KR101284707B1 - Composition for promoting and activating biosynthesis of protopanaxadiol - Google Patents

Abstract

The present invention relates to a ginseng-derived CYP716A47 gene involved in protopanaxadiol biosynthesis, and more particularly, to promote protopanaxadiol biosynthesis comprising a CYP716A47 protein derived from ginseng and a gene encoding the same. The present invention relates to a transformant transformed with the composition together with a composition or a recombinant vector, a plasmid, a method of increasing the expression of the gene, and to increase the production of protopanaxadiol. Ginseng-derived CYP716A47 gene involved in the protopanaxanadiol biosynthesis according to the present invention can be usefully used in a method for mass-producing protopanaxadiol or increasing the ginseng saponin biosynthesis of the protopanaxanadiol family.

Description

Composition for promoting and activating biosynthesis of protopanaxadiol

The present invention relates to a CYP716A47 protein involved in the biosynthesis of protopanaxadiol compounds and genes encoding the same.

Saponins are chemically called glycosides and are widely distributed in plants and are also found in some marine animals. Animals and plants containing saponins have been applied to medicines for the purpose of cleaning, expectoration, and antitussives in oriental medicine since ancient times. The chemical structure of saponin is composed of sugar (glycoside) and non-sugar (aglycoside), triterpenoid-based saponins and steroids largely depending on the skeletal structure of the non-sugar portion ) Is classified as saponin.

Saponin of ginseng is almost a triterpenoid saponin of dammarane type. It is a unique saponin that exists only in the plant of the panax, and it has the pharmacological effect that ginseng is different from other saponin containing plants. So far, dozens of ginseng saponins have been identified, and they are called ginsenoside, a glycoside contained in ginseng. In general, saponins of plants generally exhibit hemolytic action (blood cell dissolving action), but ginseng saponins have been found to be very mild, not toxic by overdose, and have little hemolytic action.

Triterpenoid saponins are secondary metabolites of isoprene compounds and are found in higher plants. They exhibit a wide range of structural diversity and biological activities among plant species. In addition, the molecules may have significant commercial value is used as a drug (Hostettmann, KA, Marston, A. (1995) Saponins Chemistry and Pharmacology of Natural Products Cambridge University Press, Cambridge;.. Vogler, BK , etc. (1999), Eur. J. Clin . Pharmacol. 55: 567575; Shibata, S. (2001) J. Korean Med . Sci . 16: S28S37). The basic role of saponins in plants is known to defend against the attack of pathogens and pests (Osbourn, AE (1996) Plant Cell 8: 18211831). The key constituents of triterpenoid saponins are oleanane (β-amyrin), ursane (α-amyrin), lupeol or dammarene-type triterpenoids It is a skeleton.

Panax ginseng is well known among consumers for its superior pharmacological effects especially in cancer, diabetes and neurodegenerative diseases. Ginsenosides are known to be a major component of ginseng roots showing its biological activity. P. ginseng The roots contain at least 4% ginsenosides by dry weight (Shibata, 2001). Seven dimalane-type tetracyclic triterpenes (ginsenosides Rb1, Rb2, Rc, Rd, Re, Rf, and Rg1) are known as major ginsenoside components and only ginsenoside Ro Anan-type pentacyclic triterpene is found very little in P. ginseng . The damaran-type ginsenosides are classified into panaxadiol (Rb1, Rb2, Rc and Rd) and panaxatriol groups (Rg1, Re, Rf and Rg2) according to aglycone structure ). ≪ / RTI > Damain-type tritter pen Panax (Kushiro, T. et al. (1997), Biol . Pharm . Bull . 20: 292-294 ) and Gynostemma (Cui, JF et al. (1999), Eur. J. Pharm. Sci. 8: 187-191). It is well known as a compound.

The first step in damarene-type ginsenoside biosynthesis is to cyclize 2, 3-oxidosqualene into dammarenediol, which is activated by dammarenediol synthase ) (Fig. 1), the two homologous femarene diol synthases of P. ginseng , DDS and PNA , (Tansakul, P. et al. (2006), FEBS Lett . 580: 5143-5149 .; Han, JY et al. (2006) Plant Cell Physiol . 47: 1653-1662). Dammarenediol-II is the hydroxylation of cytochrome P450 (CYP) enzyme (Shibuya, M. et al. (2006), FEBS J. 273: 948-959) and the following glycosyl transferase (glycosyl). glycosylation of transferase (GT) (Kushiro, T. et al. (1997), Biol . Pharm . Bull . 20: 292-294; Shibuya et al., 2006; Choi, DW et al. (2005), Plant Cell Rep . 23: 557-566), and ginsenosides Ro are thought to be synthesized from oleanolic acid, a product of β-amyrin (Shibata, S). . (1977) saponins with biological and pharmacological activity In:.. H. Wagner and P. Wolff (. Eds), New natural products and plant drugs with pharmacological or therapeutical activity Springer-Verlag, NewYork pp.177-196).

CYP and GT are located in the supergene families of plant genomes. In plants, CYP plays an important role in oxidation during the biosynthesis of various plant secondary metabolites, lignin, terpenoids, sterols, fatty acids, hormones, pigments, and defense-related phytoalexins (Schuler , M. (1996) Plant cytochrome P450 monooxygenases. Crit. Rev. Plant Sci . 15: 235-284). In P. ginseng , two CYP genes are thought to be involved in damagen-type ginsenoside biosynthesis. One of these genes may be involved in the fmalene dihydroxylation at the C-12 site for protopanaxadiol synthesis. Another gene may be involved in the protopanaxadiol hydroxylation at the C-6 site for protopanaxatriol synthesis, and these two compounds may be used for damagen-type ginsenosides Used as backbones.

On the other hand, the prior art related to the present invention includes the Republic of Korea Patent No. 0931845, which is the previous invention of the present applicant. The above-mentioned prior art documents have identified the genes involved in protopanaxadiol biosynthesis similarly to the present invention, but the present invention has identified a new gene and protein that is completely different from the genes described in the prior art document, the genetic between the two Homology is very weak, but there is a fundamental difference.

That is, the present inventors have tried to find a new gene capable of promoting and activating the biosynthesis of protofaanacodiol in the precursor dammarenediol II.

The inventors have isolated nine putative full CYP gene sequences from the EST sequences of the elicitor (MeJA) -adventitious roots, of which CYP716A47 is Ginseno. The present invention has been completed by proving that it is a protoparanaxadiol synthase that plays a very important role in side biosynthesis.

An object of the present invention is CYP716A47, which is a promoter for protofanaxadiol biosynthesis CYP716A47 genetically or encoded therefrom It is to provide a composition for promoting protopanaxadiol biosynthesis containing a protein.

Another object of the present invention is to provide a host cell transformed with said composition.

It is another object of the present invention to provide a transgenic plant transformed with said composition.

In addition, another object of the present invention is the CYP716A47 It is to provide a method for increasing the production of protoparnaxadiol by increasing the expression of the protoparnaxadiol biosynthesis promoting gene.

In order to achieve the above object, the present invention provides a composition for promoting protopanaxadiol biosynthesis comprising a protein consisting of the amino acid sequence of SEQ ID NO: 2 (CYP716A47 protein) or a gene encoding it (CYP716A47 gene). .

In one embodiment of the present invention, the gene may be composed of the nucleotide sequence of SEQ ID NO: 1.

In one embodiment of the invention, the composition may comprise a recombinant vector or plasmid containing a gene encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2.

In one embodiment of the invention, the composition can increase the synthesis of protopananadiol in dammarenediol (II) through the activation of dalmarenediol 12-hydroxylase (hydroxylase).

In one embodiment of the present invention, the composition may further comprise a panax ginseng dammarenediol synthase (PgDDS) protein or a gene encoding the same.

In one embodiment of the present invention, the composition may be capable of synthesizing protoparanaxadiol without the addition of dammarenediol II.

The present invention also provides a host cell which is transformed with the recombinant vector or plasmid capable of synthesizing protopanaxadiol.

In one embodiment of the present invention, the host cell may be yeast or E. coli.

In another aspect, the present invention provides a transformed plant that is transformed with the recombinant vector or plasmid capable of synthesizing protopanaxadiol.

The present invention also provides a method of increasing the production of protopanaxadiol by increasing the expression of a protein consisting of the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same.

In one embodiment of the invention, the method may comprise the step of transforming the host with a recombinant vector or plasmid to overexpress the protein consisting of the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same.

In one embodiment of the invention, the host is yeast, E. coli or Ginseng ( Panax ginseng ).

When the host ginseng-derived CYP716A47 gene involved in proto-paransediol biosynthesis according to the present invention is transformed into a host, it can be seen that the present invention can rapidly increase the proto-paransediol in large quantities. In addition, it is possible to manufacture a product, and ultimately, it is possible to promote the biosynthesis of the proto-panaxanadiol-based ginseng saponin (ginsenoside).

Figure 1 shows the biosynthetic pathway of ginsenosides expected in ginseng ( P. ginseng) . Squalene eposidase converts squalene into 2,3-oxidosquane, which is triterpene aglycones (damarenediol or by dammarenediol synthetase or beta-amirin synthase). Beta-amirin). Triterpenal aglycons are continuously oxidized and glycosylated and eventually become triterpen saponins (ginsenosides).
2 shows the phylogenies identified from amino acid sequences inferred for P. ginseng CYPs (bold) and other plant CYPs. Gm , Glycine max ; Sc , Solanum chacoense ; At , Arabidopsis thaliana ; Ge , Glycyrrhiza echinata ; Sm , Solanum melongena ; Gu , Glycyrrhiza uralensis ; Sb , Sorghum bicolor ; Vs , Vicia sativa ; Cr , Catharanthus roseus; Hm, Hyoscyamus muticus; Ps, Pisum sativum; Ph, Petunia hybrida; Va, Vitis arizonica x Vitis rupestris . Bar = 0.1 amino acid substitutions / site.
FIG. 3 shows the results of RT-PCR analysis of nine CYP genes in MeJA-treated roots and transformed PgSS1 -overexpressing ginseng roots. (A) RT-PCR analysis in MeJA-treated roots. Arrows indicate transcripts activated after MeJA treatment. (B) RT-PCR analysis on transformed PgSS1 -overexpressing ginseng roots. Two arrows indicate the transcripts activated in the transformed roots.
Figure 4 is the total ion chromatogram of LC / APCIMS analysis for the CYP716A47 product in yeast. (A) LC chromatogram of yeast cell extract with empty vector as control. (B) LC chromatogram of yeast cell extract with pYES2-DDS vector. (C) LC chromatogram of ProtoPanaxadiol standard.
5 is an LC / APCIMS spectrum of the peak detected in yeast with CYP716A47. (A) MS spectrum of the peak detected in yeast with CYP716A47 . (B) MS spectra of peaks detected in the ProtoPanaxadiol standard.
6 is an LC / APCIMS UV chromatogram of yeast extracts expressing both PgDDS and CYP716A47 . (A) UV chromatogram of yeast cell extract with empty vector as control. (B) UV chromatogram of ProtoPanaxadiol product (arrow) at a retention time of 32.59 min in yeast expressing both PgDDS and CYP716A47 . (C) UV chromatogram of ProtoPanaxadiol standard.
Figure 7 PgDDS and CYP716A47 LC / APCIMS analysis of the protoparnaxadiol product in WAT21 yeast expressing all. (A) Total ion chromatogram of yeast cell extract with empty vector as a control. (B) total ion chromatogram of the protoparanaxadiol product at a retention time of 32.59 minutes in yeast expressing both PgDDS and CYP716A47 ; Arrows indicate ProtoPanaxadiol signals. (C) TLC chromatogram of Protoparanaxadiol standard. (D) MS spectrum of the ProtoPanaxadiol peak at retention time of 32.59 min from yeast with CYP716A47 .

The present invention is a protein consisting of the amino acid sequence of SEQ ID NO: 2, which is a cytochrome P450 enzyme derived from ginseng involved in protopanaxadiol biosynthesis (hereinafter referred to as 'CYP716A47 protein') and a gene encoding the same (hereinafter referred to as 'CYP716A47'). The present invention relates to the use of the CYP716A47 gene and a protein thereof.

The CYP superfamily is a large and diverse group of enzymes. A. has been 246 CYP genes are reported in thaliana (Nelson, D. (2006) Plant cytochrome P450s from moss to poplar Phytochem Rev 5:... 193-204).

To find the CYP gene associated with ginsenoside biosynthesis, we successfully isolated CYP716A47 from the EST sequence of MeJA-treated ginseng roots and identified CYP716A47 as a novel protopanaxadiol synthase.

Ginseng saponin is called "ginsenoside" in the sense of ginseng glycoside to distinguish it from other plant-based saponins, and these ginsenoids are from squalene to dammarenediol as shown in FIG. And protopa-naxadiol. Accordingly, the present invention provides a composition for promoting protopanaxadiol biosynthesis that can significantly increase the synthesis of protopanaxadiol as an intermediate in the ginsenoid biosynthesis process.

Many previous studies have reported that MeJA treatment most stimulates ginsenoside biosynthesis (Lee et al. 2004; Han et al. 2006). The present inventors hypothesized that the CYP genes involved in ginsenoside biosynthesis would produce multiple transcripts in EST sequences isolated from MeJA treated roots.

Of 61 EST clones homologous to the CYP gene, the entire sequence was obtained from 9 ESTs with multiple transcripts. RT-PCR analysis also confirmed that three of the nine CYP genes ( CYP73A100 , CYP749A20 , and CYP716A47 ) increased transcription after MeJA treatment. However, MeJA treatment is a gene related to the gene as well as a variety of defenses related triterpene biosynthesis was also active (Cheong, JJ, Choi, YD (2003) Methyl jasmonate as a vital substance in plants. Trends in Genetics 19: 409-413).

Previously, we have found that all downstream genes, such as SE , β- AS , and CAS , have been upregulated by overexpression of PgSS1 in the root of transgenic ginseng ( P. ginseng ) . I have reported it. Increased activity of PgSS1 enzyme significantly increased phytosterol and ginsenoside contents.

The present inventors conducted RT-PCR analysis on nine genes, and as a result, two genes ( CYP716A47) having increased transcription in PgSS1 -overexpressing transgenic ginseng roots were analyzed. And CYP749A20 ) was selected as the most potent CYP gene candidate for ginsenoside biosynthesis.

In addition, the present inventors have found that by using a yeast expression analysis, was identified as a proto-wave incident diol synthase (protopanaxadiol synthase) the CYP716A47 having Dhamma Lene diol 12-hydroxylation enzyme (dammarenediol 12-hydroxylase) activation ability. That is, the recombinant CYP716A47 -expressing yeast was produced, and it was confirmed that protepa - naxadiol was produced from the dammarendiol after ingesting the dammarerendiol in the yeast, and with the CYP716A47 gene without feeding the dammarerendiol in the yeast. Co-expression of dammarenediol synthase (PgDDS) was confirmed to produce a protoparnaxadiol.

More than 30 ginsenosides have been identified in Ginseng (P. ginseng ) , which are panaxadiol (Rb1, Rb2, Rc, and Rd) and panaxatriol (Rg1, depending on the aglycone structure). Re, Rf, and Rg2) group is divided into two groups. Each ginsenoside has been found to have different pharmacological effects such as anti-stress, anti-diabetic, anti-inflammatory, anti-oxidant, anti-cancer as well as immune system abnormalities (Briskin, DP (2000) Plant Physiol. 124: 50714 Shibata, 2001).

In addition, recent studies have reported that ginsenoside metabolites have a greater biological effect than ginsenosides (Jia, W. et al., (2004) J Clin Oncol ASO Annual Meeting Proceedings (Post-Meeting Edition). 22: 9663). In addition, protopanaxadiol, a triterpene aglycon hydrolyzed from various ginsenosides, has been shown to exhibit apoptotic effects through various signaling pathways in cancer cells and cytotoxicity against multidrug-resistant tumors (Jia et Popovich and Kitts 2004 Li et al. 2006). As a result, some pharmaceutical companies (PanaGin Pharmaceuticals, British Columbia, Canada) are developing cancer treatments containing protopanaxadiol (Pandimex).

In reality, organic synthesis has difficulties in the synthesis of triterpene, so the compound must be isolated from nature or obtained by ginsenoside hydrolysis.

Thus, a method for producing protopanaxanalyse diol through co-expression of Panax ginseng dammarenediol synthase (hereinafter referred to as 'PgDDS') and CYP716A47 in yeast and the like according to the present invention may be used without protomalamane. The biosynthesis of pananaxadiol can be induced, making it an effective way to produce even more useful damarene-type triterpenes.

The PgDDS refers to a dammarenediol synthase that produces an intermediate dammarenediol II during the ginsenoid biosynthesis process of ginseng ( P. ginseng ) , and may specifically have an amino acid sequence of SEQ ID NO: 30. The cDNA of the gene encoding may have a nucleotide sequence of SEQ ID NO: 29.

Therefore, the present invention can provide a composition for promoting protopanaxadiol biosynthesis comprising a CYP716A47 protein or a CYP716A47 gene encoding the same. The range of the CYP716A47 protein includes a protein having an amino acid sequence represented by SEQ ID NO: 2 isolated from ginseng and a functional equivalent of the protein.

The term "functional equivalent" herein refers to at least 70%, preferably 80% or more, more preferably 90% or more of the amino acid sequence represented by SEQ ID NO: 2 as a result of the addition, substitution or deletion of the amino acid. Preferably it refers to a protein having a sequence homology of 95% or more, and exhibits substantially the same physiological activity as the protein represented by SEQ ID NO: 2. As used herein, "substantially homogeneous physiological activity" means activity involved in protopanaxadiol biosynthesis in plants.

In addition, the CYP716A47 gene according to the present invention includes both genomic DNA and cDNA encoding the CYP716A47 protein. Preferably, the gene of the present invention, that is, the cDNA of CYP716A47 may be composed of the nucleotide sequence represented by SEQ ID NO: 1. In addition, mutants of the above base sequences may be included within the scope of the present invention. Specifically, the mutant includes a nucleotide sequence having a sequence homology of 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 .

Here, "% of sequence homology to polynucleotide" is identified by comparing the comparison region with two optimally aligned sequences, and some of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences Or not including deletions) in the context of the present invention.

In addition, the present invention can provide a composition for promoting protopanaxadiol biosynthesis comprising a recombinant vector or plasmid inserted with the CYP716A47 gene according to the present invention. The recombinant vector is preferably a recombinant yeast expression vector or a recombinant plant expression vector.

As used herein, "recombinant" refers to a cell expressing a heterologous nucleic acid, expressing the nucleic acid, or expressing a protein encoded by a peptide, heterologous peptide, or heterologous nucleic acid. The recombinant cell transformed with the vector may express a gene or a gene fragment which is not expressed in the natural form of the cell in one of the sense and antisense forms. In addition, recombinant cells may express genes expressed in cells in a natural state, but the genes are modified and reintroduced into cells by artificial means.

"Vector" as used herein refers to DNA fragment (s), nucleic acid molecules to be delivered into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. "Delivers" can often be used interchangeably with "vectors." "Expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

The yeast expression vector may include a promoter gene, a gene coding for a target protein from which the detoxification initiation and termination codons have been removed, and a terminator. The promoter gene may be a gene selected from the group consisting of GAPDH, PGK, ADH, PHO5, GAL1 and GAL10 But is not limited thereto.

On the other hand, the CYP716A47 gene of the present invention comprises a nucleic acid sequence encoding a signal peptide, which allows for the export of the expressed protein. Wherein the nucleic acid sequence encoding the signal peptide is preferably directly linked to the 5 ' of the expressed heterologous gene. In the secretion and modification of many eukaryotic proteins, fusion with a protein sequence having a signal sequence at the N-terminus is required to steer the polypeptide into a secretion apparatus. The vector may be a combined yeast plasmid (YIp) and an extrachromosomal plasmid vector. The extrachromosomal plasmid vector is divided into an episomal yeast plasmid (YEp), a replicative yeast plasmid (YRp), and a yeast centromer plasmid (YCp). Furthermore, artificial yeast chromosomes (YACs) are also possible as expression vectors according to the present invention.

In addition, particularly preferred yeast vectors are yeast replication plasmids that can be propagated and selected in E. coli, containing the origin of replication ori and an antibiotic resistance cassette. Furthermore, they have ARS sequences capable of independent chromosome replication in yeast cells, such as HARS1 from H. polymorpha, and metabolic yeast selection markers such as URA3 or HLEU2.

A preferred example of a plant expression vector is a Ti-plasmid vector that is capable of transferring a so-called T-region into a plant cell when it is present in a suitable host such as Agrobacterium tumefaciens. Other types of Ti-plasmid vectors (see EP 0116718 B1) are currently being used to transfer hybrid DNA sequences to plant cells, or to protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0120516 B1 and US 4,940,838.

Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol. It is not limited to this.

In one embodiment of the invention, the promoter of the plant expression vector may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter. The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

The terminator can be a conventional terminator such as nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, agrobacterium tumefaciens octopter And the terminator of the Octopine gene, but the present invention is not limited thereto. With regard to the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

In addition, the present invention can be provided with a host cell capable of transforming with a recombinant vector or plasmid according to the present invention capable of protofa naxadiol biosynthesis. The host cell may be yeast or E. coli, although not limited thereto.

Specifically, the present invention can provide a transformed yeast transformed with a recombinant yeast vector comprising the CYP716A47 gene. Preferably, the yeast may be a genus selected from Pichia, Hansenula, Candida, Torulopsis, Saccharomyces, Schizosaccharomyces, Kluyveromyces and Yarrowia. Particularly preferably, the microorganism may belong to a species selected from the group consisting of Hansenula polymorpha, Saccharomyces cervisiae, Schizosaccharomyces pombe, Kluyveromyces lactis and Yarrowia lipolytica.

Transformation of the yeast can allow the nucleic acid molecule or vector to be introduced into cells by standard methods known to those skilled in the art, preferably by electroporation, chemical transformation, transformation by plasmid fusion, or particle bombardment (Third Edition), J. Sambrook and D. Russell, 2001, Cold Spring Harbor Laboratory Press, < RTI ID = 0.0 > ).

In addition, the present invention can provide a transgenic plant capable of protofaxadiol biosynthesis by transformation with the recombinant vector or plasmid containing the CYP716A47 gene of the present invention.

But not limited to, tobacco, eggplant, tobacco, red pepper, tomato, burdock, shag cherry, lettuce, bellflower, spinach, modern sweet potato, celery, carrot, parsley, parsley, cabbage, cabbage, Cucumber, amber, pak, strawberry, soybean, mung bean, kidney bean and pea, but is preferably a Arabidopsis thaliana. Transformation of a plant means any method of transferring DNA to a plant.

Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202,179-185 (Klein et al., 1987, Nature 327, 70), the infiltration of plants or the transformation of mature pollen or vesicles into Agrobacterium tumefaciens Infection by viruses (non-integrative) in virus-mediated gene transfer (EP 0 301 316), and the like.

A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EPA 120516 and U.S. Patent No. 4,940,838.

"Plant cell" used for transformation of a plant may be any plant cell. The plant cells may be cultured cells, cultured tissues, cultured organs or whole plants, preferably cultured cells, cultured tissues or cultured organs and more preferably any form of cultured cells. "Plant tissue" refers to a tissue of differentiated or undifferentiated plant, including but not limited to roots, stems, leaves, pollen, seeds, cancer tissues, and various types of cells used for culture, protoplasts, shoots and callus tissue. The plant tissue may be in planta or in an organ culture, tissue culture or cell culture.

Accordingly, the present invention can provide a method of increasing the production of the CYP716A47 gene or the CYP716A47 protein encoded therefrom, thereby increasing the production of protopanaxadiol. The method also includes the step of overexpressing the CYP716A47 gene or protein by transforming the host with the recombinant vector or plasmid according to the present invention. But are not limited to, yeast, E. coli, plants, especially ginseng.

CYP716A47 gene of the present invention promotes the synthesis of protopanaxadiol in dammarenediol Ⅱ through the activation of dalmarenediol 12-hydroxylase, so as to promote the protopananaxadiol biosynthesis as described above The compositions and the compositions can be used to provide transformed plants with overproduced ProtoPanaxadiol, and also provide methods for increasing ProtoPanaxadiol production.

In addition, as a more efficient method of increasing protoparnaxadiol production, a composition further comprising a PgDDS protein or a gene encoding the same in addition to the CYP716A47 gene, that is, a recombinant vector or plasmid containing the two genes (CYP716A47 and PgDDS) It provides a method for producing protoparanaxadiol without dammarenediol. The PgDDS protein may have an amino acid sequence set forth in SEQ ID NO: 30.

The present inventors have found that when the CYP716A47 gene and the PgDDS gene according to the present invention are expressed together, protofanaxadiol can be biosynthesized without yeast, such as yeast, for promoting more effective protofanaxadiol biosynthesis. It is possible to provide a composition and a method for increasing protopanaxadiol biosynthesis.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited to these examples.

≪ Example 1 >

P. ginseng  Isolation of the CYP Gene from the EST Library

<1-1> Plant Materials and EST Library

Total RNA was extracted from adventitious roots of ginseng cultured in vitro. Poly (A) + RNA was extracted using Poly (A) quick mRNA isolation kit (Stratagene). A cDNA library was constructed using the Creator SMART cDNA library construction kit (Clontech). DH10B was used as a host strain and pDNR-LIB was used as a cloning vector.

Single-pass partial sequences were measured using an automated DNA sequencer (ABI Prism 3700, Applied Biosystems). A total of 4,226 cDNA strands (NCBI GenBank dbEST accession Nos. HS076062HS080287) were randomly extracted and sequenced from the 5 'end using an ABI 3730 XL automated DNA sequencer (Applied Biosystems). ESTs results were compared to GenBank and dbEST sequences using the BLASTX algorithm on the NCBI website.

<1-2> Identification and Analysis of CYP Family

In many species, including P. ginseng , the treatment of elicitor (MeJA) strongly activates the biosynthesis of triterpene saponins, and in many studies, MeJA treatment stimulated the ginsenoside biosynthesis most significantly (Lee, MH). (2004) Plant Cell Physiol. 45, 976-984; Han et al. 2006). Thus we isolated EST sequences from MeJA-treated adventitious roots to isolate CYP genes involved in ginsenoside biosynthesis. Of 4,140 high quality EST (2,966 unigenes) sequences, 53 EST sequences are CYP There was homology to the mRNAs. They were divided into 11 CYP families with single and multiple copy numbers (see Table 1).

EST Sequence Homologous to CYP Gene from MeJA-treated Absolute Root of P. ginseng CYP450
family Typical EST ID GenBank Access Number EST
Number CYPs
denomination Homology to
(species name) Description Accession No. E-
value CYP71 KYERRC001_46-A08 JN604540 7 CYP71D312 CYP71D55
( Hyoscyamusmuticus )
Premnaspirodiene Oxygenase EF569601 2e ^-09 KYERRC001_36-B03 JN604541 5 CYP71D313 KYERRC001_26-F07 One CYP71D314 KYERRC001_18-F12 One CYP71D315v2 KYERRC001_17-H02 2 CYP71D315v1 KYERRC001_10-D12 One CYP71D316 KYERRC001_19-G01 One CYP71D317 KYERRC001_43-F04 One CYP71D318v1 KYERRC001_45-G06 One CYP71D318v2 CYP72 KYERRC001_39-E08 JN604542 2 CYP72A129 CYP72A57
( Nicotianatabacum ) Unknown DQ350360 3e ^-64 KYERRC001_42-H03 One CYP72A220 KYERRC001_31-H09 One CYP72A221 CYP73 KYERRC001_19-F10 JN604543 5 CYP73A100 CYP73A5
( Arabidopsisthaliana ) Cinnamic acid 4-hydroxylase D78596 3e ^-166 CYP82 KYERRC001_42-G11 JN604544 3 CYP82H23 CYP82A1
( Pisumsativum ) Unknown
Wound-inducible P450 hydroxylase AF175278 2e ^-09 KYERRC001_19-F02 One CYP82H24 KYERRC001_01-H12 JN604545 One CYP82D47 CYP90 KYERRC001_12-D12 3 CYP90A29 CYP90 A2
( Pisumsativum ) Putative brassinosteroid C-23 hydroxylase AB218762 9e ^-122 CYP94 KYERRC001_27-A10 One CYP94A33 CYP94A1
( Viciasativa ) Fatty acid omega-hydroxylase O81117 0.0 CYP98 KYERRC001_26-B07 One CYP98A58 CYP98A13
( Ocimumbasilicum ) p-coumaroyl shikimate 3'-hydroxylase AY082612 1x
10 ^-141 KYERRC001_08-H05 One CYP98A59 CYP716 KYERRC001_23-C09 JN604536 7 CYP716A47 CYP716A2
( Medicagotruncatula ) Oxidation of β-amyrin and erythrodiol at the C-28 position FN 995 112 6e ^-169 CYP734 KYERRC001_09-G04 One CYP734A23 CYP734 A7
( Lycopersiconesculentum ) Brassinosteroid C-26 hydroxylase AB223042 5e ^-49 CYP736 KYERRC001_22-F01 JN604539 3 CYP736A12 CYP736B
( Vitisarizonica x Vitisrupestris ) Unknown
Disease responsive FJ828518 5e ^-24 CYP749 KYERRC001_20-C10 JN604538 2 CYP749A20 CYP86A22
( Petunia x hybrida ) Fatty Acyl-CoA-Hydroxylase DQ099540 2e ^-17

The largest number of CYP transcripts in the ginseng root muscle is for the CYP71D subfamily, which contains seven isoforms. Other CYP450 family genes with multiple transcripts were CYP716, CYP73, CYP72, and CYP82.

Since the EST sequences were isolated from the MeJA-treated abscess, we hypothesized that multiple transcripts could contain CYP genes involved in ginsenoside biosynthesis. Therefore, CYP genes with multiple copy numbers were selected as genes predicted to be responsible for ginsenoside biosynthesis. Nine full-length sequences ( CYP71D312 , CYP71D313, CYP72A219 , CYP73A100 , CYP82H23 , CYP82D47 , CYP716A47 , CYP736A12 , and CYP749A22 ) were obtained from CYP mRNA transcript sequences with more than 2 EST copy numbers.

< Example  2>

multiple EST Transcript  Phylogenetic analysis of 9 genes

<2-1> Cytochrome P450  Isolation and comparison of protein sequences

Nine complete genes were isolated by sequencing the nine provisional CYP ESTs selected in Example 1 above. The GenBank accession numbers of the nine potential CYP sequences of P. ginseng are: CYP72A219 (JN604542), CYP73A100 (JN604543), CYP736A12 (JN604539), CYP82H23 (JN604544), CYP82D47 (JN604545), CYP71D312 (JN604540), and CYP71D313 (JN604541), CYP749A22 (JN604538), and CYP716A47 (JN604537).

The DNASIS program (Hitachi Software Engineering Co.) was used to analyze their nucleotides and expected amino acid sequences. To analyze the phylogeny between these gene sequences, amino acid sequences were obtained from EMBL, GenBank and DDBJ sequence data. Multiple sequence alignments were made using the CLUSTAL W program (Thompson, JD et al. (1994) Nucl. Acids Res . 22: 46734680). Phylogenetic analysis of inferred amino acid alignments was performed using a neighbor-joining method using TreeView software (Page, RD (1996) TreeView: an application to display phylogenetic trees on personal computers Comput . Appl . Biosci ., 12, 357358). The strength measurements of the nodes in the tree were performed using 1000 replicates of bootstrap analysis (Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783791).

&Lt; 2-2 >

We analyzed the relationship between the flexible CYP gene of nine potential CYP genes and other plants of P. ginseng above (see Fig. 2), the amino acid sequence deduced from the CYP716A47 is shown a homology of only 49% of those CYP716A12 It was.

< Example  3>

MeJA After treatment and Ginsenoside  9 in Transgenic Ginseng Overexpressing CYP mRNAs Transcriptional activity of

<3-1> RT - PCR  analysis

Total RNA was extracted from MeJA-treated adventitious roots or other organs of ginseng and reverse transcribed using the ImProm-II Reverse Transcription System (Promega). First-strand cDNA was used as a template for RT-PCR analysis, and RT-PCR was performed under the following conditions. 5 cycles at 96 ° C., 30 cycles of (96 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. 1 minute), and the extension of the last 10 minutes at 72 ° C. Beta-bactin cDNA was used as a control for RNA integrity and loading accuracy. The electrophoresis of the products was done in 1% agar / 0.5 × TBA buffer. Primer sequences used are shown in Table 2. RT-PCR analysis was performed twice and representative data are shown in FIG. 3.

Primers used for RT-PCR of 9 CYP P. ginseng genes name Sequence (5 '3') Annealing
Temperature (℃) CYP71D312 Forward: ATGCTCCATTTGGCAGGTACCCTACAA (SEQ ID NO: 3)
Reverse: TTAGTTGTTGCTTGGAATGCAAGAGGTG (SEQ ID NO: 4) 64 CYP71D313 Forward: ATGGAACTTCAATTTCCATTATTTTCCA (SEQ ID NO: 5)
Reverse: TCAGCTTGAGTCCTCATTAGGGGTGTAA (SEQ ID NO: 6) 61 CYP72A129 Forward: ATGGAGTTAGTTTTGAAGTTAATTTCAAG (SEQ ID NO: 7)
Reverse: TTATATTAGTGAGTGTAAAATCAAGTGTG (SEQ ID NO: 8) 55 CYP73A100 Forward: ATGGCCCAAAATATTGGCAAATTCCATCA (SEQ ID NO: 9)
Reverse: TTATTCCATGATGGCATTGAATACAACC (SEQ ID NO: 10) 61 CYP82H23 Forward: ATGGCCGATAAATATGGACCTATCTTCT (SEQ ID NO: 11)
Reverse: TTATGGTTTTTTCATGGATGAATTTTGGA (SEQ ID NO: 12) 62 CYP82D47 Forward: ATGTTTGCATTTACGCCCTACAGTTCAT (SEQ ID NO: 13)
Reverse: TCAAAACCCATGCAGAGTAGCCAG (SEQ ID NO: 14) 63 CYP716A47 Forward: ATGGTGTTGTTTTTCTCCCTATCT (SEQ ID NO: 15)
Reverse: TTAATTGTGGGGATGTAGATGAAT (SEQ ID NO: 16) 57 CYP736A12 Forward: ATGTTCCCCTTAGCTTATCCCCTTCTTTTC (SEQ ID NO: 17)
Reverse: TCAAAGGCGATATTTAGGCACGGCAAGCA (SEQ ID NO: 18) 65 CYP749A20 Forward: ATGAGTTGGAACAATATTGGTGTTGTAG (SEQ ID NO: 19)
Reverse: TTAGAGAGGCTGCACCATTACCTGAAG (SEQ ID NO: 20) 58 Actin Forward: CGTGATCTTACAGATAGCTTCATGA (SEQ ID NO: 21)
Reverse: AGAGAAGCTAAGATTGATCCTCC (SEQ ID NO: 22) 55

<3-2> CYP mRNAs Transcriptional activity analysis

To narrow the range of CYP candidate genes involved in ginsenoside biosynthesis, nine isolated CYPs were used using RT-PCR analysis. Transcriptional activity of mRNAs was measured. The negative root was exposed to 10 uM MeJA for 12 or 48 hours. This is the condition that showed the best activity results for genes involved in ginsenoside biosynthesis in previous studies (Lee et al. 2004 Han et al. 2006; Han et al. 2010). CYP73A100 , CYP749A20 , and CYP716A47 were upregulated by MeJA (FIG. 3A), CYP82D47 and CYP82H23 were downregulated by MeJA, and CYP736A12 , CYP71D312 , CYP71D313 , and CYP72A219 were unchanged.

Previously, the present inventors have found that over-expression of squalene by Squelch alkylene synthase (squalene synthase) (PgSS1) in transgenic P. ginseng epoxidase , β - amyrin synthase , and cycloartenol It has been reported that upregulation of downstream genes such as synthase occurs (Lee et al. 2004). Increased activity of PgSS1 enzyme results in a significant increase in ginsenoside content (Lee et al. 2004). Therefore, we hypothesized that PgSS1 -overexpressing transgenic ginseng roots would upregulate transcription of protopanaxadiol synthase, and that 9 strains of transgenic ginseng roots overexpressing PgSS1 using RT-PCR were used. CYP The transcriptional activity of mRNAs was observed. As a result, CYP716A47 and CYP749A20 showed transcriptional activity while the remaining seven CYP genes did not respond or showed reduced activity.

< Example  4>

WAT21 In yeast CYP716A47 cDNA of ectopic  Expression

<4-1> In yeast CYP716A47 Manifestation of

To prepare expression plasmid vectors for yeast, open reading frames (ORFs) were amplified using PCR from the cDNA of CYP716A47. PCR was carried out 25 cycles of 94 ° C. for 40 seconds, 55 ° C. for 40 seconds and 72 ° C. for 2 minutes, and Pfu DNA polymerase (Stratagene) was used. The above PCR products were cloned into pYES2.1 using the TOPO TA expression kit (Invitrogen). The primer pairs used to isolate the cDNAs are as follows:

For CYP716A47 synthase,

 5'-ATG GTG TTG TTT TTC TCC CTA TCT-3 '(SEQ ID NO: 23) and

 5'-TTA ATT GTG GGG ATG TAG ATG AAT-3 '(SEQ ID NO: 24).

The PCR product was cloned into the pYES2.1 / V5-His-TOPO vector and Escherichia E. coli . The ORFs were then operably conjugated to the GAL1 promoter. The nucleotide sequence of the inserted DNA was confirmed by sequencing. Arabidopsis CYP716A47 and Empty Vectors Saccharomyces with thaliana NADPH-CYP reductase It was expressed in cerevisiae strain WAT21 (Urban, P. et al . (1997) J. Biol. Chem . 272, 19176-19186).

WAT21 yeast cells were transformed with a known modified lithium acetate method (Gietz, D., St Jean, A., Woods, RA, Schiestl, RH (1992) Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res . 20: 1425). Transformed cells were selected with SC-U (uracil-deficient SC minimal medium), cultured for 3 days, and subcultured in YPG medium (Kribii et al., 1997).

Culture conditions and methods for the induction by galactose and the preparation of the triterpene monoalcohol fraction are known, except that dammarenediol II (50 mg L- ¹ ) is added to the medium as a substrate. Method was followed (Kushiro, T., Ohno, Y., Shibuya, Y., Ebizuka, Y. (1997) In vitro conversion of 2,3-oxidosqualene into dammarenediol by Panax ginseng microsomes. Biol . Pharm . Bull . 20: 292294). After galactose induction for one day, the cells were collected by centrifugation at 500 g for 5 minutes and refluxed with 2 ml of 20% KOH / 50% EtOH for 5 minutes. After extraction with the same volume of hexane, the extract was analyzed by LC / APCIMS.

<4-2> Recombinant Yeast LC Of APCIMS  analysis

LC-APCIMS analysis was performed on a Surveyor LC system (Thermo Finnigan Co., San Jose, CA, USA). It consists of four solvent pumps, a Rheodyne injector (5 ml loop) and an HTP Pal autosampler (CTC Analytics, Zwingen, Switzerland). The analytical column used YMC pack-pro C18 RS (5 mm, 2.0 × 150 mm, YMC Co. LTD. Japan) stored at 408 ° C.

Water and acetonitrile gradient application times and composition ratios were: 0 min, 80% acetonitrile and 20% water; 30 min, 10% acetonitrile and 90% water; 32 min, 5% acetonitrile and 95% water; 34 min, 5% acetonitrile and 95% water; 36 min, 80% acetonitrile and 20% water; And 45 min, 80% acetonitrile and 20% water, flow rate of 0.2 ml min &lt; ^{-1 &} gt ;.

A triple quadrupole mass spectrometer, Finnigan TSQ Quantum Ultra (Thermo Electron Co., San Jose, Calif., USA), equipped with an atmospheric pressure chemical ionization (APCI) system was used for detection. The analysis conditions were as follows: positive mode of 5.0 mA discharge current, 320 ° C vaporizer temperature and 320 ° C ion-transfer capillary temperature. Nitrogen was used as sheath (15 psi) and auxiliary gas (10 psi). For HPLC-UV detection, ginsenosides were observed at a wavelength of 202 nm. The original dammarenediol and protopanaxadiol were tested under the same conditions. Dammarenediol-II was used as standard for LC / APCIMS analysis.

<4-3> Analysis of Protoparanaxadiol Biosynthesis

CYP716A47 The full length cDNA clone of (AB115496) is 1485 bp in size, has an open reading frame (ORF) of 487-amino acids, and produces a protein whose molecular weight is predicted to be 55.36 kDa. Prototype wave incident to the diol to measure the hydroxylated (hydroxylation) of CYP716A47 active in the production, by inserting the ORF region of the cDNA CYP716A47 pYES2.1 expression vector, were expressed in WAT21 yeast (yeast) under the control of the GAL1 promoter. Yeast extracts were analyzed using total ion chromatograms from LC / APCIMS (liquid chromatography-atmospheric pressure chemical ionization mass spectrometry).

Since dammarenediol-II was applied exogenously to yeast, both dammarenediol and protopanaxadiol were measured in total ion chromatograms from LC / APCIMS (Figure 3B). ). Retention times of the standard dammarenediol and protopanaxanadiol peaks were 24.70 and 32.59 minutes, respectively (FIG. 3A). Both dammarenediol and protoparnaxadiol were identified in CYP716A47 -expressing yeast using LC / APCI-MS (FIG. 5B). In the control yeast extract with an empty vector, the peak of exogenously added dammarenediol was detected, but no protopanaxanadiol signal was detected (FIG. 5A).

In yeast expressing the CYP716A47 gene, the protopanaxadiol signal at 32.59-minute retention time was analyzed using an MS fragmentation pattern (FIG. 4). The LC / APCIMS fragmentation pattern in yeast expressing the CYP716A47 gene was m / s of 407 [M-3H ₂ O + H] ⁺ , 425 [M-2H ₂ O + H] ⁺ , and 443 [MH ₂ O + H] ⁺ . z ratios were included, which was the same as for the original Protopanaxanadiol (FIG. 4). These results show that CYP716A47 is a dammarenediol 12-hydroxylase gene and converts it to protopanaxadiol.

< Example  5>

In yeast PgDDS  And CYP716A47 Co-expression of co - expression )

<5-1> Plasmid Preparation

PgDDS coding region fragment (GenBank accession number GU183405) was amplified by PCR. The following primer sets were used with restriction enzyme sites at the 5 'end:

Not I- PgDDS -Fw:

5'- GCGGCCGC ATG TGG AAG CTG AAG GTT GCT CAA GGA-3 '(SEQ ID NO: 25)

Sac I- PgDDS -Rv:

5'- GAGCTC TTA AAT TTT GAG CTG CTG GTG CTT AGG-3 '(SEQ ID NO: 26).

The product was cloned into pGEM-Teasy vector and sequenced. ORF behind the short cut through the Not I and Sac I, was inserted into the Not I and Sac I sites of pESC-URA vector (Stratagene). In a similar way, CYP716A47 Amplifying a fragment of the gene coding region, and, Xho I- Kpn I was subcloned in pGET-Teasy vector fragment. The primer pairs used were as follows:

Xho I- CYP716A47 -Fw:

5'- CTCGAG ATG GTG TTG TTT TTC TCC CTA TCT-3 '(SEQ ID NO: 27)

Kpn I- CYP716A47 -Rv:

5'- GGTACC TTA ATT GTG GGG ATG TAG ATG AAT-3 '(SEQ ID NO: 28).

After cutting the plasmid DNA with Xho I and Kpn I, PgDDS It was conjugated to the Xho I and Kpn I sites of the pESC-URA vector containing the gene. The plasmid product was named pESC - PgDDS - CYP716A47- URA. WAT21 cells were transformed with this plasmid in the same manner as above.

LC / APCIMS analysis for recombinant yeast was performed in the same manner as described in Example <4-2> above.

<5-2> Analysis of Protoparanaxadiol Biosynthesis

PgDDS and CYP716A47 genes were subcloned into the yeast expression vector pESC-URA using double gene expression cassettes, and ethyl acetate extracts of cells were analyzed using LC / APCIMS. As a result, HPLC analysis using UV fluorescence detection showed similar chromatogram fraction patterns between recombination (FIG. 6B) and control yeast (FIG. 6A), but new peaks formed at a retention time of 32.59 minutes, which is standard. It was found to be a ProtoPanaxadiol peak (FIG. 6C).

That is, the total ion chromatogram of LC / APCIMS showed that co-expression of PgDDS and CYP716A47 in yeast clearly produced peaks at a retention time of 32.59 minutes (FIG. 7B), which was the same retention as for the Protopananadiol standard. Time (Figure 7C). In the control yeast containing only the empty vector, no protopananadiol peak was detected at the same retention time (24.70 minutes) as that of the standard protopanaxanadiol peak (FIG. 7A).

In addition, we analyzed the protopanaxadiol signal at a retention time of 32.59 minutes in yeast expressing both PgDDS and CYP716A47 genes using the MS fragmentation pattern (FIG. 6D). As a result, the LC / APCIMS spectrum of the peak at 32.59 min retention time of yeast expressing both PgDDS and CYP716A47 genes was found to be 407 [M-3H ₂ O + H] ⁺ , 425 [M-2H ₂ O + H] ⁺ , And the m / z ratio of 443 [MH ₂ O + H] ⁺ , which is the same as for the original Protopananadiol (FIG. 5B). These results show that CYP716A47 is a dammarenediol 12-hydroxylase gene that produces protoparnaxadiol. The yield of protopanaxadiol after 2 days of culture in galactose-induced medium was about 17.32 μg g ⁻¹ fresh weight.

That is, PgDDS in yeast according to <Example 5> And co-expression of CYP716A47 was different from that of <Example 4>, despite the fact that Dhammarendiol II was not added to the medium as a substrate, it was found that propananaxadiol can be produced only by the additional expression of the PgDDS gene in CYP716A47. Prove it.

In addition, the inventors also tested whether CYP716A47 -expressing yeast can convert ProtoPanacodiol to ProtoPanacotriol . The original Protopananatriol peak was found at a retention time of 19.20 minutes. PgDDS And CYP716A47 In the yeast expressing all of them, no protopanaxanatriol was detected. In addition, no traceable LC / APCIMS signal was detected for ProtoPanaxatriol. These results show that CYP716A47 cannot further hydroxylate ProtoPanaxadiol for biosynthesis of ProtoPanaxatriol .

So far I looked at the center of the preferred embodiment for the present invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

Attach an electronic file to a sequence list

Claims (12)

A composition for promoting protopanaxadiol biosynthesis comprising a protein consisting of the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same. delete The method of claim 1,
The composition is a composition for promoting protopanaxadiol biosynthesis, characterized in that it comprises a recombinant vector or plasmid containing a gene encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2. The method of claim 1,
The composition is a composition for promoting protopanaxadiol biosynthesis, characterized in that to increase the synthesis of protoparanaxadiol in dammarenediol (II) through the activation of dalmarenediol 12-hydroxylase (hydroxylase). The method of claim 1,
The composition is a panax ginseng dammarenediol synthase (Panax ginseng dammarenediol synthase, PgDDS) protein or composition for promoting protopananaxadiol biosynthesis further comprising a gene encoding the same. The method of claim 5,
The composition is a composition for promoting protopanaxadiol biosynthesis capable of synthesizing protopanaxadiol without addition of dammarenediol II. A host cell transformed with the recombinant vector or plasmid of claim 3. The method of claim 7, wherein
Wherein the host cell is yeast or Escherichia coli. delete A method for increasing protoparanaxadiol production by increasing the expression of a protein consisting of the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same. The method of claim 10,
The method comprises the steps of transforming the host with the recombinant vector or plasmid of claim 3, overexpressing a protein consisting of the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same. . 12. The method of claim 11,
And said host is yeast or Escherichia coli.

Images