KR101334853B1 - Primer set for detection of xanthomonas campestris pv. nigromaculans and diagnostic kit using the same - Google Patents

Abstract

The present invention relates to a PCR primer set for detecting Xanthomonas campestris pv. nigromaculans and, more specifically, to a PCR primer set of sequence numbers 1 and 2 or 3 and 4, a kit containing the same for diagnosing Xanthomonas campestris pv. nigromaculans, and a method for detecting Xanthomonas campestris pv. nigromaculans using the same. The primer set of the present invention has a sequence which is able to specifically detect Xanthomonas campestris pv. nigromaculans, thereby being used in diagnosing and detecting Xanthomonas campestris pv. nigromaculans.

Description

PCR primer set for detecting burdock germ spot pattern germ and diagnostic kit using same {Primer set for detection of Xanthomonas campestris pv. nigromaculans and diagnostic kit using the same}

The present invention relates to a set of pathovar specific PCR primers for detecting burdock bacterium pathogens and a diagnostic kit using the same, and more specifically, specifically binds to 23S rRNA gene partial sequences of burdock bacterium pathogens. Primer XNIGf (forward, SEQ ID NO: 1) and XNIGr (reverse, SEQ ID NO: 2) a primer set consisting of a base sequence or complementary to them, kit for detecting burdock bacterium bacterial pathogen comprising any one of the above two and The present invention relates to a method for detecting burdock microorganisms using the same.

Dot-blot, polymerase chain reaction (PCR), etc. are used as a method for diagnosing plant pathogens. In particular, PCR is a widely used method because it is economical in terms of time, effort, and manpower than the dot-blot method. PCR (polymerase chain reaction) diagnostic method is to anneal a specific DNA fragment (primer) consisting of 10 ~ 20bp to the genomic DNA of the bacteria and then heat-resistant DNA polymerase (Taq polymerase) After repeated addition and repeated synthesis, the primer-bound region rapidly amplifies, and the PCR amplification product is electrophoresed on an agarose gel or acrylamide gel and ethidium bromide It is a method for detecting and diagnosing DNA polymorphisms of bacterial species such as the presence or absence of DNA bands and staining after DNA staining with bromide and silver stain. At present, the PCR method is mainly used for diagnosing bacterial diseases of humans or animals, but recently, PCR diagnostic methods have been developed to diagnose plant pathogens and are used for quarantine of imported and imported agricultural products. . In addition, the PCR diagnostic method is shorter in time than other methods, is inexpensive to diagnose, and is economical because many samples can be simultaneously tested. Recently, a PCR diagnostic method for amplifying a nucleic acid, which is a genetic material, is most preferred among Xanthomonas detection methods.

Xanthomonas campestris invade leaves, stems, and fruit, resulting in tiny light brown or brown spots. In the case of leaves, angular lesions may occur only in the leaf veins. In severe cases, the lesions fuse and the leaves wither. Burdock jeommunuibyeong bacterial strains to be diagnosed by the present invention (Xanthomonas campestris pv. Nigromaculans) will cause the bar to break the bacterial jeommunuibyeong burdock, many economic damage.

Burdock ( Arcium) lappa L. ) is a biennial herbaceous plant belonging to Asteraceae, its height is about 1.5m, and its stem is purple and grows straight. Root leaves agglomerate, petiole long, stem leaves displaced, and heart-shaped with shallow basal edges. The front side of the leaf is dark green and the back side is fluffy and white. The root contains inulin and some palmitic acid. It is also used as a diuretic and antiperspirant, or as an antidote for sore throats and poisons.

Among the existing Xanthomonas microorganisms, rice leaf blight pathogen ( Xanthomonas oryzae pv. oryzae ), bacterial spot pattern pathogen ( Xanthomonas campestris pv. vesicatoria ), Cruciferous Black Pathogen ( Xanthomonas) campestris pv. campestris ), citrus ulcer pathogen ( Xanthomonas axonopodis pv. citri and Xanthomonas axonopodis pv. Study on the individual PCR primers used for the detection of various microorganisms, such as glycines) has been made, burdock bacteria jeommunuibyeong bacteria (Xanthomonas campestris pv. nigromaculans ) has not been studied yet.

Therefore, the inventors of the present invention compare the 23SrRNA genes of the burdock bacterium pathogen and Xanthomonas bacteria to diagnose the burdock bacillus pathogen using a method of identifying a pathovar at the gene level. The sequences were expressed and primer sets designed to amplify this specific sequence were designed.

Therefore, an object of the present invention is to provide a PCR primer set for detecting burdock bacillus bacteria ( Xanthomonas campestris pv. Nigromaculans ) represented by SEQ ID NO: 1 and SEQ ID NO: 2.

Another object of the present invention is to provide a PCR primer set for detecting burdock bacillus bacteria ( Xanthomonas campestris pv. Nigromaculans ) represented by SEQ ID NO: 3 and SEQ ID NO: 4.

Another object of the present invention is a burdock bacterium comprising a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2 or SEQ ID NO: 3 and SEQ ID NO: 4 ( Xanthomonas campestris pv. nigromaculans ) to provide a diagnostic kit.

It is another object of the present invention to provide a method for detecting DNA comprising: (a) separating DNA from a sample; (b) amplifying the DNA isolated in the step (a) by PCR using the primer pairs shown in SEQ ID NO: 1 and SEQ ID NO: 2 or SEQ ID NO: 3 and SEQ ID NO: 4; And (c) the burdock bacterium pathogen comprising the step of confirming the amplified PCR product of step (b) by electrophoresis ( Xanthomonas campestris pv . nigromaculans ) detection method.

In order to achieve the above object, the present invention provides a PCR primer set for detecting burdock bacillus bacterium ( Xanthomonas campestris pv. Nigromaculans ) represented by SEQ ID NO: 1 and SEQ ID NO: 2.

In order to achieve another object of the present invention, the present invention provides a PCR primer set for detecting burdock bacillus bacteria ( Xanthomonas campestris pv. Nigromaculans ) represented by SEQ ID NO: 3 and SEQ ID NO: 4.

To achieve another object of the present invention, the present invention provides a kit for diagnosing burdock bacterium ( Xanthomonas campestris pv. Nigromaculans ) comprising a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2 or SEQ ID NO: 3 and SEQ ID NO: 4 To provide.

In order to accomplish still another object of the present invention, the present invention provides a method for detecting a DNA fragment, comprising: (a) separating DNA from a sample; (b) amplifying the DNA isolated in step (a) by PCR using primer pairs of SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4; And (c) detecting the amplified PCR product of step (b) by electrophoresis ( Xanthomonas campestris pv. Nigromaculans ) comprising the step of confirming by electrophoresis.

Hereinafter, the present invention will be described in detail.

The term 'primer' in the present invention means a short nucleic acid sequence capable of forming a base pair with a complementary sequence and serving as a starting point for complementary strand duplication. In the present specification, the terms "forward primer" and "reverse primer" refer to primers that bind to the 3 'and 5' ends of a certain region of a gene amplified by PCR, respectively.

The present invention is the burdock bacillus pathogens represented by SEQ ID NO: 1 and SEQ ID NO: 2 ( Xanthomonas campestris pv. nigromaculans ) is directed to a set of PCR primers for detection.

A variety of genes such as rRNA and house keeping genes have been used in the production of polymerase chain reaction primers specific to microbial genes. Among them, 16S rRNA and 23S rRNA are stable to evolution and belong to the same species or subclass Because genetic variation is rare, it is ideal as a polymerase chain reaction primer for the diagnosis of hospital germs. In the present invention, the polymerase chain reaction (PCR) primer set targets a specific region of the species conserved 23S rRNA in the gene sequence of the burdock bacterium pathogen genome, and thus is specific to microbial genes other than the burdock bacterium pathogen. It is characterized by the fact that it is not specifically bound and can only specifically detect burdock germ spot disease.

Burdock bacterial spot pattern germ of the present invention ( Xanthomonas campestris pv. nigromaculans ) PCR primer set is characterized in that it has a specific sequence present only in burdock bacterial pathogen, compared to other microorganisms belonging to the genus Xanthomonas . In the present invention, by comparing the 23S rRNA gene of the known genus Xanthomonas and the 23S rRNA gene of Burdock bacterial spot pattern bacteria, primer sets specific for Burdock bacterial spot disease (XNIGf <forward, SEQ ID NO: 1>& XHIGr <reverse direction , SEQ ID NO: 2>) was prepared (see Example 1). In order to verify that the primer set has specificity only for the burdock bacterium, the gDNA of 90 strains belonging to 26 species of genus Xanthomonas , including the burdock bacterium, was isolated and PCR-reacted with the primer set. When electrophoresis was performed (described in [Fig. 1]), the DNA of burdock bacterial spot pattern germ was detected.

In another aspect, the present invention provides a PCR primer set for detecting burdock bacillus pathogens represented by SEQ ID NO: 3 and SEQ ID NO: 4 having a sequence complementary to SEQ ID NO: 1 and SEQ ID NO: 2. The primer sets of the present invention may be modified (eg, added, deleted, substituted) within a range that does not affect specific detection of burdock bacterial spot pattern bacteria.

The present invention provides a kit for diagnosing burdock bacillus pathogen, comprising a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2 or SEQ ID NO: 3 and SEQ ID NO: 4.

The kit of the present invention includes a variety of reagents, such as PCR compositions, restriction enzymes, agarose, and hybridization, for experiments (eg, PCR) and for confirming the results necessary for detecting the burdock bacillus pathogen using the primer set of the present invention. And a buffer solution required for electrophoresis may be further included. More specifically, the PCR composition may be prepared by mixing a complementary DNA synthesized by a reverse transcription reaction with a PCR primer pair provided in the present invention in an appropriate amount of a DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis or Pyrococcus heat stable DNA polymerase obtained from furiosus (Pfu), dNTP, PCR buffer and water (dH ₂ O). The PCR buffer comprises Tris -HCl (Tris-HCl), MgCl 2, KCl and the like. At this time, MgCl ₂ concentration greatly affects amplification specificity and yield. In general, when Mg ^{2 +} are in excess will increase the non-specific PCR amplification products, and reduce the yield of PCR product when the Mg ²⁺ insufficient. The PCR buffer is not limited thereto, but an appropriate amount of Triton X-100, dimethylsulfoxide (DMSO), Tween 20, nonidet P40, PEG 6000, formamide and bovine serum albumin ( bovine serum albumine (BSA)) may be additionally included.

In addition, the kit may further include a DNA polymerase and a PCR reaction buffer solution having the above composition in order to facilitate the PCR reaction, and a kit for performing electrophoresis, May be further included in the kit of the present invention.

(A) separating DNA from a sample; (b) amplifying the DNA isolated in step (a) by PCR using primer pairs of SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4; And (c) it provides a method for detecting burdock microorganism pattern germ comprising the step of confirming the amplified PCR product of step (b) by electrophoresis.

Polymerase chain reaction (PCR) is a technique in which a small amount of DNA present in a living body is separated and used as a template, and a pair of primers consisting of oligonucleotides complementary to both ends of the target DNA sequence is used. . By using such PCR, microorganisms infected by plants can be detected quickly and accurately. In the present invention, the detection method including the PCR was used to detect the burdock bacilli.

Looking at this step by step, the separation of DNA in the step (a) is the burdock bacterium pathogen ( Xanthomonas campestris pv. nigromaculans ) according to methods commonly used in the art, and may be performed using a commercially available DNA extraction kit.

In step (b), the DNA isolated in step (a) is used as a template, and the primer pair of the present invention can be used to amplify the 23S rRNA gene of burdock bacillus bacterium. This step is performed by repeating cycles including i) denaturation step, ii) target nucleic acid annealing step of the primer, and iii) elongation step. The term "cycle " in the present invention means a process of generating one copy of a target nucleic acid. The denaturation, temperature and time conditions in the target nucleic acid binding step and extension step of the primer can be selected by a person skilled in the art suitable conditions and are not limited to a specific range, but preferably (i) 55 to 65 seconds at 90 to 98 ℃ 30 cycles of one cycle consisting of denaturation process of (ii) annealing for 55 to 60 seconds at 55 to 70 ° C. and elongation of 170 to 190 seconds at 65 to 75 ° C. Performing and (iii) further stretching for 5 to 10 minutes at 65 to 75 ° C. The time and number of cycles in each step can be determined according to the conditions commonly practiced in the art.

The step (c) can separate the PCR products by DNA size according to methods well known in the art. Preferably by agarose gel or polyacrylamide gel electrophoresis or fluorescence analysis apparatus. In this case, in order to use the fluorescence analysis apparatus, the PCR should be performed in the step (b) using a pair of primers having a fluorescent dye well known in the art. The PCR amplification result can preferably be confirmed by agarose gel electrophoresis. After electrophoresis, electrophoresis results can be analyzed by ethidium bromide staining. For the general reverse transcription reaction, PCR and analysis of the results, methods well known in the art are used.

The present invention relates to a PCR primer set for detecting a burdock bacterium ( Xanthomonas campestris pv.nigromaculans ), more specifically, a PCR primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2 or SEQ ID NO: 3 and SEQ ID NO: 4, the primer The present invention relates to a kit for diagnosing a burdock bacterial spot pattern bacterium comprising any one of the sets, and a method for detecting a burdock bacterial spot pattern bacterium using the same. Since the primer set of the present invention has a sequence capable of specifically detecting the burdock bacterium pathogen, it is effective for the diagnosis and detection of the burdock bacterium pathogen.

Figure 1 is an electrophoresis result showing the specificity for the burdock bacterium bacterium pathogen of the PCR primer set of the present invention. (Lane description: M -size marker (1kb), 1 ~ 90 : shows the numbers in [Table 2], This is the result of electrophoresis on the corresponding bacteria.)

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1>

Burdock bacteria ( X. campestris pv . nigromaculans ) For detection primer  Pair design

<1-1> Search for information of specific base sequence

Burdock Bacterium Streptococcus ( Xanthomonas) campestris pv. Among the rRNA and housekeeping genes that are frequently used in PCR primer development to select nucleic acids with specific bases of nigromaculans ), they are stable in evolution among burdock bacterial pathogen genome sequences, and the mutations in the same species or subclass are rare. And targeted 23S rRNA regions that are ideal for PCR bacterial diagnostic primers. In the present invention, 23S rRNA genes of phytopathogenic bacteria of Xanthomonas , which are registered in the GenBank and analyzed for the entire nucleotide sequence, are used in the ClustalW multiple alignment program installed in the BioEdit program (Version7.0.9.0). The comparison was made with the 23S rRNA gene of Burdock bacilli.

As a result, it was confirmed that some of the sequences of the 23S rRNA of the burdock bacillus pathogen were specifically present only in the microorganism.

<1-2> For specific sequence amplification primer  Making pairs

Using the 23S rRNA gene confirmed specificity in Example <1-1> to prepare the forward and reverse primer pairs of the polymerase chain reaction specific to the burdock bacillus pathogens as shown in Table 1 below.

SEQ ID NO: primer Base sequence The length (mer) direction One XNIGf CGCCTTTTACTGGGGCTTCGATCAAGAGCTTCA 33 Forward 2 XNIGr AGCAGTGAACCGAAGCTTGGGGTGCGTAAAAC 32 Reverse

< Example  2>

Manufactured primer  Investigate specificity of pairs

Burdock bacterial spot pattern germ of the primer set of Example 1 ( Xanthomonas campestris pv. nigromaculans ), to investigate the specificity of the PCR reaction. Whole DNAs of 90 strains belonging to 26 species of Xanthomonas species listed in [Table 2] were isolated using DNeasy Blood & Tissue Kit (Qiagen, Cat. No. 69504).

10 mM Tris-HCl pH 8.0, 50mM KCl, 1.5mM MgCl2, 200uM dNTP, 10pmole primer XNIGf, 10pmole primer XNIGr, 2U Taq DNA polymerase were added to the PCR reaction solution, and the amount was adjusted to distilled water. The reaction solution was amplified 30 times at 95 ° C for 1 minute-68 ° C for 1 minute-72 ° C for 3 minutes, and then treated at 72 ° C for 7 minutes. The PCR product is shown in [Fig. 1] the result of electrophoresis with agarose gel.

As shown in FIG. 1, the primer set prepared in Example 1 was burdock bacterium patterned germ ( Xanthomonas campestris pv. nigromaculans ) DNA is detected. This is the result that the primer set of Example 1 specifically amplifies the burdock bacterium pathogen.

Bacterial number Pathogen name Other strain number Host Separation area One 2561 campestris pv. nigromaculanss LMG787t Japan 2 2205 alfalfae subsp. alfalfae ICMP5718T Medicago sativa India 3 2935 alfalfae subsp. citrumelonis ICMP15808t Citrus sp. United States of America 4 2616 arboricola pv. celebennsis CFBP3523t Musa acuminata New Zealand 5 2579 arboricola pv. corylina CFBP1159t Corylus maxima United States of America 6 2633 arboricola pv. fragariae CFBP6771t Fragaria X ananassa Italy 7 608 arboricola pv. juglandis LMG747T Jugans regia New Zealand 8 2673 arboricola pv. poinsettiicola ICMP6274t Euphorbia pulcherrima New Zealand 9 2615 arboricola pv. populi CFBP3123t Populus x canadensis cv. Robusta Netherlands 10 609 arboricola pv. pruni LMG852t Prunus salicina New Zealand 11 610 axonopodis pv. axonopodis LMG982T Axonopus scoparius Columbia 12 2523 axonopodis pv. bauhiniae ICMP5720t Bauhinia racemosa India 13 2600 axonopodis pv. begoniae CFBP2524t Begonia sp. New Zealand 14 2634 campestris pv. aberrans CFBP6865t Brassica oleracea L. var. capitataL . Australia 15 2563 axonopodis pv. cassavae LMG8049 Manihot esculenta Niger 16 2551 axonopodis pv. cassiae LMG675t Cassia tora India 17 2572 axonopodis pv. clitoriae LMG9045t Clitoria biflara India 18 2552 axonopodis pv. coracanae LMG686t Eleusine coracana India 19 2553 axonopodis pv. cyamopsidis LMG691t Cyamopsistetragonolobus India 20 2554 axonopodis pv. desmodii LMG692t Desmodiumdichotomum India 21 2555 axonopodis pv. DesmodiGangger LMG693t Desmodium gangicine India 22 2573 axonopodis pv. desmodiilaxiflori LMG9046t Desmodium laxi-orum India 23 2556 axonopodis pv. desmodiirotundifolii LMG694t Desmodium styracifolium India 24 2557 axonopodis pv. dieffenbachiae LMG695t Anthurium sp. Brazil 25 2558 axonopodis pv. erythrinae LMG698t Erythrina variegata India 26 2196 axonopodis pv. glycines ICMP5732t Glycine max Way 27 2560 axonopodis pv. lespedezae LMG757t Lespedeza sp. United States of America 28 2959 axonopodis pv. manihotis ICMP5741T Glycine max Way 29 615 axonopodis pv. nakataecorchori LMG786t Corchorus aestuans India 30 2564 axonopodis pv. pateli LMG811t Crotalaria juncea India 31 2603 axonopodis pv. phaseoli CFBP2534t Phaseolus vulgaris Romania 32 2565 axonopodis pv. phyllanthi LMG844t Phyllanthus niruri Way 33 2566 axonopodis pv. physalidicola LMG845t Physalis alkekengi Japan 34 2961 axonopodis pv. poinsettiicola ICMP5779T Euphorbia pulcherrima India 35 2562 axonopodis pv. rhynchosiae LMG8021t Rhynchosia memnonia Way 36 2568 axonopodis pv. ricini LMG861t Ricinus communis Ethiopia 37 2522 axonopodis pv. sesbaniae ICMP367t Sesbania sesban Unknown 38 2576 axonopodis pv. tamarindi LMG955t Tamarindus indica India 39 2962 axonopodis pv. vasculorum ICMP5757T Saccharum officinarum Mauritius 40 2574 axonopodis pv. vignaeradiatae LMG936t Vigna radiata Way 41 2570 axonopodis pv. vignicola LMG8752t Vigna unguiculata United States of America 42 2610 axonopodis pv. vitians CFBP2538t Lactuca sp. United States of America 43 618 bromine LMG947T Bromus carinatus France 44 2204 campestris pv. viticola ICMP3867t Vitis sp. India 45 2936 fuscans subsp. aurantifolii ICMP15806t Citrus lemon Argentina 46 2937 albilineans ICMP196T Saccharum officinarum sebum 47 2559 campestris pv. fici LMG701t Ficus religiosa India 48 2621 melonis CFBP4644T Cucumis melo Brazil 49 619 campestris pv. campestris LMG568T I have Brassica oleracea. gemmifera England 50 2630 campestris pv. paulliniae CFBP5862t I have a Paullinia cupana. sorbilis Brazil 51 2636 perforance NCPPB4321T Lycopersicon esculentum United States of America 52 2201 campestris pv. sesami ICMP621t Sesamum indicum Way 53 2617 campestris pv. armoracieae CFBP3838t Iberis sp. Tanzania 54 620 cassavae LMG673T Manihot esculenta Malawi 55 2934 citrisubsp. citri ICMP15804T Citrus aurantiifolia United States of America 56 2958 citri subsp. malvaceaerum ICMP217T Gossypium sp. United States of America 57 2622 codiaei CFBP4690T Codiaeum variegatum United States of America 58 621 cucurbitae LMG690T Cucurbita maxima New Zealand 59 2619 cynarae CFBP4188T Cynara scolymus France 60 2674 euvesicatoria ICMP109T Capsicum frutescens United States of America 61 2598 fragariae CFBP2157T Fragaria ananassa United States of America 62 2960 fuscans pv. fuscans ICMP239T Phaseolus vulgaris Canada 63 2628 campestris pv. barbareae CFBP5825t Barbarea vulgaris United States of America 64 2635 gardner NCPPB88T Lycopersicon esculentum Yugo 65 2625 hortorum pv. carotae CFBP4997t I have Daucus carota. sativa Hungary 66 2624 hortorum pv. hederae CFBP4925T Hedera helix United States of America 67 2602 hortorum pv. pelargonii CFBP2533t Pelargonium sp. New Zealand 68 2606 hortorum pv. taraxaci CFBP410t Taraxacum coke-sahgyz United States of America 69 2575 hortorum pv. vitians LMG938 Lactuca sativa Zimbabwe 70 622 hyacinthi LMG739T Hyacinthus orientalis Netherlands 71 2601 campestris pv. incanae CFBP2527t Matthiola sp. United States of America 72 2203 oryzae pv. oryzae ICMP3125T Oryza sativa India 73 623 oryzae pv. oryzicola LMG797t Oryza sativa Philippines 74 2629 campestris pv. raphani CFBP5827t Raphanus sativus United States of America 75 2200 pisi ICMP570T Pisum sativum Japan 76 2582 populi CFBP1817T Populus x canadensis cv. Regenerata France 77 625 populi LMG5743T Populus canadensis France 78 2620 sacchari CFBP4641T Saccharum officinarum Guadeloupe 79 2623 theicola CFBP4691T Camellia sinensis Japan 80 2591 translucence pv. arrhenatheri CFBP2056t Arrhenatherum elatius Swiss 81 2612 translucence pv. cerealis CFBP2541t Bromus intarsis Canada 82 2588 translucence pv. graminis CFBP2053t Dactylisglomerata Swiss 83 2593 translucence pv. phlei CFBP2062t Phleum pratense Norway 84 2611 translucence pv. phleipratensis CFBP2540t Phleum pratense United States of America 85 2592 translucence pv. poae CFBP2057t Poa trivialis Swiss 86 2605 translucence pv. secalis CFBP2539t Secale cereale Canada 87 2589 translucence pv. translucence CFBP2054T Hordeum vulgare United States of America 88 2963 translucence pv. undulosa ICMP5755T Triticum sp. Canada 89 2613 vasicola pv. holcicola CFBP2543T Sorghum vulgare New Zealand 90 626 vesicatoria LMG911T Lycopersicon esculentum Italy

The present invention is burdock bacillus spot disease ( Xanthomonas campestris pv. nigromaculans ) relates to a PCR primer set for detecting the PCR primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2 or SEQ ID NO: 3 and SEQ ID NO: 4, for the diagnosis of burdock germ spot disease comprising any one of the primer set It relates to a kit and a method for detecting burdock bacterial spot pattern germs using the same. Since the primer set of the present invention has a sequence capable of specifically detecting a burdock bacterium pathogen, it can be used for diagnosis and detection of burdock bacterium pathogen, and its industrial applicability is high.

Attach an electronic file to a sequence list

Claims (4)

Burdock bacillus bacteria having a nucleotide sequence represented by SEQ ID NO: 1 and SEQ ID NO: 2 ( Xanthomonas campestris pv. nigromaculans ) primer set for detection.
Burdock bacillus bacterium having a nucleotide sequence represented by SEQ ID NO: 3 and SEQ ID NO: 4 ( Xanthomonas campestris pv. nigromaculans ) primer set for detection.
Burdock bacillus bacterium comprising the primer set of claim 1 or 2 ( Xanthomonas campestris pv. nigromaculans ) kit for detection.
(a) separating DNA from a sample;
(b) amplifying the DNA isolated in step (a) by PCR using the primer set of claim 1 or 2; And
(c) burdock bacillus pathogens comprising the step of confirming the amplified PCR product of step (b) by electrophoresis ( Xanthomonas campestris pv. nigromaculans ) detection method.

Images