and is suitable for use as markers of varieties that need to secure distinction, reproducibility, and stability because of limitations in obtaining genetic information even when searching for polymorphisms between varieties. There is a problem that is not.

In Yang et al (2001), Comparison of ITS and 5.8S rDNA sequences among varieties and cultivars in Panax ginseng , Journal of Photoscience, 8, 55-60, The ITS and 5.8S rDNA sequences of Hwangsook, Hwangsook, and Hwangsook were compared and analyzed, suggesting that Hwangsook showed single nucleotide polymorphism.

On the other hand, according to the inventors of Kim & Bang et al (2007), Molecular authentication of ginseng cultivars by comparison of internal transcribed spacer and 5.8S rDNA sequences, Plant Biotechnology Report, 1, 163-167, Treatment of restriction enzyme TaqⅠ which recognizes ITS and 5.8S rDNA sequencing and single nucleotide polymorphism sites of Ginseng, old wind, whirlwind, Geum wind, and domestic and international collections such as Jakyungjong, Hwang Sukjong, Mimachi, Seokjusam, Jukjesam, and American ginseng As a result of comparing and analyzing the genetic patterns, it was reported that only the old winds and gold winds were distinguished from other varieties and other domestic and international collections.

However, these methods alone had difficulty in clearly distinguishing the developed ginseng varieties.

Korean Patent Registration No. 10-0215084 discloses a method for determining the origin of Korean ginseng by RAPD and primers used in the method. Korean Patent Laid-Open No. 2004-0034331 discloses wild ginseng and cultivated ginseng using single nucleotide polymorphism. Discrimination method is disclosed, and Korean Patent Registration No. 10-0610312 discloses a species discrimination kit of ginseng, but is different from the primer set of the present invention.

On the other hand, in the method of using a DNA marker, one of the molecular biological techniques used to distinguish the varieties of ginseng, first extract the DNA from the target sample and quantify the extracted DNA. Then, amplify the desired DNA fragment by PCR using a specific primer that can amplify the desired DNA, followed by electrophoresis, staining with ethidium bromide, and confirming the DNA bands of the varieties with UV transilluminators. do.

In particular, in order to search for polymorphism (SNP) of a single nucleotide sequence, PCR is performed to amplify a desired DNA fragment, and then additionally a restriction enzyme is treated to an amplification product and undergoes electrophoresis to determine whether the varieties are distinguished. As another method of searching for polymorphism of a single nucleotide sequence, the PCR amplification product can be identified by comparing the nucleotide sequences obtained from the nucleotide sequence obtained through the gene cloning process.

In contrast, the real-time PCR method can omit the restriction enzyme treatment, electrophoresis and sequencing process in the above process, and the result can be confirmed in real time during the PCR process, faster, safer, and accurate than the conventional analysis method.

Therefore, the probe and primer as a control to be used for the relative quantification of the target DNA and the target DNA to be analyzed by real-time PCR to amplify the target DNA fragments as in the present invention should be developed in order to activate the cross ginseng research Can be.

Accordingly, an object of the present invention is to provide a specific primer and probe set for amplifying DNA fragments related to the determination of ginseng varieties by real-time PCR analysis.

It is another object of the present invention to provide a method for quantitatively measuring a DNA fragment of interest related to discriminating ginseng varieties by real-time PCR analysis.

The present invention for achieving the above object provides a set of specific primers and probes for amplifying the desired DNA fragments associated with the determination of ginseng varieties by real-time PCR analysis.

The present invention provides a method for quantitatively measuring a DNA fragment of interest related to the determination of ginseng varieties by a real-time PCR assay.

Hereinafter, the present invention will be described in detail.

The present invention has the technical features to provide a specific primer pair and the base sequence of the probe to measure the DNA fragments significantly amplified in ginseng varieties, specifically 5 kinds of Korean ginseng by real-time PCR analysis. In particular, sequencing of specific DNA fragments in ginseng varieties can be performed to establish specific regions of these DNA fragments with primers and probes, which can be used for quantitative analysis of gene expression based on real-time PCR reactions.

At this time, the species belonging to five kinds of Korean ginseng may be Chunpoong, Yunpoong, Gopoong, Gopoong, Kumpoong, or Sunpoong, and the pair of primers and probes for determining the ginseng variety of the present invention The base sequence may be derived from Panax ginseng CA Meyer.

The present invention provides a method for quantitatively measuring the amplification amount of a specific DNA fragment by real-time PCR analysis.

In the above, the real-time PCR analysis is preferably measured quantitatively by real-time PCR analysis using a primer pair or probe that can confirm the amplification amount of the DNA fragment.

At this time, the primers were prepared in three pairs of primers including sense primers and antisense primers. Fluorescent probes attached VIC or FAM as a reporter at the 5 'end and TaqMan MGB probe and MGB-NFQ at 3' direction. (See Table 2).

In the above quantitative measurement by real-time PCR analysis, in order to quantitatively calculate the relative amount of amplification, in the case of PGP74, a primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 and the nucleotide sequences of SEQ ID NOs: 3 and 4 were used as VIC or PAM ( It is preferable to use a gene expression analysis set consisting of a probe labeled with FAM), and in the case of PGP110, a primer set consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6 and a VIC or FAM in the nucleotide sequence of SEQ ID NOs: 7,8 It is preferable to use a gene expression analysis set composed of probes labeled with.

In the case of PGP130, it is preferable to use a specific DNA amplification analysis set consisting of a primer set consisting of nucleotide sequences of SEQ ID NOs: 9 and 10 and a probe labeled with VIC or FAM in the nucleotide sequences of SEQ ID NOs: 11, 12 Do.

The present invention rapidly and accurately amplifies only the target DNA amplified from the above-described DNA fragment by real-time PCR reaction among a plurality of total DNA extracted from ginseng leaves using the primer and probe set, and quantitatively amplifies the amplification amount. It can be measured.

Therefore, primers and probe sets for amplifying the desired DNA fragments related to the determination of ginseng varieties by real-time PCR analysis according to the present invention can be applied directly or indirectly to the field of development, as well as the field of research. If necessary, a kit including the specific DNA amplification assay set may be manufactured.

The present invention provides a method for quantitative analysis using a real-time PCR analysis method for amplifying DNA fragments related to discrimination in ginseng varieties, particularly 5 kinds of Korean ginseng, to quantitatively analyze amplification results of DNA fragments by real time PCR reaction. It is possible to provide a set of primers and probes specific to the variety used.

According to the present invention, the primers and probe sets are rapidly and accurately amplify only the DNA of the above-described specific sequence region by real-time PCR among a plurality of total DNA extracted from the leaves of ginseng varieties, and quantitatively amplify the amplification amount thereof. We can measure and can distinguish five kinds of ginseng reliably. Therefore, it can be used as a breed guarantee marker for protecting the intellectual property of each variety. In addition, it can be used as a nucleic acid marker for varieties guarantee, which can be a great help in exercising the external intellectual property rights of developers and distributors of excellent varieties.

In addition, it can be used as a base technology to correct distribution market confusion caused by mixed ginseng and processed products of ginseng when domestic ginseng is grown, and to increase the genetic stability (purity) of varieties during ginseng breeding. It can be used for the business of spreading high-purity seeds to farms by preventing breeding.

1 is a graph showing the results of the single base sequence variation (SNP-A or ANP-G) of the ginseng 5 varieties using the PGP74 probe combination of Table 2.
Figure 2 is a graph showing the results of the single base sequence variation (SNP-A or ANP-G) of the ginseng 5 varieties using the PGP110 probe combination of Table 2.
Figure 3 is a graph showing the results of the single base sequence variation (SNP-A or ANP-G) of the ginseng 5 varieties using the PGP130 probe combination of Table 2.

Through the following examples will be described in more detail the present invention. However, these embodiments are intended to describe the present invention in more detail, and the scope of the present invention is not limited to the matters set forth in the embodiments according to the gist of the present invention.

Example 1 Ginseng Sample Preparation and DNA Separation

Materials for this study were five varieties of Tianfeng, Yeonpung, Old Wind, Geumpung, and Whirlwind, which were grown in the ginseng and test packaging of the National Ginseng Specialty Research Institute, National Institute of Horticultural & Herbal Science, Rural Development Administration.

The materials used in the experiment were collected by five ginseng samples per variety by grasping the morphological characteristics of the ground with the help of breeding specialists of the ginseng special division. It was stored separately in Korea Medicinal Herbarium.

In order to define gene-specific probe and primer pairs by real-time PCR analysis in genes, to obtain genomic DNA of ginseng, three-year-old leaves are collected, washed, quenched with liquid nitrogen, and ground using a mortar and pestle. DNA was isolated using the company's DNeasy plant mini kit.

The isolated DNA was electrophoresed with λDNA on a 1% agarose gel, and then stained with EtBr (Ethidium Bromide), and the concentration was measured by comparing the brightness of DNA bands in UV light. Each DNA sample of which concentration measurement was completed was used for PCR reaction by adjusting the final DNA concentration to 10 ng / μl using sterile midstream water.

Example 2: PCR and Electrophoresis Analysis

The PCR reaction was carried out on 5 varieties of ginseng using three pairs of STS primers of UGFp74, MFGp110A, and MFGp130A disclosed in the previously-patent application No. 10-2008-0080459.

For reference, the three pairs of STS primer combinations are shown in Table 1 below:

primer The sequence (5'-3 ') SEQ ID NOS in patent literature Tm (占 폚) One
KGY + 0130A
F-GGAAAGCGTTCAGCTCTTACG One 65
R-TAAATGCTGTCAAGCCCAGAG 2 2
KGY + 0110A
F-AGTCCCAACGGAATTTCATC 5 65
R-GTTTTCCGCTTATGTTGCAG 6 3
KGY-0074
F-GCGAATTTCACAGAATTAGACG 7 65
R-ACAGGTCTCGAAACAATTGAAG 8

Meanwhile, the composition of the PCR reaction mixture (25 μl) performed to observe polymorphism between ginseng varieties was as follows: 50 ng of genomic DNA of ginseng, 20 pM of each primer, 200 μM of dNTP, 0.5 unit DNA polymerase, 1 XPCR reaction buffer solution ( Solgent, Korea).

PCR reaction was performed using TProfessional (Biometra, Germany) for 5 minutes at 94 ° C, initial denaturation, 94 ° C 1 minute denaturation, 60 ° C 1 minute binding, and 72 ° C 1 minute extension in total 40 cycles. The final extension reaction was carried out at 72 ° C. for 5 minutes. The amplified PCR product was electrophoresed on 1.5% agarogel and stained with EtBr to confirm the genetic characteristics between the varieties in an image analyzer. Comparative analysis.

As a result, PCR was performed using the MFGp130 primer. As a result, DNA fragments of 375 bp were observed in the three varieties of gusts, arches and gold winds, and DNA fragments of 322 bp in gusts and whirlwinds.

In addition, when two primers of UFGp74 and MFGp110A were used, DNA fragments of the same size of 639bp and 930bp were observed. Meanwhile, DNA fragments obtained through the above procedure were subjected to gene cloning and nucleotide sequence comparison.

As a result, when the MFGp130 primer was used, it was confirmed that 53bp was inserted / deleted and there was a mutation in one nucleotide sequence. In addition, when using the MFGp74 primer, two nucleotide sequence mutations were identified, and when MFGp110A was used, it was confirmed that there were mutations in six nucleotide sequences.

Example 3: Preparation of primers and fluorescent probes using real-time gene amplification

Primers and fluorescent probes to be used in real-time gene amplification were prepared using the base sequence information as a target for the site of variation between varieties. First, primers were prepared with three pairs of primers including sense primers and antisense primers. Fluorescent probes were attached with VIC or FAM as a reporter at the 5 'end, and both TaqMan MGB probe and MGB-NFQ were attached to the 3' direction.

Fluorescent probe and primer combinations used in the present invention are summarized as Table 2 below:

Probe Combination Name Probes and Primers Sequence (5 '→ 3') PGP74


Probe G VIC-CGTTTAACGAATCCTC-MGB (SEQ ID NO: 3) Probe A FAM-CGTTTAACAAATCCTC-MGB (SEQ ID NO: 4) Primer f GCTCAAGAATCGTCAGATTCTGACT (SEQ ID NO: 1) Primer r CGGAATCCGTTAACTTGAAATTCACTT (SEQ ID NO: 2) PGP110


Probe C VIC-CCTCCCCTAG C TACTCT-MGB (SEQ ID NO: 7) Probe T FAM-CCTCCCCTAGTTACTCT-MGB (SEQ ID NO: 8) Primer f GGCCCTTTCATTCTACAACTCTCAA (SEQ ID NO: 5) Primer r GTCGCCTTGTACCGAGTCAA (SEQ ID NO: 6) PGP130


Probe C VIC-ACCTCTGA C ATCTTG-MGB (SEQ ID NO: 11) Probe A FAM-CCTCTGAAATCTTG-MGB (SEQ ID NO: 12) Primer f GCACCCCCAAAAGGGCTAAA (SEQ ID NO: 9) Primer r TCGATAGGTGGCTCCATACGAT (SEQ ID NO: 10)

Example 4: Real-Time Gene Amplification and Genotyping

Real-time gene amplification reactions were performed using the ABI Step One Plus System. PCR reaction mixture composition (10ul) is 50ng genomic DNA, TaqMan ^? Universal master mix 5ul, each primer 300nM, each MGB probe 200nM was used, PCR reaction conditions were 60 ℃ 30 seconds, 95 ℃ 10 minutes after the reaction 95 ℃ 15 seconds, 60 ℃ 1 minute two steps of PCR 40 cycles It was. Genotypic analysis among five varieties of ginseng was carried out using six TaqMan MGB probes and three pairs of primers under the above PCR conditions. The wild type showed a green signal with the VIC dye attached during the PCR reaction. FAM dye attached to give a blue signal. After PCR, the results were analyzed using Step One ^TM software ver.2.1 (Applied Biosystems, USA). Through this process, genotype of ginseng was determined.

Tables 1 to 3 show the results of single base sequence variation (SNP-A or ANP-G) of 5 ginseng varieties using the PGP74 probe combination, the PGP110 probe combination, and the PGP 130 probe combination of Table 2, respectively.

As a result, genotypes of five kinds of ginseng were identified using the combination of PGP74. As a result, the typhoon and whirlwind were SNP-A type, and the typhoon, archaea and gold wind were SNP-G type genotypes. In addition, when the PGP110 combination was used, the typhoon and the high wind were classified into the SNP-T type, and the typhoon, the gold wind, and the whirlwind were classified into the SNP-C type.

Finally, when the PGP130 combination was used, the wind, wind and gold winds were classified into SNP-A type, and the wind and whirlwinds were classified into SNP-C type.

In conclusion, genotypes of five ginseng varieties using three selected combinations of probes (PGP74, PGP110, PGP130) are shown in Table 3 below, as the typhoon 'ATA', the typhoon 'GCC', the old wind 'GTA', Geumpung is a genotype of 'GCA' and Whirlwind is 'ACC'. These genotypes were able to discriminate five Korean varieties of Ginseng faster, safer and more accurately than conventional methods.

Probe Combination Name
Breed / Genotype Typhoon Breeze Antiquity Gold wind whirlwind PGP74 A G G G A PGP110 T C T C C PGP130 A C A A C Genotype combination ATA GCC GTA GCA ACC

Attach an electronic file to a sequence list

Claims (7)

Ginseng varieties consisting of a primer set consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, a probe labeled VIC on the nucleotide sequence of SEQ ID NO: 3, and a probe labeled FAM on the nucleotide sequence of SEQ ID NO: 4 Gene expression assay set for discrimination.
delete delete According to claim 1, The ginseng varieties Chunpoong, Yunpoong, Gopoong, Gopoong, Kumpoong or Sunpoong gene expression analysis set for determining the ginseng.
The gene expression analysis set for discriminating ginseng varieties according to claim 1, wherein the base sequences of the primer set and the probe are derived from Panax ginseng CA Meyer.
Ginseng varieties genes are quantitatively measured by real-time PCR,
Real-time PCR analysis is a method for quantitatively measuring by the real-time PCR analysis, characterized in using the gene expression analysis set of claim 1.
The method of claim 6, wherein the ginseng varieties are Chunpoong, Yunpoong, Gopoong, Kumpoong or Sunpoong.

Images