WO2019224321A1 - Triterpene glycosylation - Google Patents

Triterpene glycosylation Download PDF

Info

Publication number
WO2019224321A1
WO2019224321A1 PCT/EP2019/063369 EP2019063369W WO2019224321A1 WO 2019224321 A1 WO2019224321 A1 WO 2019224321A1 EP 2019063369 W EP2019063369 W EP 2019063369W WO 2019224321 A1 WO2019224321 A1 WO 2019224321A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
plant
seq
triterpenoid
nucleotide sequence
Prior art date
Application number
PCT/EP2019/063369
Other languages
French (fr)
Inventor
Anne Osbourn
Anastasia ORME
Thomas LOUVEAU
Original Assignee
Plant Bioscience Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Plant Bioscience Limited filed Critical Plant Bioscience Limited
Publication of WO2019224321A1 publication Critical patent/WO2019224321A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1077—Pentosyltransferases (2.4.2)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8281—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance

Definitions

  • the present invention relates generally to methods and materials for use in glycosylation of chemical scaffolds, such as triterpenes.
  • UGTs uridine diphosphate- dependant glycosyltransferases belonging to the carbohydrate-active enzyme (CAZY) GT1 family
  • CAZY carbohydrate-active enzyme
  • UGTs transfer sugars from uridine diphosphate-activated sugar moieties to small hydrophobic acceptor molecules.
  • UGTs generally show high specificity for their sugar donors and recognise a single uridine diphosphate (UDP)-activated sugar as their substrate (Kubo, Arai et al. 2004, Bowles,
  • Plant UGTs recognise their sugar donors via a motif localized on the C-terminal part of the enzyme. This Plant Secondary Product Glycosyltransferase (PSPG) motif is highly conserved throughout UGT families (Hughes and Hughes 1994, Mackenzie, Owens et al. 1997,
  • UGTs UDP-a-D-glucose (UDP-GIc) as their sugar donor, although UGTs that use alternative sugars have also been reported (Bowles, Lim et al. 2006, Osmani, Bak et al. 2009).
  • Triterpene glycosides are one of the largest and most structurally diverse groups of plant natural products. These compounds are synthesised from the mevalonate pathway and share a common biogenic origin with sterols. They protect plants against pests and pathogens and can determine other agronomically important traits such as flavour. They also have a wide range of potential medicinal and industrial applications (Marchin, Kuzina et al. 201 1 , Sawai and Saito 201 1 ).
  • Saponins commonly have a sugar chain attached at the C-3 position that may consist of up to five sugar molecules, normally D-glucose, D-galactose, L-arabinose, D-glucuronic acid, D-xylose, or L-rhamnose, and sometimes additional sugar chains located elsewhere on the molecule. This glycosylation is critical for many of the bioactive properties of triterpene glycosides (Osbourn 1996, Francis, Kerem et al. 2002).
  • triterpenoid UGTs Despite the importance of glycosylation for the bioactive properties of saponins, the characterization of triterpenoid UGTs has so far been limited. Of the 19 triterpenoid UGTs reported so far, 15 are D-glucosyltransferases. A further three are also hexose
  • Avenacins are antimicrobial compounds that are produced in oat roots and that provide protection against attack by soil-borne fungal pathogens, including the causal agent of take-all disease of cereals, Gaeumannomyces graminis v ar. tritici (Papadopoulou, Melton et al. 1999), a disease responsible for major yield losses in all wheat-growing areas of the world.
  • Avenacin A-1 has a branched sugar chain at the C-3 position. This sugar chain is essential for antimicrobial activity, rendering the molecule amphipathic and so enabling it to disrupt fungal membranes (Osbourn, Bowyer et al. 1995, Armah, Mackie et al. 1999).
  • the first sugar in the sugar chain is L-arabinose, which is linked to two D-glucose molecules via 1 -2 and 1 -4 linkages.
  • the enzymes required for avenacin glycosylation have not yet been characterised
  • the present inventors have characterised two enzymes which represent the first triterpene arabinosyltransferases to be reported from plants: these enzymes are termed AsAATI and GmSSAT herein. An ortholog of AsAATI has also been identified.
  • glucosyltransferases from oat ( Avena strigosa) that are required for the biosynthesis of the antifungal triterpene glycoside, avenacin A-1 : these enzymes are termed AsUGT91 and AsTG herein.
  • AsTG is a vacuolar transglycosidase (specifically a transglucosidase) belonging to glycosyl hydrolase family 1 (GH1 ) and is the first member of this family of enzymes to be involved in triterpene biosynthesis.
  • GH1 glycosyl hydrolase family 1
  • a transglycosidase is an enzyme that catalyzes the transfer of a sugar moiety between different glycosides.
  • a transglucosidase (“TG”) is an enzyme that catalyzes the transfer of a glucose moiety between different glycosides.
  • AsAAT 1 is a GT1 from oat that catalyses the addition of the first sugar in the avenacin oligosaccharide chain.
  • benthamiana and characterisation of an oat mutant line that this enzyme adds L- arabinose to the triterpene scaffold at the C-3 position.
  • AsAAT 1 is the first triterpene arabinosyltransferase to be characterized, and only the second reported plant GT 1 arabinosyltransferase.
  • AsAAT 1 shows high specificity for UDP-b-L-arabinopyranose (UDP-Ara) as its sugar donor and identify two amino acid residues mutually required for sugar donor specificity Using a targeted mutagenesis approach, we have shown that two residues are mutually required to provide sugar specificity to AsAAT 1. If modified, AsAAT 1 is converted into a glucosyltransferase.
  • One of those, H404 is conserved in monocot and dicot
  • AsAAT 1 has a pivotal role in the biosynthesis of the oat antifungal saponin avenacin A-1 , which is crucial for take-all disease resistance.
  • GmSSAT triterpenoid arabinosyltransferase
  • transglycosidases to triterpene glycoside biosynthesis increases the range of possible glycosylation events that are possible in heterologous systems, as molecules that are transferred to the vacuole and are inaccessible to cytosolic UGTs can be further decorated by vacuolar transglucosidases.
  • AsAATI and soybean GmSSAT together with UGT78D3 from A. thaliana are the only GT1 arabinosyltransferases characterised to date. Although these 3 enzymes reside in different clades of the UGT phylogenetic tree, they all harbor the same His residue critical for arabinosylation activity, suggesting convergent evolution of plant natural product arabinosyltransferases in monocots and dicots.
  • glycosylated triterpenes in a heterologous host or via semi-synthetic means.
  • the glycosylated triterpenes may be non- naturally occurring in the species into which they are introduced.
  • Glycosylated triterpenes from the plants or other hosts of the invention may be isolated and commercially exploited.
  • the present invention provides means for manipulation of total levels of glycosylated triterpenes in host cells such as microorganisms or plants.
  • TMG TriTerpenoid glycosyating activity
  • polynucleotides and polypeptides of Table TTG1 a having TTG activity may be referred to herein as“TTG genes” or“TTG nucleic acids” and“TTG polypeptides” respectively. Collectively they may be referred to as“TTG sequences” of the invention.
  • Triterpenoid glycosylating activity displayed by the present TTGs involves the transfer of a sugar unit from a sugar donor onto a triterpenoid acceptor.
  • a triterpenoid acceptor in this context includes non-modified triterpene scaffolds, oxygenated triterpene scaffolds or a triterpenoid molecule that has been further modified (e.g. glycosylated, acylated, or methylated).
  • TTGs involved in sugar chain extension i.e. that are able to transfer sugar units onto glycosidic moieties of triterpenoid glycosides.
  • an isolated nucleic acid molecule which comprises a nucleotide sequence encoding a triterpenoid arabinosyltransferase (AT) enzyme capable of transferring an arabinoside moiety from UDP-Ara to a triterpenoid acceptor to form a triterpenoid arabinoside.
  • the AT enzyme may be a GT family 1 , UGT group D enzyme.
  • the AT enzyme may be plant derived, optionally from a monocot plant, which is optionally an Avena spp. plant.
  • the AT enzyme may optionally be from a dicot plant, which is optionally Glycine max.
  • the acceptor may optionally be selected from a scaffold of the oleanane-type, ursane- type, lupane-type or dammarane-type.
  • the AT enzyme may be transfer the arabinoside to the C-3 position of the triterpenoid acceptor.
  • the AT enzyme comprises a PSPG motif in which motif the amino acid residue corresponding to residue 404 in AsAATI is a His residue.
  • the PSPG motif the amino acid residue corresponding to residue 376 in AsAATI is a Thr residue.
  • the PSPG motif is as shown in Table TTG2, including said His residue at the amino acid residue corresponding to residue 404 in AsAATI (either naturally, or by modification as explained below).
  • PSPG motifs are well established in the art (see Hughes & Hughes, 1994). PSPG motifs and other sequences can be aligned to show“equivalent” or“corresponding” residues by methods well known in the art. For example, pairwise alignment can be performed as shown in Table TTG2 e.g. using either clustalW or BLASTp from NCBI (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi). Default settings should be applied.
  • an isolated nucleic acid molecule which comprises a nucleotide sequence encoding a glycosyl hydrolase family 1 (GH1 ) transglucosidase enzyme capable of transferring a glucoside moiety via a 1 ,4 link to the arabinoside moiety of a triterpenoid arabinoside 1 ,2-glucoside acceptor to form a triterpene triglycoside.
  • GH1 glycosyl hydrolase family 1
  • the polypeptide sequence encoded by the nucleotide may comprises a vacuolar targeting sequence.
  • TTG genes form aspects of the present invention in their own right.
  • nucleic acids which are variants of these TTG nucleic acids.
  • variants may be used to alter the glycosylated triterpene content of a plant, as assessed by the methods disclosed herein.
  • a variant nucleic acid may include a sequence encoding a variant TTG polypeptide sharing the relevant biological activity of the native TTG polypeptide, as discussed above. Examples include variants of any of SEQ ID Nos 2, 4, 6, 8 or 10.
  • the methods of the present invention will include the use of one or more of these newly characterised TTG nucleic acids of the invention (e.g. one, two, three or four such TTG nucleic acids) optionally in conjunction with the manipulation of other genes affecting triterpenoid synthesis or decoration known in the art.
  • nucleic acid molecule which nucleic acid comprises a nucleotide sequence encoding an enzyme having TTG activity, wherein the nucleotide sequence:
  • (ii) encodes a variant polypeptide which is a homologous variant of SEQ ID NO 2, 4, 6, 8, or 10 which shares at least about 50% identity with said SEQ ID NO, which polypeptide has the respective activity of said SEQ ID NO. shown in Table TTG1 b.
  • the nucleotide sequence may be selected from SEQ ID NO: 1 , 3, 5, 7, or 9 or the genomic equivalent thereof.
  • the nucleotide sequence may encode a derivative of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, or 10 by way of addition, insertion, deletion or substitution of one or more amino acids.
  • nucleotide sequence consist of or comprise an allelic or other homologous or orthologous variant of the original native nucleotide sequences described herein
  • nucleic acids of the invention include those which are degeneratively equivalent to these.
  • aspects of the invention further embrace isolated nucleic acid comprising a sequence which is complementary to any of those discussed herein.
  • nucleic acid molecule which nucleic acid comprises a nucleotide sequence encoding an enzyme having TTG activity, wherein the nucleotide sequence encodes a variant polypeptide which is a homologous variant of the amino acid sequence shown in SEQ ID NO 2, 4, or 6 and which shares at least about 50% identity with said SEQ ID NO,
  • nucleotide sequence encodes a derivative of said amino acid sequence wherein the His residue at the amino acid residue corresponding to residue 404 in SEQ ID NO. 2 has been substituted or deleted to alter the sugar specificity thereof compared to the respective activity of said SEQ ID NO. shown in Table TTG1 b.
  • His may be substituted for Gin.
  • nucleic acid molecule which comprises a nucleotide sequence encoding an enzyme having triterpenoid glycosylation (TTG) activity, wherein the nucleotide sequence encodes a variant polypeptide which is a homologous variant of the amino acid sequence of a triterpenoid glucosyltransferase, wherein the nucleotide sequence encodes a derivative of said amino acid sequence wherein the Gin residue at the amino acid residue corresponding to residue 404 in SEQ ID NO. 2 has been substituted or deleted such as to convert said
  • TTG triterpenoid glycosylation
  • the invention provides a method which comprises the steps of:
  • the invention further provides a method which comprises the steps of:
  • primers suitable for PCR at least one of said primers being a sequence of at least about 16-24 nucleotides in length, which sequence is present in a nucleotide sequence of a nucleic acid described herein;
  • Another aspect of the invention utilises a nucleic acid of the invention to interrogate a database of plant genomic sequences, and identify target TTG nucleic acid based on sequence similarity and clustering of the target nucleic acid with other TTG sequences (see the Examples herein).
  • any putative TTG enzyme can be confirmed after identification using the assays described herein.
  • the invention provides a recombinant vector which comprises the TTG nucleic acid of the invention.
  • the nucleic acid may be operably linked to a promoter for transcription in a host cell, wherein the promoter is optionally an inducible promoter.
  • the vector may be a plant vector, a microbial vector, an insect cell vector, or a mammalian cell vector. Examples are discussed hereinafter.
  • a 3’ UTR located upstream of said terminator sequence. Also provided is a method which comprises the step of introducing the vector into a host cell, optionally such as to cause recombination between the nucleic acid in the vector and the host cell genome such as to transform the host cell.
  • a host cell e.g. microbial, insect, plant or mammalian cell
  • a heterologous nucleic acid of the invention or with the vector e.g. microbial, insect, plant or mammalian cell
  • the cell is a plant cell, optionally having the heterologous nucleic acid within its chromosome.
  • Also provided is a method for producing a transgenic plant which method comprises the steps of:
  • transgenic plant obtained or obtainable by the methods described herein, or one which is a clone, or selfed or hybrid progeny or other descendant of said transgenic plant, which in each case includes a heterologous nucleic acid of the invention.
  • an edible portion or propagule from such as plant includes a
  • heterologous nucleic acid of the invention and ⁇ or modified triterpene as described herein.
  • a method for assessing the triterpene glycosylation phenotype of a plant comprising the step of determining the presence and/or identity of an allele therein comprising the use of a TTG nucleotide sequence of the invention or a part thereof.
  • TTG nucleic acids of the invention may be used in combination to provide appropriate TTG activity.
  • aspects may employ combinations of:
  • nucleic acid having a nucleotide sequence encoding all or part of the polypeptide SEQ ID NO: 2 or 6, or encoding a variant polypeptide which is a homologous variant of SEQ ID NO 2 or 6 which shares at least about 50% identity with said SEQ ID NO;
  • nucleic acid having a nucleotide sequence encoding all or part of the polypeptide SEQ ID NO: 8, or encoding a variant polypeptide which is a homologous variant of SEQ ID NO 8 which shares at least about 50% identity with said SEQ ID NO;
  • nucleic acid having a nucleotide sequence encoding all or part of the polypeptide SEQ ID NO: 10, or encoding a variant polypeptide which is a homologous variant of SEQ ID NO 10 which shares at least about 50% identity with said SEQ ID NO;
  • TTG products and the use of a TTG sequence to catalyse its respective biological activity forms another aspect of the invention.
  • the invention provides an isolated TTG polypeptide which is encoded by the nucleotide sequences of the invention described herein.
  • an antibody which specifically binds the polypeptide.
  • TTG polypeptides in a method of catalyse triterpenoid glycosylation in vivo or in vitro. As explained herein, this has utility for generating natural or novel triterpenoids, or diverting fluxes between different types of triterpenoid.
  • Example utilities include:
  • novel glycosylated triterpenes obtained or obtainable by the methods described herein e.g. in vivo, in vitro, or mixed methods (semi-synthetic).
  • TTG polypeptide which method comprises the step of causing or allowing expression from a TTG nucleic acid of the invention.
  • the invention further provides a method of influencing or affecting triterpenoid
  • the method including causing or allowing transcription of a heterologous TTG nucleic acid as discussed above within the cells of the plant.
  • the step may be preceded by the earlier step of introduction of the TTG nucleic acid into a cell of the plant or an ancestor thereof.
  • Such methods will usually form a part of, possibly one step in, a method of producing a glycosylated triterpene in a host such as a plant.
  • the method will employ a TTG polypeptide of the present invention or derivative thereof, as described above, or nucleic acid encoding either.
  • Example methods may comprise the step of:
  • Said double-stranded RNA e.g. siRNA duplex
  • RNA e.g. siRNA duplex
  • Plant triterpene glycosides are a large and varied class of terpenoids that are often associated with plant defence mechanisms and have a wide range of different properties with many potential applications, from foaming agents in beverages to vaccine adjuvants.
  • Triterpene glycosides are difficult to isolate from natural sources due to their presence in low amounts or in composite mixtures, and their chemical complexity impedes chemical or partial synthesis.
  • the present invention opens the possibility of the production of multiple triterpene glycosides in heterologous hosts in sufficient amounts to evaluate their properties systematically, opening up opportunities to scale-up production for applications in medicine and industry.
  • TTG materials e.g. genes and polypeptides.
  • n vivo sugar donors of AsTG may include cinnamic acid O-b-D-glucoside or N-methyl anthranilic acid O-b-D-glucoside.
  • GH1 transglycosidases to triterpene glycoside biosynthesis increases the range of possible glycosylation events that are possible in heterologous systems, as molecules that are transferred to the vacuole and are inaccessible to cytosolic UGTs can be further decorated by vacuolar TTGs.
  • biosynthetic pathways can be used to engineer new traits into crops, or to modify undesirable traits that are associated with triterpene glycosides (Osbourn, Goss et al. 201 1 )(Heng2006, Osbourn201 1 ).
  • glycosylated triterpenes which may be naturally occurring or novel, or to modify the glycosylation of a triterpene, in a host.
  • the methods may be used for reduction or increase in glycosylated triterpene quality or quantity in the host.
  • triterpenoid arabinosyltransferase enzymes described herein can also be used for the purpose of alleviating endogenous modifications of triterpenoid scaffolds and over-accumulate arabinosyl- conjugates of a desire molecule.
  • the SAD6 product is not highly accumulated in planta due to endogenous glycosylation or other endogenous modification.
  • the corresponding glucoside is also subject to endogenous modification (Leveau et al. unpublished).
  • arabinosylation of the product leads to the accumulation of a defined
  • arabinosylation may be used to‘tag’ triterpenoid products of interest, such that they can be purified and analysed, and, if desired, the arabinose moiety may be removed by hydrolysis.
  • a method for inhibiting endogenous modifications of a triterpenoid scaffold and ⁇ or accumulating arabinosyl-conjugates of a triterpenoid scaffold wherein a heterologous nucleic acid encoding a triterpenoid arabinosyltransferase (AT) enzyme is expressed within the cells of the host, following an earlier step of introducing the nucleic acid into a cell of the host or an ancestor thereof.
  • AT triterpenoid arabinosyltransferase
  • arabinosylation may be used to‘tag’ triterpenoid products of interest, such that they are not further modified, and can be purified and analysed.
  • TTG materials described herein to modify any of these properties forms part of the present invention.
  • triterpenoid glycosides have been determined to provide various health promoting properties. Furthermore some triterpenes (Soyasaponins from group A) are believed to contribute to bitterness and anti-feedant activity in soybean, and other beans.
  • example utilities for the methods and materials of the invention in relation to plant or plant product phenotypes include:
  • a preferred property of the methods and materials of the invention is to reduce bitterness caused by triterpenoid glycosides.
  • a preferred property is to enhance resistance to at least one fungal disease e.g. the root disease take-all.
  • a “resistance to at least one fungus” refers to a plant comprising a recombinant nucleic acid of the present invention which when infected with a fungus is able to resist infection or to tolerate infection to a greater degree, resulting in less damage, more vigorous health and less or no loss of yield due to fungal infection relative to plants without the nucleic acid of the present invention.
  • the fungus is typically pathogenic.
  • Pathogenic or “fungal pathogen” refer to a fungus that under conditions that do not include the nucleic acid of the present invention, would cause disease in a plant. Examples of specific fungal pathogens for the major crops are described in W02006/044508 and include but are not limited to, the following:
  • Soybeans Macrophomina phaseolina, Rhizoctonia solani, Sclerotinia sclerotiorum, Fusarium oxysporum, Diaporthe phaseolorum var. sojae (Phomopsis sojae), Diaporthe phaseolorum var.
  • Alfalfa Phoma medicaginis var. medicaginis, Cercospora medicaginis, Pseudopeziza medicaginis, Leptotrichila medicaginis, Fusarium oxysporum, Verticillium alboatrum, Stemphylium herbarum, Stemphylium alfalfae, Colletotrichum trifolii, Leptosphaerulina briosiana, Uromyces striatus, Sclerotinia trifoliorum, Stagonospora meliloti, Stemphylium botryosum, Leptotrochila medicaginis;
  • Urocystis agropyri Altemaria alternata, Cladosporium herbarum, Fusarium a venaceum, Fusarium culmorum, Ustilago tritici, Ascochyta tritici, Cephalosporium gramineum, Collotetrichum graminicola, Erysiphe graminis f.sp. tritici, Puccinia graminis f.sp. tritici, Puccinia recondita f.sp.
  • tritici Puccinia striiformis, Pyrenophora tritici-repentis, Septoria nodorum, Septoria tritici, Septoria avenae, Pseudocercosporella herpotrichoides, Rhizoctonia solani, Rhizoctonia cerealis, Gaeumannomyces graminis var. tritici (“take- all”), Bipolaris sorokiniana, Claviceps purpurea, Tilletia tritici, Tilletia laevis, Ustilago tritici, Tilletia indica, Rhizoctonia solani;
  • Sunflower Plasmophora halstedii, Sclerotinia sclerotiorum, Septoria helianthi, Phomopsis helianthi, Altemaria helianthi, Altemaria zinniae, Botrytis cinerea, Phoma macdonaldii, Macrophomina phaseolina, Erysiphe cichoracearum, Rhizopus oryzae, Rhizopus arrhizus, Rhizopus stolonifer, Puccinia helianthi, Verticillium dahliae, Cephalosporium acremonium;
  • terpenoids also called isoprenoids
  • isoprenoids are well known in the art and constitute the largest family of natural products with over 22,000 individual compounds of this class having been
  • the triterpenes or terpenoids include hemiterpenes, monoterpenes, sesquiterpenes, diterpenes, triterpenes, tetraterpenes, polyprenols, and the like, and play diverse functional roles in plants as hormones, photosynthetic pigments, electron carriers, mediators of
  • polysaccharide assembly and structural components of membranes.
  • the majority of plant terpenoids are found in resins, latex, waxes, and oils.
  • Triterpenes are synthesised via the cyclization of squalene (in bacteria) or 2,3- oxidosqualene (in fungi, animals, and plants). Specifically, triterpenoids are synthesized from these linear precursors by enzymes known as oxidosqualene cyclases via a process involving substrate folding into the chair-chair-chair conformation. These reactions involve the production of cyclic derivatives via protonation and epoxide ring opening of the precursor, which creates a carbocation that can undergo several types of cyclization reactions. Over 200 triterpene scaffolds have been reported (Xu et al. 2004).
  • the triterpenoid backbone undergoes various modifications (oxidation, substitution, and glycosylation), mediated by cytochrome P450-dependent monooxygenases, glycosyltransferases, and other enzymes.
  • Non-limiting examples of triterpenoid scaffolds recognized as acceptors by one or more of the present TTGs are 30 carbon polycyclic terpenoids derived from the precursor 2,3- oxidosqualene. These include triterpenoids derived from the b-amyrin scaffold
  • the triterpene acceptor may optionally be selected from a scaffold of the oleanane-type, ursane-type, lupane-type or dammarane-type and ⁇ or the triterpene or triterpenoid is selected from: a soyasaponin which is optionally selected from a group A saponin, which is optionally Ab, Ac, Ad, Af and Ah; an avenacin which is optionally selected from Avenacin A-1 , A-2, B-1 and B-2.
  • the invention may be applied to triterpenoids derived from the b-amyrin scaffold (oleanane-type), a-amyrin scaffold (ursane-type), lupeol scaffold (lupane-type) or dammarenediol II scaffold (dammarane-type).
  • the triterpene glycoside is an avenacin.
  • Avenacins are antifungal triterpene glycosides that are synthesised in the epidermal cell layers of roots of oat (Avena) species and the closely related Arrhenatherum elatius (Turner, 1953; Crombie and Crombie, 1986; Osbourn et al., 1994; Qi et al., 2006).
  • avenacin A-1 the most abundant one is avenacin A-1.
  • These compounds are preformed phytoprotectants that confer resistance against soil-borne fungal pathogens such as Gaeumannomyces graminis var.
  • the sugar chain of avenacin A-1 is a trisaccharide of an l-arabinose linked in the a-configuration to the 3-0 of the avenacin backbone with two branching b-1 ,4- and b-1 ,2 ⁇ Iuoo8b molecules.
  • the triterpene glycoside is a soyasaponin.
  • Soyasaponins are triterpene glycoside saponins found in soybeans.
  • Soybean produces triterpene glycosides (soyasaponins) some of which, referred as soyasaponins from group A, harbouring a branched sugar chain attached at the C-22 position and initiated by an L-arabinose residue (Fig. 1 A).
  • Soyasaponins have been reported to promote various health functions and to display antioxidative and cholesterol-lowering properties. Favourable properties reported include the ability to reduce blood glucose levels, reduce anti-kidney disease progression, anti- inflammatory properties, renin inhibition, hepatoprotection, and antitumor effects (Kamo, Suzuki et al. 2014).
  • soyasaponins Aa and Ab Group A
  • Other reported activities for soyasaponins Aa and Ab include an anti-obesity effect on 3T3-L1 adipocytes through the downregulation of adipogenesis-related transcription factor peroxisome proliferator-activated receptor y (Yang, Ahn et al. 2015).
  • TTG nucleic acid or TTG polypeptide molecule shares homology with, or is identical to, all or part of the TTG genes or polypeptides discussed herein.
  • a variant polypeptide shares the relevant biological activity of the native TTG polypeptide (enzyme) as shown in Table TTG1 b.
  • a variant nucleic acid encodes the relevant variant polypeptide.
  • the“biological activity” of the TTG polypeptide is the ability to catalyse the respective reaction shown in Table TTG1 b or otherwise described herein e.g. with reference to the Figures.
  • the relevant biological activities may be assayed based on the reactions shown in Table TTG1 b in vitro. Alternatively they can be assayed by activity in vivo as described in the Examples i.e. by introduction of the TTG nucleotide sequences of the invention into a host to generate glycosylated triterpenes, which can be assayed by LC-MS or the like.
  • Variants of the sequences disclosed herein preferably share at least 50%, 55%, 56%, 57%, 58%, 59%, 60%, 65%, or 70%, or 80% identity, most preferably at least about 90%, 95%, 96%, 97%, 98% or 99% identity. Such variants may be referred to herein as “substantially homologous”.
  • Preferred variants may be:
  • Naturally occurring nucleic acids such as alleles (which will include polymorphisms or mutations at one or more bases) or pseudoalleles (which may occur at closely linked loci to the TTG genes of the invention).
  • paralogues isogenes, or other homologous genes belonging to the same families as the TTG genes of the invention.
  • orthologues or homologues from other plant species are also included.
  • nucleic acid molecules which encode amino acid sequences which are homologues of TTG genes of the invention. Homology may be at the nucleotide sequence and/or amino acid sequence level, as discussed below.
  • nucleotide sequence information and other characterisation provided herein may be utilised in a bioinformatics approach to find homologous or orthologous sequences within a database (e.g. of whole genomes, or EST). Expression products of the sequences can then be tested for activity as described below.
  • Artificial nucleic acids which can be prepared by the skilled person in the light of the present disclosure. Such derivatives may be prepared, for instance, by site directed or random mutagenesis, or by direct synthesis. Preferably the variant nucleic acid is generated either directly or indirectly (e.g. via one or more amplification or replication steps) from an original nucleic acid having all or part of the sequence of a TTG gene of the invention.
  • nucleic acids corresponding to those above, but which have been extended at the 3' or 5' terminus.
  • TGT variant nucleic acid encompasses all of these amino acids
  • the preferred TTG nucleic acids are any of SEQ ID Nos 1 , 3, 5, 7, or 9, or substantially homologous variants thereof.
  • the preferred TTG polypeptides are any of SEQ ID Nos 2, 4, 6, 8, or 10, or substantially homologous variants thereof.
  • TMG triterpenoid glycosylation
  • Described herein are methods of producing a derivative nucleic acid comprising the step of modifying any of the TTG genes of the present invention disclosed above.
  • Changes may be desirable for a number of reasons. For instance they may introduce or remove restriction endonuclease sites or alter codon usage. This may be particularly desirable where the Qs genes are to be expressed in alternative hosts e.g. microbial hosts such as yeast.
  • microbial hosts such as yeast.
  • Methods of codon optimizing genes for this purpose are known in the art (see e.g. Maria, Stephan, et al. "Expression of codon optimized genes in microbial systems: current industrial applications and perspectives.” Frontiers in microbiology 5 (2014)).
  • sequences described herein including codon modifications to maximise yeast expression represent specific embodiments of the invention.
  • changes to a sequence may produce a derivative by way of one or more (e.g. several) of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution of one or more (e.g. several) amino acids in the encoded polypeptide.
  • Such changes may modify sites which are required for post translation modification such as cleavage sites in the encoded polypeptide; motifs in the encoded polypeptide for phosphorylation etc.
  • Leader or other targeting sequences e.g. membrane or golgi locating sequences
  • Other desirable mutations may be random or site directed mutagenesis in order to alter the activity (e.g. specificity) or stability of the encoded polypeptide. Changes may be by way of conservative variation, i.e. substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine.
  • altering the primary structure of a polypeptide by a conservative substitution may not significantly alter the activity of that peptide because the side-chain of the amino acid which is inserted into the sequence may be able to form similar bonds and contacts as the side chain of the amino acid which has been substituted out. This is so even when the substitution is in a region which is critical in determining the peptides conformation. Also included are variants having non-conservative substitutions. As is well known to those skilled in the art, substitutions to regions of a peptide which are not critical in determining its conformation may not greatly affect its activity because they do not greatly alter the peptide's three dimensional structure. In regions which are critical in determining the peptides conformation or activity such changes may confer advantageous properties on the polypeptide. Indeed, changes such as those described above may confer slightly advantageous properties on the peptide e.g. altered stability or specificity.
  • the present inventors have identified key residues which are conserved in all 3 characterised arabinosyltransferases, but not in the glucosyltransferases.
  • This residue is H404 in in C-terminus of the PSPG motif in AsAAT 1 , but Q in the corresponding motif in glucosyltransferases (see Table TTG2).
  • the present invention provides for, inter alia methods of modifying the glycosyl specificity of a TTG enzyme by substituting the residue corresponding to H404 in AsAAT 1 (SEQ ID NO: 2) in the PSPG motif of said TTG enzyme. This may be achieved using any of the methods described herein e.g. site directed mutagenesis based on modification of the encoding amino acid sequence.
  • Such may be used to convert glucosyltransferases to arabinosyltransferases (for example by modifying the residue to H) or vice versa (for example by modifying the residue from H e.g. to Q).
  • the invention also provides for the resulting nucleic acids and polypeptides e.g.
  • CRISPR clustered regularly interspaced short palindromic repeat
  • Cas CRISPR associated protein
  • crRNAs CRISPR RNAs
  • tracrRNA trans- encoded RNA
  • Cas CRISPR-associated proteins
  • CRISPR-Cas9 is a type II CRISPR-Cas system.
  • Streptococcus pyogenes is used in the art as a simple and versatile tool for RNA guided genome editing (RGE) in different organisms.
  • RGE RNA guided genome editing
  • gRNA-Cas9 recognizes targeted DNA by gRNA-DNA pairing between 5’-end leading sequence of gRNA (referred as gRNA spacer) and one DNA strand (complementary stand of protospacer).
  • Cas9 also requires the presence of protospacer-adjacent motif (PAM) in the target site following the gRNA-DNA pairing region.
  • PAM protospacer-adjacent motif
  • CRISPR-cas9 plasmids for use in plants are commercially available, for example from addgene - see: www.addgene.org/crispr/plant/
  • the TTG genes may be targets for editing using CRISPR-cas9 plasmids (i.e. be used to provide“gRNAs”).
  • the present invention may utilise fragments of the polypeptides encoding the TTG genes of the present invention disclosed above.
  • an“active portion” of a polypeptide means a peptide which is less than said full length polypeptide, but which retains its essential biological activity.
  • A“fragment” of a polypeptide means a stretch of amino acid residues of at least about five to seven contiguous amino acids, often at least about seven to nine contiguous amino acids, typically at least about nine to 13 contiguous amino acids and, most preferably, at least about 20 to 30 or more contiguous amino acids. Fragments of the polypeptides may include one or more epitopes useful for raising antibodies to a portion of any of the amino acid sequences disclosed herein. Preferred epitopes are those to which antibodies are able to bind specifically, which may be taken to be binding a polypeptide or fragment thereof of the invention with an affinity which is at least about 1000x that of other polypeptides.
  • fragments of the present invention include at least 100, 200, 300, 400, 450, 460, or 470 contiguous amino acids.
  • these other polynucleotides and polypeptides may also be referred to herein as“TTG genes” or“TTG nucleic acids” and“TTG polypeptides” respectively.
  • TGT sequences Collectively they may be referred to as“TTG sequences” of the invention.
  • the TTG-biosynthesis modifying nucleic acid described above is in the form of a recombinant and preferably replicable vector.
  • Vector is defined to include, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self-transmissible or mobilizable, and which can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g.
  • a“binary vector” system includes (a) border sequences which permit the transfer of a desired nucleotide sequence into a plant cell genome; (b) desired nucleotide sequence itself, which will generally comprise an expression cassette of (i) a plant active promoter, operably linked to (ii) the target sequence and ⁇ or enhancer as appropriate.
  • the desired nucleotide sequence is situated between the border sequences and is capable of being inserted into a plant genome under appropriate conditions.
  • the binary vector system will generally require other sequence (derived from A. tumefaciens) to effect the integration. Generally this may be achieved by use of so called "agro-infiltration" which uses Agrobacterium-mediated transient transformation.
  • T-DNA Agrobacterium tumefaciens to transfer a portion of its DNA
  • the T-DNA is defined by left and right border sequences which are around 21-23 nucleotides in length.
  • the infiltration may be achieved e.g. by syringe (in leaves) or vacuum (whole plants).
  • the border sequences will generally be included around the desired nucleotide sequence (the T- DNA) with the one or more vectors being introduced into the plant material by agro- infiltration.
  • Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • appropriate regulatory sequences including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eucaryotic (e.g. higher plant, mosses, yeast or fungal cells).
  • a vector including nucleic acid according to the present invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the genome.
  • the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, e.g. yeast and bacterial, or plant cell.
  • a host cell such as a microbial, e.g. yeast and bacterial, or plant cell.
  • the vector may be a bi-functional expression vector which functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter or other regulatory elements (optionally in combination with a heterologous enhancer, such as the 35S enhancer discussed in the Examples below).
  • promoter is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA).
  • operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
  • DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.
  • the promoter is an inducible promoter.
  • inducible as applied to a promoter is well understood by those skilled in the art. In essence, expression under the control of an inducible promoter is "switched on” or increased in response to an applied stimulus. The nature of the stimulus varies between promoters. Some inducible promoters cause little or undetectable levels of expression (or no expression) in the absence of the appropriate stimulus. Other inducible promoters cause detectable constitutive expression in the absence of the stimulus. Whatever the level of expression is in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus.
  • nucleic acid according to the invention may be placed under the control of an externally inducible gene promoter to place expression under the control of the user.
  • An advantage of introduction of a heterologous gene into a plant cell, particularly when the cell is comprised in a plant, is the ability to place expression of the gene under the control of a promoter of choice, in order to be able to influence gene expression, and therefore triterpenoid glycosylation, according to preference.
  • mutants and derivatives of the wild-type gene e.g. with higher or lower activity than wild-type, may be used in place of the endogenous gene.
  • this aspect of the invention provides a gene construct, preferably a replicable vector, comprising a promoter (optionally inducible) operably linked to a nucleotide sequence provided by the present invention.
  • nucleic acid constructs which operate as plant vectors.
  • Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Cray RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148).
  • Suitable vectors may include plant viral-derived vectors (see e.g. EP-A-194809).
  • the vectors of the present invention which are for use in plants comprise border sequences which permit the transfer and integration of the expression cassette into the plant genome.
  • the construct is a plant binary vector.
  • the binary transformation vector is based on pPZP (Hajdukiewicz, et al. 1994).
  • Other example constructs include pBin19 (see Frisch, D. A., L. W. Harris-Haller, et al. (1995).“Complete Sequence of the binary vector Bin 19.” Plant Molecular Biology 27: 405-409).
  • Suitable promoters which operate in plants include the Cauliflower Mosaic Virus 35S (CaMV 35S). Other examples are disclosed at pg. 120 of Lindsey & Jones (1989)“Plant Biotechnology in Agriculture” Pub. OU Press, Milton Keynes, UK.
  • the promoter may be selected to include one or more sequence motifs or elements conferring developmental and/or tissue-specific regulatory control of expression.
  • Inducible plant promoters include the ethanol induced promoter of Caddick et al (1998) Nature Biotechnology 16: 177-180.
  • selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibiotics or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).
  • Positive selection system such as that described by Haldrup et al. 1998 Plant molecular Biology 37, 287-296, may be used to make constructs that do not rely on antibiotics.
  • a preferred vector is a 'CPMV-HT' vector as described in W02009/087391.
  • vectors for use in the present invention will typically comprise an expression cassette comprising:
  • Enhancer sequences are sequences derived from (or sharing homology with) the RNA-2 genome segment of a bipartite RNA virus, such as a comovirus, in which a target initiation site has been mutated. Such sequences can enhance downstream expression of a heterologous ORF to which they are attached. Without limitation, it is believed that such sequences when present in transcribed RNA, can enhance translation of a heterologous ORF to which they are attached.
  • A“target initiation site” as referred to herein, is the initiation site (start codon) in a wild- type RNA-2 genome segment of a bipartite virus (e.g. a comovirus) from which the enhancer sequence in question is derived, which serves as the initiation site for the production (translation) of the longer of two carboxy coterminal proteins encoded by the wild-type RNA-2 genome segment.
  • a bipartite virus e.g. a comovirus
  • RNA virus will be a comovirus as described hereinbefore.
  • Most preferred vectors are the pEAQ vectors of W02009/087391 which permit direct cloning version by use of a polylinker between the 5’ leader and 3’ UTRs of an expression cassette including a translational enhancer of the invention, positioned on a T-DNA which also contains a suppressor of gene silencing and an NPTII cassettes.
  • suppressors of gene silencing are known in the art and described in WO/2007/135480. They include HcPro from Potato virus Y, He-Pro from TEV, P19 from TBSV, rgsCam, B2 protein from FHV, the small coat protein of CPMV, and coat protein from TCV.
  • a preferred suppressor when producing stable transgenic plants is the P19 suppressor incorporating a R43W mutation.
  • the present invention also provides methods comprising introduction of such a construct into a plant cell or a microbial (e.g. bacterial, yeast or fungal) cell and/or induction of expression of a construct within a plant cell, by application of a suitable stimulus e.g. an effective exogenous inducer.
  • a suitable stimulus e.g. an effective exogenous inducer.
  • cell suspension cultures of suitable plant species including also the moss Physcomitrella patens may be cultured in fermentation tanks (see e.g. Grotewold et al. (Engineering Secondary Metabolites in Maize Cells by Ectopic Expression of Transcription Factors, Plant Cell, 10, 721-740, 1998).
  • host cells having well established expression systems include mammalian cells (see e.g. Wurm, Florian M. "Production of recombinant protein therapeutics in cultivated mammalian cells.” Nature biotechnology 22.11 (2004): 1393) which may thus be used mutatis mutandis in the methods described herein.
  • heterologous TTG nucleic acid according to the present invention, especially a plant or a microbial cell.
  • a further aspect of the present invention provides a method of transforming a plant cell involving introduction of a construct as described above into a host (e.g. plant cell) and causing or allowing recombination between the vector and the cell genome to introduce a TTG nucleic acid according to the present invention into the genome.
  • a host e.g. plant cell
  • the invention further encompasses a host cell transformed with nucleic acid or a vector according to the present invention (e.g. comprising the TTG nucleic acid) especially a plant or a microbial cell.
  • a host cell transformed with nucleic acid or a vector according to the present invention e.g. comprising the TTG nucleic acid
  • the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. There may be more than one heterologous nucleotide sequence per haploid genome.
  • Yeast has seen extensive employment as a triterpene-producing host [6-8, 19-22] and is therefore potentially well adapted for biosynthesis of glycosylated triterpenes.
  • the host is a yeast.
  • Plants which include a plant cell transformed as described above, form a further aspect of the invention.
  • a plant may be regenerated, e.g. from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues and organs of the plant. Available techniques are reviewed in Vasil et al., Cell Culture and Somatic Cell Genetics of Plants, Vol I, II and III, Laboratory Procedures and Their Applications, Academic Press, 1984, and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989.
  • the present invention embraces all of the following: a clone of such a plant, seed, selfed or hybrid progeny and descendants (e.g. F1 and F2 descendants).
  • the invention also provides a plant propagule from such plants, that is any part which may be used in reproduction or propagation, sexual or asexual, including cuttings, seed and so on. It also provides any part of these plants, which in all cases include the plant cell or heterologous TTG-biosynthesis modifying DNA described above.
  • the present invention also encompasses the expression product of any of the coding TTG nucleic acid sequences disclosed and methods of making the expression product by expression from encoding nucleic acid therefore under suitable conditions, which may be in suitable host cells.
  • plant backgrounds such as those above may be natural or transgenic e.g. for one or more other genes relating to glycosylated triterpene
  • the TTG nucleic acids described herein may be used in combination with any other gene, such as transgenes affecting the rate or yield of triterpene frameworks, or their modification.
  • any other gene such as transgenes affecting the rate or yield of triterpene frameworks, or their modification.
  • co-expression of genes providing substrates or donors as described herein may be desirable.
  • plants or microorganisms e.g. bacteria, yeasts or fungi
  • plants or microorganisms can be tailored to enhance production of desirable precursors, or reduce undesirable metabolism.
  • down-regulation of genes in the host may be desired e.g. to reduce undesirable metabolism or fluxes which might impact on glycosylated triterpene yield.
  • Such down regulation may be achieved by methods known in the art, for example using anti-sense technology.
  • a nucleotide sequence is placed under the control of a promoter in a "reverse orientation" such that transcription yields RNA which is complementary to normal mRNA transcribed from the "sense" strand of the target gene.
  • An alternative to anti-sense is to use a copy of all or part of the target gene inserted in sense, that is the same, orientation as the target gene, to achieve reduction in expression of the target gene by co-suppression.
  • van der Krol et al. (1990) The Plant Cell 2, 291-299; Napoli et al., (1990) The Plant Cell 2, 279-289; Zhang et al., (1992) The Plant Cell 4, 1575-1588, and US-A-5,231 ,020.
  • dsRNA Double stranded RNA
  • RNAi RNA interference
  • RNA interference is a two step process.
  • dsRNA is cleaved within the cell to yield short interfering RNAs (siRNAs) of about 21-23nt length with 5' terminal phosphate and 3' short overhangs ( ⁇ 2nt)
  • siRNAs target the corresponding mRNA sequence specifically for destruction (Zamore P.D. Nature Structural Biology, 8, 9, 746-750, (2001 )
  • miRNA miRNA
  • stem loop precursors incorporating suitable oligonucleotide sequences, which sequences can be generated using well defined rules in the light of the disclosure herein.
  • TTG polypeptides may be employed in fermentation via expression in microorganisms such as e.g. E.coli, yeast and filamentous fungi and so on.
  • microorganisms such as e.g. E.coli, yeast and filamentous fungi and so on.
  • one or more newly characterised TTG sequences of the present invention may be used in these organisms in conjunction with one or more other biosynthetic genes.
  • In vivo methods are describe extensively above, and generally involve the step of causing or allowing the transcription of, and then translation from, a recombinant nucleic acid molecule encoding the TTG polypeptides.
  • the TTG polypeptides may be used in vitro, for example in isolated, purified, or semi-purified form. Optionally they may be the product of expression of a recombinant nucleic acid molecule.
  • Example acceptors include the the b-amyrin derivatives oleanolic acid, hederagenin and 18b- glycyrrhetinic acid, which all have the pentacyclic C-30 b-amyrin scaffold.
  • AsAAT 1 is able to utilise other oxygenated b-amyrin derivatives. This was done by generating different oxygenated b-amyrin scaffolds using combinatorial synthesis:
  • AsAATI was also shown to be active towards the triterpenoid scaffold dammarenediol II and the oxygenated form of this, protopanaxadiol, which is the precursor of bioactive ginsenosides.
  • the dammarenediol II scaffold is distinct from the b-amyrin scaffold in that it is C-30 but tetracyclic rather than pentacyclic.
  • TTG-genes of the present invention also provides novel methods of plant breeding and selection, for instance to manipulate phenotypes such as disease resistance, or flavours.
  • a further aspect of the present invention provides a method for assessing the
  • glycosylated triterpene biosynthesis phenotype of a plant comprising the step of determining the presence and/or identity of a terpene glycosylating encoding allele therein comprising the use of a TTG nucleic acid as described above.
  • a diagnostic test may be used with transgenic or wild-type plants, and such plants may or may not be mutant lines e.g. obtained by chemical mutagenesis.
  • diagnostic tests for alleles allows the researcher or plant breeder to establish, with full confidence and independent from time consuming biochemical tests, whether or not a desired allele is present in the plant of interest (or a cell thereof), whether the plant is a representative of a collection of other genetically identical plants (e.g. an inbred variety or cultivar) or one individual in a sample of related (e.g. breeders’ selection) or unrelated plants.
  • nucleic acid or polypeptide diagnostics for the desirable allele or alleles in high throughput, low cost assays as provided by this invention reliable selection for the preferred genotype can be made at early generations and on more material than would otherwise be possible. This gain in reliability of selection plus the time saving by being able to test material earlier and without costly phenotype screening is of considerable value in plant breeding.
  • Nucleic acid-based determination of the presence or absence of one or more desirable alleles may be combined with determination of the genotype of the flanking linked genomic DNA and other unlinked genomic DNA using established sets of markers such as RFLPs, microsatellites or SSRs, AFLPs, RAPDs etc. This enables the researcher or plant breeder to select for not only the presence of the desirable allele but also for individual plant or families of plants which have the most desirable combinations of linked and unlinked genetic background. Such recombinations of desirable material may occur only rarely within a given segregating breeding population or backcross progeny.
  • Direct assay of the locus as afforded by the present invention allows the researcher to make a stepwise approach to fixing (making homozygous) the desired combination of flanking markers and alleles, by first identifying individuals fixed for one flanking marker and then identifying progeny fixed on the other side of the locus all the time knowing with confidence that the desirable allele is still present.
  • antibodies raised to a TTG polypeptide or peptide of the invention are provided.
  • Purified protein according to the present invention or a fragment, mutant, derivative or variant thereof, e.g. produced recombinantly by expression from encoding nucleic acid therefor, may be used to raise antibodies employing techniques which are standard in the art.
  • Antibodies and polypeptides comprising antigen-binding fragments of antibodies may be used in identifying homologues from other species as discussed further below.
  • Methods of producing antibodies include immunising a mammal (e.g. human, mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof.
  • Antibodies may be obtained from immunised animals using any of a variety of techniques known in the art, and might be screened, preferably using binding of antibody to antigen of interest. For instance, Western blotting techniques or immunoprecipitation may be used (Armitage et al, 1992, Nature 357: 80-82). Antibodies may be polyclonal or monoclonal.
  • antibodies with appropriate binding specificity may be obtained from a recombinantly produced library of expressed immunoglobulin variable domains, e.g. using lambda bacteriophage or filamentous bacteriophage which display functional immunoglobulin binding domains on their surfaces; for instance see W092/01047.
  • Antibodies raised to a polypeptide or peptide can be used in the identification and/or isolation of homologous polypeptides, and then the encoding genes.
  • Antibodies may be modified in a number of ways. Indeed the term“antibody” should be construed as covering any specific binding substance having a binding domain with the required specificity. Thus, this term covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including any polypeptide comprising an immunoglobulin binding domain, whether natural or synthetic.
  • the nucleotide sequence information provided herein may be used to design probes and primers for probing or amplification.
  • An oligonucleotide for use in probing or PCR may be about 30 or fewer nucleotides in length (e.g. 18, 21 or 24). Generally specific primers are upwards of 14 nucleotides in length. For optimum specificity and cost effectiveness, primers of 16-24 nucleotides in length may be preferred.
  • probing can be done with entire restriction fragments of the gene disclosed herein which may be 100's or even 1000's of nucleotides in length. Small variations may be introduced into the sequence to produce‘consensus’ or‘degenerate’ primers if required.
  • Probing may employ the standard Southern blotting technique. For instance DNA may be extracted from cells and digested with different restriction enzymes. Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probe may be hybridised to the single stranded DNA fragments on the filter and binding determined. DNA for probing may be prepared from RNA preparations from cells. Probing may optionally be done by means of so-called ‘nucleic acid chips’ (see Marshall & Hodgson (1998) Nature Biotechnology 16: 27-31 , for a review).
  • a variant encoding a TTG polypeptide in accordance with the present invention is obtainable by means of a method which includes:
  • test nucleic acid may be provided from a cell as genomic DNA, cDNA or RNA, or a mixture of any of these, preferably as a library in a suitable vector. If genomic DNA is used the probe may be used to identify untranscribed regions of the gene (e.g. promoters etc.), such as are described hereinafter,
  • probes may be radioactively, fluorescently or enzymatically labelled.
  • Other methods not employing labelling of probe include amplification using PCR (see below), RN’ase cleavage and allele specific oligonucleotide probing.
  • the identification of successful hybridisation is followed by isolation of the nucleic acid which has hybridised, which may involve one or more steps of PCR or amplification of a vector in a suitable host.
  • Preliminary experiments may be performed by hybridising under low stringency conditions.
  • preferred conditions are those which are stringent enough for there to be a simple pattern with a small number of hybridisations identified as positive which can be investigated further.
  • Hybridization 100 mg/ml denatured, fragmented salmon sperm DNA, 0.05% sodium pyrophosphate and up to 50% formamide. Hybridization is carried out at 37-42°C for at least six hours.
  • filters are washed as follows: (1 ) 5 minutes at room temperature in 2X SSC and 1 % SDS; (2) 15 minutes at room temperature in 2X SSC and 0.1 % SDS; (3) 30 minutes - 1 hour at 37°C in 1X SSC and 1 % SDS; (4) 2 hours at 42-65°C in 1 X SSC and 1 % SDS, changing the solution every 30 minutes.
  • Tm 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex
  • the T m is 57°C.
  • the T m of a DNA duplex decreases by 1 - 1.5°C with every 1 % decrease in homology.
  • targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42°C.
  • Such a sequence would be considered substantially homologous to the nucleic acid sequence of the present invention.
  • suitable conditions include, e.g. for detection of sequences that are about 80-90% identical, hybridization overnight at 42°C in 0.25M Na 2 HP0 4 , pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 55°C in 0.1X SSC, 0.1 % SDS.
  • suitable conditions include hybridization overnight at 65°C in 0.25M Na2HP04, pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 60°C in 0.1X SSC, 0.1 % SDS.
  • hybridization of a nucleic acid molecule to a variant may be determined or identified indirectly, e.g. using a nucleic acid amplification reaction, particularly the polymerase chain reaction (PCR).
  • PCR requires the use of two primers to specifically amplify target nucleic acid, so preferably two nucleic acid molecules with sequences characteristic of a TTG gene of the present invention are employed.
  • RACE PCR only one such primer may be needed (see "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, Academic Press, New York, (1990)).
  • a method involving use of PCR in obtaining nucleic acid according to the present invention may include:
  • clones or fragments identified in the search can be extended. For instance if it is suspected that they are incomplete, the original DNA source (e.g. a clone library, mRNA preparation etc.) can be revisited to isolate missing portions e.g. using sequences, probes or primers based on that portion which has already been obtained to identify other clones containing overlapping sequence.
  • the original DNA source e.g. a clone library, mRNA preparation etc.
  • Nucleic acid may include cDNA, RNA, genomic DNA and modified nucleic acids or nucleic acid analogs (e.g. peptide nucleic acid). Where a DNA sequence is specified, e.g. with reference to a figure, unless context requires otherwise the RNA equivalent, with U substituted for T where it occurs, is encompassed. Nucleic acid molecules according to the present invention may be provided isolated and/or purified from their natural environment, in substantially pure or homogeneous form, or free or substantially free of other nucleic acids of the species of origin, and double or single stranded. Where used herein, the term“isolated” encompasses all of these possibilities. The nucleic acid molecules may be wholly or partially synthetic.
  • Nucleic acids may comprise, consist, or consist essentially of, any of the sequences discussed hereinafter.
  • the term "heterologous” is used broadly herein to indicate that the gene/sequence of nucleotides in question (e.g. encoding triterpene-biosynthesis modifying polypeptides) have been introduced into said cells of the host or an ancestor thereof, using genetic engineering, i.e. by human intervention. Nucleic acid heterologous to a host cell will be non-naturally occurring in cells of that type, variety or species.
  • heterologous nucleic acid may comprise a coding sequence of or derived from a particular type of plant cell or species or variety of plant, placed within the context of a plant cell of a different type or species or variety of plant.
  • a nucleic acid sequence may be placed within a cell in which it or a homologue is found naturally, but wherein the nucleic acid sequence is linked and/or adjacent to nucleic acid which does not occur naturally within the cell, or cells of that type or species or variety of plant, such as operably linked to one or more regulatory sequences, such as a promoter sequence, for control of expression.
  • Transformed in this context means that the nucleotide sequences of the heterologous nucleic acid alter one or more of the cell’s characteristics and hence phenotype e.g. with respect to triterpene biosynthesis. Such transformation may be transient or stable.
  • Ranges are often expressed herein as from“about” one particular value, and/or to“about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent“about,” it will be understood that the particular value forms another embodiment.
  • UGT94B1 molecular modeling substantiated by site-specific mutagenesis and biochemical analyses. Plant Physiol 148(3): 1295-1308.
  • FIG. 1 Saponins glycosylation, avenacin pathway.
  • A Structures of two triterpene glycosides, avenacin A-1 from oat, and soyasaponin Ab (from soybean).
  • B Current understanding of the oat avenacin biosynthetic pathway.
  • Avenacin A-1 is synthesised from the linear isoprenoid precursor 2, 3-oxidosqualene.
  • 2,3- Oxidosqualene is cyclized by the triterpene synthase AsbASI (SAD1 ) to the pentacyclic triterpene b-amyrin (Haralampidis et al., 2001 ).
  • b-Amyrin is then oxidized to 12,13b-epoxy-16b-hydroxy-b-amyrin (ErHbA) by the cytochrome P450 enzyme AsCYP51 H10 (SAD2) (Geisler et al., 2013). Subsequent modifications involve a series of further oxygenations, the addition of a branched trisaccharide moiety at the C-3 position (initiated by introduction of an L-arabinose), and acylation at the C-21 position.
  • FIG. 1 Phylogenetic tree of GT 1 glycosyltransferases expressed in A. strigosa root tips. Predicted amino acid sequences from oat were aligned with published triterpenoid
  • UGT groups are as defined by Ross, Li, Lim, and Bowles (2001 ). Some of the most common enzyme activities are indicated around the periphery in front of the corresponding branches. The tree was constructed using the Neighbour Joining method with 1000 bootstrap replicates (percentage values shown at branch points). The scale bar indicates 0.1 substitutions per site at the amino acid level.
  • Tissues were collected from the root tips (RT), elongation zone (EZ), whole root (WR) and leaves (L).
  • RT root tips
  • EZ elongation zone
  • WR whole root
  • L leaves
  • avenacin biosynthetic gene AsUGT74H5 Sad10
  • GAPDH glyceraldehyde 3-phosphate dehydrogenase
  • FIG. 3 Biochemical characterisation of candidate oat UGTs.
  • A In vitro assays to investigate sugar donor specificity. Recombinant UGTs were incubated overnight with 100 mM of 2,4,5-trichlorophenol (TCP) and various sugar nucleotide donors (400 mM UDP-Ara, UDP-GIc or UDP-Gal). Red, blue and yellow bars represent the conversion of TCP to TCP glucoside, galactoside and arabinoside, respectively. Height of the bars are drawn relative to the sugar unit showing the highest activity for each UGT (i.e. activity here refers at TCP to TCP glycoside conversion monitored by spectrophotometry at 405 nm).
  • FIG. 4 Biochemical analysis of aat1 mutant and susceptibility to take-all disease.
  • A Structures of the four avenacins. HPLC-CAD analysis of methanolic root extracts from seedlings of the A. strigosa wild type accession and the aat1 mutant (avenacin-deficient mutant line #807). New metabolites detected in the mutant are arrowed and corresponding structures are tentatively drawn based on ion chromatograms presented in Figure 1 1D.
  • B Mutant aat1 has enhanced disease susceptibility. Images of representative seedlings of wild type A. strigosa (WT), the sad1 mutant #610 (Haralampidis et al., 2001 ), and the aat1 mutant. Seedlings were inoculated with the take-all fungus (G. graminis var. tritici). The dark lesions on the roots are symptoms of infection.
  • FIG. 5 A new arabinosyltransferase from Glycine max.
  • A Phylogenetic tree of glycosyltransferases from group D (UGT73s). GmSSAT is highlighted in red as well as AsAATI , and characterised triterpenoid glycosyltransferases in blue.
  • UGT accession numbers and corresponding literature can be found in Table S3. The tree was rooted with UGT90A1 , an Arabidopsis UGT from group C; constructed using the Neighbour Joining method, with 1000 bootstrap replicates (percentage values shown at branch points). The scale bar indicates 0.1 substitutions per site at the amino acid level.
  • a homology model was generated using the online software l-TASSER (Yang et al., 2015) based on the crystal structure of Medicago truncatula UGT71 G1 complexed with UDP-GIc (PDB: 2ACW). The loop shown in orange was reconstructed using MODELLER (Sali & Blundell, 1993). UDP- Ara (green sticks) was inserted into the active site and the complex was relaxed using GROMACS for energy minimisation.
  • C HPLC-CAD chromatograms of extracts from N.
  • Figure 7 Proteomic analysis of A. strigosa root samples.
  • FIG. 9 AsUGT99D1 has activity towards the avenacin pathway intermediate 12,13- epoxy-16-hydroxy ⁇ -amyrin (ErHbA).
  • A GC-MS analysis of extracts from agro-infiltrated Nicotiana benthamiana leaves. Co-expression of SAD1 and SAD2 leads to accumulation of ErHbA (1R 12.9 min). When SAD1 and SAD2 are co-expressed with UGT99D1 , ErHbA is consumed. The upper chromatogram consists of a control from leaves expressing GFP only.
  • B HPLC-charged aerosol detection (CAD) chromatogram of extracts from leaves co- expressing SAD1 , SAD2 and UHT99D1 (black). Traces for in vitro assays of
  • Figure 10 1 H and 13 C NMR of the major product generated by co-expression of SAD1 , SAD2 and UGT99D1 in N. benthamiana.
  • A Mutant line #807 has a single nucleotide variation in AsAATI at base 735 when compared with the wild type gene (a G to A mutation).
  • B Chemotyping of the #807 mutant by TLC. Methanolic extract of roots of 3day-old seedlings were separated by TLC using chloroform:methanol:water (13:6:1 ) as the mobile phase.
  • C TLC separation of root extracts from seedlings of F 2 progeny from a cross between the wild type A. strigosa line and mutant #807. Pictures of the corresponding F 2 seedlings, shown in the lower panel, do not show any obvious root morphology phenotype.
  • FIG. 14 Mutation of AsAATI : purified recombinant enzymes and LCMS analysis of glycosides produced in N. benthamiana tissues expressing AsAATI mutants.
  • FIG. 15 15A Phylogenetic analysis of A. strigosa UGT candidates (red circles) with characterised UGTs from other plant species (listed in Supplementary Table 1 ). Functionally characterised glycoside glycosyltransferases (GGTs) (see
  • Figure 16 Biochemical analysis of recombinant AsUGT91 G16 and AsUGT91 G16 mutants.
  • sad3 mutants (#1139) accumulate mono-deglucosyl avenacins (dark blue trace). Mutants (#85, #543, #1073 and #1473) do not accumulate avenacins but accumulate two major products (18.3 min and 20.5 min) that are less polar than the avenacins (green, dark red, blue and pink traces). Avenacin A-1 standard is shown in red. Figure 16D, Reduced fluorescence of roots of AsUGT91G16 mutants #543 and #1473 compared to wild type (S75) seedlings. Photo credits: Andrew Davis, John Innes Centre sad mutant numbers are as described in Papadopoulou et al. (1999).
  • Figure 17 Biochemical analysis of AsTG.
  • Figure 17A Phylogenetic tree of AsTG with other plant glycosyl hydrolase family 1 proteins.
  • GH1 family members of rice (Opassiri et al., 2006) and Arabidopsis (Xu et al., 2004) were included in the analysis, as well as sequences from other plant species.
  • the phylogenetic clusters that include rice and Arabidopsis sequences (At/Os 1-8) and the Arabidopsis clusters (At I and II) are labelled as designated in Opassiri et al., 2006, in addition to the monocot plastid b-glucosidases as in Ketudat Cairns et al., 2012.
  • the tree is drawn as an unrooted tree but is rooted by the outgroup, At/Os 8, which contains the chloroplastic A.
  • Enzymes with reported transglycosylase activity are indicated (blue circles) and the Avena strigosa AsTG is highlighted (red circle).
  • Figure 17B RT-PCR expression profile of AsTG.
  • the profile of the previously characterised AsbASI ( Sadi ) gene and the housekeeping oat glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) gene were included as positive controls.
  • Oat tissues used are illustrated: root tips (RT), elongation zone (EZ), whole roots (WR) and young leaves (L). RNA was extracted from 3-day-old A.
  • FIG. 17C HPLC-UV-MS analyses of the enzymatic reactions with 4-nitrophenyl b-d-glucoside and mono-deglucosyl avenacin A-1 with a boiled protein preparation of AsTG (control reaction) and AsTG.
  • Protein preparations for control reactions had been boiled at 95°C for 10 minutes. Data are representative of two separate experiments. Absorbance was measured at 357nm (Begley et al., 1986).
  • Figure 17D HPLC-CAD analysis of extracts from infiltrated N. benthamiana leaves.
  • AsUGT91G16 results in the accumulation of peaks with the mass of 12,13b-epoxy- 16b-hydroxy-b-amyrin-3-0-b-D-glucosyl-[1 ,2]-a-L-arabinose (ErHbA-3-O-Ara-Glu).
  • Figure 18 HPLC-MS analyses of the in vitro enzymatic reactions of AsUGT91 G16 and AsTG.
  • Figure 18A Mass of adducts formed in LC-MS of bis-deglucosyl avenacin A-1 , mono-deglucosyl avenacin A-1 and avenacin A-1 in negative mode;
  • Figure 19A HPLC-MS with Charged Aerosol Detection (CAD) analysis of extracts from infiltrated N. benthamiana leaves expressing AsbASI, AsCYP51H10, AsAATI and AsUGT91G16.
  • Figure 20 Characterisation of avenacin-deficient oat mutants.
  • FIG. 20A Single nucleotide variations in the AsUGT91G16 gene are highlighted for mutants #85 (G963A), #543 (G375A), #1073 (G776A) and #1473 (G775A).
  • FIG. 20B Single nucleotide variations in the AsTG gene are highlighted for sad3 mutants #1139 (G1800A), #105 (G1705A), #368 (G216A) and #891 (C481T).
  • Figure 21 HPLC-IT-ToF analysis of mutant #85 root extract.
  • Figure 21 A Total ion chromatogram (TIC) of the #85 mutant root extract in negative mode shows two major peaks at 2.2 minutes and 2.7 minutes with the mass of avenacin A-2 and avenacin A-1 respectively with the loss of a hexose and the loss of the oxidation at the C-30 position.
  • Figure 22 Representative take-all disease symptoms of WT and sad mutants.
  • the disease resistance of homozygous AsUGT91G16 mutant lines to the take-all pathogen G. graminis var. tritici isolate T5 was compared to wild type A. strigosa S75 seedlings; sad1 mutants, which do not synthesise avenacins (Haralampidis et al., 2001 ); AsAATI mutants, which accumulate avenacin
  • Figure 4A representative take-all disease symptoms of WT and sad mutants. Photo credit: Andrew Davis, John Innes Centre.
  • Figure 22B graph of distribution of take-all disease severity for the different lines.
  • Figure 23 Analysis of N. benthamiana leaf extracts expressing tHMGR, AsbASI, AsCYP51H10, AsAATI, AsUGT91G16 and AsTG by HPLC-CAD.
  • AsbASI cyclises 2,3-oxidosqualene to form b-amyrin (Haralampidis et al., 2001 ), which is insufficiently polar to be detected in the HPLC analysis.
  • AsbASI and AsCYP51 H10 form the triterpene compound, 12,13b-epoxy-16b-hydroxy-b-amyrin (ErHbA) (Haralampidis et al., 2001 ; Qi et al., 2006).
  • AsUGT91G16 resulted in the accumulation of new peaks with the mass of 12,13b- epoxy-16 b-hydroxy-b-amyrin-3-0-b-d-glucosyl-[1 ,2]-a-L-arabinose (EpHbA-3-O-Ara- Glu) (dark blue triangles).
  • the activity of AsUGT91 G16 is dependent on the arabinosyltransferase AsAATI , as co-expression of a combination of AsbASI, AsCYP51H10 and AsUGT91 without AsAATI results only in ErHbA.
  • FIG. IS internal standard (digitoxin).
  • Figure 24 AsGH1 and characterised transglucosidases have predicted N-terminal targeting sequences. N-terminal section of the full-sequence alignment between AsGH1 (AsTG) and the GH1 transglucosidases: BAM29304 AaAA7GT, from
  • Figure 25 Fluorescent protein fusions of AsUGT91 G16 and AsTG are catalytically active in N. benthamiana.
  • Figure 25A GFP-tagged AsUGT91 G16 fusion constructs (GFP:AsUGT91 and AsUGT91 :GFP) are active in N. benthamiana and accumulate the same compounds as AsUGT91 G16 (AsUGT91 ) with no fluorescent tag.
  • Figure 27 AsTG localises to the vacuole and the apoplast in N. benthamiana leaves. Co-expression of an N-terminal GFP fusion to AsUGT91 G16 (GFP:AsUGT91 G16): ( Figure 27A), alone; ( Figure 27B), with AsTG:RFP, and ( Figure 27C), with NOSIG- AsTG:RFP. An RFP fusion to AsTG localises to the vacuole and the apoplast (white arrow) and does not co-localise with a GFP fusion protein to AsUGT91 in the cytoplasm.
  • Partial secretion to the apoplast may be due to the saturation of the vacuolar targeting machinery (daSilva et al., 2005; Frigerio et al., 1998; Pereira et al., 2013).
  • An RFP fusion to AsTG without the N-terminal signal peptide (NOSIG- AsTG:RFP) co-localises with the GFP fusion to AsUGT91 in the cytoplasm and nucleus. No signal is seen in the RFP channel when no RFP construct is co- infiltrated.
  • Figure 28 AsTG is targeted to the endomembrane system and traffics through the ER.
  • Co-expression of an C-terminal GFP fusion to AsTG (AsTG:GFP) with: ( Figure 28A), free RFP (35S:mRFP (Moglia et al., 2014)); ( Figure 28B), ER:mCherry (ER-rk CD3-959 (Nelson et al., 2007)), and (Figure 28C), GolgkmCherry (G-rk CD3-967 (Nelson et al., 2007)).
  • Figure 29 Acceptor promiscuity revealed by AsAAT 1 in vitro assays.
  • AsAATI is active over triterpenoid acceptors in the presence of UDP-Ara.
  • Recombinant AsAAT 1 (200 ng) was incubated over night with triterpenoid acceptors (200pM) and each of the 3 sugar donors (UDP-Ara, UDP-GIc and UDP-Gal; 400pM). The assays were analysed by TLC after overnight incubation at 30C. The TLC was stained with 10% sulfuric acid in methanol and the picture was taken under UV.
  • B TLC analysis of UGT99D1/ AsAAT 1 activity over triterpenoid and steroid acceptors.
  • Recombinant AsAAT 1 (1.5 mg) was incubated over night with triterpenoid acceptors (200 pM) and UDP-Ara (500 pM). The assays were analysed by TLC. The TLC was stained with 10% sulfuric acid in methanol and the picture was taken under UV.
  • Yellow arrows are pointing toward major products, white arrows are pointing towards presumed minor products.
  • Figure 30 Combinatorial biosynthesis of arabinosylated oleanane triterpenoids in N. benthamiana.
  • Figure 31 Production of new-to-nature ginsenosides in N. benthamiana.
  • Example 1 Identification of candidate UGTs expressed in oat root tips
  • Avenacin A-1 is synthesised and accumulates in the epidermal cells of oat root tips.
  • the avenacin biosynthetic genes that have been characterized to date are all expressed specifically in this part of the root (Haralampidis et al., 2001 ; Mugford et al., 2009), suggesting that the whole biosynthetic pathway may perhaps take place in this cell type.
  • the mRNA used to generate this transcriptome resource was extracted from the terminal 0.5 cm of the root tips of young oat seedlings, i.e. from avenacin-producing tissues.
  • Representative UGT sequences from each of the 21 subfamilies of plant UGTs present in Arabidopsis were used as query sequences (Table S2). The resulting hits were then assessed manually using alignment tools to eliminate redundant sequences. A total of -100 unique UGT-like sequences were identified, 36 of which were predicted to
  • the UGTs were expressed as recombinant N-terminal 9xhistidine-tagged proteins in Escherichia coli.
  • protein preparations enriched for the recombinant enzymes were prepared using Immobilized Metal Affinity Chromatography (IMAC, Figure 8 A). The resulting preparations were incubated with each of three sugar donors [UDP-GIc, UDP-a-D-galactose (UDP-Gal) or UDP-Ara] and 2,4,5-trichlorophenol (TCP).
  • IMAC Immobilized Metal Affinity Chromatography
  • TCP was chosen as a universal acceptor in these assays because previous studies have shown that many UGTs are able to glycosylate TCP as well as their natural acceptor (Messner, Thulke, & Schaffner, 2003). The previously characterized oat /V-methyl anthranilate
  • AsUGT99D1 showed a preference for UDP-Ara. This enzyme did not give any detectable product when UDP-Gal or UDP-GIc were supplied as potential sugar donors. The other UGTs showed a preference for UDP-GIc and so are likely to be glucosyltransferases.
  • benthamiana leaves enables rapid production of milligram to gram-scale amounts of simple and oxygenated triterpenes (Geisler et al., 2013; Mugford et al., 2013; Reed et al., 2017).
  • This system to carry out functional analysis of the candidate avenacin arabinosyltransferase enzyme AsUGT99D1 in planta.
  • the AsUGT99D1 coding sequence was introduced into a Gateway-compatible pEAQ- Destl vector for co-expression with earlier enzymes in the avenacin pathway.
  • AsUGT99D1 is the missing avenacin arabinosyltransferase (hereafter named AsAATI ).
  • Biochemical characterisation of AsAATI suggests a relative promiscuity of this enzyme towards acceptors; AsAAT 1 glycosylates early intermediates of the avenacin pathway as well as later ones (e.g. ErHbA and deglycosylated avenacin).
  • AsAATI seems strictly restricted to UDP-Ara; very little activity was detected with UDP-GIc and no activity with UDP-Gal.
  • Example 4 Mutation at AsAATI results in compromised avenacin production and enhanced susceptibility to take-all disease in oats: identification of AATs in other plant species
  • Avenacin A-1 is the major avenacin found in oat roots. However, three other closely related forms of avenacin, harbouring the same trisaccharide sugar chain, are also present in oat root extracts. These are the minor UV fluorescent form B-1 and the non-fluorescent avenacins A-2 and B-2.
  • mutant aat1 accumulates the avenacin aglycone lacking the acyl group and the C-30 aldehyde (structure shown in Fig.4A).
  • the other new peak (f R 6.3 min) has a molecular weight that corresponds to the first product plus two hexoses (814.5 Da) ( Figure 1 1D, right panel).
  • a corresponding monoglucoside could also be detected at 7.7 min (652.4 Da) ( Figure 11 D, central panel).
  • aat1 mutant accumulates the avenacin aglycone lacking the acyl group and the C-30 aldehyde.
  • avenacin C-30 oxidase may requires glycosylation of the scaffold prior to come in action.
  • the other more polar products may be a result of modification of this intermediate by non-specific glycosyltransferases in the absence of the functional AsAATI arabinosyltransferase.
  • Avenacins are still detected in aat1 mutant suggesting that another oat enzyme is partially redundant with AsAAT 1.
  • No homologues of AsAAT 1 were present in our oat root tip transcriptome database.
  • Future sequencing of the oat genome may reveal another oat arabinosyltransferase.
  • Activity redundancy coupled with modification of aat1 intermediate i.e. addition of hexoses; Figure 4 A) may alleviate accumulation of toxic intermediates preventing root phenotype seen in the other avenacin mutants affected in glycosylation (Mylona et al., 2008).
  • F 2 lines that were homozygous for the aat1 mutation did not have any obvious root phenotype other than reduced fluorescence, indicating that mutation of AsAATI is unlikely to affect root growth and development (Figure 11 C).
  • GmSSAT involvement in soyasaponins biosynthesis remains to be elucidated.
  • the predicted natural acceptor of GmSSAT nonacetylated nonarabinosylated
  • soyasaponin A0-ag is not commercially available and soyasaponin I is missing the C-21 hydroxyl group unique to group A soyasaponins (C-22 glycosylated saponins in soybean).
  • Co-expression of GmSSAT with known soyasaponin pathway genes especially in soybean pods where soyasaponins accumulates suggest a potential role of GmSSAT in this pathway ( Figure 13 B).
  • the arabinosyltransferase involved in soyasaponins pathway is initializing the assembly of the C-22 sugar chain present in group A saponins.
  • GmSSAT gene may be a very good target for breeders to obtain non-bitter varieties.
  • the N5 loop has been shown to be involved in sugar specificity of UGT71 G1 , UGT74F2/4 or UGT88D7 (He, Wang, & Dixon, 2006; Kubo et al., 2004; Noguchi et al., 2009).
  • a homology model was generated using the online software l-TASSER (Yang et al., 2015) as well as MODELLER (Sali & Blundell, 1993) to refine the N-terminal loop of AAT 1 PSPG motif. Docking of UDP-Ara into the sugar donor binding site of AsAATI was consistent with the arabinoside moiety of UDP-Ara having a hydrogen-bond to His404 and a hydrophobic interaction with Pro154 ( Figure 6S).
  • Glucosyltransferase activity being nearly 10-fold higher in AsAATI -P154S-H404Q than wild type enzyme while arabinosyltransferase activity decreases dramatically (30 times slower).
  • H404 galactosyltransferases and arabinosyltransferases
  • Direct interaction of H404 with C-4 of the hemiacetal ring is not suggested by the 3D model but the two extra residues present upstream of H404 render the modelling of the PSPG C-terminus precarious.
  • H404 may also modify the orientation of the hemiacetal ring indirectly impacting selectivity for the C-4 stereochemistery.
  • Molecular modelling suggests that P154 is in close proximity with CH 2 at C-5 position of UDP-Ara, modifying this residue seems to affect selectivity of pentoses versus hexoses shown by AsAAT 1.
  • the steric constraint / hydrophobic interaction with C-5 of pentoses potentially provided by the proline may also prevent C-6 accommodation of hexoses.
  • Replacement of proline 154 by a serine could allow formation of a hydrogen bond with C-6 hydroxyl group of glucose or galactose.
  • Harnessing glycosylation is key to fully exploit the modulations of bioactivity, solubility, cellular compartmentalisation brought by sugar moieties. It is especially important to understand how family 1 GTs work. This requires further insights into acceptor glycosylation regiospecificity and sugar donor preference, which are the main attributes of plant family 1 GTs (Vogt & Jones, 2000).
  • H404 and P154 residues prove to be essential for arabinosylation specificity shown by monocot UGT AsAATI . Mutation of these two residues is enough to modify sugar specificity back to glucose, specificity that can be considered as the ancestral specificity displayed by plant UGTs.
  • H404 is the final residue of UGTs signature motif (PSPG) and is conserved in all three characterised
  • AsAAT 1 proves to have a pivotal role for the sugar chain assembly of the antifungal compound avenacin. Its role in the avenacin pathway is supported by converging biochemical and physiological evidences.
  • AsAATI UGT99D1
  • UGT99D1 the first UGT99 to be functionally characterised or described in literature. This is also the first monocot enzyme from the extended plant UGT group D (including UGT73, UGT99, UGT701 and UGT98) characterised to date.
  • RNA and cDNA preparation The cDNA used for amplification and subsequent cloning (method is described in Example 10) of the selected oat UGT genes as well as expression profile analysis was generated from 3 day-old tissues of A. strigosa seedlings (accession S75). Total RNA was extracted using the RNeasy Plant Mini kit (Qiagen). First-strand cDNA synthesis was carried out from 1 mg of DNase-treated RNA using Superscript II Reverse Transcriptase (Invitrogen).
  • Trichlorophenol glycosylation assays Reactions were carried out in a total volume of 75 mI_, composed of 100 mM TRIS-HCI pH 7, 100 mM 2,4,5-trichlorophenol (TCP) and 200 mM uridine diphospho sugars [UDP-oD-glucose, UDP-oD-galactose or UDP-b-L-arabinopyranose (see Table S7 for suppliers)]. Reactions were initiated by addition of 1 mg of enriched recombinant enzyme (obtained as detailed in Example 10) to pre-warmed reaction mixes, and incubated overnight at 28 °C before stopping with 3.5 mI_ trichloroacetic acid 6.1 N. Proteins were precipitated by centrifugation at 21 ,000 g for 10 min at 4 °C. Supernatants were stored at -20 °C prior to analysis by HPLC-UV (method A described in Example 10).
  • avenacin A-1 Hydrolysis and partial reglycosylation of avenacin A-1.
  • Purified avenacin A-1 (Table S7) was hydrolysed in 1 M HCI for 15 min at 99 °C, with shaking at 1400 rpm. The preparation was then cooled on ice and buffered with 1 :1 (v:v) unequilibrated TRIS 1 M. The hydrolysed sample was extracted twice by ethyl acetate, and the combined organic extracts were dried under N 2 flux and resuspended in dimethyl sulfoxide. The resulting hydrolysed avenacin A-1 (approx. 100 mM in 50 mI_ reaction volume) was incubated with 500 mM UDP-Ara and 2 mg purified recombinant
  • Root tissues were ground using a homogenizer (2010 Geno/Grinder, SPEX SamplePrep) and extracted with methanol following the method described for analysis of triterpenoid glycosides in N. benthamiana leaf extracts, detailed in Example 10. Filtered methanolic samples were diluted three-fold in 50% methanol and analysed by LC-MS-CAD-fluorescence (method D described in Example 10).
  • Pathogenicity tests to assess root infection with the fungal pathogen Gaeumannomyces graminis var. tritici isolate T5 were carried out as described previously (Papadopoulou et al., 1999). Seedlings were scored after 3- week incubation for root lesions using a 7-point scale.
  • Enzymatic assays with soybean recombinant enzymes were ordered as synthetic genes, cloned into expression vector. The recombinant enzymes were purified as described in Example 10. Enzyme assays were carried out in 100 mL reaction volumes consisting of 50 mM TRIS-HCI pH 7.5, 100 mM of soyasaponin I (Table S7) and 300 mM uridine diphospho sugars (UDP-a-D-glucose, UDP-a-D-galactose or UDP- b-L-arabinopyranose; see Table S7).
  • reaction products were analysed by HR-MS following method E described in Example 10.
  • Example 10 ( Figure 14 A). Optimal catalytic conditions for AsAATI were observed at pH 6.5. Reactions were made in 55 mI_ volume at 25 °C and time points were taken under steady-state conditions transferring 10 mI_ reaction mix into 55 mI_ glacial 10% TCA to stop the reaction. A volume of 10 mL sugar donor mix (5 mM of UDP-Ara, UDP-GIc, UDP-Xyl or UDP-Gal) was added to pre-warmed enzyme mix composed of 30 mM deglycosylated avenacin A-1 dissolved in 0.5 mM methyl-b-cyclodextrin (substrate inhibition observed over 30 mM [acceptor]).
  • sugar donor mix 5 mM of UDP-Ara, UDP-GIc, UDP-Xyl or UDP-Gal
  • pre-warmed enzyme mix composed of 30 mM deglycosylated avenacin A-1 dissolved in 0.5 mM methyl
  • UGT94B1 molecular modeling substantiated by site-specific mutagenesis and biochemical analyses. Plant Physiol.
  • Kemen AC et al. (2014) Investigation of triterpene synthesis and regulation in oats reveals a role for beta-amyrin in determining root epidermal cell patterning. Proc Natl Acad Sci U S A 1 11 (23):8679-8684.
  • the unrooted phylogenetic tree was constructed using MEGA 5 (http://www.megasoftware.net/) by the neighbor-joining method with 1000 bootstrap replicates.
  • Protein samples (8 mg) were denatured at 95 °C for 15 min in the presence of Nupage reducing agent (Invitrogen) and separated using a precast polyacrylamide gel (Nupage 4-12% Bis-TRIS, Invitrogen) in 3-(/V-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen).
  • Nupage reducing agent Invitrogen
  • MOPS 3-(/V-morpholino)propanesulfonic acid
  • Peptides were extracted from the gels and analysed by LC-MS/MS on an Orbitrap- FusionTM mass spectrometer (Thermo Fisher, Hemel Hempstead, UK) equipped with an UltiMateTM 3000 RSLCnano System using an Acclaim PepMap C18 column (2 pm, 75 pm c 500 mm, Thermo). Aliquots of the tryptic digests were loaded and trapped using a pre-column which was then switched in-line to the analytical column for separation. Peptides were eluted with a gradient of 5-40% acetonitrile in water/0.1% formic acid at a rate of 0.5% min 1 .
  • the column was connected to a 10 pm SilicaTipTM nanospray emitter (New Objective, Woburn, MA, USA) for infusion into the mass spectrometer.
  • RNA- reverse transcription-PCR mRNA- reverse transcription-PCR
  • cDNA was generated from 3-day-old tissues of the whole root (WR), root tip (RT, last 0.2 cm of the root), root elongation zone (EZ, from 0.2 cm to the first root hair) and young leaves (L).
  • Transcript levels of the housekeeping gene encoding glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) was used to normalize the cDNA libraries over the 4 tissues.
  • GAPDH glyceraldehyde-3-phosphate dehydrogenase
  • the previously characterised avenacin biosynthetic gene AsUGT74H5 ( Sad10 ) (ref) was included as a control.
  • Gene-specific primers used for PCR amplification are listed in Table S8.
  • Selected transformants were cultured in liquid Lysogeny Broth (LB) media under kanamycin/chloramphenicol (100 mg/mL and 35 mg/mL respectively) selection overnight at 37 °C. Pre-cultures were diluted 100-fold into fresh medium to initiate the cultures for induction. Production of recombinant enzymes was induced at 16 °C overnight with 0.1 pM of Isopropyl b-D-l- thiogalactopyranoside (IPTG) after 30 min of acclimation, and bacterial cells harvested by centrifugation at 4000 g for 10 min.
  • IPTG Isopropyl b-D-l- thiogalactopyranoside
  • Pellets were lysed enzymatically by resuspension and incubation at room temperature for 30 min in lysis buffer (50 mM TRIS pH 7.5, 300 mM NaCI, 20 mM imidazol, 5% glycerol, 1 % Tween 20 (Sigma), 10 mM b-mercaptoethanol, EDTA free protease inhibitor (Roche), 1 mg. ml 1 lysozyme (Lysozyme human, Sigma)). DNAse treatment was performed at room temperature for 15 min using deoxyribonuclease I from bovine pancreas (Sigma).
  • Sonication of the lysate was performed on ice (3 x 10 s, amplitude 16; Soniprep 150 Plus, MSE). Soluble fractions were then harvested by centrifugation (21 ,000 g, 4 °C, 20 min) and filtered through 0.22 pm diameter filters (Millipore).
  • the soluble protein fraction was enriched for the His-tagged recombinant enzymes using nickel-charged resin (Ni- NTA agarose resin, Qiagen).
  • Ni-NTA resin 300 mL pre-equilibrated with buffer A (300 mM NaCI, 50 mM TRIS-HCI pH 7.5, 20 mM Imidazol, 5% glycerol) was incubated 30 min at 4 °C with the protein extract.
  • Protein samples were aliquoted and flash-frozen in liquid nitrogen prior to storage at - 80 °C.
  • Reactions 50 mL comprised 100 mM TRIS-HCI pH 7.5, 200 pM of triterpenoid (see Table S7 for suppliers) and 500 pM uridine diphospho sugars [UDP-a-D-glucose (UDP-GIc), UDP- a-D-galactose (UDP-Gal) or UDP ⁇ -L-arabinopyranose (UDP-Ara); see Table S7 for suppliers].
  • Reactions were started by addition of 1 mg of enriched recombinant enzyme to the pre-warmed reaction mix and incubated overnight at 25 °C with shaking at 300 rpm. Reactions were stopped by partitioning twice the sample in 100 pl_ ethyl acetate. The organic phase was dried under N 2 flux and resuspended in 20 mI_ methanol for analysis.
  • TLC analysis of triterpenoid glycosides TLC plates were spotted with 10 mL of a methanolic sample. TLC plates were pre-run 3 times in 100% methanol 0.5 cm above the loading line prior to elution with the mobile phase dichloromethane:methanol:H 2 0 (80:19:1 ; v:v:v). Plates were sprayed with methanoksulfuric acid (9:1 ) and heated to 130 °C for 2-3 min until coloration appeared. Photographs were taken under UV illumination at 365 nm. The organic phase was dried under N 2 flux and resuspended in 20 mL methanol for analysis.
  • Co-infiltration were prepared by mixing equal volumes of bacterial solutions previously diluted down to 0.8 ODeoo nm ; GFP was used as a control or included in combination in place of a gene to have comparable bacterial density between infiltrations of the same experiment.
  • N. benthamiana leaves were harvested 6 days after agro-infiltration and freeze-dried. Freeze-dried leaf material (20 mg) was ground twice at 20 c.s -1 for 30 s (TissueLyser, Qiagen). Extractions were carried out in 1 mL 80% methanol with 20 mg of digitoxin (internal standard; Sigma) for 20 min at 90 °C, with shaking at 1400 rpm (Thermomixer Comfort, Eppendorf). Samples were centrifuged at 10,000 g for 5 min and 0.8 mL of the supernatant partitioned twice with 0.3 mL of hexane.
  • aqueous phase was dried in vacuo (EZ-2 Series Evaporator, Genevac). Dried material was resuspended in 0.5 mL distilled water and partitioned twice with 0.5 ml of ethyl acetate. The organic phase was dried in vacuo and resuspended in 150 mL of methanol followed by filtration (0.2 pm, Spin-X, Costar). Filtered samples were transferred to glass vials and 50 mL of water added. Samples were analysed by HPC-CAD following method C.
  • Agro-infiltration of N. benthamiana leaves for co-expression of SAD1 , SAD2 and UGT99D1 was carried out by vacuum infiltration of 44 N. benthamiana plants following published methods (Reed et al., 2017). The plants were harvested 6 days later and the leaves lyophilized. Dried leaf material was ground to a powder using a mortar and pestle and processed by pressurized extraction as described previously (Reed et al., 2017). The extraction method consisted of an initial hexane cycle (5 min pressure holding at 130 bars followed by 3 min discharge, extraction cells being heated at 90 °C) to remove chlorophylls and apolar pigments. The following 5 cycles were done with ethyl acetate and were used for further purification.
  • the crude extract was dried by rotary evaporation before being resuspended in 80% aqueous methanol.
  • the methanolic extract was then partitioned in n-hexane (1 :1 ) three times until most of the remaining chlorophyll had been removed.
  • the resulting methanolic sample was dried by rotary evaporation together with diatomaceous earth to allow dry-loading of the flash chromatography column (Celite 545 AW, Sigma). Purification was performed using an Isolera One (Biotage) automatic flash purification system. The crude solid was subjected to normal phase flash
  • the fractions containing the ErHbA-Ara were identified by TLC and pooled prior to rotary evaporation down to 10 mL. A precipitate was observed in the resulting aqueous sample at 4 °C. The ErHbA-Ara was pelleted by centrifugation at 4000 g for 15 min.
  • Root tips were harvested from 3 day-old seedlings of F 2 progeny from a cross between the avenacin-deficient mutant #807 and the A. strigosa wild type as described by Papadopoulou et al. (1999), incubated in methanol at 50 °C for 15 min with shaking at 1400 rpm, and then put on ice. The methanolic extract was transferred to a new tube, dried under N 2 flux, and resuspended in 50 uL of methanol. Aliquots (5 uL) of each sample was loaded onto TLC plates.
  • A. atlantica accession Cc7277 (IBERS collection, Aberystwyth University) was sequenced by lllumina technology to approximately 38-fold coverage with a number of paired end and mate pair libraries. Assembled contigs were then mapped by survey sequencing of recombinant inbred lines of a population of Cc7277 and the A. strigosa accession Cc7651 (IBERS) (Vickerstaff et al, in preparation). Annotations of contigs linked to the previously identified Sad genes were used to identify potential UGTs and other candidates for components of the avenacin pathway.
  • soyasaponin I arabinoside Semi-preparative HPLC purification of soyasaponin I arabinoside (SSI-Ara) was carried out with an UltiMate 3000 HPLC system (Dionex) combined with a Corona Veo RS Charged Aerosol Detector (CAD) using a Kinetex column 2.6 pm XB-C18 100 A, 50 x 2.1 mm (Phenomenex).
  • a homology model was generated with l-TASSER (Yang et al., 2015) using the crystal structure of Medicago truncatula UGT71 G1 complexed with UDP-GIc as a template (PDB entry: 2ACW) (Shao et al., 2005).
  • This homology model contained a strained loop comprising residues Trp396 to Ser402 due to a 2-residue insertion relative to the template. To identify the most likely conformation for this loop, 20 loop models were generated using the
  • the models were solvated in a cubic periodic box of SPC 3-site water molecules and subjected to 104 steps of energy minimization.
  • the necessary parameters for UDP-Ara were based on those available for uridine, ATP and glucose in the 53a6 forcefield.
  • the optimal model was selected for analysis based on having the best QMEAN score (Benkert, Tosatto, & Schomburg, 2008) and no Ramanchandran or rotamer outliers in the remodelled loop according to the structure validation service, MolProbity (Chen et almony 2010).
  • Mutagenesis of AsAATI Site-directed mutagenesis was performed by PCR amplification using the expression vector pH9GW-AsAAT1 as template and the mutated complementary sequences as primers (Table S8). Mutagenized genes were cloned into the entry vector pDONR207, transferred back into pH9GW expression vector and transformed into E. coli BL21 Rosetta. The recombinant enzymes were purified via IMAC using an AKTA purifier apparatus and quantified with the Bradford method as described in Expression of recombinant UGTs in Escherichia coli, above. Purification of hydrolysed avenacin A-1. AsAATI acceptor, hydrolysed avenacin A-1 , required purification and absolute quantification prior to kinetic analysis.
  • Hydrolysis of purified avenacin A-1 (483 mg, Table S7) was scaled up using the method described previously (/.e., partial re-glycosylation of avenacin A-1 ).
  • the entire sample was directly subjected to reverse phase flash chromatography (SNAP Ci 8 column 12 g, Biotage). Elution was performed with a linear gradient from 65 to 72% methanokwater over 55 CV. Elution of hydrolysed avenacin A-1 was monitored under illumination at 365 nm. Fluorescent fractions were collected, dried via rotary evaporation and subjected to normal phase flash chromatography (column SNAP KP/Sil 30 g, Biotage). The mobile phase was dichloromethane as solvent A and methanol as solvent B. After an initial isocratic phase with 5% B (5 CV), a gradient was set from 5 to 11 % B over 40 CV. Fluorescent fractions were pooled and dried.
  • Method A - HPLC-UV analysis of TCP glycosylation assays Instrument: Dionex UltiMate 3000. Injection volume: 15 mL. Gradient: 20 % [B] from 0 to 1.5 min, 20 % to 50 % [B] from 1.5 to 16 min, 50 % to 95 % [B] from 16 to 16.5 min, 95 % [B] from 16.5 to 18.5 min, 95 % to 20 % [B] from 18.5 to 20 min. Detection: UV 205 nm.
  • Method B Analysis of avenacin A-1 reglycosylation assay using LCMS- fluorescence: Instrument: Prominence HPLC system, RF-20Axs fluorescence detector, single quadrupole mass spectrometer LCMS-2020 (Shimadzu). Injection volume: 5 mL. Gradient: 35 % [B] from 0 to 2 min, 35 % to 50 % [B] from 2 to 12 min, 50 % to 95 % [B] from 12 to 12.5 min, 95 % [B] from 12.5 to 14 min, 95 % to 35 % [B] from 14 to 14.1 min, 35 % [B] from 14.1 to 15 min.
  • Method D Metabolites analysis of oat root tips using LCMS-CAD- fluorescence: Instrument: Prominence HPLC system, RF-20Axs fluorescence detector (Shimadzu), single quadrupole mass spectrometer LCMS-2020 (Shimadzu), Corona Veo RS CAD (Dionex). Injection volume: 10 mI_. Gradient: 20 % [B] from 0 to 3 min, 20 % to 60 % [B] from 3 to 28 min, 60 % to 95 % [B] from 28 to 30 min, 95 % [B] from 30 to 33 min, 95 % to 20 % [B] from 33 to 34 min, 20 % [B] from 34 to 35 min. Detection: fluorescence and charged aerosol (settings identical to previous methods).
  • Method E - HRMS analysis of in vitro reaction with recombinant soybean enzymes Instrument: Prominence HPLC system, IT-TOF mass spectrometer (Shimadzu). Injection volume: 5 mL. Gradient: 20 % [B] from 0 to 2 min, 20 % to 46 % [B] from 2 to 16.5 min, 46 % to 95 % [B] from 16.5 to 17 min, 95 % [B] from 17 to
  • Neg. ESI ionization (capillary temp. 250 °C, nebulizing gas 1.5 L.min 1 , heat block temp. 300 °C, spray voltage -3.5 kV. Energy/collision gas MS2 50 %, MS3 75 %).
  • deglycosylated avenacin A-1 as substrate Instrument: Prominence HPLC system, RF-20Axs fluorescence detector (Shimadzu). Injection volume: 7 mL. Gradient: 40 % [B] from 0 to 2 min, 40 % to 50 % [B] from 2 to 6 min, 50 % to 95 % [B] from 6.5 to 7 min, 95 % [B] from 7 to 7.5 min, 95 % to 20 % [B] from 7.5 to 8 min, 20 % [B] from 8 to 9 min. Detection: fluorescence (Ex 353 nm/Em 441 nm).
  • Triterpenoid extraction and analysis by GC-MS Triterpenoid extraction and analysis by GC-MS. Samples preparation and GC-MS analysis was performed as described previously (Reed et al., 2017). Briefly, approximately 5 mg of dried agro-infiltrated leaf material was saponified in alkaline conditions. Hexane partition was used to remove saponified pigments, the
  • UGT80s and UGT81 s belong to GT28 and therefore does not fall into one of the phylogenetic group defined for GT 1 s.
  • GmSSATI is highlighted in grey.
  • AsllGT93B16 AGAAAGCTGGGTAT CAAAT CCTT GT GAT GT GAGCAA 77.6
  • Sad3 and Sad4 are required for saponin biosynthesis and root development in oat. Plant Cell, 20(1 ): 201-212.
  • the neighbor-joining method a new method for
  • glycosyltransferase locus regulates structural diversity of triterpenoid saponins of soybean. Plant Cell, 24(5): 2123-2138.
  • glucosyltransferases are involved in detoxification of benzoxazinoids in maize. Plant J, 28(6): 633-642.
  • UDP uridine diphosphate
  • UGTs UDP-dependent glycosyltransferases
  • GT1 glycosyltransferase family 1
  • Triterpene glycosides are often accumulated in specific tissues, at different developmental times or in response to abiotic or biotic stress, and additionally the pathway biosynthetic genes are often physically clustered in the genome
  • A. strigosa root tip (terminal 0.5 cm) transcriptome database was available (Kemen et al., 2014) which was used previously in the search for the avenacin arabinosyltransferase (see Example 1 ).
  • this database was searched for UGT sequences by a BLAST (tBLASTn) search using full-length sequences of representative UGTs from every plant UGT subfamily (A-N) (listed in Supplementary Table GS1 ).
  • the oat genome has not yet been sequenced, however a genetic map was available of the Avena A genome constructed by re-sequencing recombinant inbred progeny derived from a cross between two avenacin-producing diploid oat species (A.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Nutrition Science (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates generally to newly characterised enzymes from plant species for use in glycosylation of chemical scaffolds, such as triterpenes (saponins). A protein from oat (Avena strigosa) was identified. The protein, an arabinosyltransferase, uses UDP-arabinose as substrate and adds arabinose to the C-3 position for formation of avenacin.

Description

TRITERPENE GLYCOSYLATION
Technical field
The present invention relates generally to methods and materials for use in glycosylation of chemical scaffolds, such as triterpenes.
Background art
Plants produce a huge array of natural products, many of which are glycosylated (Vetter 2000, Vincken, Heng et al. 2007, Liu, Liu et al. 2013). Glycosylation can play a major role in the structural diversification of secondary metabolites. For example, over 300 glycosides have been reported for the simple flavonol quercetin alone (Reuben, Cseke et al. 2006). Glycosylation modifies the reactivity and solubility of the corresponding aglycones, so influencing cellular localization and bioactivity (Augustin, Kuzina et al.
2011 , Liu, Liu et al. 2013).
Plant natural products are decorated with a variety of different types of sugars and oligosaccharide chains. Studies involving various glycoconjugates of the same scaffold suggest that the identity of the sugar unit can have a major influence on bioactivity. For example, tests of six different monoglycosides of the sesquiterpene a-bisabolol against various cancerous cell lines for cytotoxicity revealed considerable variation in activity, with obisabolol rhamoside being the most active (Piochon, Legault et al. 2009). Similarly, Bernard, Sable et al. (1997) showed that quercetin 3-0-a-L-rhamnopyranosyl-[1 ,6]-b-D- galactopyranoside was five time less effective in stimulating topoisomerase IV-dependent DNA cleavage than quercetin 3-0-oL-rhamnopyranosyl-[1 ,6]-b-D-glucopyranoside, the two flavones differing only in the nature of the sugar unit attached to the C-3 position.
Glycosylation of plant natural products is usually carried out by uridine diphosphate- dependant glycosyltransferases (UGTs) belonging to the carbohydrate-active enzyme (CAZY) GT1 family (Vogt and Jones 2000, Bowles, Lim et al. 2006). These enzymes transfer sugars from uridine diphosphate-activated sugar moieties to small hydrophobic acceptor molecules. Over the last 15 years, considerable effort has been invested in the functional characterisation of multiple UGTs from a variety of plant species. UGTs generally show high specificity for their sugar donors and recognise a single uridine diphosphate (UDP)-activated sugar as their substrate (Kubo, Arai et al. 2004, Bowles,
Lim et al. 2006, Osmani, Bak et al. 2008, Noguchi, Horikawa et al. 2009). Plant UGTs recognise their sugar donors via a motif localized on the C-terminal part of the enzyme. This Plant Secondary Product Glycosyltransferase (PSPG) motif is highly conserved throughout UGT families (Hughes and Hughes 1994, Mackenzie, Owens et al. 1997,
Ross, Li et al. 2001 ). Most characterized plant UGTs use UDP-a-D-glucose (UDP-GIc) as their sugar donor, although UGTs that use alternative sugars have also been reported (Bowles, Lim et al. 2006, Osmani, Bak et al. 2009).
Triterpene glycosides (saponins) are one of the largest and most structurally diverse groups of plant natural products. These compounds are synthesised from the mevalonate pathway and share a common biogenic origin with sterols. They protect plants against pests and pathogens and can determine other agronomically important traits such as flavour. They also have a wide range of potential medicinal and industrial applications (Augustin, Kuzina et al. 201 1 , Sawai and Saito 201 1 ). Saponins commonly have a sugar chain attached at the C-3 position that may consist of up to five sugar molecules, normally D-glucose, D-galactose, L-arabinose, D-glucuronic acid, D-xylose, or L-rhamnose, and sometimes additional sugar chains located elsewhere on the molecule. This glycosylation is critical for many of the bioactive properties of triterpene glycosides (Osbourn 1996, Francis, Kerem et al. 2002).
Despite the importance of glycosylation for the bioactive properties of saponins, the characterization of triterpenoid UGTs has so far been limited. Of the 19 triterpenoid UGTs reported so far, 15 are D-glucosyltransferases. A further three are also hexose
transferases, transferring D-glucuronic acid, D-galactose and L-rhamnose, respectively, while the last transfers the pentose D-xylose (Table S1 ).
Previously we carried out a forward screen for sodium azide-generated mutants of diploid oat ( Avena strigosa) that are unable to synthesise triterpene glycosides known as avenacins (Fig. 1 A) (Papadopoulou, Melton et al. 1999). Avenacins are antimicrobial compounds that are produced in oat roots and that provide protection against attack by soil-borne fungal pathogens, including the causal agent of take-all disease of cereals, Gaeumannomyces graminis v ar. tritici (Papadopoulou, Melton et al. 1999), a disease responsible for major yield losses in all wheat-growing areas of the world. We have subsequently cloned and characterized five of the genes in the avenacin pathway, which form part of a biosynthetic gene cluster (Haralampidis, Bryan et al. 2001 , Owatworakit, Townsend et al. 2012, Geisler, Hughes et al. 2013, Mugford, Louveau et al. 2013). Two of these genes encode enzymes for the biosynthesis and oxidation of the triterpene scaffold ( AsbAS1/Sad1 and AsCYP51 H10/Sad2, respectively) (Haralampidis, Bryan et al. 2001 , Geisler, Hughes et al. 2013). The other three ( AsMT1/Sad9 , AsUGT74H5/Sad10 and AsSCPL1/Sad7) are required for synthesis and addition of the acyl group at the C-21 position (Owatworakit, Townsend et al. 2012, Mugford, Louveau et al. 2013) (Fig. 1 B). Avenacin A-1 has a branched sugar chain at the C-3 position. This sugar chain is essential for antimicrobial activity, rendering the molecule amphipathic and so enabling it to disrupt fungal membranes (Osbourn, Bowyer et al. 1995, Armah, Mackie et al. 1999). The first sugar in the sugar chain is L-arabinose, which is linked to two D-glucose molecules via 1 -2 and 1 -4 linkages. The enzymes required for avenacin glycosylation have not yet been characterised
Thus it can be seen that the characterisation of new glycosyltransferase activities, for example which may be applied to generate triterpene glycosides, would provide a contribution to the art. Summary of the invention
The present inventors have characterised two enzymes which represent the first triterpene arabinosyltransferases to be reported from plants: these enzymes are termed AsAATI and GmSSAT herein. An ortholog of AsAATI has also been identified.
Furthermore the present inventors have newly characterised two glucosyltransferases from oat ( Avena strigosa) that are required for the biosynthesis of the antifungal triterpene glycoside, avenacin A-1 : these enzymes are termed AsUGT91 and AsTG herein.
Unexpectedly, AsTG is a vacuolar transglycosidase (specifically a transglucosidase) belonging to glycosyl hydrolase family 1 (GH1 ) and is the first member of this family of enzymes to be involved in triterpene biosynthesis.
A transglycosidase is an enzyme that catalyzes the transfer of a sugar moiety between different glycosides. A transglucosidase (“TG”) is an enzyme that catalyzes the transfer of a glucose moiety between different glycosides.
Analysis of oat mutants revealed that AsUGT91 and AsTG correspond to loci required for avenacin glucosylation. Both sets of mutants have root developmental defects, are deficient in avenacin production and show increased susceptibility to the take-all fungal pathogen, Gaeumannomyces graminis var. tritici.
The characterisation of enzymes that are able to add sugars to chemical scaffolds such as triterpenes, and investigation of the features that determine preference for different sugar donors enables a wider array of triterpenoid glycoforms to be engineered.
These advances, along with improved understanding of the significance of sugar chain composition for bioactivity, open up new opportunities to fully exploit glycodiversification for agronomic, medicinal and industrial biotechnology applications.
Furthermore, the enzymes provided by the present disclosure can be used in
combinatorial biosynthesis to create novel triterpene glycosides.
AsAAT 1 is a GT1 from oat that catalyses the addition of the first sugar in the avenacin oligosaccharide chain. We show by in vitro studies, expression in Nicotiana
benthamiana, and characterisation of an oat mutant line that this enzyme adds L- arabinose to the triterpene scaffold at the C-3 position.
AsAAT 1 is the first triterpene arabinosyltransferase to be characterized, and only the second reported plant GT 1 arabinosyltransferase. We demonstrate that AsAAT 1 shows high specificity for UDP-b-L-arabinopyranose (UDP-Ara) as its sugar donor and identify two amino acid residues mutually required for sugar donor specificity Using a targeted mutagenesis approach, we have shown that two residues are mutually required to provide sugar specificity to AsAAT 1. If modified, AsAAT 1 is converted into a glucosyltransferase. One of those, H404, is conserved in monocot and dicot
arabinosyltransferases. AsAAT 1 has a pivotal role in the biosynthesis of the oat antifungal saponin avenacin A-1 , which is crucial for take-all disease resistance.
Using our findings in relation to AsAATI we identified a second UGT plant triterpenoid arabinosyltransferase (GmSSAT) implicated in the synthesis of triterpene glycosides that determine bitterness and anti-feedant activity in soybean.
The characterisation of the enzymes AsUGT91 and AsTG identifies activities responsible for the transfer of a glucose to the 2-0 and 4-0 positions of a triterpene-3-O-arabinoside that have not been previously described. The expansion of the role of GH1
transglycosidases to triterpene glycoside biosynthesis increases the range of possible glycosylation events that are possible in heterologous systems, as molecules that are transferred to the vacuole and are inaccessible to cytosolic UGTs can be further decorated by vacuolar transglucosidases.
No triterpene arabinosyltransferase has previously been characterized, and the only GT1 plant natural product arabinosyltransferase identified so far in plants is a flavonoid arabinosyltransferase (UGT78D3) from Arabidopsis thaliana (Yonekura-Sakakibara, Tohge et al. 2008).
AsAATI and soybean GmSSAT together with UGT78D3 from A. thaliana are the only GT1 arabinosyltransferases characterised to date. Although these 3 enzymes reside in different clades of the UGT phylogenetic tree, they all harbor the same His residue critical for arabinosylation activity, suggesting convergent evolution of plant natural product arabinosyltransferases in monocots and dicots.
The methods described herein may be used to generate glycosylated triterpenes in a heterologous host or via semi-synthetic means. The glycosylated triterpenes may be non- naturally occurring in the species into which they are introduced.
Glycosylated triterpenes from the plants or other hosts of the invention may be isolated and commercially exploited.
Some aspects and embodiments of the present invention will now be described in more detail:
Detailed description of the invention
In different embodiments, the present invention provides means for manipulation of total levels of glycosylated triterpenes in host cells such as microorganisms or plants.
The following abbreviations are used hereinafter: “GT” - GlycosylTransferase
“UGT” - Uridine diphosphate-dependant GlycosylTransferase
“TTG” - TriTerpenoid glycosyating activity
“AAT” - Avenacin ArabinosylTransferase
“TG” - TransGlucosidase
“GH” - Glycosyl hydrolase
For brevity the polynucleotides and polypeptides of Table TTG1 a having TTG activity may be referred to herein as“TTG genes” or“TTG nucleic acids” and“TTG polypeptides” respectively. Collectively they may be referred to as“TTG sequences” of the invention.
Triterpenoid glycosylating activity displayed by the present TTGs involves the transfer of a sugar unit from a sugar donor onto a triterpenoid acceptor. A triterpenoid acceptor in this context includes non-modified triterpene scaffolds, oxygenated triterpene scaffolds or a triterpenoid molecule that has been further modified (e.g. glycosylated, acylated, or methylated). Specifically included are TTGs involved in sugar chain extension, i.e. that are able to transfer sugar units onto glycosidic moieties of triterpenoid glycosides.
Thus in one aspect there is provided an isolated nucleic acid molecule which comprises a nucleotide sequence encoding a triterpenoid arabinosyltransferase (AT) enzyme capable of transferring an arabinoside moiety from UDP-Ara to a triterpenoid acceptor to form a triterpenoid arabinoside. The AT enzyme may be a GT family 1 , UGT group D enzyme. The AT enzyme may be plant derived, optionally from a monocot plant, which is optionally an Avena spp. plant. The AT enzyme may optionally be from a dicot plant, which is optionally Glycine max.
The acceptor may optionally be selected from a scaffold of the oleanane-type, ursane- type, lupane-type or dammarane-type. The AT enzyme may be transfer the arabinoside to the C-3 position of the triterpenoid acceptor.
In some embodiment the AT enzyme comprises a PSPG motif in which motif the amino acid residue corresponding to residue 404 in AsAATI is a His residue.
In some embodiments the PSPG motif the amino acid residue corresponding to residue 376 in AsAATI (SEQ ID No: 2) is a Thr residue.
In some embodiments the PSPG motif is as shown in Table TTG2, including said His residue at the amino acid residue corresponding to residue 404 in AsAATI (either naturally, or by modification as explained below).
PSPG motifs are well established in the art (see Hughes & Hughes, 1994). PSPG motifs and other sequences can be aligned to show“equivalent” or“corresponding” residues by methods well known in the art. For example, pairwise alignment can be performed as shown in Table TTG2 e.g. using either clustalW or BLASTp from NCBI (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi). Default settings should be applied.
An example consensus motif is as follows:
[FW]-[2X]-Q-[2X]-[LIVMYA]-[LIMV]-[4-6X]-[LVGAC]-[LVFYA]-[LIVMF]-[STAGCM]- [HNQ]-[STAGC]-G-[2X]-[STAG]-[3X]-[STAGL]-[LIVMFA]- [4X]-[PQR]-[LIVMT]- [3X]-[PA]-[3X]-[DES]-[QEHN]
In another aspect there is provided an isolated nucleic acid molecule which comprises a nucleotide sequence encoding a glycosyl hydrolase family 1 (GH1 ) transglucosidase enzyme capable of transferring a glucoside moiety via a 1 ,4 link to the arabinoside moiety of a triterpenoid arabinoside 1 ,2-glucoside acceptor to form a triterpene triglycoside.
The polypeptide sequence encoded by the nucleotide may comprises a vacuolar targeting sequence.
As explained above, the inventors have identified genes which encode enzymes which effect triterpenoid glycosylation (see e.g. SEQ. ID: Nos 1-10 in Tables TTG1 a and G1 b).
The above newly characterised TTG genes form aspects of the present invention in their own right.
In another aspect of the present invention there are disclosed nucleic acids which are variants of these TTG nucleic acids.
Such variants, as with the native TTG genes discussed herein, may be used to alter the glycosylated triterpene content of a plant, as assessed by the methods disclosed herein. For instance a variant nucleic acid may include a sequence encoding a variant TTG polypeptide sharing the relevant biological activity of the native TTG polypeptide, as discussed above. Examples include variants of any of SEQ ID Nos 2, 4, 6, 8 or 10.
In some embodiments, the methods of the present invention will include the use of one or more of these newly characterised TTG nucleic acids of the invention (e.g. one, two, three or four such TTG nucleic acids) optionally in conjunction with the manipulation of other genes affecting triterpenoid synthesis or decoration known in the art.
Thus in one aspect there is provided an isolated nucleic acid molecule which nucleic acid comprises a nucleotide sequence encoding an enzyme having TTG activity, wherein the nucleotide sequence:
(i) encodes all or part of the polypeptide SEQ ID NO: 2, 4, 6, 8, or 10; or
(ii) encodes a variant polypeptide which is a homologous variant of SEQ ID NO 2, 4, 6, 8, or 10 which shares at least about 50% identity with said SEQ ID NO, which polypeptide has the respective activity of said SEQ ID NO. shown in Table TTG1 b. The nucleotide sequence may be selected from SEQ ID NO: 1 , 3, 5, 7, or 9 or the genomic equivalent thereof.
The nucleotide sequence may encode a derivative of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, or 10 by way of addition, insertion, deletion or substitution of one or more amino acids.
The nucleotide sequence consist of or comprise an allelic or other homologous or orthologous variant of the original native nucleotide sequences described herein
Other nucleic acids of the invention include those which are degeneratively equivalent to these.
Aspects of the invention further embrace isolated nucleic acid comprising a sequence which is complementary to any of those discussed herein.
As described above, the inventors have investigated the residues required to provide sugar specificity to TTG enzymes.
In one aspect there is provided an isolated nucleic acid molecule which nucleic acid comprises a nucleotide sequence encoding an enzyme having TTG activity, wherein the nucleotide sequence encodes a variant polypeptide which is a homologous variant of the amino acid sequence shown in SEQ ID NO 2, 4, or 6 and which shares at least about 50% identity with said SEQ ID NO,
wherein the nucleotide sequence encodes a derivative of said amino acid sequence wherein the His residue at the amino acid residue corresponding to residue 404 in SEQ ID NO. 2 has been substituted or deleted to alter the sugar specificity thereof compared to the respective activity of said SEQ ID NO. shown in Table TTG1 b.
For example the His may be substituted for Gin.
Conversely there invention also provides an isolated nucleic acid molecule which comprises a nucleotide sequence encoding an enzyme having triterpenoid glycosylation (TTG) activity, wherein the nucleotide sequence encodes a variant polypeptide which is a homologous variant of the amino acid sequence of a triterpenoid glucosyltransferase, wherein the nucleotide sequence encodes a derivative of said amino acid sequence wherein the Gin residue at the amino acid residue corresponding to residue 404 in SEQ ID NO. 2 has been substituted or deleted such as to convert said
glucosyltransferase to an arabinosyltransferase.
In one aspect there is provided a process for producing variant nucleic acids as described above by modifying the native nucleic acids described herein.
Also provided is a method for identifying or cloning a TTG encoding nucleic acids employing all or part of the nucleic acids described herein. Thus the invention provides a method which comprises the steps of:
(a) providing a preparation of nucleic acid from a plant cell;
(b) providing a nucleic acid molecule which is a probe based on the sequence of a nucleic acid described herein;
(c) contacting nucleic acid in said preparation with said nucleic acid molecule under conditions for hybridisation; and,
(d) identifying nucleic acid in said preparation which hybridises with said nucleic acid molecule.
The invention further provides a method which comprises the steps of:
(a) providing a preparation of nucleic acid from a plant cell;
(b) providing a pair of nucleic acid molecule primers suitable for PCR, at least one of said primers being a sequence of at least about 16-24 nucleotides in length, which sequence is present in a nucleotide sequence of a nucleic acid described herein;
(c) contacting nucleic acid in said preparation with said primers under conditions for performance of PCR; and,
(d) performing PCR and determining the presence or absence of an amplified PCR product.
Another aspect of the invention utilises a nucleic acid of the invention to interrogate a database of plant genomic sequences, and identify target TTG nucleic acid based on sequence similarity and clustering of the target nucleic acid with other TTG sequences (see the Examples herein).
Optionally the activity of any putative TTG enzyme can be confirmed after identification using the assays described herein.
In one aspect the invention provides a recombinant vector which comprises the TTG nucleic acid of the invention..
The nucleic acid may be operably linked to a promoter for transcription in a host cell, wherein the promoter is optionally an inducible promoter. The vector may be a plant vector, a microbial vector, an insect cell vector, or a mammalian cell vector. Examples are discussed hereinafter.
In a preferred embodiment the vector is a plant vector which comprises an expression cassette comprising:
(i) a promoter, operably linked to
(ii) an enhancer sequence derived from the RNA-2 genome segment of a bipartite RNA virus, in which a target initiation site in the RNA-2 genome segment has been mutated;
(iii) the nucleotide sequence encoding the enzyme;
(iv) a terminator sequence; and optionally
(v) a 3’ UTR located upstream of said terminator sequence. Also provided is a method which comprises the step of introducing the vector into a host cell, optionally such as to cause recombination between the nucleic acid in the vector and the host cell genome such as to transform the host cell.
Also provided is a host cell (e.g. microbial, insect, plant or mammalian cell) containing or transformed with a heterologous nucleic acid of the invention or with the vector.
In one embodiment the cell is a plant cell, optionally having the heterologous nucleic acid within its chromosome.
Also provided is a plant having the heterologous nucleic acid or vector in one or more of its cells.
Also provided is a method for producing a transgenic plant, which method comprises the steps of:
(a) performing a method as described above using a plant vector and a plant cell,
(b) regenerating a plant from the transformed plant cell.
Also provided is a transgenic plant obtained or obtainable by the methods described herein, or one which is a clone, or selfed or hybrid progeny or other descendant of said transgenic plant, which in each case includes a heterologous nucleic acid of the invention.
Also provided is an edible portion or propagule from such as plant, includes a
heterologous nucleic acid of the invention and\or modified triterpene as described herein.
In another aspect there is provided a method for assessing the triterpene glycosylation phenotype of a plant, the method comprising the step of determining the presence and/or identity of an allele therein comprising the use of a TTG nucleotide sequence of the invention or a part thereof.
In aspects of the invention, TTG nucleic acids of the invention may be used in combination to provide appropriate TTG activity. For example aspects may employ combinations of:
(i) nucleic acid having a nucleotide sequence encoding all or part of the polypeptide SEQ ID NO: 2 or 6, or encoding a variant polypeptide which is a homologous variant of SEQ ID NO 2 or 6 which shares at least about 50% identity with said SEQ ID NO;
(ii) nucleic acid having a nucleotide sequence encoding all or part of the polypeptide SEQ ID NO: 8, or encoding a variant polypeptide which is a homologous variant of SEQ ID NO 8 which shares at least about 50% identity with said SEQ ID NO;
(iii) nucleic acid having a nucleotide sequence encoding all or part of the polypeptide SEQ ID NO: 10, or encoding a variant polypeptide which is a homologous variant of SEQ ID NO 10 which shares at least about 50% identity with said SEQ ID NO; These may be used for example to provide an arabinose moiety to the triterpenoid acceptor and\or provide one or more glucose moieties to the arabinose moiety. Other sequences of the invention having the respective activities (e.g. produced or identified according to the methods of the invention) may likewise be utilised, optionally in conjunction with other synthetic or metabolic enzymes.
TTG products and the use of a TTG sequence to catalyse its respective biological activity (as described in Table TTG1a) forms another aspect of the invention.
Thus in one aspect the invention provides an isolated TTG polypeptide which is encoded by the nucleotide sequences of the invention described herein.
Also provided is an antibody which specifically binds the polypeptide.
Also provide is the use of TTG polypeptides in a method of catalyse triterpenoid glycosylation in vivo or in vitro. As explained herein, this has utility for generating natural or novel triterpenoids, or diverting fluxes between different types of triterpenoid.
Example utilities include:
(i) in vitro modification of a purified triterpene substrate to deliver a desired product or intermediate;
(ii) in vivo generation of a desired triterpene product or intermediate which is recovered;
(iii) in vivo generation of a desired triterpene product or intermediate which is recovered and subject to in vitro modification by chemical modification
Other utilities and phenotypes which may be modified are described herein.
In another aspect of the invention there provided novel glycosylated triterpenes obtained or obtainable by the methods described herein e.g. in vivo, in vitro, or mixed methods (semi-synthetic).
In another aspect there is provided a method of making the TTG polypeptide which method comprises the step of causing or allowing expression from a TTG nucleic acid of the invention.
The invention further provides a method of influencing or affecting triterpenoid
glycosylation in a host such as a plant, the method including causing or allowing transcription of a heterologous TTG nucleic acid as discussed above within the cells of the plant. The step may be preceded by the earlier step of introduction of the TTG nucleic acid into a cell of the plant or an ancestor thereof.
Such methods will usually form a part of, possibly one step in, a method of producing a glycosylated triterpene in a host such as a plant. Preferably the method will employ a TTG polypeptide of the present invention or derivative thereof, as described above, or nucleic acid encoding either.
Example methods may comprise the step of:
(i) causing or allowing expression of coding heterologous nucleic acid within the cells of the host, following an earlier step of introducing the nucleic acid into a cell of the host or an ancestor thereof, or
(ii) introducing a silencing agent capable of silencing expression of a nucleotide sequence of the invention into a cell of the host or an ancestor thereof.
For example there is a provided a method for influencing or affecting triterpenoid glycosylation in a host, which method comprises any of the following steps of:
(i) causing or allowing transcription from a nucleic acid comprising the complement sequence of the TTG nucleotide sequence such as to reduce the respective encoded polypeptide activity by an antisense mechanism;
(ii) causing or allowing transcription from a nucleic acid encoding a stem loop precursor comprising 20-25 nucleotides, optionally including one or more mismatches, of the TTG nucleotide sequence such as to reduce the respective encoded polypeptide activity by an miRNA mechanism;
(iii) causing or allowing transcription from nucleic acid encoding double stranded RNA corresponding to 20-25 nucleotides, optionally including one or more mismatches, of the TTG nucleotide sequence such as to reduce the respective encoded polypeptide activity by an siRNA mechanism.
Said double-stranded RNA (e.g. siRNA duplex) based on the novel TTG sequences of the invention forms an aspect of the invention per se.
Plant triterpene glycosides are a large and varied class of terpenoids that are often associated with plant defence mechanisms and have a wide range of different properties with many potential applications, from foaming agents in beverages to vaccine adjuvants.
It has historically proved difficult to study the properties of triterpene glycosides and their potential uses due to the lack of availability of pure compounds. Triterpene glycosides are difficult to isolate from natural sources due to their presence in low amounts or in composite mixtures, and their chemical complexity impedes chemical or partial synthesis.
However the present invention opens the possibility of the production of multiple triterpene glycosides in heterologous hosts in sufficient amounts to evaluate their properties systematically, opening up opportunities to scale-up production for applications in medicine and industry.
This approach can be combined with semi-synthetic chemistry to create novel compounds with enhanced properties such as reduced toxicity (Augustin, Kuzina et al. 2011 , Osbourn, Goss et al. 201 1 ).
Thus non-limiting utilities for the present TTG materials (e.g. genes and polypeptides) include:
• In vitro (ex-vivo) modification of purified triterpene substrates (natural or synthetic) by recombinant TTG polypeptides to deliver a specific product or intermediate;
• In-vivo generation of a specific triterpene product or intermediate by recombinantly expressed TTG genes in suitable host cells;
• In-vivo generation of a specific intermediates (as above) to enable further ex-vivo modification, for example chemical modification based on known chemical reactions to add further functionality e.g. acylation of the scaffold or the sugar moiety, esterification, methylation, oxygenation etc.
• Down regulation of native TTG genes to redirect triterpene metabolic fluxes.
• Modification of cell or host phenotypes as described below.
The characterisation of the enzymes AsUGT91 and AsTG identifies activities responsible for the transfer of a glucose to the 2-0 and 4-0 positions of an triterpene-3-O-arabinoside that have not been previously described. / n vivo sugar donors of AsTG may include cinnamic acid O-b-D-glucoside or N-methyl anthranilic acid O-b-D-glucoside.
The expansion of the role of GH1 transglycosidases to triterpene glycoside biosynthesis increases the range of possible glycosylation events that are possible in heterologous systems, as molecules that are transferred to the vacuole and are inaccessible to cytosolic UGTs can be further decorated by vacuolar TTGs.
In addition, knowledge of the biosynthetic pathways can be used to engineer new traits into crops, or to modify undesirable traits that are associated with triterpene glycosides (Osbourn, Goss et al. 201 1 )(Heng2006, Osbourn201 1 ).
Furthermore the enzymes provided by the present disclosure can be used in
combinatorial biosynthesis to create novel triterpene glycosides.
Thus the methods described herein may be used to produce (and optionally isolate) glycosylated triterpenes, which may be naturally occurring or novel, or to modify the glycosylation of a triterpene, in a host.
The methods may be used for reduction or increase in glycosylated triterpene quality or quantity in the host.
Not only can the triterpenoid arabinosyltransferase enzymes described herein be used to produce products per se, but they can also be used for the purpose of alleviating endogenous modifications of triterpenoid scaffolds and over-accumulate arabinosyl- conjugates of a desire molecule.
By way of non-limiting example, the SAD6 product is not highly accumulated in planta due to endogenous glycosylation or other endogenous modification. The corresponding glucoside is also subject to endogenous modification (Leveau et al. unpublished). However arabinosylation of the product leads to the accumulation of a defined
triterpenoid arabinoside which can then be recovered. The same methodology can be applied to dammarane-type triterpenoids. Without wishing to be bound by theory, it appears that the arabinose moiety is not well recognised as a target for detoxification in planta and thereby does not effectively induce expression of detoxifying gene families.
Thus arabinosylation may be used to‘tag’ triterpenoid products of interest, such that they can be purified and analysed, and, if desired, the arabinose moiety may be removed by hydrolysis.
Accordingly, in one aspect there is provided a method for inhibiting endogenous modifications of a triterpenoid scaffold and\or accumulating arabinosyl-conjugates of a triterpenoid scaffold, wherein a heterologous nucleic acid encoding a triterpenoid arabinosyltransferase (AT) enzyme is expressed within the cells of the host, following an earlier step of introducing the nucleic acid into a cell of the host or an ancestor thereof.
As described below, arabinosylation may be used to‘tag’ triterpenoid products of interest, such that they are not further modified, and can be purified and analysed.
As explained above, triterpene glycosides have many utilities. Use of the TTG materials described herein to modify any of these properties forms part of the present invention.
For example triterpenoid glycosides have been determined to provide various health promoting properties. Furthermore some triterpenes (Soyasaponins from group A) are believed to contribute to bitterness and anti-feedant activity in soybean, and other beans.
As described below, example utilities for the methods and materials of the invention in relation to plant or plant product phenotypes include:
(i) enhanced herbivore and\or pathogen resistance;
(ii) improved flavour or reducing bitterness;
(iii) improving health promoting properties.
Thus in one embodiment a preferred property of the methods and materials of the invention is to reduce bitterness caused by triterpenoid glycosides.
A preferred property is to enhance resistance to at least one fungal disease e.g. the root disease take-all.
A "resistance to at least one fungus" refers to a plant comprising a recombinant nucleic acid of the present invention which when infected with a fungus is able to resist infection or to tolerate infection to a greater degree, resulting in less damage, more vigorous health and less or no loss of yield due to fungal infection relative to plants without the nucleic acid of the present invention. The fungus is typically pathogenic. Pathogenic" or "fungal pathogen" refer to a fungus that under conditions that do not include the nucleic acid of the present invention, would cause disease in a plant. Examples of specific fungal pathogens for the major crops are described in W02006/044508 and include but are not limited to, the following:
Soybeans: Macrophomina phaseolina, Rhizoctonia solani, Sclerotinia sclerotiorum, Fusarium oxysporum, Diaporthe phaseolorum var. sojae (Phomopsis sojae), Diaporthe phaseolorum var. caulivora, Sclerotium rolfsii, Cercospora kikuchii, Cercospora sojina, Colletotrichum dematium (Colletotichum truncatum), Corynespora cassiicola, Septoria glycines, Phyllosticta sojicola, Altemaria altemata, Microsphaera diffusa, Fusarium semitectum, Phialophora gregata, Glomerel/a glycines, Phakopsora pachyrhizi, Fusarium solani; Canola: Altemaria brassicae, Leptosphaeria maculans, Rhizoctonia solani, Sclerotinia sclerotiorum, Mycosphaerella brassicicola, Fusarium roseum, Altemaria alternata;
Alfalfa: Phoma medicaginis var. medicaginis, Cercospora medicaginis, Pseudopeziza medicaginis, Leptotrichila medicaginis, Fusarium oxysporum, Verticillium alboatrum, Stemphylium herbarum, Stemphylium alfalfae, Colletotrichum trifolii, Leptosphaerulina briosiana, Uromyces striatus, Sclerotinia trifoliorum, Stagonospora meliloti, Stemphylium botryosum, Leptotrochila medicaginis;
Wheat: Urocystis agropyri, Altemaria alternata, Cladosporium herbarum, Fusarium a venaceum, Fusarium culmorum, Ustilago tritici, Ascochyta tritici, Cephalosporium gramineum, Collotetrichum graminicola, Erysiphe graminis f.sp. tritici, Puccinia graminis f.sp. tritici, Puccinia recondita f.sp. tritici, Puccinia striiformis, Pyrenophora tritici-repentis, Septoria nodorum, Septoria tritici, Septoria avenae, Pseudocercosporella herpotrichoides, Rhizoctonia solani, Rhizoctonia cerealis, Gaeumannomyces graminis var. tritici (“take- all”), Bipolaris sorokiniana, Claviceps purpurea, Tilletia tritici, Tilletia laevis, Ustilago tritici, Tilletia indica, Rhizoctonia solani;
Sunflower: Plasmophora halstedii, Sclerotinia sclerotiorum, Septoria helianthi, Phomopsis helianthi, Altemaria helianthi, Altemaria zinniae, Botrytis cinerea, Phoma macdonaldii, Macrophomina phaseolina, Erysiphe cichoracearum, Rhizopus oryzae, Rhizopus arrhizus, Rhizopus stolonifer, Puccinia helianthi, Verticillium dahliae, Cephalosporium acremonium;
Corn : Colletotrichum graminicola (Glomerella graminicola), Stenocarpella maydi
(Diplodia maydis), Fusarium moniliforme var. subglutinans, Fusarium verticillioides, Gibberella zeae (Fusarium graminearum), Aspergillus flavus, Bipolaris maydis 0, T (Cochliobolus heterostrophus), Helminthosporium carbonum I, II & III (Cochliobolus carbonum), Exserohilum turcicum I, II & III , Helminthosporium pedicellatum, Physoderma maydis, Phyllosticta maydis, Kabatiella maydis, Cercospora sorghi, Ustilago maydis, Puccinia sorghi, Puccinia polysora, Macrophomina phaseolina, Penicillium oxalicum, Nigrospora oryzae, Cladosporium herbarum, Curvularia lunata, Curvularia inaequalis, Curvularia pallescens, Trichoderma viride, Claviceps sorghi, Diplodia macrospora, Sclerophthora macrospora, Sphacelotheca reiliana, Physopella zeae, Cephalosporium maydis, Cephalosporium acremonium; Sorghum: Exserohilum turcicum, Cercospora sorghi, Gloeocercospora sorghi, Ascochyta sorghina, Puccinia purpurea, Macrophomina phaseolina, Perconia circinata, Fusarium moniliforme, Alternaria alternata, Bipolaris sorghicola, Helminthosporium sorghicola, Curvularia lunata, Phoma insidiosa, Ramulispora sorghi, Ramulispora sorghicola, Phyllachara sacchari, Sporisorium reilianum (Sphacelotheca reiliana), Sphacelotheca cruenta , Sporisorium sorghi, Claviceps sorghi, Rhizoctonia solani, Acremonium strictum, Colletotrichum (Glomerella) graminicola (C. sublineolum), Fusarium graminearum, Fusarium oxysporum; and the like.
Some of the terms, aspects and embodiments discussed above will now be described in more detail.
Triterpene acceptors or scaffolds
The terpenoids, also called isoprenoids, are well known in the art and constitute the largest family of natural products with over 22,000 individual compounds of this class having been
described.
The triterpenes or terpenoids (the terms are used interchangeably unless context demands otherwise) include hemiterpenes, monoterpenes, sesquiterpenes, diterpenes, triterpenes, tetraterpenes, polyprenols, and the like, and play diverse functional roles in plants as hormones, photosynthetic pigments, electron carriers, mediators of
polysaccharide assembly, and structural components of membranes. The majority of plant terpenoids are found in resins, latex, waxes, and oils.
Triterpenes are synthesised via the cyclization of squalene (in bacteria) or 2,3- oxidosqualene (in fungi, animals, and plants). Specifically, triterpenoids are synthesized from these linear precursors by enzymes known as oxidosqualene cyclases via a process involving substrate folding into the chair-chair-chair conformation. These reactions involve the production of cyclic derivatives via protonation and epoxide ring opening of the precursor, which creates a carbocation that can undergo several types of cyclization reactions. Over 200 triterpene scaffolds have been reported (Xu et al. 2004).
In vivo the triterpenoid backbone undergoes various modifications (oxidation, substitution, and glycosylation), mediated by cytochrome P450-dependent monooxygenases, glycosyltransferases, and other enzymes.
Non-limiting examples of triterpenoid scaffolds recognized as acceptors by one or more of the present TTGs are 30 carbon polycyclic terpenoids derived from the precursor 2,3- oxidosqualene. These include triterpenoids derived from the b-amyrin scaffold
(oleanane-type), a-amyrin scaffold (ursane-type), lupeol scaffold (lupane-type) or dammarenediol II scaffold (dammarane-type).
In embodiments of the invention described herein, the triterpene acceptor may optionally be selected from a scaffold of the oleanane-type, ursane-type, lupane-type or dammarane-type and\or the triterpene or triterpenoid is selected from: a soyasaponin which is optionally selected from a group A saponin, which is optionally Ab, Ac, Ad, Af and Ah; an avenacin which is optionally selected from Avenacin A-1 , A-2, B-1 and B-2.
For example the invention may be applied to triterpenoids derived from the b-amyrin scaffold (oleanane-type), a-amyrin scaffold (ursane-type), lupeol scaffold (lupane-type) or dammarenediol II scaffold (dammarane-type).
In some embodiments of the invention, the triterpene glycoside is an avenacin.
Avenacins are antifungal triterpene glycosides that are synthesised in the epidermal cell layers of roots of oat (Avena) species and the closely related Arrhenatherum elatius (Turner, 1953; Crombie and Crombie, 1986; Osbourn et al., 1994; Qi et al., 2006). There are four different structurally related avenacins of which the most abundant one is avenacin A-1. These compounds are preformed phytoprotectants that confer resistance against soil-borne fungal pathogens such as Gaeumannomyces graminis var. tritici, which causes the agriculturally important root-infecting disease“take-all” in crops such as wheat or barley (Papadopoulou, Melton et al. 1999)(Papadopoulou et al., 1999). The majority of the avenacin biosynthetic pathway genes have been elucidated in the diploid oat species A. strigosa; these genes are expressed specifically in oat root tips and are physically clustered in the A. strigosa genome. The sugar chain of avenacin A-1 is a trisaccharide of an l-arabinose linked in the a-configuration to the 3-0 of the avenacin backbone with two branching b-1 ,4- and b-1 ,2^^Iuoo8b molecules.
In some embodiments of the invention, the triterpene glycoside is a soyasaponin.
Soyasaponins are triterpene glycoside saponins found in soybeans.
Soybean ( Glycine max) produces triterpene glycosides (soyasaponins) some of which, referred as soyasaponins from group A, harbouring a branched sugar chain attached at the C-22 position and initiated by an L-arabinose residue (Fig. 1 A).
Soyasaponins have been reported to promote various health functions and to display antioxidative and cholesterol-lowering properties. Favourable properties reported include the ability to reduce blood glucose levels, reduce anti-kidney disease progression, anti- inflammatory properties, renin inhibition, hepatoprotection, and antitumor effects (Kamo, Suzuki et al. 2014).
Other reported activities for soyasaponins Aa and Ab (Group A) include an anti-obesity effect on 3T3-L1 adipocytes through the downregulation of adipogenesis-related transcription factor peroxisome proliferator-activated receptor y (Yang, Ahn et al. 2015).
It is also known that Group A saponins are bitter in taste and are undesirable in soybean (Rehman, Nawaz et al. 2018).
Variants As described above, in addition to use of newly characterised native TTG genes (and polypeptides) the invention encompasses use of variants of these genes (and
polypeptides).
A“variant” TTG nucleic acid or TTG polypeptide molecule shares homology with, or is identical to, all or part of the TTG genes or polypeptides discussed herein.
A variant polypeptide shares the relevant biological activity of the native TTG polypeptide (enzyme) as shown in Table TTG1 b. A variant nucleic acid encodes the relevant variant polypeptide.
In this context the“biological activity” of the TTG polypeptide is the ability to catalyse the respective reaction shown in Table TTG1 b or otherwise described herein e.g. with reference to the Figures. The relevant biological activities may be assayed based on the reactions shown in Table TTG1 b in vitro. Alternatively they can be assayed by activity in vivo as described in the Examples i.e. by introduction of the TTG nucleotide sequences of the invention into a host to generate glycosylated triterpenes, which can be assayed by LC-MS or the like.
Variants of the sequences disclosed herein preferably share at least 50%, 55%, 56%, 57%, 58%, 59%, 60%, 65%, or 70%, or 80% identity, most preferably at least about 90%, 95%, 96%, 97%, 98% or 99% identity. Such variants may be referred to herein as “substantially homologous”.
Preferred variants may be:
(i) Naturally occurring nucleic acids such as alleles (which will include polymorphisms or mutations at one or more bases) or pseudoalleles (which may occur at closely linked loci to the TTG genes of the invention). Also included are paralogues, isogenes, or other homologous genes belonging to the same families as the TTG genes of the invention. Also included are orthologues or homologues from other plant species.
Furthermore, included within the scope of the present invention are nucleic acid molecules which encode amino acid sequences which are homologues of TTG genes of the invention. Homology may be at the nucleotide sequence and/or amino acid sequence level, as discussed below.
In one embodiment, nucleotide sequence information and other characterisation provided herein may be utilised in a bioinformatics approach to find homologous or orthologous sequences within a database (e.g. of whole genomes, or EST). Expression products of the sequences can then be tested for activity as described below.
(ii) Artificial nucleic acids, which can be prepared by the skilled person in the light of the present disclosure. Such derivatives may be prepared, for instance, by site directed or random mutagenesis, or by direct synthesis. Preferably the variant nucleic acid is generated either directly or indirectly (e.g. via one or more amplification or replication steps) from an original nucleic acid having all or part of the sequence of a TTG gene of the invention.
Also included are nucleic acids corresponding to those above, but which have been extended at the 3' or 5' terminus.
The term“TTG variant nucleic acid” as used herein encompasses all of these
possibilities. When used in the context of polypeptides or proteins it indicates the encoded expression product of the variant nucleic acid.
In each case, the preferred TTG nucleic acids are any of SEQ ID Nos 1 , 3, 5, 7, or 9, or substantially homologous variants thereof.
The preferred TTG polypeptides (enzymes) are any of SEQ ID Nos 2, 4, 6, 8, or 10, or substantially homologous variants thereof.
Other preferred triterpenoid glycosylation (TTG) activity modifying nucleic acids for use in the invention include fragments, or RNA equivalents of any of these sequences.
Described herein are methods of producing a derivative nucleic acid comprising the step of modifying any of the TTG genes of the present invention disclosed above.
Changes may be desirable for a number of reasons. For instance they may introduce or remove restriction endonuclease sites or alter codon usage. This may be particularly desirable where the Qs genes are to be expressed in alternative hosts e.g. microbial hosts such as yeast. Methods of codon optimizing genes for this purpose are known in the art (see e.g. Elena, Claudia, et al. "Expression of codon optimized genes in microbial systems: current industrial applications and perspectives." Frontiers in microbiology 5 (2014)). Thus sequences described herein including codon modifications to maximise yeast expression represent specific embodiments of the invention.
Alternatively changes to a sequence may produce a derivative by way of one or more (e.g. several) of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution of one or more (e.g. several) amino acids in the encoded polypeptide.
Such changes may modify sites which are required for post translation modification such as cleavage sites in the encoded polypeptide; motifs in the encoded polypeptide for phosphorylation etc. Leader or other targeting sequences (e.g. membrane or golgi locating sequences) may be added to the expressed protein to determine its location following expression if it is desired to isolate it from a microbial system.
Other desirable mutations may be random or site directed mutagenesis in order to alter the activity (e.g. specificity) or stability of the encoded polypeptide. Changes may be by way of conservative variation, i.e. substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine. As is well known to those skilled in the art, altering the primary structure of a polypeptide by a conservative substitution may not significantly alter the activity of that peptide because the side-chain of the amino acid which is inserted into the sequence may be able to form similar bonds and contacts as the side chain of the amino acid which has been substituted out. This is so even when the substitution is in a region which is critical in determining the peptides conformation. Also included are variants having non-conservative substitutions. As is well known to those skilled in the art, substitutions to regions of a peptide which are not critical in determining its conformation may not greatly affect its activity because they do not greatly alter the peptide's three dimensional structure. In regions which are critical in determining the peptides conformation or activity such changes may confer advantageous properties on the polypeptide. Indeed, changes such as those described above may confer slightly advantageous properties on the peptide e.g. altered stability or specificity.
Specifically, the present inventors have identified key residues which are conserved in all 3 characterised arabinosyltransferases, but not in the glucosyltransferases. This residue is H404 in in C-terminus of the PSPG motif in AsAAT 1 , but Q in the corresponding motif in glucosyltransferases (see Table TTG2).
Thus the present invention provides for, inter alia methods of modifying the glycosyl specificity of a TTG enzyme by substituting the residue corresponding to H404 in AsAAT 1 (SEQ ID NO: 2) in the PSPG motif of said TTG enzyme. This may be achieved using any of the methods described herein e.g. site directed mutagenesis based on modification of the encoding amino acid sequence.
Such may be used to convert glucosyltransferases to arabinosyltransferases (for example by modifying the residue to H) or vice versa (for example by modifying the residue from H e.g. to Q).
The invention also provides for the resulting nucleic acids and polypeptides e.g.
derivatives of the amino acid sequence shown in SEQ ID NO: 2 or 6 wherein the H at position 404 or 387 respectively has been substituted or deleted to alter the TTG activity thereof e.g. to Q.
Modification of the TTG sequence of the invention by other methods, such as gene editing, is also embraced by the present invention.
The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR associated protein (Cas) system is an adaptive immune mechanism found in bacterial and archaeal species that allows the host to combat pathogens, such as bacteriophages (Barrangou, R. et al. Science 315, 1709-1712 (2007); Marraffini, L.A. & Sontheimer, E.J. Science 322, 1843-1845 (2008); Bhaya, D., Davison, M. & Barrangou, R. Annual review of genetics 45, 273-297 (201 1 ); Garneau, J.E. et al. Nature 468, 67-71 (2010)). Bacteriophage-derived 30-bp DNA fragments are inserted into the CRISPR locus of the host cell and transcribed as CRISPR RNAs (crRNAs). These form a complex with trans- encoded RNA (tracrRNA) and CRISPR-associated (Cas) proteins, and the complex introduces site-specific cleavage at DNA sites that match the sequence of the crRNAs.
CRISPR-Cas9 is a type II CRISPR-Cas system. CRISPR-Cas9 system from
Streptococcus pyogenes is used in the art as a simple and versatile tool for RNA guided genome editing (RGE) in different organisms. In Cas9 mediated RGE, a single or duplex short RNA molecule (guide RNA or gRNA) directs Cas9 to target the desired DNA site for genome modification or transcriptional control. gRNA-Cas9 recognizes targeted DNA by gRNA-DNA pairing between 5’-end leading sequence of gRNA (referred as gRNA spacer) and one DNA strand (complementary stand of protospacer). Cas9 also requires the presence of protospacer-adjacent motif (PAM) in the target site following the gRNA-DNA pairing region. The approximate 20 nt long gRNA spacer sequence could be readily programmed to target DNA sites with PAM. But gRNA-Cas9 also recognizes PAM sites that match gRNA spacer imperfectly, resulting off-target risk in genome editing. As a result, designing gRNA with highly specific spacer sequence is critical for RGE.
CRISPR-cas9 plasmids for use in plants are commercially available, for example from addgene - see: www.addgene.org/crispr/plant/
In the context of the present inventions, the TTG genes may be targets for editing using CRISPR-cas9 plasmids (i.e. be used to provide“gRNAs”).
The present invention may utilise fragments of the polypeptides encoding the TTG genes of the present invention disclosed above.
Thus the present invention provides for the production and use of fragments of the full- length TTG polypeptides of the invention disclosed herein, especially active portions thereof. An“active portion” of a polypeptide means a peptide which is less than said full length polypeptide, but which retains its essential biological activity.
A“fragment” of a polypeptide means a stretch of amino acid residues of at least about five to seven contiguous amino acids, often at least about seven to nine contiguous amino acids, typically at least about nine to 13 contiguous amino acids and, most preferably, at least about 20 to 30 or more contiguous amino acids. Fragments of the polypeptides may include one or more epitopes useful for raising antibodies to a portion of any of the amino acid sequences disclosed herein. Preferred epitopes are those to which antibodies are able to bind specifically, which may be taken to be binding a polypeptide or fragment thereof of the invention with an affinity which is at least about 1000x that of other polypeptides.
Examples of fragments of the present invention include at least 100, 200, 300, 400, 450, 460, or 470 contiguous amino acids.
For brevity, unless context demands otherwise, these other polynucleotides and polypeptides (e.g. variants such as derivatives and fragments) may also be referred to herein as“TTG genes” or“TTG nucleic acids” and“TTG polypeptides” respectively.
Collectively they may be referred to as“TTG sequences” of the invention.
It will be appreciated that where this term is used generally, it also applies to any of these sequences individually.
General molecular biology techniques applicable to the invention
In one aspect of the present invention, the TTG-biosynthesis modifying nucleic acid described above is in the form of a recombinant and preferably replicable vector.
“Vector” is defined to include, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self-transmissible or mobilizable, and which can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g.
autonomous replicating plasmid with an origin of replication).
As is well known to those skilled in the art, a“binary vector” system includes (a) border sequences which permit the transfer of a desired nucleotide sequence into a plant cell genome; (b) desired nucleotide sequence itself, which will generally comprise an expression cassette of (i) a plant active promoter, operably linked to (ii) the target sequence and\or enhancer as appropriate. The desired nucleotide sequence is situated between the border sequences and is capable of being inserted into a plant genome under appropriate conditions. The binary vector system will generally require other sequence (derived from A. tumefaciens) to effect the integration. Generally this may be achieved by use of so called "agro-infiltration" which uses Agrobacterium-mediated transient transformation. Briefly, this technique is based on the property of Agrobacterium tumefaciens to transfer a portion of its DNA ("T-DNA") into a host cell where it may become integrated into nuclear DNA. The T-DNA is defined by left and right border sequences which are around 21-23 nucleotides in length. The infiltration may be achieved e.g. by syringe (in leaves) or vacuum (whole plants). In the present invention the border sequences will generally be included around the desired nucleotide sequence (the T- DNA) with the one or more vectors being introduced into the plant material by agro- infiltration.
Generally speaking, those skilled in the art are well able to construct vectors and design protocols for recombinant gene expression. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al, 1989, Cold Spring Harbor Laboratory Press or Current Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1992.
Specifically included are shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eucaryotic (e.g. higher plant, mosses, yeast or fungal cells).
A vector including nucleic acid according to the present invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the genome.
Preferably the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, e.g. yeast and bacterial, or plant cell. The vector may be a bi-functional expression vector which functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter or other regulatory elements (optionally in combination with a heterologous enhancer, such as the 35S enhancer discussed in the Examples below).
The advantage of using a native promoter is that this may avoid pleiotropic responses. In the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell
By "promoter" is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA).
"Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.
In a preferred embodiment, the promoter is an inducible promoter.
The term "inducible" as applied to a promoter is well understood by those skilled in the art. In essence, expression under the control of an inducible promoter is "switched on" or increased in response to an applied stimulus. The nature of the stimulus varies between promoters. Some inducible promoters cause little or undetectable levels of expression (or no expression) in the absence of the appropriate stimulus. Other inducible promoters cause detectable constitutive expression in the absence of the stimulus. Whatever the level of expression is in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus.
Thus nucleic acid according to the invention may be placed under the control of an externally inducible gene promoter to place expression under the control of the user. An advantage of introduction of a heterologous gene into a plant cell, particularly when the cell is comprised in a plant, is the ability to place expression of the gene under the control of a promoter of choice, in order to be able to influence gene expression, and therefore triterpenoid glycosylation, according to preference. Furthermore, mutants and derivatives of the wild-type gene, e.g. with higher or lower activity than wild-type, may be used in place of the endogenous gene. Thus this aspect of the invention provides a gene construct, preferably a replicable vector, comprising a promoter (optionally inducible) operably linked to a nucleotide sequence provided by the present invention.
Particularly of interest in the present context are nucleic acid constructs which operate as plant vectors. Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Cray RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148). Suitable vectors may include plant viral-derived vectors (see e.g. EP-A-194809).
Preferably the vectors of the present invention which are for use in plants comprise border sequences which permit the transfer and integration of the expression cassette into the plant genome. Preferably the construct is a plant binary vector. Preferably the binary transformation vector is based on pPZP (Hajdukiewicz, et al. 1994). Other example constructs include pBin19 (see Frisch, D. A., L. W. Harris-Haller, et al. (1995).“Complete Sequence of the binary vector Bin 19.” Plant Molecular Biology 27: 405-409).
Suitable promoters which operate in plants include the Cauliflower Mosaic Virus 35S (CaMV 35S). Other examples are disclosed at pg. 120 of Lindsey & Jones (1989)“Plant Biotechnology in Agriculture” Pub. OU Press, Milton Keynes, UK. The promoter may be selected to include one or more sequence motifs or elements conferring developmental and/or tissue-specific regulatory control of expression. Inducible plant promoters include the ethanol induced promoter of Caddick et al (1998) Nature Biotechnology 16: 177-180.
If desired, selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibiotics or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate). Positive selection system such as that described by Haldrup et al. 1998 Plant molecular Biology 37, 287-296, may be used to make constructs that do not rely on antibiotics.
A preferred vector is a 'CPMV-HT' vector as described in W02009/087391.
These vectors (typically binary vectors) for use in the present invention will typically comprise an expression cassette comprising:
(i) a promoter, operably linked to
(ii) an enhancer sequence derived from the RNA-2 genome segment of a bipartite RNA virus, in which a target initiation site in the RNA-2 genome segment has been mutated;
(iii) a TTG nucleic acid sequence as described above;
(iv) a terminator sequence; and optionally
(v) a 3’ UTR located upstream of said terminator sequence.
“Enhancer” sequences (or enhancer elements), as referred to herein, are sequences derived from (or sharing homology with) the RNA-2 genome segment of a bipartite RNA virus, such as a comovirus, in which a target initiation site has been mutated. Such sequences can enhance downstream expression of a heterologous ORF to which they are attached. Without limitation, it is believed that such sequences when present in transcribed RNA, can enhance translation of a heterologous ORF to which they are attached.
A“target initiation site” as referred to herein, is the initiation site (start codon) in a wild- type RNA-2 genome segment of a bipartite virus (e.g. a comovirus) from which the enhancer sequence in question is derived, which serves as the initiation site for the production (translation) of the longer of two carboxy coterminal proteins encoded by the wild-type RNA-2 genome segment.
Typically the RNA virus will be a comovirus as described hereinbefore.
Most preferred vectors are the pEAQ vectors of W02009/087391 which permit direct cloning version by use of a polylinker between the 5’ leader and 3’ UTRs of an expression cassette including a translational enhancer of the invention, positioned on a T-DNA which also contains a suppressor of gene silencing and an NPTII cassettes.
The presence of a suppressor of gene silencing in such gene expression systems is preferred but not essential. Suppressors of gene silencing are known in the art and described in WO/2007/135480. They include HcPro from Potato virus Y, He-Pro from TEV, P19 from TBSV, rgsCam, B2 protein from FHV, the small coat protein of CPMV, and coat protein from TCV. A preferred suppressor when producing stable transgenic plants is the P19 suppressor incorporating a R43W mutation.
The present invention also provides methods comprising introduction of such a construct into a plant cell or a microbial (e.g. bacterial, yeast or fungal) cell and/or induction of expression of a construct within a plant cell, by application of a suitable stimulus e.g. an effective exogenous inducer.
As an alternative to microorganisms, cell suspension cultures of suitable plant species, including also the moss Physcomitrella patens may be cultured in fermentation tanks (see e.g. Grotewold et al. (Engineering Secondary Metabolites in Maize Cells by Ectopic Expression of Transcription Factors, Plant Cell, 10, 721-740, 1998).
Other host cells having well established expression systems include mammalian cells (see e.g. Wurm, Florian M. "Production of recombinant protein therapeutics in cultivated mammalian cells." Nature biotechnology 22.11 (2004): 1393) which may thus be used mutatis mutandis in the methods described herein.
In a further aspect of the invention, there is disclosed a host cell containing a
heterologous TTG nucleic acid according to the present invention, especially a plant or a microbial cell.
Thus a further aspect of the present invention provides a method of transforming a plant cell involving introduction of a construct as described above into a host (e.g. plant cell) and causing or allowing recombination between the vector and the cell genome to introduce a TTG nucleic acid according to the present invention into the genome.
The invention further encompasses a host cell transformed with nucleic acid or a vector according to the present invention (e.g. comprising the TTG nucleic acid) especially a plant or a microbial cell. In the transgenic plant cell (i.e. transgenic for the nucleic acid in question) the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. There may be more than one heterologous nucleotide sequence per haploid genome.
Yeast has seen extensive employment as a triterpene-producing host [6-8, 19-22] and is therefore potentially well adapted for biosynthesis of glycosylated triterpenes.
Therefore in one embodiment, the host is a yeast. For such hosts, it may potentially be desirable to introduce additional genes to improve the flux of glycosylated triterpene production as described above.
Plants, which include a plant cell transformed as described above, form a further aspect of the invention.
If desired, following transformation of a plant cell, a plant may be regenerated, e.g. from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues and organs of the plant. Available techniques are reviewed in Vasil et al., Cell Culture and Somatic Cell Genetics of Plants, Vol I, II and III, Laboratory Procedures and Their Applications, Academic Press, 1984, and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989.
In addition to the regenerated plant, the present invention embraces all of the following: a clone of such a plant, seed, selfed or hybrid progeny and descendants (e.g. F1 and F2 descendants). The invention also provides a plant propagule from such plants, that is any part which may be used in reproduction or propagation, sexual or asexual, including cuttings, seed and so on. It also provides any part of these plants, which in all cases include the plant cell or heterologous TTG-biosynthesis modifying DNA described above.
The present invention also encompasses the expression product of any of the coding TTG nucleic acid sequences disclosed and methods of making the expression product by expression from encoding nucleic acid therefore under suitable conditions, which may be in suitable host cells.
As described below, plant backgrounds such as those above may be natural or transgenic e.g. for one or more other genes relating to glycosylated triterpene
biosynthesis, or otherwise affecting that phenotype or trait.
In modifying the host phenotypes, the TTG nucleic acids described herein may be used in combination with any other gene, such as transgenes affecting the rate or yield of triterpene frameworks, or their modification. For examples co-expression of genes providing substrates or donors as described herein may be desirable.
By use of a combination of genes, plants or microorganisms (e.g. bacteria, yeasts or fungi) can be tailored to enhance production of desirable precursors, or reduce undesirable metabolism.
As an alternative, down-regulation of genes in the host may be desired e.g. to reduce undesirable metabolism or fluxes which might impact on glycosylated triterpene yield.
Such down regulation may be achieved by methods known in the art, for example using anti-sense technology.
In using anti-sense genes or partial gene sequences to down-regulate gene expression, a nucleotide sequence is placed under the control of a promoter in a "reverse orientation" such that transcription yields RNA which is complementary to normal mRNA transcribed from the "sense" strand of the target gene. See, for example, Rothstein et al, 1987; Smith et a/, (1988) Nature 334, 724-726; Zhang et a/, (1992) The Plant Cell 4, 1575-1588,
English et al., (1996) The Plant Cell 8, 179-188. Antisense technology is also reviewed in Bourque, (1995), Plant Science 105, 125-149, and Flavell, (1994) PNAS USA 91 , 3490- 3496.
An alternative to anti-sense is to use a copy of all or part of the target gene inserted in sense, that is the same, orientation as the target gene, to achieve reduction in expression of the target gene by co-suppression. See, for example, van der Krol et al., (1990) The Plant Cell 2, 291-299; Napoli et al., (1990) The Plant Cell 2, 279-289; Zhang et al., (1992) The Plant Cell 4, 1575-1588, and US-A-5,231 ,020. Further refinements of the gene silencing or co-suppression technology may be found in W095/34668 (Biosource); Angell & Baulcombe (1997) The EMBO Journal 16,12:3675-3684; and Voinnet & Baulcombe (1997) Nature 389: pg 553.
Double stranded RNA (dsRNA) has been found to be even more effective in gene silencing than both sense or antisense strands alone (Fire A. et al Nature, Vol 391 , (1998)). dsRNA mediated silencing is gene specific and is often termed RNA interference (RNAi) (See also Fire (1999) Trends Genet. 15: 358-363, Sharp (2001 ) Genes Dev. 15: 485-490, Hammond et al. (2001 ) Nature Rev. Genes 2: 1 110-1 119 and Tuschl (2001 ) Chem. Biochem. 2: 239-245).
RNA interference is a two step process. First, dsRNA is cleaved within the cell to yield short interfering RNAs (siRNAs) of about 21-23nt length with 5' terminal phosphate and 3' short overhangs (~2nt) The siRNAs target the corresponding mRNA sequence specifically for destruction (Zamore P.D. Nature Structural Biology, 8, 9, 746-750, (2001 )
Another methodology known in the art for down-regulation of target sequences is the use of“microRNA” (miRNA) e.g. as described by Schwab et al 2006, Plant Cell 18, 1121- 1133. This technology employs artificial miRNAs, which may be encoded by stem loop precursors incorporating suitable oligonucleotide sequences, which sequences can be generated using well defined rules in the light of the disclosure herein.
The methods of the present invention embrace both the in vitro and in vivo production, or manipulation, of one or more glycosylated triterpenes. For example, TTG polypeptides may be employed in fermentation via expression in microorganisms such as e.g. E.coli, yeast and filamentous fungi and so on. In one embodiment, one or more newly characterised TTG sequences of the present invention may be used in these organisms in conjunction with one or more other biosynthetic genes.
In vivo methods are describe extensively above, and generally involve the step of causing or allowing the transcription of, and then translation from, a recombinant nucleic acid molecule encoding the TTG polypeptides.
In other aspects of the invention, the TTG polypeptides (enzymes) may be used in vitro, for example in isolated, purified, or semi-purified form. Optionally they may be the product of expression of a recombinant nucleic acid molecule.
Scaffold modification by AATs of the invention
The inventors have shown that incubation of the recombinant AsAAT 1 enzyme preparation with a range of triterpenoid acceptors generates new products. Example acceptors include the the b-amyrin derivatives oleanolic acid, hederagenin and 18b- glycyrrhetinic acid, which all have the pentacyclic C-30 b-amyrin scaffold.
Efficient conversion was also observed with lupeol, which has a different scaffold (also pentacyclic but with a 5 carbon E ring instead of the 6 carbon ring present in b-amyrin).
Figure imgf000029_0001
b-Amyrin Lupeol Dammarenediol II
The inventors have shown that AsAAT 1 is able to utilise other oxygenated b-amyrin derivatives. This was done by generating different oxygenated b-amyrin scaffolds using combinatorial synthesis:
Figure imgf000030_0002
Figure imgf000030_0001
The results indicate a high level of extreme acceptor promiscuity of AsAATI .
AsAATI was also shown to be active towards the triterpenoid scaffold dammarenediol II and the oxygenated form of this, protopanaxadiol, which is the precursor of bioactive ginsenosides. The dammarenediol II scaffold is distinct from the b-amyrin scaffold in that it is C-30 but tetracyclic rather than pentacyclic.
Marker assisted breeding
The disclosure of the TTG-genes of the present invention also provides novel methods of plant breeding and selection, for instance to manipulate phenotypes such as disease resistance, or flavours. A further aspect of the present invention provides a method for assessing the
glycosylated triterpene biosynthesis phenotype of a plant, the method comprising the step of determining the presence and/or identity of a terpene glycosylating encoding allele therein comprising the use of a TTG nucleic acid as described above. Such a diagnostic test may be used with transgenic or wild-type plants, and such plants may or may not be mutant lines e.g. obtained by chemical mutagenesis.
The use of diagnostic tests for alleles allows the researcher or plant breeder to establish, with full confidence and independent from time consuming biochemical tests, whether or not a desired allele is present in the plant of interest (or a cell thereof), whether the plant is a representative of a collection of other genetically identical plants (e.g. an inbred variety or cultivar) or one individual in a sample of related (e.g. breeders’ selection) or unrelated plants.
In a breeding scheme based on selection and selfing of desirable individuals, nucleic acid or polypeptide diagnostics for the desirable allele or alleles in high throughput, low cost assays as provided by this invention, reliable selection for the preferred genotype can be made at early generations and on more material than would otherwise be possible. This gain in reliability of selection plus the time saving by being able to test material earlier and without costly phenotype screening is of considerable value in plant breeding.
Nucleic acid-based determination of the presence or absence of one or more desirable alleles may be combined with determination of the genotype of the flanking linked genomic DNA and other unlinked genomic DNA using established sets of markers such as RFLPs, microsatellites or SSRs, AFLPs, RAPDs etc. This enables the researcher or plant breeder to select for not only the presence of the desirable allele but also for individual plant or families of plants which have the most desirable combinations of linked and unlinked genetic background. Such recombinations of desirable material may occur only rarely within a given segregating breeding population or backcross progeny. Direct assay of the locus as afforded by the present invention allows the researcher to make a stepwise approach to fixing (making homozygous) the desired combination of flanking markers and alleles, by first identifying individuals fixed for one flanking marker and then identifying progeny fixed on the other side of the locus all the time knowing with confidence that the desirable allele is still present.
Antibodies
In a further embodiment, there are provided antibodies raised to a TTG polypeptide or peptide of the invention
Purified protein according to the present invention, or a fragment, mutant, derivative or variant thereof, e.g. produced recombinantly by expression from encoding nucleic acid therefor, may be used to raise antibodies employing techniques which are standard in the art. Antibodies and polypeptides comprising antigen-binding fragments of antibodies may be used in identifying homologues from other species as discussed further below.
Methods of producing antibodies include immunising a mammal (e.g. human, mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof. Antibodies may be obtained from immunised animals using any of a variety of techniques known in the art, and might be screened, preferably using binding of antibody to antigen of interest. For instance, Western blotting techniques or immunoprecipitation may be used (Armitage et al, 1992, Nature 357: 80-82). Antibodies may be polyclonal or monoclonal.
As an alternative or supplement to immunising a mammal, antibodies with appropriate binding specificity may be obtained from a recombinantly produced library of expressed immunoglobulin variable domains, e.g. using lambda bacteriophage or filamentous bacteriophage which display functional immunoglobulin binding domains on their surfaces; for instance see W092/01047.
Antibodies raised to a polypeptide or peptide can be used in the identification and/or isolation of homologous polypeptides, and then the encoding genes.
Antibodies may be modified in a number of ways. Indeed the term“antibody” should be construed as covering any specific binding substance having a binding domain with the required specificity. Thus, this term covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including any polypeptide comprising an immunoglobulin binding domain, whether natural or synthetic.
Utility of newly characterised sequences in identifying new TTGS
The nucleotide sequence information provided herein may be used to design probes and primers for probing or amplification. An oligonucleotide for use in probing or PCR may be about 30 or fewer nucleotides in length (e.g. 18, 21 or 24). Generally specific primers are upwards of 14 nucleotides in length. For optimum specificity and cost effectiveness, primers of 16-24 nucleotides in length may be preferred. Those skilled in the art are well versed in the design of primers for use in processes such as PCR. If required, probing can be done with entire restriction fragments of the gene disclosed herein which may be 100's or even 1000's of nucleotides in length. Small variations may be introduced into the sequence to produce‘consensus’ or‘degenerate’ primers if required.
Probing may employ the standard Southern blotting technique. For instance DNA may be extracted from cells and digested with different restriction enzymes. Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probe may be hybridised to the single stranded DNA fragments on the filter and binding determined. DNA for probing may be prepared from RNA preparations from cells. Probing may optionally be done by means of so-called ‘nucleic acid chips’ (see Marshall & Hodgson (1998) Nature Biotechnology 16: 27-31 , for a review).
In one embodiment, a variant encoding a TTG polypeptide in accordance with the present invention is obtainable by means of a method which includes:
(a) providing a preparation of nucleic acid, e.g. from plant cells. Test nucleic acid may be provided from a cell as genomic DNA, cDNA or RNA, or a mixture of any of these, preferably as a library in a suitable vector. If genomic DNA is used the probe may be used to identify untranscribed regions of the gene (e.g. promoters etc.), such as are described hereinafter,
(b) providing a nucleic acid molecule which is a probe or primer as discussed above,
(c) contacting nucleic acid in said preparation with said nucleic acid molecule under conditions for hybridisation of said nucleic acid molecule to any said gene or homologue in said preparation, and,
(d) identifying said gene or homologue if present by its hybridisation with said nucleic acid molecule. Binding of a probe to target nucleic acid (e.g. DNA) may be measured using any of a variety of techniques at the disposal of those skilled in the art. For instance, probes may be radioactively, fluorescently or enzymatically labelled. Other methods not employing labelling of probe include amplification using PCR (see below), RN’ase cleavage and allele specific oligonucleotide probing. The identification of successful hybridisation is followed by isolation of the nucleic acid which has hybridised, which may involve one or more steps of PCR or amplification of a vector in a suitable host.
Preliminary experiments may be performed by hybridising under low stringency conditions. For probing, preferred conditions are those which are stringent enough for there to be a simple pattern with a small number of hybridisations identified as positive which can be investigated further.
For example, hybridizations may be performed, according to the method of Sambrook et al. (below) using a hybridization solution comprising: 5X SSC (wherein‘SSC’ = 0.15 M sodium chloride; 0.15 M sodium citrate; pH 7), 5X Denhardt’s reagent, 0.5-1.0% SDS,
100 mg/ml denatured, fragmented salmon sperm DNA, 0.05% sodium pyrophosphate and up to 50% formamide. Hybridization is carried out at 37-42°C for at least six hours.
Following hybridization, filters are washed as follows: (1 ) 5 minutes at room temperature in 2X SSC and 1 % SDS; (2) 15 minutes at room temperature in 2X SSC and 0.1 % SDS; (3) 30 minutes - 1 hour at 37°C in 1X SSC and 1 % SDS; (4) 2 hours at 42-65°C in 1 X SSC and 1 % SDS, changing the solution every 30 minutes.
One common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is (Sambrook et al., 1989):
Tm = 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex
As an illustration of the above formula, using [Na+] = [0.368] and 50-% formamide, with GC content of 42% and an average probe size of 200 bases, the Tm is 57°C. The Tm of a DNA duplex decreases by 1 - 1.5°C with every 1 % decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42°C. Such a sequence would be considered substantially homologous to the nucleic acid sequence of the present invention.
It is well known in the art to increase stringency of hybridisation gradually until only a few positive clones remain. Other suitable conditions include, e.g. for detection of sequences that are about 80-90% identical, hybridization overnight at 42°C in 0.25M Na2HP04, pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 55°C in 0.1X SSC, 0.1 % SDS. For detection of sequences that are greater than about 90% identical, suitable conditions include hybridization overnight at 65°C in 0.25M Na2HP04, pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 60°C in 0.1X SSC, 0.1 % SDS.
In a further embodiment, hybridization of a nucleic acid molecule to a variant may be determined or identified indirectly, e.g. using a nucleic acid amplification reaction, particularly the polymerase chain reaction (PCR). PCR requires the use of two primers to specifically amplify target nucleic acid, so preferably two nucleic acid molecules with sequences characteristic of a TTG gene of the present invention are employed. Using RACE PCR, only one such primer may be needed (see "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, Academic Press, New York, (1990)).
Thus a method involving use of PCR in obtaining nucleic acid according to the present invention may include:
(a) providing a preparation of plant nucleic acid, e.g. from a seed or other appropriate tissue or organ,
(b) providing a pair of nucleic acid molecule primers useful in (i.e. suitable for) PCR, at least one of said primers being a primer according to the present invention as discussed above,
(c) contacting nucleic acid in said preparation with said primers under conditions for performance of PCR,
(d) performing PCR and determining the presence or absence of an amplified PCR product. The presence of an amplified PCR product may indicate identification of a variant.
In all cases above, if need be, clones or fragments identified in the search can be extended. For instance if it is suspected that they are incomplete, the original DNA source (e.g. a clone library, mRNA preparation etc.) can be revisited to isolate missing portions e.g. using sequences, probes or primers based on that portion which has already been obtained to identify other clones containing overlapping sequence.
Additional definitions
“Nucleic acid” according to the present invention may include cDNA, RNA, genomic DNA and modified nucleic acids or nucleic acid analogs (e.g. peptide nucleic acid). Where a DNA sequence is specified, e.g. with reference to a figure, unless context requires otherwise the RNA equivalent, with U substituted for T where it occurs, is encompassed. Nucleic acid molecules according to the present invention may be provided isolated and/or purified from their natural environment, in substantially pure or homogeneous form, or free or substantially free of other nucleic acids of the species of origin, and double or single stranded. Where used herein, the term“isolated” encompasses all of these possibilities. The nucleic acid molecules may be wholly or partially synthetic. In particular they may be recombinant in that nucleic acid sequences which are not found together in nature (do not run contiguously) have been ligated or otherwise combined artificially. Nucleic acids may comprise, consist, or consist essentially of, any of the sequences discussed hereinafter. The term "heterologous" is used broadly herein to indicate that the gene/sequence of nucleotides in question (e.g. encoding triterpene-biosynthesis modifying polypeptides) have been introduced into said cells of the host or an ancestor thereof, using genetic engineering, i.e. by human intervention. Nucleic acid heterologous to a host cell will be non-naturally occurring in cells of that type, variety or species. Thus the heterologous nucleic acid may comprise a coding sequence of or derived from a particular type of plant cell or species or variety of plant, placed within the context of a plant cell of a different type or species or variety of plant. A further possibility is for a nucleic acid sequence to be placed within a cell in which it or a homologue is found naturally, but wherein the nucleic acid sequence is linked and/or adjacent to nucleic acid which does not occur naturally within the cell, or cells of that type or species or variety of plant, such as operably linked to one or more regulatory sequences, such as a promoter sequence, for control of expression.
“Transformed” in this context means that the nucleotide sequences of the heterologous nucleic acid alter one or more of the cell’s characteristics and hence phenotype e.g. with respect to triterpene biosynthesis. Such transformation may be transient or stable.
A number of patents and publications are cited herein in order to more fully describe and disclose the invention and the state of the art to which the invention pertains. Each of these references is incorporated herein by reference in its entirety into the present disclosure, to the same extent as if each individual reference was specifically and individually indicated to be incorporated by reference.
Throughout this specification, including the claims which follow, unless the context requires otherwise, the word“comprise,” and variations such as“comprises” and “comprising,” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
It must be noted that, as used in the specification and the appended claims, the singular forms“a,”“an,” and“the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to“a pharmaceutical carrier” includes mixtures of two or more such carriers, and the like.
Ranges are often expressed herein as from“about” one particular value, and/or to“about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent“about,” it will be understood that the particular value forms another embodiment.
Any sub-titles herein are included for convenience only, and are not to be construed as limiting the disclosure in any way. The invention will now be further described with reference to the following non-limiting Figures and Examples. Other embodiments of the invention will occur to those skilled in the art in the light of these.
The disclosure of all references cited herein, inasmuch as it may be used by those skilled in the art to carry out the invention, is hereby specifically incorporated herein by cross- reference.
Armah, C. N., A. R. Mackie, C. Roy, K. Price, A. E. Osbourn, P. Bowyer and S. Ladha (1999). "The membrane-permeabilizing effect of avenacin A-1 involves the reorganization of bilayer cholesterol." Biophys J 76(1 ): 281-290.
Augustin, J. M., V. Kuzina, S. B. Andersen and S. Bak (201 1 ). "Molecular activities, biosynthesis and evolution of triterpenoid saponins." Phytochemistry 72(6): 435-457. Bernard, F. X., S. Sable, B. Cameron, J. Provost, J. F. Desnottes, J. Crouzet and F.
Blanche (1997). "Glycosylated flavones as selective inhibitors of topoisomerase IV." Antimicrob Agents Chemother 41 (5): 992-998.
Bowles, D., E. K. Lim, B. Poppenberger and F. E. Vaistij (2006). "Glycosyltransferases of lipophilic small molecules." Annu Rev Plant Biol 57: 567-597.
Francis, G., Z. Kerem, H. P. Makkar and K. Becker (2002). "The biological action of saponins in animal systems: a review." Br J Nutr 88(6): 587-605.
Geisler, K., R. K. Hughes, F. Sainsbury, G. P. Lomonossoff, M. Rejzek, S. Fairhurst, C. E. Olsen, M. S. Motawia, R. E. Melton, A. M. Hemmings, S. Bak and A. Osbourn (2013). "Biochemical analysis of a multifunctional cytochrome P450 (CYP51 ) enzyme required for synthesis of antimicrobial triterpenes in plants." Proc Natl Acad Sci U S A 110(35): 3360- 3367.
Haralampidis, K., G. Bryan, X. Qi, K. Papadopoulou, S. Bakht, R. Melton and A. Osbourn (2001 ). "A new class of oxidosqualene cyclases directs synthesis of antimicrobial phytoprotectants in monocots." Proc Natl Acad Sci U S A 98(23): 13431-13436.
Hughes, J. and M. A. Hughes (1994). "Multiple secondary plant product UDP-glucose glucosyltransferase genes expressed in cassava ( Manihot esculenta Crantz) cotyledons." DNA Seq 5(1 ): 41-49.
Kamo, S., S. Suzuki and T. Sato (2014). "The content of soyasaponin and soyasapogenol in soy foods and their estimated intake in the Japanese." Food Sci Nutr 2(3): 289-297. Kubo, A., Y. Arai, S. Nagashima and T. Yoshikawa (2004). "Alteration of sugar donor specificities of plant glycosyltransferases by a single point mutation." Arch Biochem Biophys 429(2): 198-203.
Liu, Z., Y. Liu, Z. Pu, J. Wang, Y. Zheng, Y. Li and Y. Wei (2013). "Regulation, evolution, and functionality of flavonoids in cereal crops." Biotechnol Lett 35(1 1 ): 1765-1780.
Mackenzie, P. I., I. S. Owens, B. Burchell, K. W. Bock, A. Bairoch, A. Belanger, S.
Fournel-Gigleux, M. Green, D. W. Hum, T. lyanagi, D. Lancet, P. Louisot, J. Magdalou, J. R. Chowdhury, J. K. Ritter, H. Schachter, T. R. Tephly, K. F. Tipton and D. W. Nebert (1997). "The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence." Pharmacogenetics 7(4): 255-269. Mugford, S. T., T. Louveau, R. Melton, X. Qi, S. Bakht, L. Hill, T. Tsurushima, S.
Honkanen, S. J. Rosser, G. P. Lomonossoff and A. Osbourn (2013). "Modularity of plant metabolic gene clusters: A trio of linked genes that are collectively required for acylation of triterpenes in oat." Plant Cell 25(3): 1078-1092.
Noguchi, A., M. Horikawa, Y. Fukui, M. Fukuchi-Mizutani, A. luchi-Okada, M. Ishiguro, Y. Kiso, T. Nakayama and E. Ono (2009). "Local differentiation of sugar donor specificity of flavonoid glycosyltransferase in Lamiales." Plant Cell 21 (5): 1556-1572.
Osbourn, A. (1996). "Saponins and plant defence - a soap story." Trends in plant science 1(1 ): 4-9.
Osbourn, A., P. Bowyer, P. Lunness, B. Clarke and M. Daniels (1995). "Fungal pathogens of oat roots and tomato leaves employ closely related enzymes to detoxify different host plant saponins." Mol Plant Microbe Interact 8(6): 971-978.
Osbourn, A., R. J. Goss and R. A. Field (2011 ). "The saponins: polar isoprenoids with important and diverse biological activities." Nat Prod Rep 28(7): 1261-1268.
Osmani, S. A., S. Bak, A. Imberty, C. E. Olsen and B. L. Moller (2008). "Catalytic key amino acids and UDP-sugar donor specificity of a plant glucuronosyltransferase,
UGT94B1 : molecular modeling substantiated by site-specific mutagenesis and biochemical analyses." Plant Physiol 148(3): 1295-1308.
Osmani, S. A., S. Bak and B. L. Moller (2009). "Substrate specificity of plant UDP- dependent glycosyltransferases predicted from crystal structures and homology modeling." Phytochemistry 70(3): 325-347.
Owatworakit, A., B. Townsend, T. Louveau, H. Jenner, M. Rejzek, R. K. Hughes, G. Saalbach, X. Qi, S. Bakht, A. Deb Roy, S. T. Mugford, R. J. Goss, R. A. Field and A. Osbourn (2012). "Glycosyltransferases from oat (Avena) implicated in the acylation of avenacins." J Biol Chem 288(6): 3696-3704.
Papadopoulou, K., R. E. Melton, M. Leggett, M. J. Daniels and A. E. Osbourn (1999). "Compromised disease resistance in saponin-deficient plants." Proc Natl Acad Sci U S A 96(22): 12923-12928.
Piochon, M., J. Legault, C. Gauthier and A. Pichette (2009). "Synthesis and cytotoxicity evaluation of natural alpha-bisabolol beta-D-fucopyranoside and analogues."
Phytochemistry 70(2): 228-236.
Rehman, H. M., M. A. Nawaz, Z. H. Shah, S. H. Yang and G. Chung (2018). "Functional characterization of naturally occurring wild soybean mutant (sg-5) lacking astringent saponins using whole genome sequencing approach." Plant Sci 267: 148-156.
Reuben, S., L. J. Cseke, V. S. Bhinu, K. Narasimhan, M. Jeyakumar and S. Swarup (2006). Molecular biology of plant natural products. Natural products from plants. L. J. Cseke, A. Kirakosyan, P. B. Kaufman et al. Boca Raton, CRC Press/Taylor & Francis: 61 1-202.
Ross, J., Y. Li, E. Lim and D. J. Bowles (2001 ). "Higher plant glycosyltransferases." Genome Biol 2(2): REVIEWS3004.
Sawai, S. and K. Saito (2011 ). "Triterpenoid biosynthesis and engineering in plants."
Front Plant Sci 2: 25.
Vetter, J. (2000). "Plant cyanogenic glycosides." Toxicon 38(1 ): 11-36.
Vincken, J. P., L. Heng, A. de Groot and H. Gruppen (2007). "Saponins, classification and occurrence in the plant kingdom." Phytochemistry 68(3): 275-297. Vogt, T. and P. Jones (2000). "Glycosyltransferases in plant natural product synthesis: characterization of a supergene family." Trends Plant Sci 5(9): 380-386.
Yang, S. H., E. K. Ahn, J. A. Lee, T. S. Shin, C. Tsukamoto, J. W. Suh, I. Mei and G. Chung (2015). "Soyasaponins Aa and Ab exert an anti-obesity effect in 3T3-L1 adipocytes through downregulation of PPARgamma." Phytother Res 29(2): 281-287. Yonekura-Sakakibara, K., T. Tohge, F. Matsuda, R. Nakabayashi, H. Takayama, R. Niida, A. Watanabe-Takahashi, E. Inoue and K. Saito (2008). "Comprehensive flavonol profiling and transcriptome coexpression analysis leading to decoding gene-metabolite correlations in Arabidopsis." Plant Cell 20(8): 2160-2176.
Figure imgf000039_0001
Figure imgf000040_0001
Figure imgf000041_0001
Figure imgf000042_0001
Figure imgf000043_0001
Figure imgf000044_0001
Figure imgf000045_0001
Figure imgf000046_0001
Figure imgf000047_0001
Figures
Figure 1. Saponins glycosylation, avenacin pathway. (A) Structures of two triterpene glycosides, avenacin A-1 from oat, and soyasaponin Ab (from soybean). (B) Current understanding of the oat avenacin biosynthetic pathway. Avenacin A-1 is synthesised from the linear isoprenoid precursor 2, 3-oxidosqualene. 2,3- Oxidosqualene is cyclized by the triterpene synthase AsbASI (SAD1 ) to the pentacyclic triterpene b-amyrin (Haralampidis et al., 2001 ). b-Amyrin is then oxidized to 12,13b-epoxy-16b-hydroxy-b-amyrin (ErHbA) by the cytochrome P450 enzyme AsCYP51 H10 (SAD2) (Geisler et al., 2013). Subsequent modifications involve a series of further oxygenations, the addition of a branched trisaccharide moiety at the C-3 position (initiated by introduction of an L-arabinose), and acylation at the C-21 position. Acylation is carried out by the serine carboxypeptidase-like acyl transferase AsSCPLI (SAD7), which uses /V-methyl anthranilate glucoside as the acyl donor generated by the methyl transferase AsMT1 and the glucosyl transferase UGT74H5 (SAD10) (Mugford et al., 2013; Mugford et al., 2009; Owatworakit et al., 2012). The uncharacterized steps are indicated by dotted arrows.
Figure 2. Mining for avenacin glycosyltransferase candidates. (A) Phylogenetic tree of GT 1 glycosyltransferases expressed in A. strigosa root tips. Predicted amino acid sequences from oat were aligned with published triterpenoid
glycosyltransferases (indicated in red and blue, respectively) as well as with a selection of other biochemically characterized plant UGTs (see Table S3). UGT groups are as defined by Ross, Li, Lim, and Bowles (2001 ). Some of the most common enzyme activities are indicated around the periphery in front of the corresponding branches. The tree was constructed using the Neighbour Joining method with 1000 bootstrap replicates (percentage values shown at branch points). The scale bar indicates 0.1 substitutions per site at the amino acid level. (B)
Expression profiles of selected UGT genes. Tissues harvested from 3-day old A. strigosa seedlings were used for mRNA-reverse transcription-PCR (RT-PCR).
Tissues were collected from the root tips (RT), elongation zone (EZ), whole root (WR) and leaves (L). The characterized avenacin biosynthetic gene AsUGT74H5 ( Sad10 ) and the glyceraldehyde 3-phosphate dehydrogenase ( GAPDH )
housekeeping gene were included as controls.
Figure 3. Biochemical characterisation of candidate oat UGTs. (A) In vitro assays to investigate sugar donor specificity. Recombinant UGTs were incubated overnight with 100 mM of 2,4,5-trichlorophenol (TCP) and various sugar nucleotide donors (400 mM UDP-Ara, UDP-GIc or UDP-Gal). Red, blue and yellow bars represent the conversion of TCP to TCP glucoside, galactoside and arabinoside, respectively. Height of the bars are drawn relative to the sugar unit showing the highest activity for each UGT (i.e. activity here refers at TCP to TCP glycoside conversion monitored by spectrophotometry at 405 nm). The characterised oat N- methyl anthranilate glycosyltransferase AsUGT74H5 (SAD10) and the A. thaliana flavonoid arabinosyltransferase UGT78D3 were included as control for glucosylation and arabinosylation, respectively. Values are means of three technical replicates; error bars represent standard deviations. (B) LC-MS profiles for avenacin A-1 (left), deglycosylated avenacin A-1 (middle), and the product generated by incubation of deglycosylated avenacin A-1 with AsUGT99D1 (right) (detection by fluorescence; Ex 353 nm/Em 441 nm). The hydrolysed avenacin product was drawn with an intact 12,13-epoxide (*), but this epoxide may have rearranged to a ketone under the acidic hydrolysis conditions resulting in deglycosylated 12-oxo-avenacin A-1 as observed previously (Geisler et al., 2013). (C) HPLC with charged aerosol detection (CAD) chromatograms of extracts from N. benthamiana leaves expressing UGT99D1 alone (blue), SAD1 and UGT99D1 (red) and SAD1 , SAD2 and UGT99D1 together (black). The new compound that accumulates in the latter (fR 12.0 min) is indicated by an asterisk. This compound is not detected when UGT99D1 is expressed on its own or with SAD1. The internal standard (IS) is digitoxin (1 mg/g of dwt). (D) Structure of the UGT99D1 product (see Figure 10 for NMR assignment).
Figure 4. Biochemical analysis of aat1 mutant and susceptibility to take-all disease. (A) Structures of the four avenacins. HPLC-CAD analysis of methanolic root extracts from seedlings of the A. strigosa wild type accession and the aat1 mutant (avenacin-deficient mutant line #807). New metabolites detected in the mutant are arrowed and corresponding structures are tentatively drawn based on ion chromatograms presented in Figure 1 1D. (B) Mutant aat1 has enhanced disease susceptibility. Images of representative seedlings of wild type A. strigosa (WT), the sad1 mutant #610 (Haralampidis et al., 2001 ), and the aat1 mutant. Seedlings were inoculated with the take-all fungus (G. graminis var. tritici). The dark lesions on the roots are symptoms of infection.
Figure 5. A new arabinosyltransferase from Glycine max. (A) Phylogenetic tree of glycosyltransferases from group D (UGT73s). GmSSAT is highlighted in red as well as AsAATI , and characterised triterpenoid glycosyltransferases in blue. UGT accession numbers and corresponding literature can be found in Table S3. The tree was rooted with UGT90A1 , an Arabidopsis UGT from group C; constructed using the Neighbour Joining method, with 1000 bootstrap replicates (percentage values shown at branch points). The scale bar indicates 0.1 substitutions per site at the amino acid level. (B) HPLC-CAD chromatogram of in vitro assays performed with recombinant GmSSAT. GmSSAT was incubated for 40 min at 25 °C with 100 mM soyasaponin I (SSI) and 300 mM UDP-sugars. A major product is detected only in the presence of UDP-Ara (*) (MS analysis of this product in Figure 13A). (C) HPLC-CAD analysis of reactions in which a previously characterised soyasaponin glucosyltransferase UGT73F2 (Sayama et al., 2012) was assayed for activity towards the GmSSAT product. Recombinant UGT73F2 was incubated overnight with 400 mM UDP-GIc and approx. 100 mM of GmSSAT product. HPLC-CAD analysis reveals complete conversion of SSI-Ara (fR: 10.6 min) to a new product (*) (fR: 8.6 min; MS analysis of this product in Figure 13B). No product is seen in the absence of UDP-GIc or if the acceptor is replaced by SSI. (D) Successive glycosylation of soyasaponin I by GmSSAT and UGT73F2.
Figure 6. H404 and P154 are mutually required for sugar specificity of AsAATI .
(A) Alignment of the amino acid sequences of the oat, soybean and A. thaliana arabinosyltransferases with their closest characterised glucosyltransferases in the region of the PSPG motif and the N5 loop. The histidine residue that is conserved in the arabinosyltransferases is shown in red as well as P154 of AsAATI . (B) Structural model of AsAATI with bound UDP-Ara. The protein is represented in green ribbons with the PSPG motif in salmon, including the side chains of highly conserved residues (salmon sticks). His404 and Pro154 are shown as magenta sticks. Probable hydrogen bonds are shown with yellow dots. A homology model was generated using the online software l-TASSER (Yang et al., 2015) based on the crystal structure of Medicago truncatula UGT71 G1 complexed with UDP-GIc (PDB: 2ACW). The loop shown in orange was reconstructed using MODELLER (Sali & Blundell, 1993). UDP- Ara (green sticks) was inserted into the active site and the complex was relaxed using GROMACS for energy minimisation. (C) HPLC-CAD chromatograms of extracts from N. benthamiana leaves expressing SAD1 , SAD2 together with GFP (black), AsAATI wild-type (blue), AsAATI -H404Q (green), AsAATI -P154S (red) and AsAATI -H404Q-P154S (orange). In vitro reaction of 12,13b-epoxy-16b-hydroxy-b- amyrin (ErHbA) with the four sugar donors led to the production of ErHbA glycosides co-eluting with new products (grey). Identities of the new products are further demonstrated by LCMS analysis (Figure 14C). The internal standard (IS) is digitoxin (1 mg/g of dwt). (D) Comparison of the glycosylation activity of AsAATI wild- type and mutants when fed with four sugar donors (UDP-Ara, UDP-Gal, UDP-Xyl or UDP-GIc). Initial velocities were measured using five time points, with 30 mM deglycosylated avenacin A-1 as acceptor and 5 pM UDP-sugar donors. Height of the bars are drawn relative to the highest activity observed for each AsAAT 1 enzyme (mean ± SD, n = 3).
Figure 7. Proteomic analysis of A. strigosa root samples.
Proteins were extracted from the tips and elongation zone of roots of 3day-old A. strigosa seedlings. LTQ-Orbitrap analysis was performed on size-fractionated proteins with molecular weights typical of UGTs (45-57 kDa). Raw data files were processed with MaxQuant to generate re-calibrated peaklist files, which were then used for a database search using an in-house Mascot server. The characterized avenacin pathway enzymes /V-methyl anthranilate glycosyltransferase UGT74H5 (SAD10), was more abundant in the protein preparations from the root tips compared with the elongation zone. Three other UGTs (indicated by asterisks) were also more abundant in the root tips. Values are means of three replicates.
Figure 8. Assays of AsUGT99D1 activity towards an early intermediate in the avenacin pathway.
(A) SDS-PAGE electrophoresis of recombinant 9xhistidine-tagged oat UGTs enriched using nickel resin. The heterologously expressed UGTs are indicated by arrows. (B) In the presence of UDP-Ara, AsUGT99D1 is active towards 12,13-epoxy- 16-hydroxy^-amyrin (ErHbA) the second intermediate in the avenacin pathway. Recombinant AsUGT99D1 (200 ng) was incubated overnight with ErHbA (200 pM) and three different sugar donors (UDP-Ara, UDP-GIc and UDP-Gal; 400 pM). The assays were analysed by TLC after overnight incubation at 30°C. The TLC was stained with 10% sulfuric acid in methanol and the picture was taken under UV illumination (wavelength 365 nm).
Figure 9. AsUGT99D1 has activity towards the avenacin pathway intermediate 12,13- epoxy-16-hydroxy^-amyrin (ErHbA). (A) GC-MS analysis of extracts from agro-infiltrated Nicotiana benthamiana leaves. Co-expression of SAD1 and SAD2 leads to accumulation of ErHbA (1R 12.9 min). When SAD1 and SAD2 are co-expressed with UGT99D1 , ErHbA is consumed. The upper chromatogram consists of a control from leaves expressing GFP only. (B) HPLC-charged aerosol detection (CAD) chromatogram of extracts from leaves co- expressing SAD1 , SAD2 and UHT99D1 (black). Traces for in vitro assays of
UGT99D1 activity with ErHbA as a substrate and for the major product purified from N. benthamiana leaves for structural determination (Figure 2) are also shown. The minor peak with a retention time of 9.7 min (indicated with an asterisk) is likely to be a degradation product of the major one, since the 12, 13-epoxide is known to open easily to form a C-12 ketone. Both peaks have the same mass, consistent with this.
Figure 10. 1H and 13C NMR of the major product generated by co-expression of SAD1 , SAD2 and UGT99D1 in N. benthamiana.
13C & 1H d assignments for 12, 13b-epoxy-16b-hydroxy-b-amyrin 3-O-a-L-arabinoside. MeOH -d4 [referenced to TMSj. Coupling constants are reported as observed and not corrected for second order effects. Assignments were made via a combination of 1 H, 13C, COSY, DEPT-edited HSQC, and HMBC experiments. Where signals overlap 1H d is reported as the centre of the respective HSQC cross peak.
Figure 11. Characterization of the avenacin-deficient oat mutant #807.
(A) Mutant line #807 has a single nucleotide variation in AsAATI at base 735 when compared with the wild type gene (a G to A mutation). (B) Chemotyping of the #807 mutant by TLC. Methanolic extract of roots of 3day-old seedlings were separated by TLC using chloroform:methanol:water (13:6:1 ) as the mobile phase. (C) TLC separation of root extracts from seedlings of F2 progeny from a cross between the wild type A. strigosa line and mutant #807. Pictures of the corresponding F2 seedlings, shown in the lower panel, do not show any obvious root morphology phenotype. (D) Extracted ion chromatograms of the new peaks detected in mutant root extract in Figure 4 A with proposed structures. (E) Graph showing the severity of take-all disease symptoms in wildtype A. strigosa, a previously characterized avenacin deficient sad1 mutant and an aat1 line. Seedlings were inoculated with the take-all fungus (G. graminis var tritici) and scored for disease symptoms three weeks later.
Figure 12. Sequence of the scaffold containing AsAATI in A. atlantica.
Scaffold number 0128702 was mapped by survey sequencing to the same
recombination interval as the Sad2 locus, centred at 0.66 cM on linkage group 7 of the A. atlantica genome zipper. The coding sequence of the AsAATI gene is highlighted in grey.
Figure 13. HR-MS analysis of the products of recombinant soybean UGTs GmSSAT and UGT73F2 as well as gene expression pattern of GmSSAT compare to other genes involved in soyasaponin biosynthesis.
(A) LC-IT-TOF MS and MS/MS spectra for the reaction product generated by
GmSSAT incubated with UDP-Ara and soyasaponin I (see Figure 5 B for the corresponding CAD chromatogram). The loss of 108 Da (indicated with an asterisk) can be explained by cross-ring cleavage of the uronic acid residue (Pollier, Morreel, Geelen, & Goossens, 2011 ). (B) LC-IT-TOF analysis in negative mode indicates that the UGT73F2 product is likely to be the glucoside of soyasaponin I arabinoside (see Figure 5C for the corresponding CAD chromatogram). (C) Expression profiles of genes involved in soyasaponin biosynthesis (downloaded from
http://www.soybase.org). Expression levels are normalised for each sample as a ratio over the tissue were the transcript is the most abundant. Red, high expression;
yellow, low expression. DAF: Days After Flowering.
Figure 14. Mutation of AsAATI : purified recombinant enzymes and LCMS analysis of glycosides produced in N. benthamiana tissues expressing AsAATI mutants.
(A) SDS-PAGE electrophoresis of recombinant 9xhistidine-tagged AsAATI wild-type and mutants purified by ion metal affinity chromatography (IMAC). (B) Configuration of the 4 sugar units present in sugar donors used for in vitro analysis of AsAATI mutants (Figure 6 D). (C) Comparison of LCMS chromatograms of N. benthamiana extracts shown in Figure 6 and ErHbA glycosides produced in vitro. In the left panel, LCMS analysis of extracts from N. benthamiana leaves expressing SAD1 , SAD2 together with GFP, AsAATI wild-type, AsAATI -H404Q, AsAATI -P154S and
AsAATI -H404Q-P154S (samples analysed by HPLC-CAD in Figure 6 C). In the right panel, chromatograms of in vitro reaction performed overnight with recombinant AsAAT1-H404Q incubated with 30 mM ErHbA and 100 mM UDP-sugar. Selected ion chromatograms of the chlorate adducts corresponding to ErHbA hexosides (m/z 655.0, blue) ErHbA pentosides (m/z 625.0, red) are shown as well as total ion chromatogram in negative mode (black). The“double peak” shape observed for ErHbA glycosides seems to be due to product degradation; the opening of the 12, 13-epoxide resulting in C-12 ketone (as seen in Fig 9S).
Figure 15: 15A Phylogenetic analysis of A. strigosa UGT candidates (red circles) with characterised UGTs from other plant species (listed in Supplementary Table 1 ). Functionally characterised glycoside glycosyltransferases (GGTs) (see
Supplementary Table 2) are indicated (blue circles). The UGT phylogenetic groups (Groups A-N) are labelled as described in (Ross et al., 2001 ; Caputi et al., 2012). Figure 15B RT-PCR expression profile of candidate UGTs in Groups A, D and O.
The profile of the previously characterised Sad10 ( AsUGT74H5 ) and AsAATI
( AsUGT99D1 ) genes and the housekeeping oat glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) gene were included as positive controls. RNA was extracted from 3-day-old Avena strigosa plants. The oat tissues used are illustrated: root tips (RT), elongation zones (EZ), whole roots (WR) and young leaves (L).
Figure 16: Biochemical analysis of recombinant AsUGT91 G16 and AsUGT91 G16 mutants. Figure 16A, The in vitro enzymatic reaction with AsUGT91 G16 with bis- deglucosyl avenacin A-1 and UDP-glucose resulted in a new product peak at 4.8 minutes with the expected mass of mono-deglucosyl avenacin A-1 ( m/z = 931.1 ) in analysis by HPLC-UV-MS. Protein preparations for control reactions had been boiled at 95°C for 10 minutes. Data are representative of two separate experiments.
Absorbance was measured at 357nm (Begley et al., 1986). Figure 16B, HPLC-MS with Charged Aerosol Detection (CAD) analysis of extracts from infiltrated N.
benthamiana leaves. Accumulation of 12,13b-epoxy-16b-hydroxy-b-amyrin-3-0 - ol- arabinose (ErHbA-3-O -Ara) was detected in leaves expressing AsbASI , AsCYP51 H10 and AsAATI . The addition of AsUGT91 G16 resulted in lower levels of ErHbA-3-O-Ara and the accumulation of new peaks with the mass of ErHbA-3-O- Ara with the addition of one [m/z = 751 , Rt = 14.4 and 16.8 min], or two [m/z = 913,
Rt = 13.3 and 15.3 min] hexoses, respectively. The structure as analysed by NMR of the AsUGT91 G16 product peak (highlighted by asterisk) is illustrated. Figure 16C, HPLC-CAD analysis of methanolic root extracts. WT (S75) roots contain the four avenacins: avenacin A-1 , A-2, B-1 and B2 (turquoise trace) (Crombie and Crombie, 1986). sad1 mutants (#109) are mutated in the first committed step of the avenacin biosynthetic pathway and do not accumulate any avenacins (purple trace). sad4 mutants (#9) accumulate the four avenacins and mono-deglucosylated forms (black trace). sad3 mutants (#1139) accumulate mono-deglucosyl avenacins (dark blue trace). Mutants (#85, #543, #1073 and #1473) do not accumulate avenacins but accumulate two major products (18.3 min and 20.5 min) that are less polar than the avenacins (green, dark red, blue and pink traces). Avenacin A-1 standard is shown in red. Figure 16D, Reduced fluorescence of roots of AsUGT91G16 mutants #543 and #1473 compared to wild type (S75) seedlings. Photo credits: Andrew Davis, John Innes Centre sad mutant numbers are as described in Papadopoulou et al. (1999).
Figure 17: Biochemical analysis of AsTG. Figure 17A, Phylogenetic tree of AsTG with other plant glycosyl hydrolase family 1 proteins. GH1 family members of rice (Opassiri et al., 2006) and Arabidopsis (Xu et al., 2004) were included in the analysis, as well as sequences from other plant species. The phylogenetic clusters that include rice and Arabidopsis sequences (At/Os 1-8) and the Arabidopsis clusters (At I and II) are labelled as designated in Opassiri et al., 2006, in addition to the monocot plastid b-glucosidases as in Ketudat Cairns et al., 2012. The tree is drawn as an unrooted tree but is rooted by the outgroup, At/Os 8, which contains the chloroplastic A.
thaliana AtSFR2 and the rice homologue, OsSFR2. Enzymes with reported transglycosylase activity are indicated (blue circles) and the Avena strigosa AsTG is highlighted (red circle). Figure 17B, RT-PCR expression profile of AsTG. The profile of the previously characterised AsbASI ( Sadi ) gene and the housekeeping oat glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) gene were included as positive controls. Oat tissues used are illustrated: root tips (RT), elongation zone (EZ), whole roots (WR) and young leaves (L). RNA was extracted from 3-day-old A. strigosa plants.; Figure 17C, HPLC-UV-MS analyses of the enzymatic reactions with 4-nitrophenyl b-d-glucoside and mono-deglucosyl avenacin A-1 with a boiled protein preparation of AsTG (control reaction) and AsTG. The enzymatic reaction with active AsTG resulted in a new peak at 4.4 minutes ([M-H] m/z = 1092.1 ). Protein preparations for control reactions had been boiled at 95°C for 10 minutes. Data are representative of two separate experiments. Absorbance was measured at 357nm (Begley et al., 1986). Figure 17D, HPLC-CAD analysis of extracts from infiltrated N. benthamiana leaves. Co-expression of AsbASI, AsCYP51H10 and AsAATI results in the accumulation of 12,13b-epoxy-16b-hydroxy-b-amyrin-3-0-a-L-arabinose (ErHbA-3-O-Ara). Co-expression of AsbASI, AsCYP51H10, AsAATI with
AsUGT91G16 results in the accumulation of peaks with the mass of 12,13b-epoxy- 16b-hydroxy-b-amyrin-3-0-b-D-glucosyl-[1 ,2]-a-L-arabinose (ErHbA-3-O-Ara-Glu). The addition of AsTG results in a new peak with the mass of ErHbA-3-O-Ara-Glu with the addition of one hexose [m/z = 913.4, retention time = 12.8 min]. This peak was not present when the N-terminal signal peptide of AsTG was deleted (NOSIG- AsTG). AsTG is dependent on the activity of AsUGT91 G16, as co-expression of AsTG with AsbASI, AsCYP51H10 and AsAATI results only in ErHbA-3-O-Ara. Additional peaks with the mass of ErHbA-3-O-Ara with two or three hexoses (m/z = 913 or 1075, respectively) are also present which may be the action of endogenous N. benthamiana glycosyltransferases. Data are representative of two experiments. IS = internal standard (digitoxin).
Figure 18; HPLC-MS analyses of the in vitro enzymatic reactions of AsUGT91 G16 and AsTG. Figure 18A, Mass of adducts formed in LC-MS of bis-deglucosyl avenacin A-1 , mono-deglucosyl avenacin A-1 and avenacin A-1 in negative mode; Figure 18B,The in vitro enzymatic reaction with AsUGT91 G16 with bis-deglucosyl avenacin A-1 and UDP-glucose resulted in a new product peak at 4.8 minutes with the expected mass of mono-deglucosyl avenacin A-1 ([M+CI] m/z = 966.2). Figure 18C, The in vitro enzymatic reaction with AsTG with 4-nitrophenyl b-D-glucoside and mono-deglucosyl avenacin A-1. The enzymatic reaction with active AsTG resulted in a peak at 4.4 minutes ([M-H] m/z = 1092.1 ; [M+CI] m/z = 1 128.2). Protein preparations for control reactions had been boiled at 95°C for 10 minutes. Data are representative of two separate experiments.
Figure 19: Figure 19A, HPLC-MS with Charged Aerosol Detection (CAD) analysis of extracts from infiltrated N. benthamiana leaves expressing AsbASI, AsCYP51H10, AsAATI and AsUGT91G16. Methanolic extracts from single leaves (top trace) accumulate two peaks with the mass of 12,13b-epoxy-16b-hydroxy- b-amyrin-3-0- b- D-glucosyl-[1 ,2]- a-L-arabinose (EpHbA-3-O-Ara-Glu) [m/z = 751 , Rt = 15.2 and 17.4 min], and two peaks with the mass of EpHbA-3-O-Ara-Glu with the addition of a hexose [m/z = 913, Rt = 14.0 and 16.1 min] IS = internal standard (digitoxin).
Analysis of leaves extracted by pressurised solvent extraction revealed only one peak (14.4 min) with the mass of EpHbA-3-O-Ara-Glu. Figure 19B, Carbon numbering scheme and ^C NMR assignments of the purified peak at 14.4 minutes as listed below.
Figure 20: Characterisation of avenacin-deficient oat mutants.
Figure 20A, Single nucleotide variations in the AsUGT91G16 gene are highlighted for mutants #85 (G963A), #543 (G375A), #1073 (G776A) and #1473 (G775A).
Figure 20B, Single nucleotide variations in the AsTG gene are highlighted for sad3 mutants #1139 (G1800A), #105 (G1705A), #368 (G216A) and #891 (C481T).
Figure 21 : HPLC-IT-ToF analysis of mutant #85 root extract. Figure 21 A, Total ion chromatogram (TIC) of the #85 mutant root extract in negative mode shows two major peaks at 2.2 minutes and 2.7 minutes with the mass of avenacin A-2 and avenacin A-1 respectively with the loss of a hexose and the loss of the oxidation at the C-30 position. Predicted product structures are shown, Ara = L-arabinose, Glc = D-glucose. The mass spectra (MS) of the peak (Figure 21 B) between 1.87-2.40 minutes and the peak (Figure 21 D) between 2.65-2.73 minutes shows signals consistent with the mass ion ([M-H] ) and the formate adduct ([M+HCOO] ) of the predicted product structures. The MS2 spectrum of the fragmentation of the mass ion of each predicted product structure (Figure 21 C) (precursor mass ion for
fragmentation = m/z 887.4843) and (Figure 21 E) (precursor mass ion for
fragmentation = m/z 916.5106) showed signals consistent with the loss of a glucose molecule ([M-Glc-H] ). The difference in observed and expected mass values in parts per million is indicated (ppm).
Figure 22: Representative take-all disease symptoms of WT and sad mutants. The disease resistance of homozygous AsUGT91G16 mutant lines to the take-all pathogen G. graminis var. tritici isolate T5 (Bryan et al., 1999) was compared to wild type A. strigosa S75 seedlings; sad1 mutants, which do not synthesise avenacins (Haralampidis et al., 2001 ); AsAATI mutants, which accumulate avenacin
intermediates and a reduced amount of avenacins (Figure 4A); sad3 mutants, which only accumulate mono-deglucosylated avenacins and sad4 mutants, which accumulate both fully glycosylated and mono-deglucosylated avenacins (Mylona et al., 2008). Seedlings were incubated with plugs of actively growing G. graminis var. tritici and scored after 21 days based on the method in Bowyer et al. (1995). Figure 22A, representative take-all disease symptoms of WT and sad mutants. Photo credit: Andrew Davis, John Innes Centre. Figure 22B, graph of distribution of take-all disease severity for the different lines.
Figure 23: Analysis of N. benthamiana leaf extracts expressing tHMGR, AsbASI, AsCYP51H10, AsAATI, AsUGT91G16 and AsTG by HPLC-CAD. AsbASI cyclises 2,3-oxidosqualene to form b-amyrin (Haralampidis et al., 2001 ), which is insufficiently polar to be detected in the HPLC analysis. AsbASI and AsCYP51 H10 form the triterpene compound, 12,13b-epoxy-16b-hydroxy-b-amyrin (ErHbA) (Haralampidis et al., 2001 ; Qi et al., 2006). AsbASI , AsCYP51 H10 and AsAATI form the triterpene glycoside, 12,13b-epoxy-16b-hydroxy-b-amyrin-3-0-a-L-arabinose (EpHbA-3-O-Ara) (Figure 3C, D). EpHbA-3-O-Ara accumulation is detected (light blue triangle) in leaf extracts expressing tHMGR, AsbASI, AsCYP51H10 and AsAATI. The addition of AsUGT91G16 resulted in the accumulation of new peaks with the mass of 12,13b- epoxy-16 b-hydroxy-b-amyrin-3-0-b-d-glucosyl-[1 ,2]-a-L-arabinose (EpHbA-3-O-Ara- Glu) (dark blue triangles). The activity of AsUGT91 G16 is dependent on the arabinosyltransferase AsAATI , as co-expression of a combination of AsbASI, AsCYP51H10 and AsUGT91 without AsAATI results only in ErHbA. Co-expression of AsbASI, AsCYP51H10, AsAATI, AsUGT91G16 with AsTG resulted in the accumulation of new peaks with the mass of ErHbA-3-O-Ara with the addition of a hexose (red triangle). These peaks were not present when the N-terminal signal peptide of AsTG was deleted (NOSIG-AsTG) suggesting that the signal peptide is critical for AsTG activity in planta. AsTG appears to be dependent on the activity of AsUGT91 , as co-expression of AsbASI, AsCYP51H10, AsAATI and AsTG without AsUGT91G16 results in the accumulation of ErHbA-3-O-Ara. Coexpression of the arabinosyltransferase AsAATI, AsUGT91G16 and AsTG without AsbASI and AsCYP51H10 do not result in the accumulation of any new peaks, suggesting that these enzymes do not modify endogenous N. benthamiana compounds. Additional peaks due to endogenous N. benthamiana glycosyltransferases were also present.
IS = internal standard (digitoxin). Figure 24: AsGH1 and characterised transglucosidases have predicted N-terminal targeting sequences. N-terminal section of the full-sequence alignment between AsGH1 (AsTG) and the GH1 transglucosidases: BAM29304 AaAA7GT, from
Agapanthus africanus ; BAO96250 CmAA7GT from Campanula medium ; E3W9M3 DgAA7GT, BAO04178 DgAA7BG-GT 1 and BAO04181 DgAA7BG-GT2 from
Delphinium grandiflorum, E3W9M2 DcAA5GT, from Dianthus caryophyllus, B7F7K7 Os9bglu31 , from rice. Predicted N-terminal signal sequences are underlined in bold (Matsuba et al., 2010; Miyahara et al., 2012; Luang et al., 2013; Nishizaki et al.,
2013; Miyahara et al., 2014).
Figure 25: Fluorescent protein fusions of AsUGT91 G16 and AsTG are catalytically active in N. benthamiana. Figure 25A GFP-tagged AsUGT91 G16 fusion constructs (GFP:AsUGT91 and AsUGT91 :GFP) are active in N. benthamiana and accumulate the same compounds as AsUGT91 G16 (AsUGT91 ) with no fluorescent tag.
Accumulation of 12,13b-epoxy-16b-hydroxy-b-amyrin-3-0-oL-arabinose (EpHbA-3- O-Ara) was detected in leaves expressing AsbASI, AsCYP51H10 and AsAATI. Co- expression of AsbASI, AsCYP51H10 and AsAATI with: AsUGT91, GFP:AsUGT91 or AsUGT91:GFP show the accumulation of AsUGT91 G16 products (black arrows) . Figure 25B Co-expression of AsbASI, AsCYP51H10, AsAATI and AsUGT91G16 (AsUGT91 ) with: AsTG, AsTG: RFP, AsTG: GFP and NOSiG-AsTG.RFP. Fusions of GFP or mRFP1 to the C-terminus of AsTG (AsTG:RFP and AsTG:GFP) accumulate the same product peak (black arrow) as AsTG without a fusion tag. The RFP fusion protein to AsTG without the N-terminal signal sequence (NOSIG-AsTG:RFP) was not active.Additional more polar peaks are present which are likely to be due to the action of endogenous N. benthamiana glycosyltransferases. Data are representative of two experiments. IS = internal standard (digitoxin).
Figure 26: AsUGT91 localises to the cytosol in N. benthamiana leaves. Co- localisation of free mRFP1 (Moglia et al., 2014) with: (Figure 26A), GFP:AsUGT91 and (Figure 26B), AsUGT91 :GFP. The GFP fusions to AsUGT91 co-localise with free mRFP1 in the cytosol and nucleus. GFP fusions are shown in green (left); RFP is shown in magenta (middle) and merged images are shown in white (right). Images are taken two days post-infiltration. Bar = 20 pm. Image credits: Ingo Appelhagen, John Innes Centre.
Figure 27: AsTG localises to the vacuole and the apoplast in N. benthamiana leaves. Co-expression of an N-terminal GFP fusion to AsUGT91 G16 (GFP:AsUGT91 G16): (Figure 27A), alone; (Figure 27B), with AsTG:RFP, and (Figure 27C), with NOSIG- AsTG:RFP. An RFP fusion to AsTG localises to the vacuole and the apoplast (white arrow) and does not co-localise with a GFP fusion protein to AsUGT91 in the cytoplasm. Partial secretion to the apoplast may be due to the saturation of the vacuolar targeting machinery (daSilva et al., 2005; Frigerio et al., 1998; Pereira et al., 2013). An RFP fusion to AsTG without the N-terminal signal peptide (NOSIG- AsTG:RFP) co-localises with the GFP fusion to AsUGT91 in the cytoplasm and nucleus. No signal is seen in the RFP channel when no RFP construct is co- infiltrated. GFP fusions are shown in green (left); RFP fusions are shown in magenta (middle) and merged images are shown in white (right). Images are taken three days post-infiltration. Bar = 20 pm. Image credits: Ingo Appelhagen, John Innes Centre. Figure 28: AsTG is targeted to the endomembrane system and traffics through the ER. Co-expression of an C-terminal GFP fusion to AsTG (AsTG:GFP) with: (Figure 28A), free RFP (35S:mRFP (Moglia et al., 2014)); (Figure 28B), ER:mCherry (ER-rk CD3-959 (Nelson et al., 2007)), and (Figure 28C), GolgkmCherry (G-rk CD3-967 (Nelson et al., 2007)). One day post-infiltration, a GFP fusion to AsTG co-localises with a marker for the ER, and does not co- localise with free RFP in the cytoplasm or nucleus. No co-localisation was seen with a marker for the Golgi. GFP fusions are shown in green (left); RFP/mCherry fusions are shown in magenta (middle) and merged images are shown in white (right). Images are taken one day post-infiltration. Scale bars = 10 pm. Image credits: Ingo Appelhagen, John Innes Centre.
Figure 29: Acceptor promiscuity revealed by AsAAT 1 in vitro assays.
A. AsAATI is active over triterpenoid acceptors in the presence of UDP-Ara.
Recombinant AsAAT 1 (200 ng) was incubated over night with triterpenoid acceptors (200pM) and each of the 3 sugar donors (UDP-Ara, UDP-GIc and UDP-Gal; 400pM). The assays were analysed by TLC after overnight incubation at 30C. The TLC was stained with 10% sulfuric acid in methanol and the picture was taken under UV. B. TLC analysis of UGT99D1/ AsAAT 1 activity over triterpenoid and steroid acceptors. Recombinant AsAAT 1 (1.5 mg) was incubated over night with triterpenoid acceptors (200 pM) and UDP-Ara (500 pM). The assays were analysed by TLC. The TLC was stained with 10% sulfuric acid in methanol and the picture was taken under UV.
Yellow arrows are pointing toward major products, white arrows are pointing towards presumed minor products.
Figure 30: Combinatorial biosynthesis of arabinosylated oleanane triterpenoids in N. benthamiana.
A. Combinations of SAD1 - CYP450s - AsAAT 1 with their corresponding numbers (from A03 to I03; Z03 being AsAAT1-only control). B. HPLC with charged aerosol detection (CAD) chromatograms of extracts from N. benthamiana leaves expressing AsAATI alone (black), and in combination with SAD1 plus CYP450s (chromatograms labelled with combination numbers). New compounds are indicated by an arrow. C. LCMS analysis of the combinations. Selected ions correspond to expected arabinosylated products of triterpenoid scaffolds previously characterised by Reed et al. (2017). Proposed structures are shown; the products of B03 and F03
combinations are the only structures confirmed by NMR analysis so far.
Figure 31 : Production of new-to-nature ginsenosides in N. benthamiana.
A. HPLC with charged aerosol detection (CAD) chromatograms of extracts from N. benthamiana leaves expressing SAD1 mutant alone (black), and combination of SAD1 mutant plus AsAATI (blue). New compounds are indicated by an arrow. B. LCMS analysis of SAD1 mutant plus AsAATI combination. Selected ions correspond to expected arabinosylated dammarenediol II (grey and khaki chromatograms). Proposed structure is drawn in black). C. Proposed pathway built in N. benthamiana after transient expression of SAD1 mutant and AsAAT 1. Examples
Example 1 - Identification of candidate UGTs expressed in oat root tips
Avenacin A-1 is synthesised and accumulates in the epidermal cells of oat root tips. The avenacin biosynthetic genes that have been characterized to date are all expressed specifically in this part of the root (Haralampidis et al., 2001 ; Mugford et al., 2009), suggesting that the whole biosynthetic pathway may perhaps take place in this cell type. To try and identify candidate UGTs implicated in avenacin biosynthesis, we mined an oat root tip transcriptome database that we had generated previously (Kemen et al., 2014) using BLAST analysis (tBLASTn). The mRNA used to generate this transcriptome resource was extracted from the terminal 0.5 cm of the root tips of young oat seedlings, i.e. from avenacin-producing tissues. Representative UGT sequences from each of the 21 subfamilies of plant UGTs present in Arabidopsis were used as query sequences (Table S2). The resulting hits were then assessed manually using alignment tools to eliminate redundant sequences. A total of -100 unique UGT-like sequences were identified, 36 of which were predicted to
correspond to entire coding sequences (Table S3).
Phylogenetic analysis of the full length UGT coding sequences was then carried out (Figure 2 A). Four sequences corresponding to the highly conserved sterol glycosyltransferase (UGT80) and monogalactosyldiacylglycerol synthases (UGT81 ) groups (Caputi et al., 2011 ; Grille, Zaslawski, Thiele, Plat, & Warnecke, 2010) (Table S3) were omitted to avoid skewing the phylogeny reconstruction. The predicted amino acid sequences of the oat UGTs were aligned with those of characterized UGTs from other plants, including those previously reported to glycosylate
triterpenoids (Table S4). The tree approximately recapitulated the monophyletic groups A-0 previously defined by Li, Baldauf, Lim, and Bowles (2001 ), but also broadened the architecture of the tree to include oat-specific subfamilies. The oat UGTs (shown in red) were distributed across the phylogeny but were particularly well represented in groups D (UGT99, UGT98 and UGT701 ), L (UGT74 and UGT75), G (UGT85) and E (UGT88, UGT706, UGT707 and UGT72) (Figure 2 A). Of these, we have previously characterised three group L oat UGTs (AsUGT74H5, AsUGT74H6, and AsUGT74H7) and shown that AsUGT74H5 and AsUGT74H6 are required for the generation of the acyl glucose donors used by the serine carboxypeptidase-like acyltransferase AsSCPL1/SAD7 for avenacin biosynthesis (Mugford et al., 2013; Owatworakit et al., 2012).
In parallel with our transcriptome mining approach we also carried out proteomic analysis from the tips and elongation zones of oat roots using LC-MS/MS on an Orbitrap-Fusion™ mass spectrometer (Thermo Fisher, Hemel Hempstead, UK) (Figure 7). The previously characterized avenacin biosynthetic enzyme AsUGT74H5 (SAD10) (Owatworakit et al., 2012) showed higher accumulation in the root tips relative to the elongation zone. Of the 26 other UGT proteins detected in oat roots, three also accumulated at higher levels in the root tips compared with the elongation zone (AsUGT93B16, AsUGT99D1 and AsUGT706F7). Eleven of the 19 triterpene UGTs that have previously been characterized from various plant species belong to UGT group D (Table S1 ) (Achnine et al., 2005;
Augustin et al., 2012; Dai et al., 2015; Meesapyodsuk, Balsevich, Reed, & Covello, 2007; Naoumkina et al., 2010; Sayama et al., 2012; Shibuya, Nishimura, Yasuyama, & Ebizuka, 2010; Wang et al., 2015; Wei et al., 2015; Xu, Cai, Gao, & Liu, 2016). We prioritised the six oat GTs from group D (Figure 2 B) for gene expression analysis, along with the related enzyme AsUGT705A4; also AsUGT93B16 (group O) and AsUGT706F7 (group E), selected based on proteomic analysis. Six of these nine candidate genes had similar expression patterns to Sad10, a characterised avenacin biosynthetic gene (Figure 2 B).
All nine candidate UGTs were taken forward for functional analysis (Table 1 ). The coding sequences for all nine candidate genes were amplified from oat root tip complementary DNA (cDNA) and cloned into the expression vector pH9GW via the Gateway system (Hartley, Temple, & Brasch, 2000).
Example 2 - Heterologous expression and in vitro activities of candidate UGTs
To investigate whether any of the candidate enzymes showed a preference for UDP- Ara as a sugar donor, the UGTs were expressed as recombinant N-terminal 9xhistidine-tagged proteins in Escherichia coli. Following lysis, protein preparations enriched for the recombinant enzymes were prepared using Immobilized Metal Affinity Chromatography (IMAC, Figure 8 A). The resulting preparations were incubated with each of three sugar donors [UDP-GIc, UDP-a-D-galactose (UDP-Gal) or UDP-Ara] and 2,4,5-trichlorophenol (TCP). TCP was chosen as a universal acceptor in these assays because previous studies have shown that many UGTs are able to glycosylate TCP as well as their natural acceptor (Messner, Thulke, & Schaffner, 2003). The previously characterized oat /V-methyl anthranilate
glucosyltransferase (SAD10) (Owatworakit et al., 2012) and A. thaliana flavonoid arabinosyltransferase (UGT78D3) (Yonekura-Sakakibara et al., 2008) were included as controls. These two enzymes produced TCP glucoside and TCP arabinoside, respectively, as expected (Figure 3 A). Of the nine candidate UGTs, only
AsUGT99D1 showed a preference for UDP-Ara. This enzyme did not give any detectable product when UDP-Gal or UDP-GIc were supplied as potential sugar donors. The other UGTs showed a preference for UDP-GIc and so are likely to be glucosyltransferases.
Incubation of the AsUGT99D1 enzyme preparation with the avenacin pathway intermediate 12,13b-epoxy-16b-hydroxy-b-amyrin (ErHbA) led to a new product when UDP-Ara was supplied as the sugar donor (Figure 8S). No products were detected for b-amyrin, suggesting that oxygenation of this scaffold is needed for AsUGT99D1 to act. When UDP-GIc was supplied as a potential sugar donor only a very small amount of conversion was observed for ErHbA, while no products were detected with UDP-Gal.
To further investigate the function of AsUGT99D1 , we performed an acid hydrolysis on purified avenacin A-1 in order to remove the C-3 trisaccharide. LC-MS analysis confirmed that the blue fluorescent hydrolysis product generated had a mass corresponding to deglycosylated avenacin (m/z [M+H]+ 638.1 ), with complete consumption of avenacin A-1 (m/z [M+H]+ 1094.1 ; Figure 3 B, left and middle panels). After incubation of this hydrolysis product together with recombinant AsUGT99D1 and UDP-Ara, a new fluorescent product was detected that had a mass consistent with addition of a pentose (m/z [M+H]+ 770.1 ; Figure 3 B, right panel). These results suggest that AsUGT99D1 is able to carry out the first step in the addition of the sugar chain in avenacin biosynthesis - the addition of L-arabinose initiate assembly of the sugar chain of avenacin A-1 by addition of L-arabinose as shown in Figure 3 B.
Example 3- Transient expression of AsUGT99D1 with early avenacin pathway genes in Nicotiana benthamiana and purification of the co-expression product
Previously we have shown that Agrobacterium- mediated transient expression of triterpene synthase and cytochrome P450 biosynthetic genes in Nicotiana
benthamiana leaves enables rapid production of milligram to gram-scale amounts of simple and oxygenated triterpenes (Geisler et al., 2013; Mugford et al., 2013; Reed et al., 2017). We therefore used this system to carry out functional analysis of the candidate avenacin arabinosyltransferase enzyme AsUGT99D1 in planta. The AsUGT99D1 coding sequence was introduced into a Gateway-compatible pEAQ- Destl vector for co-expression with earlier enzymes in the avenacin pathway.
In accordance with previous work, co-expression of the first and second steps in the avenacin pathway (SAD1 and SAD2, respectively) yielded accumulation of the early avenacin pathway intermediate ErHbA, which was readily detectable by GC-MS (Figure 9 A). In contrast, when SAD1 and SAD2 were co-expressed with
AsUGT99D1 , the levels of ErHbA were markedly reduced (Figure 9 A) and a new more polar product was detected by HPLC coupled to charged aerosol detector (CAD) (Figure 3C). This new product was not present in extracts from leaves that had been infiltrated with the SAD1 and AsUGT99D1 expression constructs in the absence of SAD2 (Figure 3C). Furthermore, it had the same retention time (1R 12.0 min) as the product generated in vitro following incubation of ErHbA together with recombinant AsUGT99D1 (Fig 9 B).
In order to identify the product generated by co-expression of SAD1 , SAD2 and AsUGT99D1 in N. benthamiana, we scaled up our transient expression experiments. Vacuum infiltration of 44 N. benthamiana plants was carried out, and the freeze-dried leaf material extracted by pressurised solvent extraction. The triterpenoid product was purified using flash chromatography in normal and reverse phase mode. A total of 5.45 mg of product was obtained and estimated to be 94.5% pure using a CAD detector (corresponding to a yield of 0.79 mg.g-1 dry weight) (Figure 9 B). The structure of the purified product was analyzed by nuclear magnetic resonance (NMR) spectroscopy, and the 1H and 13C NMR spectra were fully assigned using a combination of COSY, DEPT-edited HSQC, and HMBC experiments (Figure 10). The data is fully consistent with the structure of 16b-hydroxy-b-amyrin 3-O-a-L- arabinoside. Importantly, a HMBC correlation was observed between the C-T hydrogen of the sugar moiety and the C-3 methine type carbon of the triterpene scaffold, confirming the site of glycosylation. (Figure 3D and 10). Collectively our data indicate that AsUGT99D1 is the missing avenacin arabinosyltransferase (hereafter named AsAATI ). Biochemical characterisation of AsAATI suggests a relative promiscuity of this enzyme towards acceptors; AsAAT 1 glycosylates early intermediates of the avenacin pathway as well as later ones (e.g. ErHbA and deglycosylated avenacin). On the contrary the sugar specificity of AsAATI seems strictly restricted to UDP-Ara; very little activity was detected with UDP-GIc and no activity with UDP-Gal. Only a single product was detected when AsAAT 1 was fed with deglycosylated avenacin or ErHbA, this might be interpreted as regiospecificity for the C-3 position of the triterpene scaffold. AsAATI is therefore a very promising candidate for
glycodiversification of various terpenoids in a regioselective manner. The versatility of the Nicotiana benthamiana transient expression platform is further exemplified here by the straightforward availability of rare sugar donors, making it a very potent candidate platform for glycodiversification of plant metabolites and small
pharmaceuticals.
Example 4 - Mutation at AsAATI results in compromised avenacin production and enhanced susceptibility to take-all disease in oats: identification of AATs in other plant species
We recently expanded our collection of avenacin-deficient mutants to -100, just over half of which have been assigned to loci that we have subsequently characterised ((Geisler et al., 2013; Mugford et al., 2013; Mugford et al., 2009; Mylona et al., 2008; Owatworakit et al., 2012; Qi et al., 2004; Qi et al., 2006), unpublished work). We sequenced the AsAATI gene in the remaining 47 uncharacterised mutants and identified a single line (mutant line #807, (Papadopoulou et al., 1999)) with a mutation in the AsAATI coding sequence. This mutation is predicted to give rise to a premature stop codon (Figure 11 A). Thin layer chromatography (TLC) analysis revealed that the levels of avenacin A-1 were substantially reduced in root extracts of this mutant (Figure 11 S). Subsequent analysis of seedlings of 139 F2 progeny derived from a cross between the wild type A. strigosa parent and mutant #807 confirmed that the reduced avenacin phenotype co-segregated with the single nucleotide polymorphism in the AsAATI gene (Figure 1 1 C; Table 2). These analyses indicate that the avenacin-deficient phenotype of mutant #807 is likely to be due to a recessive mutant allele of the AsAATI gene (Chi-squared analysis consistent with 3:1 segregation, P > 0.05; Table 2).
The previously characterized avenacin biosynthetic genes are physically clustered in the A. strigosa genome (Mugford et al., 2013). An accession of another avenacin- producing diploid oat species, Avena atlantica (IBERS Cc7277), has been the target of whole genome shotgun sequencing, with subsequent mapping of assembled contigs by survey resequencing of recombinant inbred progeny derived from a cross between this accession and A. strigosa accession Cc7651 (IBERS) (Vickerstaff and Langdon, unpublished). A single orthologue of AsAATI contained on a contig of 14,086 bp was identified in the A. atlantica assembly (Figure 12). This contig is closely linked to the Sad2 locus, while the other 8 UGT genes selected earlier are not (Table S5). This suggests that AsAAT 1 is likely to be part of the extended avenacin cluster. Future work will shed light on the full extent of the avenacin biosynthetic gene cluster and on the degree of conservation across different oat species. Avenacin A-1 is the major avenacin found in oat roots. However, three other closely related forms of avenacin, harbouring the same trisaccharide sugar chain, are also present in oat root extracts. These are the minor UV fluorescent form B-1 and the non-fluorescent avenacins A-2 and B-2. The four avenacins were readily detected in extracts of wild type oat roots by HPLC analysis (Figure 4A). The levels of avenacins were markedly reduced in aat1 mutant line, and two new smaller peaks of more polar compounds were observed (Figure 4 A). Formate and chloride adducts (m/z 524.8 and 535.0 respectively; Figure 1 1 D, left panel) of the most apolar peak (fR 1 1.4 min) correspond to a compound with a molecular weight of 490 Da. The apparent mass and polarity of this compound, as well as its lack of UV fluorescence, suggests that mutant aat1 accumulates the avenacin aglycone lacking the acyl group and the C-30 aldehyde (structure shown in Fig.4A). The other new peak (fR 6.3 min) has a molecular weight that corresponds to the first product plus two hexoses (814.5 Da) (Figure 1 1D, right panel). A corresponding monoglucoside could also be detected at 7.7 min (652.4 Da) (Figure 11 D, central panel). Thus, aat1 mutant accumulates the avenacin aglycone lacking the acyl group and the C-30 aldehyde. It suggests that the uncharacterised avenacin C-30 oxidase may requires glycosylation of the scaffold prior to come in action. The other more polar products may be a result of modification of this intermediate by non-specific glycosyltransferases in the absence of the functional AsAATI arabinosyltransferase.
Avenacins are still detected in aat1 mutant suggesting that another oat enzyme is partially redundant with AsAAT 1. No homologues of AsAAT 1 were present in our oat root tip transcriptome database. Future sequencing of the oat genome may reveal another oat arabinosyltransferase. Activity redundancy coupled with modification of aat1 intermediate (i.e. addition of hexoses; Figure 4 A) may alleviate accumulation of toxic intermediates preventing root phenotype seen in the other avenacin mutants affected in glycosylation (Mylona et al., 2008). F2 lines that were homozygous for the aat1 mutation did not have any obvious root phenotype other than reduced fluorescence, indicating that mutation of AsAATI is unlikely to affect root growth and development (Figure 11 C).
Since glycosylation is known to be critical for the antifungal activity of avenacins, we next investigated the effects of mutation at AsAATI on disease resistance. Disease tests revealed that aat1 mutant had enhanced susceptibility to take-all disease, consistent with a role for AsAATI in disease resistance (Fig 4S; Figure 1 1£).
Example 5 - New insights into UGT sugar specificity
Previously only one other arabinosyltransferase able to glycosylate natural products has been characterised from plants - UGT78D3, which is required for flavonoid biosynthesis in A. thaliana (Yonekura-Sakakibara et al., 2008). Han, Kim, Yoon, Chong, and Ahn (2014) have mutated a single residue (H380Q) sufficient to change sugar specificity of UGT78D3. The equivalent residue, at the C-terminal extremity of the PSPG motif, had already been targeted by Kubo, Arai, Nagashima, and
Yoshikawa (2004) leading to sugar preference modification from galactose to glucose. These two studies corroborate structural analysis showing direct molecular interactions between the two last residues of the PSPG motif and the hydroxyl groups at positions C2, C3 and C4 of the sugar unit. UDP sugars (Shao et al., 2005; Wang, 2009). Interestingly, the PSPG motif of AsAATI is longer than those of other characterized UGTs (46 amino acids, as opposed to 44) and ends with a His residue.
As explained below, it was hypothesised that the importance of this histidine residue in determining specificity for UDP-Ara might extend to other arabinosyltransferases.
Example 6 - Isolation of a further arabinosyltransferase
We mined the soybean genome (http://www.soybase.org/) for candidate
arabinosyltransferase genes by searching with a modified PSPG consensus motif, using the tBIastn tool. A total of six sequences with a histidine at the final position of their PSPG motifs were found (Table S6). Two of these are part of group D (Figure 5 A). One of these corresponds to GmSGT2 (UGT73P2), which has previously been characterised as a galactosyltransferase of soyasapogenol B 3-O-glucuronide (Shibuya et al., 2010). The only uncharacterised candidate is the remaining sequence from group D, which shares 51% amino acid sequence identity with the soyasaponin glucosyltransferase UGT73K1 (Table S6) (Achnine et al., 2005).
The coding sequence of this gene was synthesised and cloned into the pH9-GW vector for expression in E. coli. Soluble recombinant /V-term-9xHis-tagged enzyme was produced and enriched using Ni-NTA resin. The recombinant enzyme was incubated with soyasaponin I as an acceptor, together with each of three potential sugar donors, UDP-GIc, UDP-Gal and UDP-Ara, and reaction products were analysed by LC-CAD/MS. Only one major product was detected by CAD in the presence of UDP-Ara. This product was absent when UDP-Gal or UDP-GIc were supplied as sugar donors (Figure 5S). The mass of the new product (m/z 1073.5 by HR-MS) is consistent with arabinosylation (132.1 Da) of soyasaponin I (941.2 Da) (Figure 13A). We named this enzyme GmSSAT ( Glycine max SoyaSaponin
ArabinosylT ransferase).
A UGT (UGT73F2) that adds D-glucose to the L-arabinose of the sugar chain at the C-22 position of soyasaponin had been discovered previously (Sayama et al., 2012). Recombinant N- term 9xHis UGT73F2 was expressed in E. coli. Incubation of recombinant UGT73F2 together with UDP-GIc and the product of GmSSAT resulted in conversion into a new product with a molecular mass corresponding to the glucoside of the former product (Figure 5C, S7 B). UGT73F2 is inactive when incubated with UDP-GIc and soyasaponin I. Together, those results suggest that GmSSAT and UGT73F2 are likely to act consecutively in initiation and extension of the sugar chain at the C-22 carbon position of group A saponins from soybean (Ab, Ac, Ad, Af and Ah; Figure 5 D).
GmSSAT involvement in soyasaponins biosynthesis remains to be elucidated. The predicted natural acceptor of GmSSAT (nonacetylated nonarabinosylated
soyasaponin A0-ag) is not commercially available and soyasaponin I is missing the C-21 hydroxyl group unique to group A soyasaponins (C-22 glycosylated saponins in soybean). Co-expression of GmSSAT with known soyasaponin pathway genes especially in soybean pods where soyasaponins accumulates suggest a potential role of GmSSAT in this pathway (Figure 13 B). The arabinosyltransferase involved in soyasaponins pathway is initializing the assembly of the C-22 sugar chain present in group A saponins. The acetylated sugars attached to arabinose at the terminal position of this saponin group are thought to be the main cause of bitterness and astringent aftertastes of soybean (Sayama et al., 2012). Therefore, GmSSAT gene may be a very good target for breeders to obtain non-bitter varieties.
Example 7 - Site directed mutagenesis of AsAATI
The His residue present in C-terminus of the PSPG motif is conserved in all 3 characterised arabinosyltransferases while replaced by a glutamine in most closely related glucosyltransferases (Figure 6 A). A single amino acid difference was observed between AsAATI and UGT99A6 (closest related glucosyltransferase, based on sugar specificity assays Figure 3 A) in the middle of the N-terminus loop positioned between the 5th b-strand and the 5th a-helix (N5 loop, Figure 6 A). The N5 loop has been shown to be involved in sugar specificity of UGT71 G1 , UGT74F2/4 or UGT88D7 (He, Wang, & Dixon, 2006; Kubo et al., 2004; Noguchi et al., 2009). To further investigate the basis of AsAATI sugar donor preference, a homology model was generated using the online software l-TASSER (Yang et al., 2015) as well as MODELLER (Sali & Blundell, 1993) to refine the N-terminal loop of AAT 1 PSPG motif. Docking of UDP-Ara into the sugar donor binding site of AsAATI was consistent with the arabinoside moiety of UDP-Ara having a hydrogen-bond to His404 and a hydrophobic interaction with Pro154 (Figure 6S).
We carried out site-directed mutagenesis of AsAATI to convert H404 and P154 back to the corresponding residues existing in the glucosyltransferase UGT99A6
(respectively a glutamine and a serine). Purified N-terminal 9xHis-tagged
recombinant enzymes from wild type AsAATI , and mutants H404Q and P154S as well as double mutant H404Q-P154S were assayed for their ability to glycosylate the avenacin aglycone (Figure 14 A).
When histidine 404 is mutated back to glutamine the sugar specificity of AsAATI is dramatically modified (Figure 6D). The arabinosyltransferase and
galactosyltransferase activities are severely depleted while xylosylation and glucosylation activities increase. Overall H404Q mutant is not showing a real preference between glucose, arabinose and xylose. If the proline 154 is replaced to a serine the corresponding mutant is still showing a preference for arabinose but the galactosyltransferase activity increases (Figure 6D). UDP-galactose is therefore a better donor for mutant P154S than UDP-xylose or UDP-glucose. If the two mutations are combined the best sugar donor is UDP-glucose (Figure 6D).
Glucosyltransferase activity being nearly 10-fold higher in AsAATI -P154S-H404Q than wild type enzyme while arabinosyltransferase activity decreases dramatically (30 times slower).
The two additional residues (I400 and G401 ) present in AsAATI C-terminal part of the PSPG motif are very unusual (Figure 6 A). Unfortunately, deletion of the two corresponding codons led to inactive enzyme as well as swapping the whole PSPG motif of AsUGT99A6 with the one of AsAAT 1. AsAAT 1 3D model suggests that those two residues are shaping the region of the sugar donor binding pocket where the sugar moiety is sitting (Figure 6 B). Those two residues may be involved in sugar specificity as well.
Effect of mutations on AsAATI sugar specificity is also observed in Nicotiana benthamiana when wild type AsAATI or mutants are co-expressed with SAD1 and SAD2. When analysed by HPLC-CAD, extracts of infiltrated tissues with wild type AsAATI revealed the accumulation of the single ErHbA-Ara (Figure 6C). On the contrary AsAATI double mutant is accumulating only ErHbA-Glc, confirming the complete conversion of AsAATI from arabinosyltransferase to glucosyltransferase. Expression of AsAATI -P154S led to accumulation of ErHbA-Ara as well as ErHbA- Glc, production of ErHbA-Xyl is also detected by LCMS (Figure 14C). LCMS analysis of AsAATI - P154S suggests production of the two ErHbA hexosides with a preference for ErHbA-Gal on top of accumulation of ErHbA-Ara (Figure 14C).
Altogether, the two targeted residues are mutually required for arabinosylation specificity of AsAAT 1 . If modified back to the corresponding residues in
phylogenetically related glucosyltransferase UGT99A6, AsAATI is transformed into a glucosyltransferase. Targeted mutagenesis followed by in vitro and in planta analysis suggests that H404 promotes reaction with sugar donors having an axial position at the 4-OH (UDP-a-D-galactose has the same stereochemistery than UDP-b-ΐ.- arabinose, see Figure 14S). This correlates with previous work on UGT
galactosyltransferases and arabinosyltransferases (Han et al., 2014; Kubo et al., 2004). Direct interaction of H404 with C-4 of the hemiacetal ring is not suggested by the 3D model but the two extra residues present upstream of H404 render the modelling of the PSPG C-terminus precarious. H404 may also modify the orientation of the hemiacetal ring indirectly impacting selectivity for the C-4 stereochemistery. Molecular modelling suggests that P154 is in close proximity with CH2 at C-5 position of UDP-Ara, modifying this residue seems to affect selectivity of pentoses versus hexoses shown by AsAAT 1. The steric constraint / hydrophobic interaction with C-5 of pentoses potentially provided by the proline may also prevent C-6 accommodation of hexoses. Replacement of proline 154 by a serine could allow formation of a hydrogen bond with C-6 hydroxyl group of glucose or galactose.
Example 8 Conclusions.
Harnessing glycosylation is key to fully exploit the modulations of bioactivity, solubility, cellular compartmentalisation brought by sugar moieties. It is especially important to understand how family 1 GTs work. This requires further insights into acceptor glycosylation regiospecificity and sugar donor preference, which are the main attributes of plant family 1 GTs (Vogt & Jones, 2000).
Here we report two new UGTs arabinosyltransferases from the GT1 family.
Mutagenesis and protein modelling brought new light onto sugar selectivity shown by many plant UGTs. H404 and P154 residues prove to be essential for arabinosylation specificity shown by monocot UGT AsAATI . Mutation of these two residues is enough to modify sugar specificity back to glucose, specificity that can be considered as the ancestral specificity displayed by plant UGTs. H404 is the final residue of UGTs signature motif (PSPG) and is conserved in all three characterised
arabinosyltransferases scattered over UGT phylogeny suggesting convergent evolution of GT1 arabinosyltransferases in monocots and dicots.
AsAAT 1 proves to have a pivotal role for the sugar chain assembly of the antifungal compound avenacin. Its role in the avenacin pathway is supported by converging biochemical and physiological evidences. To the best of our knowledge AsAATI (UGT99D1 ) is the first UGT99 to be functionally characterised or described in literature. This is also the first monocot enzyme from the extended plant UGT group D (including UGT73, UGT99, UGT701 and UGT98) characterised to date.
Interestingly, triterpenoid glycosyltransferase activity is frequently associated with UGT73s (dicot UGTs from group D). Very few monocot UGTs have been
investigated so far and it will be interesting to see if monocot specific groups retain functionalities associated with their dicot counterpart.
9 _ Materials & Methods for Example 1-7
Oat material. The wild type A. strigosa accession S75 and avenacin-deficient mutants were grown as described previously (Papadopoulou et al., 1999).
RNA and cDNA preparation. The cDNA used for amplification and subsequent cloning (method is described in Example 10) of the selected oat UGT genes as well as expression profile analysis was generated from 3 day-old tissues of A. strigosa seedlings (accession S75). Total RNA was extracted using the RNeasy Plant Mini kit (Qiagen). First-strand cDNA synthesis was carried out from 1 mg of DNase-treated RNA using Superscript II Reverse Transcriptase (Invitrogen).
Trichlorophenol glycosylation assays. Reactions were carried out in a total volume of 75 mI_, composed of 100 mM TRIS-HCI pH 7, 100 mM 2,4,5-trichlorophenol (TCP) and 200 mM uridine diphospho sugars [UDP-oD-glucose, UDP-oD-galactose or UDP-b-L-arabinopyranose (see Table S7 for suppliers)]. Reactions were initiated by addition of 1 mg of enriched recombinant enzyme (obtained as detailed in Example 10) to pre-warmed reaction mixes, and incubated overnight at 28 °C before stopping with 3.5 mI_ trichloroacetic acid 6.1 N. Proteins were precipitated by centrifugation at 21 ,000 g for 10 min at 4 °C. Supernatants were stored at -20 °C prior to analysis by HPLC-UV (method A described in Example 10).
Hydrolysis and partial reglycosylation of avenacin A-1. Purified avenacin A-1 (Table S7) was hydrolysed in 1 M HCI for 15 min at 99 °C, with shaking at 1400 rpm. The preparation was then cooled on ice and buffered with 1 :1 (v:v) unequilibrated TRIS 1 M. The hydrolysed sample was extracted twice by ethyl acetate, and the combined organic extracts were dried under N2 flux and resuspended in dimethyl sulfoxide. The resulting hydrolysed avenacin A-1 (approx. 100 mM in 50 mI_ reaction volume) was incubated with 500 mM UDP-Ara and 2 mg purified recombinant
AsUGT99D1 in 50 mM TRIS-HCI pH 7.5 with 0.5 mM methyl-b-cyclodextrin. After 30 min incubation at 25 °C the reaction was stopped by addition of 2 mI_ trichloroacetic acid 6.1 N. The precipitated protein was removed by centrifugation at 21 ,000 g for 10 min at 4 °C. The supernatant was diluted with methanol (50% final volume) before analysis by LC-MS with fluorescence detection (method B described in Example 10).
Metabolite analysis of root extracts from oat mutant #807. Fresh root tips (5 mg) were harvested from 3 day-old seedlings of the A. strigosa wild type accession and the avenacin-deficient mutant #807 (identified as described in Example 10). Root tissues were ground using a homogenizer (2010 Geno/Grinder, SPEX SamplePrep) and extracted with methanol following the method described for analysis of triterpenoid glycosides in N. benthamiana leaf extracts, detailed in Example 10. Filtered methanolic samples were diluted three-fold in 50% methanol and analysed by LC-MS-CAD-fluorescence (method D described in Example 10).
Pathogenicity tests. Pathogenicity tests to assess root infection with the fungal pathogen Gaeumannomyces graminis var. tritici isolate T5 were carried out as described previously (Papadopoulou et al., 1999). Seedlings were scored after 3- week incubation for root lesions using a 7-point scale.
Enzymatic assays with soybean recombinant enzymes: GmSSAT and UGT73F2 were ordered as synthetic genes, cloned into expression vector. The recombinant enzymes were purified as described in Example 10. Enzyme assays were carried out in 100 mL reaction volumes consisting of 50 mM TRIS-HCI pH 7.5, 100 mM of soyasaponin I (Table S7) and 300 mM uridine diphospho sugars (UDP-a-D-glucose, UDP-a-D-galactose or UDP- b-L-arabinopyranose; see Table S7). Reactions were started with addition of 1 mg of enriched recombinant enzyme preparation into the pre-warmed samples and incubated at 25 °C. After 40, 80 and 200 min, 30 mI_ of reaction mixture was stopped by addition of methanol (50% final cone.). Assays for glucosylation of GmSSAT product by recombinant UGT73F2 were conducted similarly after semi-preparative purification of soyasaponin I arabinoside described in Example 10. Samples were analysed by HPLC-MS-CAD using method D (method described in Example 10) with modified gradients: 25-46 % [B] over 9.5 min (for GmSSAT assays) and 20-46 % [B] over 19.5 min (for UGT73F2 assays).
Additionally, reaction products were analysed by HR-MS following method E described in Example 10.
In vitro analysis of AsAATI wild-type and mutants: Mutagenesis of AsAATI was performed by site-directed mutagenesis (method described in Example 10). Wild- type and mutagenized AsAATI were expressed and purified as described in
Example 10 (Figure 14 A). Optimal catalytic conditions for AsAATI were observed at pH 6.5. Reactions were made in 55 mI_ volume at 25 °C and time points were taken under steady-state conditions transferring 10 mI_ reaction mix into 55 mI_ glacial 10% TCA to stop the reaction. A volume of 10 mL sugar donor mix (5 mM of UDP-Ara, UDP-GIc, UDP-Xyl or UDP-Gal) was added to pre-warmed enzyme mix composed of 30 mM deglycosylated avenacin A-1 dissolved in 0.5 mM methyl-b-cyclodextrin (substrate inhibition observed over 30 mM [acceptor]). Final samples buffer concentration was 50 mM of TRIS-HCI pH 6.5 with 0.3 mg of recombinant enzyme. The precipitated protein was removed by centrifugation at 21 ,000 g for 10 min at 4 °C. Supernatant was kept at -20 °C until analysis by HPLC-fluorescence (method F in SI Appendix).
Figure imgf000068_0001
References Examples 1 -9
1. Liu Z, et al. (2013) Regulation, evolution, and functionality of flavonoids in cereal crops. Biotechnol. Lett. 35(1 1 ):1765-1780.
2. Vetter J (2000) Plant cyanogenic glycosides. Toxicon 38(1 ): 11-36.
3. Vincken JP, Heng L, de Groot A, Gruppen H (2007) Saponins, classification and occurrence in the plant kingdom. Phytochemistry 68(3):275-297.
4. Reuben S, et al. (2006) Molecular biology of plant natural products. Natural products from plants, eds Cseke LJ, Kirakosyan A, Kaufman PB, Warber SL, Duke JA, & Brielmann HL (CRC Press/Taylor & Francis, Boca Raton), 2nd Ed, pp 61 1-202.
5. Augustin JM, Kuzina V, Andersen SB, Bak S (201 1 ) Molecular activities, biosynthesis and evolution of triterpenoid saponins. Phytochemistry
72(6):435-457.
6. Piochon M, Legault J, Gauthier C, Pichette A (2009) Synthesis and
cytotoxicity evaluation of natural alpha-bisabolol beta-D-fucopyranoside and analogues. Phytochemistry 70(2):228-236.
7. Bernard FX, et al. (1997) Glycosylated flavones as selective inhibitors of topoisomerase IV. Antimicrob. Agents Chemother. 41 (5):992-998.
8. Bowles D, Lim EK, Poppenberger B, Vaistij FE (2006) Glycosyltransferases of lipophilic small molecules. Annu. Rev. Plant Biol. 57:567-597.
9. Vogt T, Jones P (2000) Glycosyltransferases in plant natural product
synthesis: characterization of a supergene family. Trends Plant Sci. 5(9):380- 386.
10. Kubo A, Arai Y, Nagashima S, Yoshikawa T (2004) Alteration of sugar donor specificities of plant glycosyltransferases by a single point mutation. Arch Biochem Biophys 429(2):198-203.
11. Noguchi A, et al. (2009) Local differentiation of sugar donor specificity of flavonoid glycosyltransferase in Lamiales. Plant Cell 21 (5): 1556-1572.
12. Osmani SA, Bak S, Imberty A, Olsen CE, Moller BL (2008) Catalytic key
amino acids and UDP-sugar donor specificity of a plant
glucuronosyltransferase, UGT94B1 : molecular modeling substantiated by site-specific mutagenesis and biochemical analyses. Plant Physiol.
148(3):1295-1308.
13. Hughes J, Hughes MA (1994) Multiple secondary plant product UDP-glucose glucosyltransferase genes expressed in cassava ( Manihot esculenta Crantz) cotyledons. DNA Seq 5(1 ):41 -49.
14. Mackenzie PI, et al. (1997) The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence.
Pharmacogenetics 7(4):255-269.
15. Ross J, Li Y, Lim E, Bowles DJ (2001 ) Higher plant glycosyltransferases.
Genome Biol 2(2):REVIEWS3004.
16. Osmani SA, Bak S, Moller BL (2009) Substrate specificity of plant UDP- dependent glycosyltransferases predicted from crystal structures and homology modeling. Phytochemistry 70(3):325-347.
17. Sawai S, Saito K (2011 ) Triterpenoid biosynthesis and engineering in plants.
Front Plant Sci 2:25. Francis G, Kerem Z, Makkar HP, Becker K (2002) The biological action of saponins in animal systems: a review. Br J Nutr 88(6):587-605.
Osbourn A (1996) Saponins and plant defence - a soap story. Trends Plant Sci. 1 (1 ):4-9.
Papadopoulou K, Melton RE, Leggett M, Daniels MJ, Osbourn AE (1999) Compromised disease resistance in saponin-deficient plants. Proc Natl Acad Sci U S A 96(22):12923-12928.
Haralampidis K, et al. (2001 ) A new class of oxidosqualene cyclases directs synthesis of antimicrobial phytoprotectants in monocots. Proc Natl Acad Sci U S A 98(23): 13431-13436.
Geisler K, et al. (2013) Biochemical analysis of a multifunctional cytochrome P450 (CYP51 ) enzyme required for synthesis of antimicrobial triterpenes in plants. Proc Natl Acad Sci U S A 110(35):3360-3367.
Owatworakit A, et al. (2012) Glycosyltransferases from oat (Avena) implicated in the acylation of avenacins. J. Biol. Chem. 288(6):3696-3704.
Mugford ST, et al. (2013) Modularity of plant metabolic gene clusters: A trio of linked genes that are collectively required for acylation of triterpenes in oat. Plant Cell 25(3): 1078-1092.
Osbourn A, Bowyer P, Lunness P, Clarke B, Daniels M (1995) Fungal pathogens of oat roots and tomato leaves employ closely related enzymes to detoxify different host plant saponins. Mol Plant Microbe Interact 8(6):971- 978.
Armah CN, et al. (1999) The membrane-permeabilizing effect of avenacin A-1 involves the reorganization of bilayer cholesterol. Biophys. J. 76(1 ):281 -290. Yonekura-Sakakibara K, et al. (2008) Comprehensive flavonol profiling and transcriptome coexpression analysis leading to decoding gene-metabolite correlations in Arabidopsis. Plant Cell 20(8):2160-2176.
Mugford ST, et al. (2009) A serine carboxypeptidase-like acyltransferase is required for synthesis of antimicrobial compounds and disease resistance in oats. Plant Cell 21 (8):2473-2484.
Kemen AC, et al. (2014) Investigation of triterpene synthesis and regulation in oats reveals a role for beta-amyrin in determining root epidermal cell patterning. Proc Natl Acad Sci U S A 1 11 (23):8679-8684.
Grille S, Zaslawski A, Thiele S, Plat J, Warnecke D (2010) The functions of steryl glycosides come to those who wait: Recent advances in plants, fungi, bacteria and animals. Prog Lipid Res 49(3):262-288.
Caputi L, Malnoy M, Goremykin V, Nikiforova S, Martens S (201 1 ) A genome- wide phylogenetic reconstruction of family 1 UDP-glycosyltransferases revealed the expansion of the family during the adaptation of plants to life on land. Plant J. 69(6): 1030-1042.
Li Y, Baldauf S, Lim EK, Bowles DJ (2001 ) Phylogenetic analysis of the UDP- glycosyltransferase multigene family of Arabidopsis thaliana. J. Biol. Chem. 276(6):4338-4343.
Augustin JM, et al. (2012) UDP-glycosyltransferases from the UGT73C subfamily in Barbarea vulgaris catalyze sapogenin 3-O-glucosylation in saponin-mediated insect resistance. Plant Physiol. 160(4): 1881 -1895. Sayama T, et al. (2012) The Sg-1 glycosyltransferase locus regulates structural diversity of triterpenoid saponins of soybean. Plant Cell 24(5):2123- 2138.
Dai L, et al. (2015) Functional characterization of cucurbitadienol synthase and triterpene glycosyltransferase involved in biosynthesis of mogrosides from Siraitia grosvenorii. Plant Cell Physiol. 56(6):1 172-1182.
Shibuya M, Nishimura K, Yasuyama N, Ebizuka Y (2010) Identification and characterization of glycosyltransferases involved in the biosynthesis of soyasaponin I in Glycine max. FEBS Lett. 584(1 1 ):2258-2264.
Xu GJ, Cai W, Gao W, Liu CS (2016) A novel glucuronosyltransferase has an unprecedented ability to catalyse continuous two-step glucuronosylation of glycyrrhetinic acid to yield glycyrrhizin. New Phytol. 212(1 ): 123-135.
Wang P, et al. (2015) Production of bioactive ginsenosides Rh2 and Rg3 by metabolically engineered yeasts. Metab. Eng. 29:97-105.
Wei W, et al. (2015) Characterization of Panax ginseng UDP- glycosyltransferases catalyzing protopanaxatriol and biosyntheses of bioactive ginsenosides F1 and Rh1 in metabolically engineered yeasts. Mol Plant 8(9): 1412-1424.
Meesapyodsuk D, Balsevich J, Reed DW, Covello PS (2007) Saponin biosynthesis in Saponaria vaccaria. cDNAs encoding beta-amyrin synthase and a triterpene carboxylic acid glucosyltransferase. Plant Physiol.
143(2):959-969.
Achnine L, et al. (2005) Genomics-based selection and functional
characterization of triterpene glycosyltransferases from the model legume Medicago truncatula. Plant J. 41 (6):875-887.
Naoumkina MA, et al. (2010) Genomic and coexpression analyses predict multiple genes involved in triterpene saponin biosynthesis in Medicago truncatula. Plant Cell 22(3):850-866.
Hartley JL, Temple GF, Brasch MA (2000) DNA cloning using in vitro site- specific recombination. Genome Res. 10(1 1 ): 1788-1795.
Messner B, Thulke O, Schaffner AR (2003) Arabidopsis glucosyltransferases with activities toward both endogenous and xenobiotic substrates. Planta 217(1 ): 138-146.
Reed J, et al. (2017) A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules. Metab. Eng. 42:185-193.
Qi X, et al. (2004) A gene cluster for secondary metabolism in oat:
implications for the evolution of metabolic diversity in plants. Proc Natl Acad Sci U S A 101 (21 ):8233-8238.
Qi X, et al. (2006) A different function for a member of an ancient and highly conserved cytochrome P450 family: from essential sterols to plant defense. Proc Natl Acad Sci U S A 103(49): 18848-18853.
Mylona P, et al. (2008) Sad3 and Sad4 are required for saponin biosynthesis and root development in oat. Plant Cell 20(1 ):201 -212.
Han SH, Kim BG, Yoon JA, Chong Y, Ahn JH (2014) Synthesis of flavonoid O-pentosides by Escherichia coli through engineering of nucleotide sugar pathways and glycosyltransferase. Appl. Environ. Microbiol. 80(9):2754-2762. 50. Shao H, et al. (2005) Crystal structures of a multifunctional triterpene/flavonoid glycosyltransferase from Medicago truncatula. Plant Cell 17(11 ):3141-3154.
51. Wang X (2009) Structure, mechanism and engineering of plant natural
product glycosyltransferases. FEBS Lett. 583(20):3303-3309.
52. He XZ, Wang X, Dixon RA (2006) Mutational analysis of the Medicago
glycosyltransferase UGT71 G1 reveals residues that control regioselectivity for (iso)flavonoid glycosylation. J. Biol. Chem. 281 (45):34441 -34447.
53. Yang J, et al. (2015) The l-TASSER Suite: protein structure and function
prediction. Nat. Methods 12(1 ):7-8.
54. Sali A, Blundell TL (1993) Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234(3):779-815.
10 - Materials & Methods for Tables S1 -S7, and Figures 7-14
Phylogenetic analysis. Representative amino acid sequences of characterised family 1 plant UGTs were collected from the Carbohydrate-Active enZymes (CAZy) database (http://www.cazy.org/). These sequences were augmented with sequences characterized plant triterpenoid/steroidal UGTs. All sequences are listed in Table S4. Deduced amino acid sequences derived from the A. strigosa predicted full-length UGT coding sequences (Table S3) were incorporated into the phylogenetic reconstruction. Sequences were aligned using MUSCLE
(http://www.ebi.ac.uk/Tools/msa/muscle/). The unrooted phylogenetic tree was constructed using MEGA 5 (http://www.megasoftware.net/) by the neighbor-joining method with 1000 bootstrap replicates.
Phylogenetic reconstruction of group D UGTs in Figure 5 A was obtained with the same method. All sequences are listed in legend. The tree is rooted with UGT90A1 from group C.
Proteomic analysis. The tips and elongation zones of 5 day-old A. strigosa seedlings were harvested and approximately 30 mg of collected sample was ground in liquid nitrogen using a pre-chilled mortar and pestle. Protein extraction was performed following previously published methods (Owatworakit et al., 2012). Protein concentrations were determined using the Bradford method (Bradford, 1976) with bovine serum albumin (BSA, Sigma) as a standard. Protein samples (8 mg) were denatured at 95 °C for 15 min in the presence of Nupage reducing agent (Invitrogen) and separated using a precast polyacrylamide gel (Nupage 4-12% Bis-TRIS, Invitrogen) in 3-(/V-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen).
To augment the abundance of UGT proteins and simplify the sample mixture we performed on-gel size-fractionation of proteins taking advantage of the conserved length of UGTs (AsUGTs MW 48-55 kDa). Proteins with molecular weights of 45 - 57 kDa were excised from the SDS-PAGE gel with sterile razor blades. Gel slices were treated with DTT and iodoacetamide, and digested with trypsin according to standard procedures.
Peptides were extracted from the gels and analysed by LC-MS/MS on an Orbitrap- Fusion™ mass spectrometer (Thermo Fisher, Hemel Hempstead, UK) equipped with an UltiMate™ 3000 RSLCnano System using an Acclaim PepMap C18 column (2 pm, 75 pm c 500 mm, Thermo). Aliquots of the tryptic digests were loaded and trapped using a pre-column which was then switched in-line to the analytical column for separation. Peptides were eluted with a gradient of 5-40% acetonitrile in water/0.1% formic acid at a rate of 0.5% min 1. The column was connected to a 10 pm SilicaTip™ nanospray emitter (New Objective, Woburn, MA, USA) for infusion into the mass spectrometer. Data dependent analysis was performed using parallel top speed H CD/Cl D fragmentation method with the following parameters: 3 s cycle time, positive ion mode, orbitrap MS resolution = 60k, mass range (quadrupole) = 350-1550 m/z, MS2 isolation window 1.6 Da, charge states 2-5, threshold 3e4, AGO target 1 e4, max. injection time 150 ms, dynamic exclusion 2 counts within 10 s and 40 s exclusion, exclusion mass window ±7 ppm. MS scans were saved in profile mode while MSMS scans were saved in centroid mode.
Raw files from the orbitrap were processed with MaxQuant (version 1.5.5.1 )
(http://maxquant.org) (Tyanova, Temu, & Cox, 2016). The searches were performed using the Andromeda search engine in MaxQuant on a custom database containing the Avena sequences available from Uniprot augmented with the full complement of -100 unique UGT-like sequences identified from our oat root tip transcriptome database (Kemen et al., 2014) together with the MaxQuant contaminants database using trypsin/P with 2 missed cleavages, carbamidomethylation (C) as fixed and oxidation (M), acetylation (protein N-terminus), and deamidation (N,Q) as variable modifications. Mass tolerances were 4.5 ppm for precursor ions and 0.5 Da for fragment ions. Three biological replicates each of the samples from the root tip and from the elongation zone were quantitatively analysed in MaxQuant using the LFQ option.
Gene expression analysis. Expression of UGT genes was analysed by mRNA- reverse transcription-PCR (RT-PCR). cDNA was generated from 3-day-old tissues of the whole root (WR), root tip (RT, last 0.2 cm of the root), root elongation zone (EZ, from 0.2 cm to the first root hair) and young leaves (L). Transcript levels of the housekeeping gene encoding glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) was used to normalize the cDNA libraries over the 4 tissues. The previously characterised avenacin biosynthetic gene AsUGT74H5 ( Sad10 ) (ref) was included as a control. Gene-specific primers used for PCR amplification are listed in Table S8.
Cloning of the AsUGT coding sequences. Gateway technology (Invitrogen) was used to produce UGT expression constructs. Coding sequences of A. strigosa UGTs were amplified by PCR with a two-step method from root tip cDNA template (last 0.2 cm of the root). The first step consists of specific amplification of full-length CDS with gene specific primers harbouring partial AttB adapters at their 5’ ends (see Table S8 for primer sequences). The second step allows the attachment of full AttB sites at each extremity of the coding sequence. Amplified fragments were purified using QIAquick PCR Purification Kit (Qiagen). Purified CDSs were then transferred into pDONR207 vector using BP clonase II enzyme mix (Invitrogen) according to the manufacturer's instructions. Sequence-verified coding sequences were then transferred by LR clonase II reaction into pH9GW (Invitrogen), a Gateway-compatible variant of pET-28 encoding nine N-terminal histidines (O'Maille et al., 2008). Expression of recombinant UGTs in Escherichia coli. The E. coli Rosetta 2 strain DE3 (Novagen) was transformed with the expression vectors following the manufacturer’s instructions. Selected transformants were cultured in liquid Lysogeny Broth (LB) media under kanamycin/chloramphenicol (100 mg/mL and 35 mg/mL respectively) selection overnight at 37 °C. Pre-cultures were diluted 100-fold into fresh medium to initiate the cultures for induction. Production of recombinant enzymes was induced at 16 °C overnight with 0.1 pM of Isopropyl b-D-l- thiogalactopyranoside (IPTG) after 30 min of acclimation, and bacterial cells harvested by centrifugation at 4000 g for 10 min. Pellets were lysed enzymatically by resuspension and incubation at room temperature for 30 min in lysis buffer (50 mM TRIS pH 7.5, 300 mM NaCI, 20 mM imidazol, 5% glycerol, 1 % Tween 20 (Sigma), 10 mM b-mercaptoethanol, EDTA free protease inhibitor (Roche), 1 mg. ml 1 lysozyme (Lysozyme human, Sigma)). DNAse treatment was performed at room temperature for 15 min using deoxyribonuclease I from bovine pancreas (Sigma). Sonication of the lysate was performed on ice (3 x 10 s, amplitude 16; Soniprep 150 Plus, MSE). Soluble fractions were then harvested by centrifugation (21 ,000 g, 4 °C, 20 min) and filtered through 0.22 pm diameter filters (Millipore).
For preliminary assays of the oat UGT candidates, the soluble protein fraction was enriched for the His-tagged recombinant enzymes using nickel-charged resin (Ni- NTA agarose resin, Qiagen). Ni-NTA resin (300 mL) pre-equilibrated with buffer A (300 mM NaCI, 50 mM TRIS-HCI pH 7.5, 20 mM Imidazol, 5% glycerol) was incubated 30 min at 4 °C with the protein extract. The resin was washed 3 times with 500 mL buffer A and eluted with 300 mL buffer B (300 mM NaCI, 50 mM TRIS-HCI pH 7.8, 500 mM Imidazol, 5% glycerol). Protein concentrations were measured from coomasie-stained SDS-PAGE gel loaded with enriched proteins preparations and a BSA standard. Quantification of the recombinant protein was performed by densitometric analysis using ImageJ. Alternatively, for enzymatic assays performed with deglycosylated avenacin A-1 (Figure 6D, recombinant UGTs were purified by ion metal affinity chromatography (IMAC) with an AKTA purifier apparatus (GE
Healthcare) using nickel loaded HiTRAP IMAC FF 1 mL column (GE Healthcare). Chromatography was done at 0.5 mL.min 1. The column was pre-equilibrated with buffer A prior to loading with the protein extract. Unbound proteins were eluted with buffer A (0-16 min), and a linear gradient of 0-60% buffer B was then applied to the system over 30 min. Fractions containing recombinant enzyme (monitored by UV 280 nm) were pooled and concentrated using a 10 kDa centrifugal filter (Amicon, Ultra-4, Sigma). Protein purity was estimated by electrophoresis and protein concentration was measured with the Bradford method following standard procedure with a BSA standard curve (Bradford, 1976).
Protein samples were aliquoted and flash-frozen in liquid nitrogen prior to storage at - 80 °C.
Glycosylation assays using different triterpenoid acceptors. Reactions 50 mL comprised 100 mM TRIS-HCI pH 7.5, 200 pM of triterpenoid (see Table S7 for suppliers) and 500 pM uridine diphospho sugars [UDP-a-D-glucose (UDP-GIc), UDP- a-D-galactose (UDP-Gal) or UDP^-L-arabinopyranose (UDP-Ara); see Table S7 for suppliers]. Reactions were started by addition of 1 mg of enriched recombinant enzyme to the pre-warmed reaction mix and incubated overnight at 25 °C with shaking at 300 rpm. Reactions were stopped by partitioning twice the sample in 100 pl_ ethyl acetate. The organic phase was dried under N2 flux and resuspended in 20 mI_ methanol for analysis.
TLC analysis of triterpenoid glycosides. TLC plates were spotted with 10 mL of a methanolic sample. TLC plates were pre-run 3 times in 100% methanol 0.5 cm above the loading line prior to elution with the mobile phase dichloromethane:methanol:H20 (80:19:1 ; v:v:v). Plates were sprayed with methanoksulfuric acid (9:1 ) and heated to 130 °C for 2-3 min until coloration appeared. Photographs were taken under UV illumination at 365 nm. The organic phase was dried under N2 flux and resuspended in 20 mL methanol for analysis.
Transient expression in N. benthamiana. UGT coding sequences were cloned into pEAQ-HT-DEST1 (Sainsbury, Thuenemann, & Lomonossoff, 2009) via an LR clonase II reaction following the manufacturer’s instruction (Invitrogen). Strain culture and agroinfiltrations were performed following previously published method (Reed et al., 2017). Briefly, expression constructs were introduced into Agrobacterium and infiltrated into leaves of N. benthamiana. Co-infiltration were prepared by mixing equal volumes of bacterial solutions previously diluted down to 0.8 ODeoonm; GFP was used as a control or included in combination in place of a gene to have comparable bacterial density between infiltrations of the same experiment.
Metabolites sample preparation from N. benthamiana leaves. N. benthamiana leaves were harvested 6 days after agro-infiltration and freeze-dried. Freeze-dried leaf material (20 mg) was ground twice at 20 c.s-1 for 30 s (TissueLyser, Qiagen). Extractions were carried out in 1 mL 80% methanol with 20 mg of digitoxin (internal standard; Sigma) for 20 min at 90 °C, with shaking at 1400 rpm (Thermomixer Comfort, Eppendorf). Samples were centrifuged at 10,000 g for 5 min and 0.8 mL of the supernatant partitioned twice with 0.3 mL of hexane. The aqueous phase was dried in vacuo (EZ-2 Series Evaporator, Genevac). Dried material was resuspended in 0.5 mL distilled water and partitioned twice with 0.5 ml of ethyl acetate. The organic phase was dried in vacuo and resuspended in 150 mL of methanol followed by filtration (0.2 pm, Spin-X, Costar). Filtered samples were transferred to glass vials and 50 mL of water added. Samples were analysed by HPC-CAD following method C.
Purification of 12,13-epoxy-16-hydroxy-P-amyrin 3-O-arabinoside (ErHbA-Ara).
Agro-infiltration of N. benthamiana leaves for co-expression of SAD1 , SAD2 and UGT99D1 was carried out by vacuum infiltration of 44 N. benthamiana plants following published methods (Reed et al., 2017). The plants were harvested 6 days later and the leaves lyophilized. Dried leaf material was ground to a powder using a mortar and pestle and processed by pressurized extraction as described previously (Reed et al., 2017). The extraction method consisted of an initial hexane cycle (5 min pressure holding at 130 bars followed by 3 min discharge, extraction cells being heated at 90 °C) to remove chlorophylls and apolar pigments. The following 5 cycles were done with ethyl acetate and were used for further purification.
The crude extract was dried by rotary evaporation before being resuspended in 80% aqueous methanol. The methanolic extract was then partitioned in n-hexane (1 :1 ) three times until most of the remaining chlorophyll had been removed. The resulting methanolic sample was dried by rotary evaporation together with diatomaceous earth to allow dry-loading of the flash chromatography column (Celite 545 AW, Sigma). Purification was performed using an Isolera One (Biotage) automatic flash purification system. The crude solid was subjected to normal phase flash
chromatography (column SNAP KP/Sil 30 g, Biotage). The mobile phase was dichloromethane as solvent A and methanol as solvent B. After an initial isocratic phase with 4% B (5 column volumes (CV)), a gradient was set from 4 to 25% B over 40 CV. The fractions containing the ErHbA-Ara were identified by TLC, pooled and then dried down by rotary evaporation together with diatomaceous earth. The resulting solid was subjected to reverse phase flash chromatography (SNAP Cie column 12 g, Biotage). The mobile phase was water as solvent A and methanol as solvent B. After an initial isocratic phase with 70% B (3 CV), a gradient was set from 70 to 90% B over 20 CV. The fractions containing the ErHbA-Ara were identified by TLC and pooled prior to rotary evaporation down to 10 mL. A precipitate was observed in the resulting aqueous sample at 4 °C. The ErHbA-Ara was pelleted by centrifugation at 4000 g for 15 min.
NMR analysis. NMR spectra were recorded in Fourier transform mode at a nominal frequency of 400 MHz for 1H NMR, and 100 MHz for 13C NMR, using deuterated methanol. Chemical shifts were recorded in ppm and referenced to an internal TMS standard. Multiplicities are described as, s = singlet, d = doublet, dd; coupling constants are reported in Hertz as observed and not corrected for second order effects. Where signals overlap 1H d is reported as the centre of the respective HSQC crosspeak (see Figure 10).
Identification of aat1 mutant. AsAATI gene was sequenced in the remaining 47 uncharacterised sodium azide-generated avenacin deficient mutants obtained previously (1 , unpublished work). Genomic DNA was extracted by the Genotyping Scientific Service of the John Innes centre using an in-house extraction method. PCR amplification of AsAATI full-length CDS (primers in Table S8) was sent for sequencing (Eurofins); sequences were search for SNPs using CLCbio software (Qiagen). The mutant line #807 was the only one presenting a SNP (G to A at 753 bp) giving rise to a premature stop codon (Figure 11 A).
Analysis of Segregating Progeny. Root tips were harvested from 3 day-old seedlings of F2 progeny from a cross between the avenacin-deficient mutant #807 and the A. strigosa wild type as described by Papadopoulou et al. (1999), incubated in methanol at 50 °C for 15 min with shaking at 1400 rpm, and then put on ice. The methanolic extract was transferred to a new tube, dried under N2 flux, and resuspended in 50 uL of methanol. Aliquots (5 uL) of each sample was loaded onto TLC plates. Chromatography was carried out using dichloromethane:methanol:H20 (80:19:1 ; v:v:v) as a mobile phase, and the developed TLCs examined under UV illumination (365 nm). In parallel, genomic DNA was extracted by the Genotyping Scientific Service from the leaf tissues of the same plants 10 days after germination (seedlings were grown on distilled water agar after root tip harvesting as previously described (Papadopoulou et al., 1999)). A 533 bp region spanning the region of the single nucleotide mutation detected in the AsAATI gene of mutant #807 (753G->A) was amplified by PCR and sequenced (see Table S8 for primers). Recovery of the A. atlantica AsAATI gene sequence. A. atlantica accession Cc7277 (IBERS collection, Aberystwyth University) was sequenced by lllumina technology to approximately 38-fold coverage with a number of paired end and mate pair libraries. Assembled contigs were then mapped by survey sequencing of recombinant inbred lines of a population of Cc7277 and the A. strigosa accession Cc7651 (IBERS) (Vickerstaff et al, in preparation). Annotations of contigs linked to the previously identified Sad genes were used to identify potential UGTs and other candidates for components of the avenacin pathway.
Enzymatic assays with recombinant GmSSAT.
Obtaining recombinant GmSSAT and UGT73F2: The coding sequences of the soybean candidate UGT GmSSAT and the characterized G. max UGT73F2 glucosylating nonacetylated saponin AO-ag (Sayama et al., 2012) were synthesized commercially (IDT). These sequences were flanked with AttB adapters, allowing subsequent transfer into pH9GW using Gateway technology as described earlier. Recombinant GmSSAT was expressed in E. coli Rosetta 2 strain DE3 (Novagen) and purified following method described in this paper.
Enzymatic assays GmSSAT: Details in main text.
Purification of soyasaponin I arabinoside: Semi-preparative HPLC purification of soyasaponin I arabinoside (SSI-Ara) was carried out with an UltiMate 3000 HPLC system (Dionex) combined with a Corona Veo RS Charged Aerosol Detector (CAD) using a Kinetex column 2.6 pm XB-C18 100 A, 50 x 2.1 mm (Phenomenex).
GmSSAT reaction with 60 nmoles of soyasaponin I was set up in excess of UDP-Ara and left until it went to completion. The reaction products were then separated with a linear gradient (25-46 % of acetonitrile:water). Fractions containing SSI-Ara were dried and purity was assessed by CAD-HPLC (method D); purity was comparable to commercial soyasaponin I (Chengdu Biopurify Phytochemicals Ltd.; purity > 98 %).
Docking of AsAATI model with UDP-Ara: A homology model was generated with l-TASSER (Yang et al., 2015) using the crystal structure of Medicago truncatula UGT71 G1 complexed with UDP-GIc as a template (PDB entry: 2ACW) (Shao et al., 2005). This homology model contained a strained loop comprising residues Trp396 to Ser402 due to a 2-residue insertion relative to the template. To identify the most likely conformation for this loop, 20 loop models were generated using the
MODELLER (Sali & Blundell, 1993) plugin to Chimera (Pettersen et al., 2004). The six loop conformations with the best scores in terms of zDOPE, estimated RMSD and estimated overlap were used to generate models for the structure of the complex with UDP-Ara, based on the conformation of UDP-GIc found in PDB entry 2ACW (Shao et al., 2005). The resulting draft-docked complexes were relaxed using the molecular dynamics program GROMACS (Van Der Spoel et al., 2005) and the force field 53a6 (Oostenbrink, Villa, Mark, & van Gunsteren, 2004). The models were solvated in a cubic periodic box of SPC 3-site water molecules and subjected to 104 steps of energy minimization. The necessary parameters for UDP-Ara were based on those available for uridine, ATP and glucose in the 53a6 forcefield. Following this step, the optimal model was selected for analysis based on having the best QMEAN score (Benkert, Tosatto, & Schomburg, 2008) and no Ramanchandran or rotamer outliers in the remodelled loop according to the structure validation service, MolProbity (Chen et al„ 2010).
In vitro assays of AsAATI wt and mutants.
Mutagenesis of AsAATI : Site-directed mutagenesis was performed by PCR amplification using the expression vector pH9GW-AsAAT1 as template and the mutated complementary sequences as primers (Table S8). Mutagenized genes were cloned into the entry vector pDONR207, transferred back into pH9GW expression vector and transformed into E. coli BL21 Rosetta. The recombinant enzymes were purified via IMAC using an AKTA purifier apparatus and quantified with the Bradford method as described in Expression of recombinant UGTs in Escherichia coli, above. Purification of hydrolysed avenacin A-1. AsAATI acceptor, hydrolysed avenacin A-1 , required purification and absolute quantification prior to kinetic analysis.
Hydrolysis of purified avenacin A-1 (483 mg, Table S7) was scaled up using the method described previously (/.e., partial re-glycosylation of avenacin A-1 ). The entire sample was directly subjected to reverse phase flash chromatography (SNAP Ci8 column 12 g, Biotage). Elution was performed with a linear gradient from 65 to 72% methanokwater over 55 CV. Elution of hydrolysed avenacin A-1 was monitored under illumination at 365 nm. Fluorescent fractions were collected, dried via rotary evaporation and subjected to normal phase flash chromatography (column SNAP KP/Sil 30 g, Biotage). The mobile phase was dichloromethane as solvent A and methanol as solvent B. After an initial isocratic phase with 5% B (5 CV), a gradient was set from 5 to 11 % B over 40 CV. Fluorescent fractions were pooled and dried.
No impurities were detected by HPLC-CAD-fluorescence analysis. Absolute quantification via HPLC-fluorescence using an avenacin standard corroborate with precision weight of the recovered purified product; a total of 208 mg were retrieved after purification and dissolved in DMSO into a 5 mM stock solution.
In vitro analysis of AsAATI wild-type and mutants: Details in main text.
Triterpene analysis:
Analytical liquid chromatography. All methods are designed with a flow rate of 0.3 mL.min 1 and a Kinetex column 2.6 pm XB-C18 100 A, 50 x 2.1 mm (Phenomenex). Solvent A: [H2O + 0.1 % formic acid (FA)] Solvent B: [acetonitrile (CH3CN) + 0.1 % FA]
Method A - HPLC-UV analysis of TCP glycosylation assays: Instrument: Dionex UltiMate 3000. Injection volume: 15 mL. Gradient: 20 % [B] from 0 to 1.5 min, 20 % to 50 % [B] from 1.5 to 16 min, 50 % to 95 % [B] from 16 to 16.5 min, 95 % [B] from 16.5 to 18.5 min, 95 % to 20 % [B] from 18.5 to 20 min. Detection: UV 205 nm.
Method B - Analysis of avenacin A-1 reglycosylation assay using LCMS- fluorescence: Instrument: Prominence HPLC system, RF-20Axs fluorescence detector, single quadrupole mass spectrometer LCMS-2020 (Shimadzu). Injection volume: 5 mL. Gradient: 35 % [B] from 0 to 2 min, 35 % to 50 % [B] from 2 to 12 min, 50 % to 95 % [B] from 12 to 12.5 min, 95 % [B] from 12.5 to 14 min, 95 % to 35 % [B] from 14 to 14.1 min, 35 % [B] from 14.1 to 15 min. Detection: fluorescence (Ex 353 nm/Em 441 nm), MS (dual ESI/APCI ionization, DL temp 250 °C, neb gas flow 15 L.min 1, heat block temp 400 °C, spray voltage Pos 4.5 kV, Neg -3.5 kV).
Method C - HPLC-CAD analysis of N. benthamiana methanolic extracts:
Instrument: UltiMate 3000 HPLC system, Corona Veo RS Charged Aerosol Detector (CAD) (Dionex). Injection volume: 15 mI_. Gradient: 25 % [B] from 0 to 1.5 min, 25 % to 58 % [B] from 1.5 to 16 min, 58 % to 95 % [B] from 16 to 16.5 min, 95 % [B] from
16.5 to 18.5 min, 95 % to 25 % [B] from 18.5 to 19 min, 35 % [B] from 19 to 20 min. Detection: charged aerosol (data collection rate 10 Hz, filter constant 3.6 s, evaporator temp. 35 °C, ion trap voltage 20.5 V).
Method D - Metabolites analysis of oat root tips using LCMS-CAD- fluorescence: Instrument: Prominence HPLC system, RF-20Axs fluorescence detector (Shimadzu), single quadrupole mass spectrometer LCMS-2020 (Shimadzu), Corona Veo RS CAD (Dionex). Injection volume: 10 mI_. Gradient: 20 % [B] from 0 to 3 min, 20 % to 60 % [B] from 3 to 28 min, 60 % to 95 % [B] from 28 to 30 min, 95 % [B] from 30 to 33 min, 95 % to 20 % [B] from 33 to 34 min, 20 % [B] from 34 to 35 min. Detection: fluorescence and charged aerosol (settings identical to previous methods).
Method E - HRMS analysis of in vitro reaction with recombinant soybean enzymes: Instrument: Prominence HPLC system, IT-TOF mass spectrometer (Shimadzu). Injection volume: 5 mL. Gradient: 20 % [B] from 0 to 2 min, 20 % to 46 % [B] from 2 to 16.5 min, 46 % to 95 % [B] from 16.5 to 17 min, 95 % [B] from 17 to
18.5 min, 95 % to 20 % [B] from 18.5 to 19 min, 20 % [B] from 19 to 20 min.
Detection: Neg. ESI ionization (capillary temp. 250 °C, nebulizing gas 1.5 L.min 1, heat block temp. 300 °C, spray voltage -3.5 kV. Energy/collision gas MS2 50 %, MS3 75 %).
Method F - HPLC-fluorescence analysis of enzymatic assay with
deglycosylated avenacin A-1 as substrate: Instrument: Prominence HPLC system, RF-20Axs fluorescence detector (Shimadzu). Injection volume: 7 mL. Gradient: 40 % [B] from 0 to 2 min, 40 % to 50 % [B] from 2 to 6 min, 50 % to 95 % [B] from 6.5 to 7 min, 95 % [B] from 7 to 7.5 min, 95 % to 20 % [B] from 7.5 to 8 min, 20 % [B] from 8 to 9 min. Detection: fluorescence (Ex 353 nm/Em 441 nm).
Gas chromatography.
Triterpenoid extraction and analysis by GC-MS. Samples preparation and GC-MS analysis was performed as described previously (Reed et al., 2017). Briefly, approximately 5 mg of dried agro-infiltrated leaf material was saponified in alkaline conditions. Hexane partition was used to remove saponified pigments, the
unsaponifiable aqueous fraction was derivatised with 1 -(trimethylsilyl)imidazole (Sigma) and analysed by GC-MS. Coprostan-3-ol (Sigma) was used as an internal standard to a final concentration of 10 mg/mL.
Figure imgf000080_0001
Figure imgf000081_0001
Figure imgf000082_0001
Table S2. A. thaliana UGT protein sequences used in tBLASTn
Name GenBank accession no. Group
Figure imgf000083_0001
n.d., not defined. UGT80s and UGT81 s belong to GT28 and therefore does not fall into one of the phylogenetic group defined for GT 1 s.
Figure imgf000084_0001
Figure imgf000085_0001
Figure imgf000086_0001
Figure imgf000087_0001
Figure imgf000088_0001
Figure imgf000089_0001
Figure imgf000090_0001
Table S5. Mapping of candidate avenacin glycosyltransferase
genes
A. strigosa Relative position in
UGT genes A. atlantica genome*
AsUGT98B4 LG3, 52.25 cM
AsUGT701A5 LG2, 122 cM
AsUGT99C4 LG1 , 135.5 cM
AsUGT99D1 LG7, 0.66 cM
AsUGT99B9 LG3, 48.9 cM
AsUGT99A6 LG4, 70.82 cM
AsUGT705A4 LG2, 204.5 cM
AsUGT706F7 LG3, 146.35 cM
AsUGT93B16 LG5, 201 .84 cM
AsUGT74H5 LG7, 0.66 cM
*Positions of scaffolds containing oat UGTs on A. atlantica genome zipper linkage groups (LGs); Sad2 is located on LG7 at 0.66 cM.
Table S6. Candidate soybean arabinosyltransferases identified by genome mining
Amino acid
Acc. no. in UGT UGT
Figure imgf000092_0001
Most closely related characterised enzyme Percentage Plant species Ref. Soybase* subfamily group
identity
Figure imgf000092_0002
* Website: https://soybase.org
GmSSATI is highlighted in grey.
Figure imgf000093_0001
Table S8. Primers
Name Sequence
Primers used for cloning
attB1 adapter
primer GGGGACAAGTTTGTACAAAAAAGCAGGCT 72.9 attB2 adapter
primer GGGGACCACTTTGTACAAGAAAGCTGGGT 74.7
Fgw-
UGT74H5 AAAAAGCAGGCTTAATGGGGGCTGAGTGGGAGCA 82.2
Rgw-
UGT74H5 AGAAAGCTGGGTATCATGCATCTAACCCCACCAGCA 80.9
Fgw-
AsUGT705A4 AAAAAGC AGG CTT AAT G G C CTCT AAC GAT AAT GTCCCCACGG 82.1
Rgw-
AsllGT705A4 AGAAAGCTGGGTATCAGGTCCGCGGCCTCTTTGCTG 84.4
Fgw-
AsUGT99C4 AAAAAGCAGGCTTAATGGCGCCCACGGAGACGGC 85.3
Rgw-
AsUGT99C4 AGAAAGCTGGGTATCACTGCTCCTTGCTGCCACTCCGC 84.9
Fgw-
AsUGT99D1 AAAAAGCAGGCTTAATGGGGAAACCAGCAGCAGG 80.4
Rgw-
AsUGT99D1 AGAAAGCTGGGTACT AGCT AGAT CGAT CGATT G 64.4
Fgw-
AsUGT98B4 AAAAAGCAGGCTTAATGACCTTCGCCCGCGGC 83.1
Rgw-
AsllGT98B4 AGAAAGCTGGGTAT CAGCCACAT GCATTT GT G 77.7
Fgw-
AsUGT99B9 AAAAAGCAGGCTTAATGGGGACGTTGTCGGAGCT 80.3
Rgw-
AsUGT99B9 AGAAAGCTGGGTAT CAAGACT GTACT GACAGTGCAG 75.4
Fgw-
AsUGT701A5 AAAAAGCAGGCTTAATGGAGACCTCCGCAA 76.6
Rgw-
AsUGT701A5 AG AAAG CTGGGTATCACG C AC AAG AAT C G ATC 76.4
Fgw-
AsUGT93B16 AAA AAG C AG G CTT AAT GGGGATTGAGTCGATGGACA 79.9
Rgw-
AsllGT93B16 AGAAAGCTGGGTAT CAAAT CCTT GT GAT GT GAGCAA 77.6
Fgw-
AsUGT706F7 AAAAAGCAGGCTTAAT GAAGCAGACCGT CGTCCT GT 79.6
Rgw-
AsllGT706F7 AGAAAGCTGGGTATCACTCGCGTACCTGCTCTCCGA 81.9
Rgw- AAAAAG C AGG CTT AAT G G C C AAC C AAAC C C AAG C G C 71.0 AsUGT99A6
Fgw-
AsUGT99A6 AG AAAGCTGGGTAT CATT C AG CAG CAT CCT GAGT AG 67.2
Fgw-
UGT78D3 AAAAAGCAGGCTTAATGGCCAAACCCTCGCAG 79.7
Rgw-
UGT78D3 AGAAAGCTGGGTATCATTATCCAAAGTTCACAACTT 72.7
Primers used for expression profile
Fep-GAPDH T GTT GAGGGT CT GAT GACCA 64.3
Rep-GAPDH TG CTTG G G AAT GAT GTTG AA 64.0
Fep-
UGT74H5 GTGGGAGCACGTCAGCGAC 69.7
Rep-
UGT74H5 CGTTGGCAGATCCTCGGC 69.4
Fep-
AsllGT705A4 GAT GAT GAT GAT G CAGTG GTG GAG 70.0
Rep-
AsllGT705A4 TGCTGCTAGATATTGGCGGC 67.5
Fep-
AsUGT99C4 AT AT CAGTT GATT CACC GTT GTTT 62.6
Rep-
AsUGT99C4 AGAGCTGTCCGGTAGCACG 66.0
Fep-
AsllGT99D1 TTGGGGTGGCAAGAAGGTGT 60.8
Rep-
AsllGT99D1 TGGCCGGATCGTGAGAGGAT 61.3
Fep-
AsllGT98B4 GGCTTCTGTGGCTTCTCGTCC 69.7
Rep-
AsUGT98B4 TGTGTTGCTGTCTCGGTGGCA 72.9
Fep-
AsUGT99B9 GTTTCGAGGCGCGGGTCAAG 73.3
Rep-
AsUGT99B9 CATCAACTCGGCGACCGCCT 74.0
Fep-
AsllGT701A5 CTCTACAGGCAAGGGCGGCA 72.0
Rep-
AsllGT701A5 CT CCTT GCCAT CCAGCCAAG 69.4
Fep-
AsllGT93B16 CGATGGACAGTAGTGTGGCGTT 68.5
Rep-
AsllGT93B16 GCGGTGGGTGGCCGAGAG 74.2
Fep-
AsllGT706F7 GAG GAG CT GT G CAAAGAAAT CAC 66.4
Rep-
AsllGT706F7 GTCCGCTCTAGGAAACCTTCTGG 68.2 Fep-
AsllGT99A6 TGCT GACCCGAAACAGAT CAT G 69.6
Rep-
AsllGT99A6 CCACCACGAT CT CCTT CTT GT C 67.3
Primers used for sequencing AsAATI gene in avenacin deficient mutants
Fgen-
AsUGT99D1 TGAGCTGCATCGTGTCG 56.2
Rgen-
AsUGT99D1 CATCTTGGGAGCGATGGTC 56.3
Fin-
AsUGT99D1 AGCGAGCGCATTCCCAG 58.9
Primers used for site-directed mutagenesis and PSPG swapping
F-99D1-
H404Q T CGGACCAGTT CGT GAACGAGAAGTT C 64.3
R-99D1-
H404Q CGAACTGGTCCGACCCTATGAGACGAGG 67.9
F-99D1-
IGsupr CCTCGT CT CTCGGACCAGTT CGT GAACG 68.9
R-99D1-
IGsupr CGAGAGACGAGGCCACGTCACCGCGG 74.7
F-99D1-
P154S GCTT CTT CTCCAT GTGTG 51 .2
R-99D1-
P154S CACAC AT G GAGAAG AAG C 51 .4
A-99D1/99A6
pspg ccttaacgagaagctggctGTGGAGGTGCTACGGATCG 72.2
R-99D1/99A6
pspg ccaagtaacaacaggaagCCCAGCCGTGATGGCC 71 .8
Adapter pspg CCGTCATGGAGGCCATCACGGCTGGGcttcctgttgttacttggcctcatttcaccgatcagttc 99A6 cttaacgagaagctggctGTGGAGGT GCTACGGATCGGTGTCAGC
References for Example 10
Achnine, L, Huhman, D. V., Farag, M. A., Sumner, L. W., Blount, J. W., & Dixon, R.
A. 2005. Genomics-based selection and functional characterization of triterpene glycosyltransferases from the model legume Medicago truncatula. Plant J, 41 (6): 875-887.
Augustin, J. M., Drok, S., Shinoda, T., Sanmiya, K., Nielsen, J. K., Khakimov, B.,
Olsen, C. E., Hansen, E. H., Kuzina, V., Ekstrom, C. T., Hauser, T., & Bak, S. 2012. UDP-glycosyltransferases from the UGT73C subfamily in Barbarea vulgaris catalyze sapogenin 3-O-glucosylation in saponin-mediated insect resistance. Plant Physiol, 160(4): 1881-1895.
Benkert, P., Tosatto, S. C., & Schomburg, D. 2008. QMEAN: A comprehensive
scoring function for model quality assessment. Proteins, 71 (1 ): 261-277.
Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 72: 248-254.
Caputi, L., Malnoy, M., Goremykin, V., Nikiforova, S., & Martens, S. 2011. A genome- wide phylogenetic reconstruction of family 1 UDP-glycosyltransferases revealed the expansion of the family during the adaptation of plants to life on land. Plant J, 69(6): 1030-1042.
Carter, J. P., Spink, J., Cannon, P. F., Daniels, M. J., & Osbourn, A. E. 1999.
Isolation, characterization, and avenacin sensitivity of a diverse collection of cereal-root-colonizing fungi. Appl Environ Microbiol, 65(8): 3364-3372.
Chen, V. B., Arendall, W. B., 3rd, Headd, J. J., Keedy, D. A., Immormino, R. M., Kapral, G. J., Murray, L. W., Richardson, J. S., & Richardson, D. C. 2010. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr D Biol Crystallogr, 66(Pt 1 ): 12-21.
Dai, L., Liu, C., Zhu, Y., Zhang, J., Men, Y., Zeng, Y., & Sun, Y. 2015. Functional characterization of cucurbitadienol synthase and triterpene
glycosyltransferase involved in biosynthesis of mogrosides from Siraitia grosvenorii. Plant Cell Physiol, 56(6): 1172-1 182.
de Costa, F., Barber, C. J. S., Kim, Y. B., Reed, D. W., Zhang, H., Fett-Neto, A. G., & Covello, P. S. 2017. Molecular cloning of an ester-forming triterpenoid: UDP- glucose 28-O-glucosyltransferase involved in saponin biosynthesis from the medicinal plant Centella asiatica. Plant Sci, 262: 9-17.
DeBolt, S., Scheible, W. R., Schrick, K., Auer, M., Beisson, F., Bischoff, V., Bouvier- Nave, P., Carroll, A., Hematy, K., Li, Y., Milne, J., Nair, M., Schaller, H.,
Zemla, M., & Somerville, C. 2009. Mutations in UDP-glucose:sterol glucosyltransferase in Arabidopsis cause transparent testa phenotype and suberization defect in seeds. Plant Physiol, 151 (1 ): 78-87.
Frydman, A., Liberman, R., Huhman, D. V., Carmeli-Weissberg, M., Sapir-Mir, M., Ophir, R., Sumner, L. W., & Eyal, Y. 2013. The molecular and enzymatic basis of bitter/non-bitter flavor of citrus fruit: evolution of branch-forming rhamnosyl-transferases under domestication. Plant Journal, 73(1 ): 166-178.
Fukuchi-Mizutani, M., Okuhara, H., Fukui, Y., Nakao, M., Katsumoto, Y., Yonekura- Sakakibara, K., Kusumi, T., Hase, T., & Tanaka, Y. 2003. Biochemical and molecular characterization of a novel UDP-glucose : anthocyanin 3 '-O- glucosyltransferase, a key enzyme for blue anthocyanin biosynthesis, from gentian. Plant Physiology, 132(3): 1652-1663.
Geisler, K., Hughes, R. K., Sainsbury, F., Lomonossoff, G. P., Rejzek, M., Fairhurst, S., Olsen, C. E., Motawia, M. S., Melton, R. E., Hemmings, A. M., Bak, S., & Osbourn, A. 2013. Biochemical analysis of a multifunctional cytochrome P450 (CYP51 ) enzyme required for synthesis of antimicrobial triterpenes in plants. Proc Natl Acad Sci U S A, 110(35): 3360-3367.
Grille, S., Zaslawski, A., Thiele, S., Plat, J., & Warnecke, D. 2010. The functions of steryl glycosides come to those who wait: Recent advances in plants, fungi, bacteria and animals. Prog Lipid Res, 49(3): 262-288.
Han, S. H., Kim, B. G., Yoon, J. A., Chong, Y., & Ahn, J. H. 2014. Synthesis of
flavonoid O-pentosides by Escherichia coli through engineering of nucleotide sugar pathways and glycosyltransferase. Appl Environ Microbiol, 80(9): 2754-2762.
Hansen, K. S., Kristensen, C., Tattersall, D. B., Jones, P. R., Olsen, C. E., Bak, S., & Moller, B. L. 2003. The in vitro substrate regiospecificity of recombinant UGT85B1 , the cyanohydrin glucosyltransferase from Sorghum bicolor.
Phytochemistry, 64(1 ): 143-151.
Haralampidis, K., Bryan, G., Qi, X., Papadopoulou, K., Bakht, S., Melton, R., &
Osbourn, A. 2001. A new class of oxidosqualene cyclases directs synthesis of antimicrobial phytoprotectants in monocots. Proc Natl Acad Sci U S A,
98(23): 13431-13436.
Hartley, J. L., Temple, G. F., & Brasch, M. A. 2000. DNA cloning using in vitro site- specific recombination. Genome Res, 10(11 ): 1788-1795.
He, X. Z., Wang, X., & Dixon, R. A. 2006. Mutational analysis of the Medicago
glycosyltransferase UGT71 G1 reveals residues that control regioselectivity for (iso)flavonoid glycosylation. J Biol Chem, 281 (45): 34441-34447.
Hirotani, M., Kuroda, R., Suzuki, H., & Yoshikawa, T. 2000. Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis. Planta, 210(6): 1006-1013.
Hou, B., Lim, E. K., Higgins, G. S., & Bowles, D. J. 2004. /V-glucosylation of
cytokinins by glycosyltransferases of Arabidopsis thaliana. J Biol Chem, 279(46): 47822-47832.
Husar, S., Berthiller, F., Fujioka, S., Rozhon, W., Khan, M., Kalaivanan, F., Elias, L., Higgins, G. S., Li, Y., Schuhmacher, R., Krska, R., Seto, H., Vaistij, F. E., Bowles, D., & Poppenberger, B. 201 1. Overexpression of the UGT73C6 alters brassinosteroid glucoside formation in Arabidopsis thaliana. BMC Plant Biol, 1 1 : 51.
Imayama, T., Yoshihara, N., Fukuchi-Mizutani, M., Tanaka, Y., Ino, I., & Yabuya, T.
2004. Isolation and characterization of a cDNA clone of UDP-glucose:
anthocyanin 5-O-glucosyltransferase in Iris hollandica. Plant Science,
167(6): 1243-1248.
Itkin, M., Heinig, U., Tzfadia, O., Bhide, A. J., Shinde, B., Cardenas, P. D., Bocobza, S. E., Unger, T., Malitsky, S., Finkers, R., Tikunov, Y., Bovy, A., Chikate, Y., Singh, P., Rogachev, I., Beekwilder, J., Giri, A. P., & Aharoni, A. 2013.
Biosynthesis of antinutritional alkaloids in solanaceous crops is mediated by clustered genes. Science, 341 (6142): 175-179. Itkin, M., Rogachev, I., Alkan, N., Rosenberg, T., Malitsky, S., Masini, L, Meir, S., lijima, Y., Aoki, K., de Vos, R., Prusky, D., Burdman, S., Beekwilder, J., & Aharoni, A. 2011. GLYCOALKALOID METABOLISM1 is required for steroidal alkaloid glycosylation and prevention of phytotoxicity in tomato. Plant Cell, 23(12): 4507-4525.
Kannangara, R., Motawia, M. S., Hansen, N. K., Paquette, S. M., Olsen, C. E.,
Moller, B. L., & Jorgensen, K. 201 1. Characterization and expression profile of two UDP-glucosyltransferases, UGT85K4 and UGT85K5, catalyzing the last step in cyanogenic glucoside biosynthesis in cassava. Plant J, 68(2): 287-301.
Kemen, A. C., Honkanen, S., Melton, R. E., Findlay, K. C., Mugford, S. T., Hayashi, K., Haralampidis, K., Rosser, S. J., & Osbourn, A. 2014. Investigation of triterpene synthesis and regulation in oats reveals a role for beta-amyrin in determining root epidermal cell patterning. Proc Natl Acad Sci U S A,
1 11 (23): 8679-8684.
Kim, J. H., Kim, B. G., Park, Y., Ko, J. H., Lim, C. E., Lim, J., Lim, Y., & Ahn, J. H.
2006. Characterization of flavonoid 7-O-glucosyltransferase from Arabidopsis thaliana. Biosci Biotechnol Biochem, 70(6): 1471-1477.
Ko, J. H., Kim, B. G., Hur, H. G., Lim, Y., & Ahn, J. H. 2006. Molecular cloning,
expression and characterization of a glycosyltransferase from rice. Plant Cell Rep, 25(7): 741-746.
Ko, J. H., Kim, B. G., Kim, J. H., Kim, H., Lim, C. E., Lim, J., Lee, C., Lim, Y., & Ahn, J. H. 2008. Four glucosyltransferases from rice: cDNA cloning, expression, and characterization. J Plant Physiol, 165(4): 435-444.
Kubo, A., Arai, Y., Nagashima, S., & Yoshikawa, T. 2004. Alteration of sugar donor specificities of plant glycosyltransferases by a single point mutation. Arch Biochem Biophys, 429(2): 198-203.
Kumar, S., Stecher, G., & Tamura, K. 2016. MEGA7: Molecular Evolutionary
Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33(7): 1870-1874.
Lanot, A., Hodge, D., Jackson, R. G., George, G. L., Elias, L., Lim, E. K., Vaistij, F.
E., & Bowles, D. J. 2006. The glucosyltransferase UGT72E2 is responsible for monolignol 4-O-glucoside production in Arabidopsis thaliana. Plant J, 48(2): 286-295.
Li, Y., Baldauf, S., Lim, E. K., & Bowles, D. J. 2001. Phylogenetic analysis of the UDP-glycosyltransferase multigene family of Arabidopsis thaliana. J Biol Chem, 276(6): 4338-4343.
Martin, R. C., Mok, M. C., Habben, J. E., & Mok, D. W. 2001. A maize cytokinin gene encoding an O-glucosyltransferase specific to cis- zeatin. Proc Natl Acad Sci U S A, 98(10): 5922-5926.
Meesapyodsuk, D., Balsevich, J., Reed, D. W., & Covello, P. S. 2007. Saponin
biosynthesis in Saponaria vaccaria. cDNAs encoding beta-amyrin synthase and a triterpene carboxylic acid glucosyltransferase. Plant Physiol, 143(2): 959-969.
Meissner, D., Albert, A., Bottcher, C., Strack, D., & Milkowski, C. 2008. The role of UDP-glucose:hydroxycinnamate glucosyltransferases in phenylpropanoid metabolism and the response to UV-B radiation in Arabidopsis thaliana. Planta, 228(4): 663-674. Messner, B., Thulke, O., & Schaffner, A. R. 2003. Arabidopsis glucosyltransferases with activities toward both endogenous and xenobiotic substrates. Planta, 217(1 ): 138-146.
Modolo, L. V., Li, L., Pan, H., Blount, J. W., Dixon, R. A., & Wang, X. 2009. Crystal structures of glycosyltransferase UGT78G1 reveal the molecular basis for glycosylation and deglycosylation of (iso)flavonoids. J Mol Biol, 392(5): 1292- 1302.
Moehs, C. P., Allen, P. V., Friedman, M., & Belknap, W. R. 1997. Cloning and
expression of solanidine UDP-glucose glucosyltransferase from potato. Plant
J. 1 1 (2): 227-236.
Morita, Y., Hoshino, A., Kikuchi, Y., Okuhara, H., Ono, E., Tanaka, Y., Fukui, Y.,
Saito, N., Nitasaka, E., Noguchi, H., & lida, S. 2005. Japanese morning glory dusky mutants displaying reddish-brown or purplish-gray flowers are deficient in a novel glycosylation enzyme for anthocyanin biosynthesis, UDP- glucose:anthocyanidin 3-0-glucoside-2"-0-glucosyltransferase, due to 4-bp insertions in the gene. Plant J, 42(3): 353-363.
Mugford, S. T., Louveau, T., Melton, R., Qi, X., Bakht, S., Hill, L., Tsurushima, T., Honkanen, S., Rosser, S. J., Lomonossoff, G. P., & Osbourn, A. 2013.
Modularity of plant metabolic gene clusters: A trio of linked genes that are collectively required for acylation of triterpenes in oat. Plant Cell, 25(3):
1078-1092.
Mugford, S. T., Qi, X., Bakht, S., Hill, L., Wegel, E., Hughes, R. K., Papadopoulou,
K., Melton, R., Philo, M., Sainsbury, F., Lomonossoff, G. P., Roy, A. D., Goss, R. J., & Osbourn, A. 2009. A serine carboxypeptidase-like acyltransferase is required for synthesis of antimicrobial compounds and disease resistance in oats. Plant Cell, 21 (8): 2473-2484.
Mylona, P., Owatworakit, A., Papadopoulou, K., Jenner, H., Qin, B., Findlay, K., Hill,
L., Qi, X., Bakht, S., Melton, R., & Osbourn, A. 2008. Sad3 and Sad4 are required for saponin biosynthesis and root development in oat. Plant Cell, 20(1 ): 201-212.
Nagashima, S., Inagaki, R., Kubo, A., Hirotani, M., & Yoshikawa, T. 2004. cDNA
cloning and expression of isoflavonoid-specific glucosyltransferase from Glycyrrhiza echinata cell-suspension cultures. Planta, 218(3): 456-459.
Nagatoshi, M., Terasaka, K., Nagatsu, A., & Mizukami, H. 201 1. Iridoid-specific
glucosyltransferase from Gardenia jasminoides. J Biol Chem, 286(37):
32866-32874.
Naoumkina, M. A., Modolo, L. V., Huhman, D. V., Urbanczyk-Wochniak, E., Tang, Y., Sumner, L. W., & Dixon, R. A. 2010. Genomic and coexpression analyses predict multiple genes involved in triterpene saponin biosynthesis in Medicago truncatula. Plant Cell, 22(3): 850-866.
Noguchi, A., Horikawa, M., Fukui, Y., Fukuchi-Mizutani, M., luchi-Okada, A., Ishiguro,
M., Kiso, Y., Nakayama, T., & Ono, E. 2009. Local differentiation of sugar donor specificity of flavonoid glycosyltransferase in Lamiales. Plant Cell, 21 (5): 1556-1572.
Noguchi, A., Saito, A., Homma, Y., Nakao, M., Sasaki, N., Nishino, T., Takahashi, S., & Nakayama, T. 2007. A UDP-glucose:isoflavone 7-O-glucosyltransferase from the roots of soybean ( Glycine max) seedlings. Purification, gene cloning, phylogenetics, and an implication for an alternative strategy of enzyme catalysis. J Biol Chem, 282(32): 23581-23590.
Noguchi, A., Sasakib, N., Nakaoa, M., Fukamia, H., Takahashib, S., Nishinob, T., & Nakayamab, T. 2008. cDNA cloning of glycosyltransferases from Chinese wolfberry ( Lycium barbarum L.) fruits and enzymatic synthesis of a catechin glucoside using a recombinant enzyme (UGT73A10). Journal of Molecular Catalysis B: Enzymatic, 55(1-2): 84-92.
O'Maille, P. E., Malone, A., Dellas, N., Andes Hess, B., Jr., Smentek, L., Sheehan, I., Greenhagen, B. T., Chappell, J., Manning, G., & Noel, J. P. 2008.
Quantitative exploration of the catalytic landscape separating divergent plant sesquiterpene synthases. Nat Chem Biol, 4(10): 617-623.
Oostenbrink, C., Villa, A., Mark, A. E., & van Gunsteren, W. F. 2004. A biomolecular force field based on the free enthalpy of hydration and solvation: the
GROMOS force-field parameter sets 53A5 and 53A6. J Comput Chem, 25(13): 1656-1676.
Osbourn, A., Bowyer, P., Lunness, P., Clarke, B., & Daniels, M. 1995. Fungal
pathogens of oat roots and tomato leaves employ closely related enzymes to detoxify different host plant saponins. Mol Plant Microbe Interact, 8(6): 971 - 978.
Owatworakit, A., Townsend, B., Louveau, T., Jenner, H., Rejzek, M., Hughes, R. K., Saalbach, G., Qi, X., Bakht, S., Deb Roy, A., Mugford, S. T., Goss, R. J.,
Field, R. A., & Osbourn, A. 2012. Glycosyltransferases from oat (A vena) implicated in the acylation of avenacins. J Biol Chem, 288(6): 3696-3704.
Papadopoulou, K., Melton, R. E., Leggett, M., Daniels, M. J., & Osbourn, A. E. 1999.
Compromised disease resistance in saponin-deficient plants. Proc Natl Acad Sci U S A, 96(22): 12923-12928.
Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M.,
Meng, E. C., & Ferrin, T. E. 2004. UCSF Chimera— a visualization system for exploratory research and analysis. J Comput Chem, 25(13): 1605-1612.
Pollier, J., Morreel, K., Geelen, D., & Goossens, A. 201 1. Metabolite profiling of
triterpene saponins in Medicago truncatula hairy roots by liquid
chromatography Fourier transform ion cyclotron resonance mass
spectrometry. J Nat Prod, 74(6): 1462-1476.
Poppenberger, B., Fujioka, S., Soeno, K., George, G. L., Vaistij, F. E., Hiranuma, S., Seto, H., Takatsuto, S., Adam, G., Yoshida, S., & Bowles, D. 2005. The UGT73C5 of Arabidopsis thaliana glucosylates brassinosteroids. Proc Natl Acad Sci U S A, 102(42): 15253-15258.
Priest, D. M., Jackson, R. G., Ashford, D. A., Abrams, S. R., & Bowles, D. J. 2005.
The use of abscisic acid analogues to analyse the substrate selectivity of UGT71 B6, a UDP-glycosyltransferase of Arabidopsis thaliana. FEBS Lett, 579(20): 4454-4458.
Qi, X., Bakht, S., Leggett, M., Maxwell, C., Melton, R., & Osbourn, A. 2004. A gene cluster for secondary metabolism in oat: implications for the evolution of metabolic diversity in plants. Proc Natl Acad Sci U S A, 101 (21 ): 8233-8238.
Qi, X., Bakht, S., Qin, B., Leggett, M., Hemmings, A., Mellon, F., Eagles, J., Werck- Reichhart, D., Schaller, H., Lesot, A., Melton, R., & Osbourn, A. 2006. A different function for a member of an ancient and highly conserved cytochrome P450 family: from essential sterols to plant defense. Proc Natl Acad Sci U S A, 103(49): 18848-18853.
Qin, B., Eagles, J., Mellon, F. A., Mylona, P., Pena-Rodriguez, L, & Osbourn, A. E.
2010. High throughput screening of mutants of oat that are defective in triterpene synthesis. Phytochemistry, 71 (11-12): 1245-1252.
Reed, J., Stephenson, M. J., Miettinen, K., Brouwer, B., Leveau, A., Brett, P., Goss, R. J. M., Goossens, A., O'Connell, M. A., & Osbourn, A. 2017. A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules. Metab Eng, 42: 185-193.
Ross, J., Li, Y., Lim, E., & Bowles, D. J. 2001. Higher plant glycosyltransferases.
Genome Biol, 2(2): REVIEWS3004.
Sainsbury, F., Thuenemann, E. C., & Lomonossoff, G. P. 2009. pEAQ: versatile
expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotechnol J, 7(7): 682-693.
Saitou, N., & Nei, M. 1987. The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol Biol Evol, 4(4): 406-425.
Sali, A., & Blundell, T. L. 1993. Comparative protein modelling by satisfaction of
spatial restraints. J Mol Biol, 234(3): 779-815.
Sasaki, N., Adachi, T., Koda, T., & Ozeki, Y. 2004. Detection of UDP-glucose:cyclo- DOPA 5-O-glucosyltransferase activity in four o'clocks ( Mirabilis jalapa L.). FEBS Lett, 568(1-3): 159-162.
Sasaki, N., Wada, K., Koda, T., Kasahara, K., Adachi, T., & Ozeki, Y. 2005. Isolation and characterization of cDNAs encoding an enzyme with glucosyltransferase activity for cyclo-DOPA from four o'clocks and feather cockscombs. Plant Cell Physiol, 46(4): 666-670.
Sayama, T., Ono, E., Takagi, K., Takada, Y., Horikawa, M., Nakamoto, Y., Hirose, A., Sasama, H., Ohashi, M., Hasegawa, H., Terakawa, T., Kikuchi, A., Kato, S., Tatsuzaki, N., Tsukamoto, C., & Ishimoto, M. 2012. The Sg-1
glycosyltransferase locus regulates structural diversity of triterpenoid saponins of soybean. Plant Cell, 24(5): 2123-2138.
Schweiger, W., Boddu, J., Shin, S., Poppenberger, B., Berthiller, F., Lemmens, M., Muehlbauer, G. J., & Adam, G. 2010. Validation of a candidate
deoxynivalenol-inactivating UDP-glucosyltransferase from barley by heterologous expression in yeast. Mol Plant Microbe Interact, 23(7): 977- 986.
Shao, H., He, X., Achnine, L., Blount, J. W., Dixon, R. A., & Wang, X. 2005. Crystal structures of a multifunctional triterpene/flavonoid glycosyltransferase from Medicago truncatula. Plant Cell, 17(1 1 ): 3141-3154.
Shibuya, M., Nishimura, K., Yasuyama, N., & Ebizuka, Y. 2010. Identification and characterization of glycosyltransferases involved in the biosynthesis of soyasaponin I in Glycine max. FEBS Lett, 584(1 1 ): 2258-2264.
Tarraga, S., Lison, P., Lopez-Gresa, M. P., Torres, C., Rodrigo, I., Belles, J. M., & Conejero, V. 2010. Molecular cloning and characterization of a novel tomato xylosyltransferase specific for gentisic acid. J Exp Bot, 61 (15): 4325-4338.
Thimmappa, R., Geisler, K., Louveau, T., O'Maille, P., & Osbourn, A. 2014.
Triterpene biosynthesis in plants. Annu Rev Plant Biol, 65: 225-257.
Tian, L., Blount, J. W., & Dixon, R. A. 2006. Phenylpropanoid glycosyltransferases from osage orange ( Madura pomifera) fruit. FEBS Lett, 580(30): 6915-6920. Tohge, T., Nishiyama, Y., Hirai, M. Y., Yano, M., Nakajima, J., Awazuhara, M., Inoue, E., Takahashi, H., Goodenowe, D. B., Kitayama, M., Noji, M., Yamazaki, M.,
& Saito, K. 2005. Functional genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing an MYB
transcription factor. Plant J, 42(2): 218-235.
Tyanova, S., Temu, T., & Cox, J. 2016. The MaxQuant computational platform for mass spectrometry-based shotgun proteomics. Nat Protoc, 11 (12): 2301- 2319.
Van Der Spoel, D., Lindahl, E., Hess, B., Groenhof, G., Mark, A. E., & Berendsen, H.
J. 2005. GROMACS: fast, flexible, and free. J Comput Chem, 26(16): 1701- 1718.
Veach, Y. K., Martin, R. C., Mok, D. W., Malbeck, J., Vankova, R., & Mok, M. C.
2003. O-glucosylation of c/s-zeatin in maize. Characterization of genes, enzymes, and endogenous cytokinins. Plant Physiol, 131 (3): 1374-1380.
Vogt, T., & Jones, P. 2000. Glycosyltransferases in plant natural product synthesis: characterization of a supergene family. Trends Plant Sci, 5(9): 380-386. von Rad, U., Huttl, R., Lottspeich, F., Gierl, A., & Frey, M. 2001. Two
glucosyltransferases are involved in detoxification of benzoxazinoids in maize. Plant J, 28(6): 633-642.
Wang, P., Wei, Y., Fan, Y., Liu, Q., Wei, W., Yang, C., Zhang, L., Zhao, G., Yue, J., Yan, X., & Zhou, Z. 2015. Production of bioactive ginsenosides Rh2 and Rg3 by metabolically engineered yeasts. Metab Eng, 29: 97-105.
Wang, X. 2009. Structure, mechanism and engineering of plant natural product
glycosyltransferases. FEBS Lett, 583(20): 3303-3309.
Warnecke, D. C., Baltrusch, M., Buck, F., Wolter, F. P., & Heinz, E. 1997. UDP- glucose:sterol glucosyltransferase: cloning and functional expression in Escherichia coli. Plant Mol Biol, 35(5): 597-603.
Wei, W., Wang, P., Wei, Y., Liu, Q., Yang, C., Zhao, G., Yue, J., Yan, X., & Zhou, Z.
2015. Characterization of Panax ginseng UDP-glycosyltransferases catalyzing protopanaxatriol and biosyntheses of bioactive ginsenosides F1 and Rh1 in metabolically engineered yeasts. Mol Plant, 8(9): 1412-1424.
Witte, S., Moco, S., Vervoort, J., Matern, U., & Martens, S. 2009. Recombinant
expression and functional characterisation of regiospecific flavonoid glucosyltransferases from Hieracium pilosella L. Planta, 229(5): 1135-1146.
Xu, G. J., Cai, W., Gao, W., & Liu, C. S. 2016. A novel glucuronosyltransferase has an unprecedented ability to catalyse continuous two-step glucuronosylation of glycyrrhetinic acid to yield glycyrrhizin. New Phytologist, 212(1 ): 123-135.
Yan, X., Fan, Y., Wei, W., Wang, P., Liu, Q., Wei, Y., Zhang, L., Zhao, G., Yue, J., & Zhou, Z. 2014. Production of bioactive ginsenoside compound K in metabolically engineered yeast. Cell Res, 24(6): 770-773.
Yang, J., Yan, R., Roy, A., Xu, D., Poisson, J., & Zhang, Y. 2015. The l-TASSER Suite: protein structure and function prediction. Nat Methods, 12(1 ): 7-8.
Yonekura-Sakakibara, K., Tohge, T., Matsuda, F., Nakabayashi, R., Takayama, H., Niida, R., Watanabe-Takahashi, A., Inoue, E., & Saito, K. 2008.
Comprehensive flavonol profiling and transcriptome coexpression analysis leading to decoding gene-metabolite correlations in Arabidopsis. Plant Cell, 20(8): 2160-2176. Yu, H. S., Ma, L. Q„ Zhang, J. X., Shi, G. L, Hu, Y. H„ & Wang, Y. N. 201 1. Characterization of glycosyltransferases responsible for salidroside biosynthesis in Rhodiola sachalinensis. Phytochemistry.
Example 11 -characterisation of glucosyltransferases from oat
Glycosyltransferases that are involved in the biosynthesis of specialised
metabolites/triterpene glycosides use uridine diphosphate (UDP)-sugars as activated sugar donors and are called UDP-dependent glycosyltransferases (UGTs). These UGTs are classed in glycosyltransferase family 1 (GT1 ), a highly expanded superfamily with 100-200 sequences in a typical plant genome which makes it difficult to infer which UGT is involved in a specific biosynthetic pathway (Caputi et al., 201 1 ). Triterpene glycosides are often accumulated in specific tissues, at different developmental times or in response to abiotic or biotic stress, and additionally the pathway biosynthetic genes are often physically clustered in the genome
(Thimmappa, Geisler, Louveau, O'Maille, & Osbourn, 2014).
An A. strigosa root tip (terminal 0.5 cm) transcriptome database was available (Kemen et al., 2014) which was used previously in the search for the avenacin arabinosyltransferase (see Example 1 ). To identify potential UGTs involved in the addition of the two branching d-glucose molecules in the avenacin biosynthetic pathway, this database was searched for UGT sequences by a BLAST (tBLASTn) search using full-length sequences of representative UGTs from every plant UGT subfamily (A-N) (listed in Supplementary Table GS1 ). This resulted in 32 unique UGT-like sequences which include the characterised avenacin UGTs, AsAATI (AsUGT99D1 ) the avenacin arabinosyltransferase (see Figure 3), and SAD10 (AsUGT74H5) and its related homologue AsUGT74H7 which are required for the generation of the acyl glucose donor used by the avenacin acyltransferase SAD7 (Mugford et al., 2009; Owatworakit et al., 2013; Mugford et al., 2013). The identified UGTs were assigned families by a neighbor-joining phylogenetic analysis of the protein sequences along with functionally characterised UGT protein sequences from other plant species (Figure 15A).
The oat genome has not yet been sequenced, however a genetic map was available of the Avena A genome constructed by re-sequencing recombinant inbred progeny derived from a cross between two avenacin-producing diploid oat species (A.
atlantica and A. strigosa) (Vickerstaff et al, unpublished). Contigs associated with a molecular marker 0.68 cM away from the avenacin OSC ( Sadi ) were mined for UGT sequences. This returned a new Group A UGT sequence, AsUGT91 G16 (Figure 15A), in addition to the UGTs known to be involved in the avenacin pathway.
UGTs in phylogenetic groups known to extend triterpene or steroidal glycoside sugar chains (Groups A, D and O; Supplementary Table GS3) were prioritised for expression profiling by RT-PCR (Figure 15B). Four candidates, AsUGT91 G16, AsUGT99B9, AsUGT705A4 and AsUGT93B16, had an expression pattern similar to the known avenacin genes and were selected for functional characterisation. These four candidate enzymes were cloned into the pH9-GW plasmid, a vector for heterologous expression of N-terminally 9xHis-tagged protein in E. coli under the control of the Lac promoter (Hartley et al., 2000).
A triterpene acceptor substrate for an in vitro assay, bis-deglucosyl avenacin A-1 (Figure 16A), was generated by the extraction of avenacin A-1 from the roots of A. sativa plants, followed by the sequential removal of the b-1 ,4- and b-1 ,2-D-glucoses by the glycosyl hydrolase avenacinase from Gaeumannomyces graminis var. avenae (Osbourn, Bowyer, Lunness, Clarke, & Daniels, 1995), and purification by preparative thin layer chromatography.
Expression of soluble protein in E. coli was achieved for AsUGT91 G16, AsUGT99B9 and AsUGT93B16. Following cell lysis, recombinant UGTs were partially purified using Ni-NTA agarose beads and used in an in vitro assay with the substrates bis- deglucosyl avenacin A-1 and UDP-od-glucose. Control reactions (boiled protein preparations) were set up with enzyme preparations that had been denatured at 95°C for 10 minutes. HPLC-UV analysis of the assay (Figure 16A) showed that one enzyme, AsUGT91 G16, yielded a new more polar product peak at 4.8 minutes.
Mass-spectrometry analysis of this new peak showed prominent signals of the same mass as the mass ion and chloride adduct of bis-deglucosyl avenacin A-1 with the addition of a glucose molecule (Figure 18).
To verify this result, AsUGT91 G16 activity was investigated by Agrobacterium- mediated transient co-expression with avenacin biosynthetic genes in Nicotiana benthamiana leaves, which was earlier shown to produce arabinosylated avenacin scaffold (see Example 3). AsUGT91 G16 was cloned into pEAQ-/-/7-DEST1 , a Gateway-compatible binary vector for high-level transient expression of proteins in N. benthamiana (Sainsbury et al., 2009). pEAQ-HT-DEST1-AsUGT91 G16 was transformed into A. tumefaciens LBA4404 and co-infiltrated with A. tumefaciens strains containing avenacin pathway genes. Infiltrated leaves were harvested after five days and the extracted metabolites were analysed by HPLC-CAD-MS. The avenacin oxidosqualene cyclase, AsbASI (SAD1 ), forms the b-amyrin backbone and this is modified by the cytochrome P450 AsCYP51 H10 (SAD2) to form
ErHbAI (Figure 16B) (Haralampidis et al., 2001 ; Qi et al., 2006). The avenacin arabinosyltransferase, AsAATI , adds an a-1-arabinose moiety to ErHbA to yield ErHbA-3-O-Ara. Co-expression of AsbASI , AsCYP51 H10 and AsAATI results in the accumulation of ErHbA-3-O-Ara which has a mass ion [M-H] of 589.0 (eluting at 19.1 minutes in the LC-MS analysis) (Figure 16B). Co-infiltration of AsUGT91 G16 with AsbASI , AsCYP51 H10 and AsAATI results in the consumption of the ErHbA-3- O-Ara peak, and the appearance of four new more polar peaks (Figure 16B). Two of these peaks are consistent with the mass of ErHbA-3-O-Ara with the addition of a hexose (14.4 and 16.8 minutes), and two peaks (13.3 and 15.3 minutes) consistent with the mass of ErHbA-3-O-Ara with the addition of two hexoses (Figure 16B). These latter peaks may be the result of endogenous modifications of the
AsUGT91 G16 product by N. benthamiana glycosyltransferases, rather than the action of AsUGT91 G16 alone.
To investigate the AsUGT91 G16 products produced in planta, the N. benthamiana infiltration of AsbASI , As- CYP51 H10, AsAATI and AsUGT91 G16 was scaled up using a vacuum infiltration system (Reed et al., 2017). Freeze- dried leaves of 150 infiltrated plants were extracted by pressurised solvent extraction. HPLC-CAD-MS analysis showed that the large-scale extract only contained a single peak with the mass of ErHbA-3-O-Ara with the addition of a hexose. This product was purified by normal and reverse phase to obtain 4.5 mg of the purified molecule. The purified product elutes at the same time as the more polar diglycoside peak observed in the small-scale extract (Supplementary Figure 19A). Structural analysis confirms that the purified product has a disaccharide moiety linked at the C-3 position. The hexose could be identified as being linked to the pentose moiety in a b-[1 ,2]-configuration, supporting that AsUGT91 G16 is a triterpene 3-0-arabinose-b-[1 ,2]- glucosyltransferase (Figure 19B). In addition, the isolated product harbours a carbonyl at the C-12 position instead of the expected 12,13 epoxide (Figure 19B). This degradation of the avenacin epoxide has been previously observed (Crombie et al., 1984a,b; Begley et al., 1986; Crombie et al., 1986) and mild acid conditions that leave the sugar chain intact are sufficient to cause the rearrangement (Geisler et al., 2013).
To validate whether AsUGT91 G16 is involved in the avenacin pathway, its role in A. strigosa was investigated by examining sodium azide-induced A. strigosa mutants. Ten saponin-deficient (sad) mutants were found in the initial screen of sodium azide- induced mutants of A. strigosa that are deficient in avenacin production and have reduced root fluorescence under UV light (Papadopoulou et al., 1999). Further screening of the sodium azide-mutagenised population revealed additional mutants (Qi et al., 2006). Some of these mutants are known to correspond to characterised Sad genes (Mugford et al., 2013; Mylona et al., 2008; Qin et al., 2010) , but others correspond to unknown loci. The AsUGT91G16 gene was amplified from 49 uncharacterised mutants and sequenced, which revealed four sad mutants with single nucleotide polymorphisms (SNPs) in the AsUGT91 G16 gene (Table G1 ). The root extracts of these mutants were compared to those of characterised sad mutants by HPLC-CAD-MS analysis. Wild type (S75) root extracts accumulate the four avenacins, avenacin A-1 , A-2, B-1 and B-2, the most abundant of which are avenacins A-1 and A-2 (Figure 16C) (Crombie and Crombie, 1986). sad1 mutants are mutated in AsbASI (Haralampidis et al., 2001 ) which catalyses the first committed step in the avenacin biosynthetic pathway, and therefore do not accumulate any avenacins (Figure 16C). The genes responsible for the sad3 and sad4 mutant phenotypes are unknown; however sad3 mutants accumulate mono- deglucosyl avenacins missing the 1 ,4-linked d-glucose, and sad4 mutants accumulate a mixture of these mono-deglucosyl avenacins as well as fully glycosylated avenacins (Figure 16C) (Mylona et al., 2008; Papadopoulou et al.,
1999). Analysis of the root extracts confirmed that mutants #85, #543, #1073 and #1473 share similar root metabolite profiles that are distinct from the wild type, sad1, sad3 and sad4 profiles (Figure G2C). These mutants do not accumulate any avenacins, and instead accumulate two new products ( m/z = 887.1 at 18.3 minutes and m/z = 916.1 at 20.5 minutes) that are less polar than either the avenacins or the mono-deglucosyl avenacins. HPLC-MS-IT-TOF analysis of the root extract of mutant #85 showed that these two peaks have masses consistent with avenacin A-2 and A-1 with the loss of one hexose and the loss of the oxidation at the C-30 position (Figure 21 ). Root extracts of a mutant of the arabinosyltransferase AsAATI also contain avenacin intermediates with a mass difference consistent with the loss of the C-30 oxidation, suggesting the C-30 P450 may not be active on avenacin intermediates that are insufficiently glycosylated. F2 progeny from mutant lines crossed to the A. strigosa wild type parent (S75) were available for two of the mutants (#543 and #1473). Analysis of these F2 seedlings revealed that a short root phenotype co-segregated with the reduced fluorescence phenotype (n=192). The short root phenotype co-segregated with the mutation in the AsUGT91 gene in each population (n=192) and the segregation ratios for each population were statistically consistent with the expected 3:1 ratio for a single
2 2
recessive Mendelian mutation (c = 2.778, p > 0.05 and c = 0, p > 0.05,
respectively). The avenacin intermediates accumulated by the AsUGT91 mutants may have toxic effects, which would account for the stunted roots of these mutants (Figure 16D). Root growth defects were also present in sad3 and sad4 mutants, which were shown to be caused by the accumulation of toxic mono-deglucosylated avenacin intermediates (Mylona et al., 2008; Papadopoulou et al., 1999).
The characterised sad mutants are compromised in their disease resistance to the wheat pathogen Gaeumannomyces graminis var. tritici compared to wild type seedlings (Papadopoulou et al., 1999). Homozygous AsUGT91G16 mutant lines also showed higher rates of disease when incubated with G. graminis var. tritici compared to wild type seedlings (Figure 22).
Example 12 -characterisation of triterpene glycoside alvcosyltransferase
The recombinant UGT candidates were not able to glucosylate a mono-deglucosyl avenacin A-1 substrate that lacks the branching 1 ,4-d-glucose (data not shown), suggesting that none of these enzymes is the avenacin triterpene 3-O-arabinoside 1 ,4-glucosyltransferase that had yet to be characterised. Interestingly, analysis of the A. atlantica contig encoding AsUGT91G16 revealed a glycosyl hydrolase family 1 (GH1 ) member immediately adjacent to the AsUGT91G16 gene. This GH1 gene was found to share the same root tip-specific expression pattern as the avenacin biosynthetic genes as determined by RT-PCR (Figure 17B). GH1 enzymes hydrolyse glycosidic linkages with net retention of the anomeric configuration (retaining glycoside hydrolases) (Koshland, 1953). Retaining glycosyl hydrolases break glycosidic linkages in two steps, which allows these enzymes to catalyse both hydrolysis and transglycosylation. The first step is the reaction with the substrate to form a covalent glycosyl-enzyme intermediate. The second step transfers the sugar to an acceptor molecule, which if water, results in hydrolysis of the substrate, but in the case of another acceptor molecule, leads to the formation of a new glycoside (Sinnott, 1990; Bissaro et al., 2015). GH1 transglucosidases (TGs) includes a galactosyltransferase, SENSITIVE TO FREEZING 2 (SFR2), (Moellering et al., 2010; Thorlby et al., 2004) and several specific transglucosidases that transfer D-glucose molecules with b-glycosidic linkages to small hydrophobic molecules such as plant specialised metabolites (Luang et al., 2013; Matsuba et al., 2010; Miyahara et al., 2012, 2014; Nishizaki et al., 2013). These latter enzymes fall into GH1 phylogenetic groups At/Os 6 and At/Os 7 as designated in Opassiri et al. (2006) (Figure 17A). AsGFH groups with the TG Os9Bglu31 in the phylogenetic group At/Os 6 (Figure 17A), suggesting that it may have transglycosidase activity and could therefore be directly involved in the glucosylation of avenacin A-1. Consistent with the vacuolar localisation of TGs (Luang et al., 2013; Matsuba et al., 2010; Nishizaki et al., 2013), the AsGH1 protein contains an N-terminal 18-amino acid targeting sequence
(MALLLCLFLFSLRLAALS) (SignalP 4.1 Server) which may target it to the secretory pathway (Figure 24).
To assess the enzymatic activity of AsGH1 , the AsGH1 coding sequence was cloned into the Gateway-compatible pH9-GW plasmid for IPTG-inducible expression of AsGH1 with an N-terminal 9xHis-tag, and this plasmid was introduced into BL21 Rosetta E. coli cells. Solubly expressed 9xHis-tagged recombinant AsGFH was partially purified using Ni-NTA agarose beads and tested in an assay with mono- deglucosyl avenacin A-1 (lacking the b-1 ,4-linked-D-glucose) and the model b- glucosidase sugar donor substrate, 4-nitrophenyl b-D-glucoside (4NPGIc). Control reactions (boiled protein) were set up with enzyme preparations that had been denatured at 95°C for 10 minutes. HPLC-MS analysis showed that the reaction with active AsGFH enzyme produced a new peak consistent with the mass of avenacin A- 1 (Figure 17C). This suggests that AsGFH has transglycosidase activity towards the mono-deglucosyl avenacin A-1 intermediate in vitro and this enzyme was
subsequently referred to as“AsTG”.
The activity of AsTG was evaluated by transient expression in N. benthamiana. Transient expression in N. benthamiana leaves of the avenacin oxidosqualene cyclase, AsbASI (SAD1 ); the cytochrome P450, AsCYP51 H10 (SAD2) and the two UGT glycosyltransferases, AsAATI and AsUGT91 G16, leads to the accumulation of b-amyrin oxidised at two positions and glycosylated at the C-3 position with a disaccharide sugar chain, (ErHbA-3-O-Ara-Glu) (Figure 17D).
Co-expression of the full-length AsTG with AsbASI , AsCYP51 H10, AsAATI and AsUGT91 G16 resulted in the appearance of a new more polar peak in the HPLC- CAD-MS chromatogram with the expected mass ion of ErHbA- 3-0-Ara-1 ,2-Glu with the addition of a hexose (Figure 17D, m/z = 913.4, 12.8 minutes). AsTG activity is dependent on AsUGT91 G16, as when AsTG is co-expressed with AsbASI ,
AsCYP51 H10 and AsAATI without AsUGT91 G16, there is accumulation of ErHbA- 3-O-Ara with no new peaks (Figure 17D). No new peaks were evident when the AsTG signal peptide was deleted (NOSIG-AsTG, Figure 3D) suggesting that the signal peptide is necessary for AsTG activity. Without the signal peptide AsTG may be localised to a subcellular compartment where it is not active or in contact with the substrates, or it may not be properly folded in planta. sad3 and sad4 mutants were found to accumulate avenacin A-1 without the b-1 ,4-d- glucose (Mylona et al., 2008). These mutants had morphological defects such as stunted root growth, fewer root hairs, membrane trafficking defects, and exhibited stress responses such as callose deposition in their roots. These defects were rescued by double mutations with sad1, suggesting the phenotypes were a direct result of the toxic effects of incompletely glucosylated avenacins. Sad4 is unlinked to the avenacin gene cluster and mutants at this locus have a less severe phenotype. These mutants accumulate a mixture of mono-deglucosyl avenacin A-1 and avenacin A-1 and show fewer root growth defects than sad3 mutants. The Sad3 locus is likely to have a direct role in avenacin A-1 biosynthesis as it is closely linked to the avenacin cluster, and is fully compromised in b-1 ,4-d-glucose linkage. Therefore it is possible that the Sad3 locus corresponds to the AsTG gene.
Four mutants, #105, #368, #891 , and #1 139, have been shown to be independent mutant alleles of sad3 (Mylona et al., 2008). To investigate a link between the Sad3 locus and AsTG, the AsTG gene was amplified from genomic DNA from these four mutants. DNA sequencing analysis showed that all of these mutants had single-point mutations in the AsTG gene (Table G2). Two of these had mutations at intron-exon boundaries that might cause splicing errors and two had predicted amino acid substitutions (Table 2). The amino acid substitutions are all responsible for an increase in side chain length and steric bulk and may therefore affect protein folding and stability or catalytic activity. The F2 progeny from a cross of #1139 to the A. strigosa wild type parent (S75) were analysed to establish whether the sad3 phenotype and the AsTG gene SNP co-segregated. Three-day-old seedlings (n=190) were phenotyped for wild type or reduced fluorescence as in Papadopoulou et al. (1999). The segregation ratio was statistically consistent with the expected 3:1 ratio
2
for a single recessive Mendelian mutation (c = 0.007, p > 0.05). These phenotyped mutants were then sequenced; the #1 139 mutant SNP and the reduced root fluorescence phenotype absolutely co-segregated, indicating that the mutation in AsTG is responsible for the sad3 mutant phenotype.
AsTG appears to be the first TG involved in plant triterpene biosynthesis. An investigation into the subcellular localisation of AsTG by transient expression of fluorescent fusion proteins in N. benthamiana leaves was consistent with a vacuolar localisation of AsTG (Figures 26-28). Preliminary enzymatic assays in vitro in two buffer systems, (citrate buffer pH 3-6) and (acetic acid/MES/Tris buffer pH 4.5-7.5) suggest that the optimal pH of AsTG is at pH 5.5-pH6, which is also consistent with a vacuolar localisation.
Table G1. Summary of SNPs in the AsUGT91 gene found for the uncharacterised mutants
Figure imgf000111_0001
Table G2: Summary of sad3 SNPs.
Figure imgf000111_0002
References for Examples 11 and 12; Figures 15-17.
Augustin, J. M., Kuzina, V., Andersen, S. B., and Bak, S. (2011 ). Molecular activities, biosynthesis and evolution of triterpenoid saponins. Phytochemistry, 72:435-57.
Begley, M. J., Crombie, L, Crombie, W. M. L, and Whiting, D. A. (1986). The isolation of avenacins A-1 , A-2, B-1 , and B-2, chemical defences against cereal‘take- all’ disease. Structure of their‘aglycones’, the avenestergenins, and their anhydro dimers. J. Chem. Soc. Perkin Trans. 1, pages 1905-1915.
Bissaro, B., Monsan, P., Faure, R., and O’Donohue, M. J. (2015). Glycosynthesis in a waterworld: new insight into the molecular basis of transglycosylation in retaining glycoside hydrolases. Biochem. J., 467(1 ):17-35.
Caputi, L., Malnoy, M., Goremykin, V., Nikiforova, S., and Martens, S. (2012). A genome-wide phylogenetic re- construction of family 1 UDP-glycosyltransferases revealed the expansion of the family during the adaptation of plants to life on land. Plant J., 69:1030-42.
Crombie, L., Crombie, W. M. L., and Whiting, D. A. (1984a). Isolation of avenacins A- 1 , A-2, B-1 , and B-2 from oat roots: structures of their‘aglycones’, the
avenestergenins. J. Chem. Soc. Chem. Commun., 4:244-246.
Crombie, L., Crombie, W. M. L., and Whiting, D. A. (1984b). Structures of the four avenacins, oat root resistance factors to‘take-all’ disease. J. Chem. Soc., Chem. Commun., 4:246-248.
Crombie, L., Crombie, W. M. L., and Whiting, D. A. (1986). Structures of the oat root resistance factors to‘take-all’ disease, avenancins A-1 , A-2, B-1 and B-2 and their companion substances. J. Chem. Soc. Perkin Trans. 1, pages 1917-1922.
Crombie, L. M. W. and Crombie, L. (1986). Distribution of avenacins A-1 , A-2, B-1 and B-2 in oat roots: Their fungicidal activity towards‘take-all’ fungus.
Phytochemistry, 25(9):2069 - 2073.
Geisler, K., Hughes, R. K., Sainsbury, F., Lomonossoff, G. P., Rejzek, M., Fairhurst, S., Olsen, C.-E., Motawia, M. S., Melton, R. E., Hemmings, A. M., Bak, S., and Osbourn, A. (2013). Biochemical analysis of a multifunctional cytochrome P450 (CYP51 ) enzyme required for synthesis of antimicrobial triterpenes in plants. Proc. Natl. Acad. Sci. U.S.A., 110(35):E3360-7.
Haralampidis, K., Bryan, G., Qi, X., Papadopoulou, K., Bakht, S., Melton, R., and Osbourn, A. (2001 ). A new class of oxidosqualene cyclases directs synthesis of antimicrobial phytoprotectants in monocots. Proc. Natl. Acad. Sci. U.S.A.,
98(23): 13431-13436. Hartley, J. L, Temple, G. F., and Brasch, M. A. (2000). DNA cloning using in vitro site-specific recombination. Genome Res., 10(11 ): 1788—1795.
Heng, L., Vincken, J.-P., van Koningsveld, G., Legger, A., Gruppen, H., van Boekel, T., Roozen, J., and Voragen, F. (2006). Bitterness of saponins and their content in dry peas. J. Sci. Food Agric., 86(8):1225-1231.
Kemen, A. C., Honkanen, S., Melton, R. E., Findlay, K. C., Mugford, S. T., Hayashi, K., Haralampidis, K., Rosser, S. J., and Osbourn, A. (2014). Investigation of triterpene synthesis and regulation in oats reveals a role for b-amyrin in determining root epidermal cell patterning. Proc. Natl. Acad. Sci. U.S.A., 111 :8679-84.
Ketudat Cairns, J. R., Pengthaisong, S., Luang, S., Sansenya, S., Tankrathok, A., and Svasti, J. (2012). Protein- carbohydrate interactions leading to hydrolysis and transglycosylation in plant glycoside hydrolase family 1 en- zymes. J. Appl. Glycosci., 59(2):51-62.
Koshland, D. E. (1953). Stereochemistry and the mechanism of enzymatic reactions. Biol. Rev., 28(4):416-436.
Luang, S., Cho, J.-L, Mahong, B., Opassiri, R., Akiyama, T., Phasai, K., Komvongsa, J., Sasaki, N., Hua, Y.-l., Matsuba, Y., Ozeki, Y., Jeon, J.-S., and Cairns, J. R. K. (2013). Rice Os9BGIu31 is a transglucosidase with the capacity to equilibrate phenylpropanoid, flavonoid, and phytohormone glycoconjugates. J. Biol. Chem., 288(14): 101 11-10123.
Matsuba, Y., Sasaki, N., Tera, M., Okamura, M., Abe, Y., Okamoto, E., Nakamura,
H., Funabashi, H., Takatsu, M., Saito, M., Matsuoka, H., Nagasawa, K., and Ozeki,
Y. (2010). A novel glucosylation reaction on anthocyanins catalyzed by acyl-glucose- dependent glucosyltransferase in the petals of carnation and delphinium. Plant Cell, 22(10):3374-3389.
Miyahara, T., Takahashi, M., Ozeki, Y., and Sasaki, N. (2012). Isolation of an acyl- glucose-dependent anthocyanin 7-O-glucosyltransferase from the monocot
Agapanthus africanus. J. Plant Physiol., 169(13): 1321—1326.
Miyahara, T., Tani, T., Takahashi, M., Nishizaki, Y., Ozeki, Y., and Sasaki, N. (2014). Isolation of anthocyanin 7-0- glucosyltransferase from canterbury bells ( Campanula medium). Plant Biotechnology, 31 (5):555-559.
Moellering, E. R., Muthan, B., and Benning, C. (2010). Freezing tolerance in plants requires lipid remodeling at the outer chloroplast membrane. Science,
330(6001 ):226-228.
Moses, T., Papadopoulou, K. K., and Osbourn, A. (2014). Metabolic and functional diversity of saponins, biosynthetic intermediates and semi-synthetic derivatives. Crit. Rev. Biochem. Mol. Biol., 49:439-62. Mugford, S. T., Louveau, T., Melton, R., Qi, X., Bakht, S., Hill, L, Tsurushima, T., Honkanen, S., Rosser, S. J., Lomonos- soft, G. P., and Osbourn, A. (2013).
Modularity of plant metabolic gene clusters: a trio of linked genes that are collectively required for acylation of triterpenes in oat. Plant Cell, 25(3):1078-1092.
Mugford, S. T., Qi, X., Bakht, S., Hill, L., Wegel, E., Hughes, R. K., Papadopoulou,
K., Melton, R., Philo, M., Sains- bury, F., Lomonossoff, G. P., Roy, A. D., Goss, R. J., and Osbourn, A. (2009). A serine carboxypeptidase-like acyltransferase is required for synthesis of antimicrobial compounds and disease resistance in oats. Plant Cell, 21 (8):2473-2484.
Mylona, P., Owatworakit, A., Papadopoulou, K., Jenner, H., Qin, B., Findlay, K., Hill,
L., Qi, X., Bakht, S., Melton, R., and Osbourn, A. (2008). Sad3 and Sad4 are required for saponin biosynthesis and root development in oat. Plant Cell, 20(1 ):201-212.
Nishizaki, Y., Yasunaga, M., Okamoto, E., Okamoto, M., Hirose, Y., Yamaguchi, M., Ozeki, Y., and Sasaki, N. (2013). p-hydroxybenzoyl-glucose is a zwitter donor for the biosynthesis of 7-polyacylated anthocyanin in Delphinium. Plant Cell, 25(10):4150- 4165.
Opassiri, R., Pomthong, B., Onkoksoong, T., Akiyama, T., Esen, A., and Ketudat Cairns, J. R. (2006). Analysis of rice glycosyl hydrolase family 1 and expression of Os4bglu12 beta-glucosidase. BMC Plant Biol., 6:33.
Osbourn, A., Clarke, B., Dow, J., and Daniels, M. (1991 ). Partial characterization of avenacinase from Gaeumanno- myces graminis var. avenae. Physiol. Mol. Plant Pathol., 38(4):301 - 312.
Osbourn, A., Clarke, B., Lunness, P., Scott, P., and Daniels, M. (1994). An oat species lacking avenacin is susceptible to infection by Gaeumannomyces graminis var. tritici. Physiol. Mol. Plant Pathol., 45(6):457 - 467.
Osbourn, A., Goss, R. J. M., and Field, R. A. (2011 ). The saponins: polar isoprenoids with important and diverse biological activities. Nat. Prod. Rep., 28:1261-8.
Owatworakit, A., Townsend, B., Louveau, T., Jenner, H., Rejzek, M., Hughes, R. K., Saalbach, G., Qi, X., Bakht, S., Roy, A. D., Mugford, S. T., Goss, R. J. M., Field, R. A., and Osbourn, A. (2013). Glycosyltransferases from oat ( Avena ) implicated in the acylation of avenacins. J. Biol. Chem., 288(6):3696-3704.
Papadopoulou, K., Melton, R. E., Leggett, M., Daniels, M. J., and Osbourn, A. E. (1999). Compromised disease resistance in saponin-deficient plants. Proc. Natl. Acad. Sci. U.S.A., 96(22): 12923-12928.
Qi, X., Bakht, S., Qin, B., Leggett, M., Hemmings, A., Mellon, F., Eagles, J., Werck- Reichhart, D., Schaller, H., Lesot, A., Melton, R., and Osbourn, A. (2006). A different function for a member of an ancient and highly conserved cytochrome P450 family: From essential sterols to plant defense. Proc. Natl. Acad. Sci. U.S.A.,
103(49): 18848- 18853.
Qin, B., Eagles, J., Mellon, F. A., Mylona, P., Peha-Rodriguez, L, and Osbourn, A. E. (2010). High throughput screening of mutants of oat that are defective in triterpene synthesis. Phytochemistry, 71 (11 ): 1245— 1252.
Reed, J., Stephenson, M. J., Miettinen, K., Brouwer, B., Leveau, A., Brett, P., Goss, R. J. M., Goossens, A., O’Connell, M. A., and Osbourn, A. (2017). A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules. Metab. Eng., 42:185-193.
Ross, J., Li, Y., Lim, E., and Bowles, D. J. (2001 ). Higher plant glycosyltransferases. Genome Biol., 2:REVIEWS3004.
Sainsbury, F., Saxena, P., Geisler, K., Osbourn, A., and Lomonossoff, G. P. (2012). Using a virus-derived system to manipulate plant natural product biosynthetic pathways. Methods Enzymol., 517:185 - 202. Natural Product Biosynthesis by Microorganisms and Plants, Part C.
Sinnott, M. L. (1990). Catalytic mechanism of enzymic glycosyl transfer. Chem. Rev., 90(7):1 171-1202.
Thimmappa, R., Geisler, K., Louveau, T., O’Maille, P., and Osbourn, A. (2014).
Triterpene biosynthesis in plants.
Annu. Rev. Plant Biol., 65:225-257.
Thorlby, G., Fourrier, N„ and Warren, G. (2004). The SENSITIVE TO FREEZING2 gene, required for freezing toler- ance in Arabidopsis thaliana, encodes a b-glucosidase. Plant Cell, 16(8):2192-2203.
Turner, E. M. (1953). The nature of the resistance of oats to the take-all fungus. J. Exp. Bot, 4(11 ):264-271.
Xu, Z., Escamilla-Trevino, L., Zeng, L., Lalgondar, M., Bevan, D., Winkel, B.,
Mohamed, A., Cheng, C.-L., Shih, M.-C., Poulton, J., and Esen, A. (2004). Functional genomic analysis of Arabidopsis thaliana glycoside hydrolase family 1. Plant Mol. Biol., 55(3):343-367.
Example 13 - Materials and Methods for Tables G1-2, GS1-5 and Figures 15-17, 18-28.
Plant material. Avena sativa seeds for avenacin purification were provided by Rachel Melton. All other oat plants used in this study are Avena strigosa accession S75 (from the Institute of Grasslands and Environmental Research, Aberystwyth, Wales, United Kingdom). Saponin-deficient mutant lines of A. strigosa S75 were derived by sodium azide mutagenesis (Papadopoulou et al., 1999). Phylogenetic analysis. Protein sequences of characterised sequences from other plant species (listed in Supplementary Table GS1 ) were obtained from the NCBI database. Protein sequences were aligned using MAFFT
(https://mafft.cbrc.jp/alignment/software/) and the evolutionary history was inferred using the Neighbor-Joining method (Saitou and Nei, 1987). The evolutionary distances were computed using the Poisson correction method (Zuckerkandl and Pauling, 1965) and are in the units of the number of amino acid substitutions per site. Evolutionary analyses were conducted in MEGA7 (Kumar et al., 2016).
Growth of A. strigosa seedlings. Oat seedlings were grown as described in Papadopoulou et al. (1999).
RNA extraction from oat seedlings and cDNA synthesis. RNA extraction and cDNA synthesis was carried out as in the Materials and Methods for Example 1-7. Fragment amplication of constitutively expressed glyceraldehyde 3-phosphate dehydrogenase ( GAPDH ) was used to validate whether cDNA concentrations were normalised across tissues. The previously characterised avenacin biosynthetic gene AsUGT75H5 ( Sad10 ) or AsbASI ( Sadi ) were included as controls. Gene specific primers used for PCR amplification are listed in Supplementary Table GS3.
Purification of avenacinase. Avenacinase was purified as described in Osbourn et al. (1991 ). Blocks of mycelium from actively growing colonies of G. graminis var. avenae strain A3 (Bryan et al., 1999) were placed on potato dextrose agar plates with 50 mg/ml streptomycin and 50 mg/ml ampicillin. After 5 days at 22 °C, colonies were scraped from the plates and homogenised with 1 ml Jermyn’s medium (soluble starch: 1 g/L; K2HP04: 6 g/L; NH4CI: 8 g/L; Yeast Extract: 1 g/L; MgS04.7H20: 1 g/L; CaCI2: 0.02 g/L; ZnS04.7H20: 0.002 g/L; MnS04.7H20: 0.001 g/L) per colony. The homogenate was added to 2 litre flasks containing 500 ml Jermyn’s medium with 50 mg/ml streptomycin and 50 mg/ml ampicillin (1 colony per 100 ml), and cultures were grown for 5 days at 22 °C with shaking at 200 rpm. Cultures were filtered through Miracloth (Merck) and two EDTA-free protease inhibitor tablets (Roche) per 500 ml filtrate was added. Filtrates were chilled to 4°C and ammonium sulphate added, with stirring to a final concentration of 580 M of culture filtrate. The culture filtrate was centrifuged at 15 000 x g at 10 °C for 10 minutes, the supernatent was discarded and the pellet was resuspended in a minimum volume of ice-cold sterile water. The protein preparation was dialysed with four changes of buffer against 20 mM Tris-HCI pH 8 at 4 °C, centrifuged at 15000 x g at 10°C for ten minutes and frozen at -20°C.
Extracting avenacin A-1 from oat roots. Seven litres of A vena sativa seeds were surface-sterilised for ten minutes in 14 litres of 0.5% sodium hypochlorite, rinsed thoroughly with tap water and drained. Seeds were distributed evenly onto sterilised aluminium gauze grids placed over plastic trays filled with tap water to one inch below the grids. Seeds were covered in two layers of Whatmann blotting paper dampened with sterile water, surrounded in foil and incubated at room temperature. The foil and blotting paper was removed after the seeds germinated. After seven days of growth, roots were harvested with a razor blade, freeze-dried and stored at - 80°C. Root harvesting was repeated after a further seven days of growth. Freeze- dried roots were ground in liquid nitrogen and stored at -80°C.
Freeze-dried ground roots (2 x 17 g) were soaked overnight at 4°C in 500 ml 80% methanol, filtered through Miracloth (Merck) and Whatmann filter paper, and the methanol was evaporated with a rotary evaporator. The aqueous filtrate was precipitated overnight at 4 °C. The precipitate was collected by centrifugation at 3220 x g and freeze-dried. The precipitation process was repeated and the precipitates were combined. The oat root filtrate precipitate was resuspended in methanol with sonication, dried onto diatomaceous earth (Celite, Sigma-Aldrich), and separated on a Biotage®SNAP C18 30g flash chromatography column with a flow rate of 25ml/min using a gradient of 5% methanol (Solvent A) and 95% methanol (Solvent B) as follows: 0-100% Solvent B over 750 ml and 100% Solvent B for 575 ml. Fluorescent fractions were combined and further purified as above with a gradient of 0-100% Solvent B over 1000 ml and 100% Solvent B for 525 ml. Fractions enriched for avenacin A-1 were determined by separation on a silica TLC plate and HPLC-UV-MS analysis.
Avenacin A-1 digestion and preparative thin-layer chromatography. The avenacin A-1 deglucosylation reaction contained the oat root extract enriched for avenacin A-1 (4.2 mg) (see above), the avenacinase protein preparation (400 pi)
(see above) and 100 mM sodium acetate buffer pH 5 in a total volume of 13.4 ml.
The reaction was incubated for 14 hours at 37°C, dried with a Genevac EZ-2 Elite centrifugal evaporator and stored at -20°C. The reaction was resuspended in 4.5 ml methanol and loaded onto the base of a 20x20 cm preparative silica thin layer chromatography (TLC) plate. The TLC plate was pre-run three times in 100% methanol 0.5 cm above the loading line, and then run in a mobile phase of dichloromethane:methanol:water (80:19:1 ; v:v:v). The position of each fluorescent band was visualised under ultraviolet light and scraped off the plate with a scalpel blade, and filtered through filter paper with 15 ml methanokethyl acetate (25:75, v:v). The UV-active fractions were dried in a Genevac EZ-2 Elite centrifugal evaporator and stored at -20°C.
Oat genomic DNA purification. Frozen oat leaf tissue (1.5 cm^) from five-day-old seedlings was ground in liquid nitrogen with an autoclaved pestle and mortar. Ground tissue was resuspended in 1.2 ml of extraction buffer (0.2 M T ris-HCI pH 8, 250 mM NaCI, 25 mM ethylenediaminetetraacetic acid (EDTA), 1 % sodium dodecyl sulfate (SDS, Sigma-Aldrich)) and centrifuged at 13 000 x g for 5 minutes. The supernatant (4 x 375 mI) was removed to fresh tubes. An equal volume of isopropanol was added and mixed by inversion, then tubes were centrifuged at 13 000 x g for 10 minutes. The supernatant was removed and the pellets were washed with 600 mI of 70% ethanol and centrifuged at 13 000 x g for 10 minutes. The supernatant was removed and the pellets were dried at 35°C for 20 minutes in a vacuum dryer. Pellets were resuspended in 200 mI water and stored at -20 °C.
Cloning of recombinant proteins. UGT and TG expression contructs were cloned as described in the Materials and Methods for Example 1-7. Coding sequences of A. strigosa UGTs or AsTG were amplified by PCR with a two-step method from oat genomic DNA or root tip cDNA template (last 0.2 cm of the root), respectively. The first amplification step uses gene specific primers (see Supplementary Table GS3) to attach partial AttB adapters to the full- length CDS. The second amplification step attaches the full AttB site to each end of the CDS. Amplified fragments were purified with a QIAquick PCR Purification kit (Qiagen).
The purified CDS fragments were transferred into the pDONR207 vector using BP clonase II enzyme mix (Invitrogen) according to the manufacturer’s instructions.
Sequence-verified coding sequences were then transferred by LR clonase II either into pH9GW (Invitrogen), a Gateway-compatible version of pET-28 encoding nine N- terminal histidines (O’Maille et al., 2008); into pEAQ-/-/T-DEST1 , a Gateway- compatible binary vector for high-level transient expression of proteins in N.
benthamiana (Sainsbury et al., 2012); into pB7RWG2, a Gateway-compatible vector for transient expression of C-terminal RFP fusion constructs in N. benthamiana (Karimi et al., 2002); into pMDC45 a Gateway-compatible vector for transient expression of N-terminal GFP fusion constructs in N. benthamiana (Curtis and Grossniklaus, 2003); or into pMDC83, a Gateway-compatible vector for transient expression of C-terminal RFP fusion constructs in N. benthamiana (Curtis and Grossniklaus, 2003). To generate a plasmid with AsTG missing the predicted N- terminal signal sequence (AsTG-NOSIG), 60 ng of the pDONR207-AsTG plasmid was used as a template with Fgw-nosigAsTG and Rgw-AsTG primers
(Supplementary Table GS3) by two-step Gateway cloning. Before the PCR purification step, 1 pi of Dpnl (New England Biolabs) was added to the amplified PCR product and the mixture was incubated at 37°C for 1 hour to digest the pDONR207- AsTG DNA template. For p35S-driven C-terminal RFP and GFP fusion constructs, AsTG and AsTG-NOSIG were amplified from pEAQ- HT- DEST1-AsTG and pEAQ- HT- DEST1-NOSIG-AsTG as DNA templates respectively, in one-step Gateway PCR reactions where the full AttB adapters are attached in one step to the CDS (primers in Table GS3). The PCR products were cloned into the pDONR207 entry plasmid and transferred into the pB7RWG2 or the pMDC83 destination vector. For p35-driven N- and C-terminal fusion constructs of AsUGT91 G16, AsUGT91 G16 was amplified from the pH9- GW-AsUGT91 G16 plasmid with AsUGT91-NTGW and Rgw-UGT91 , or Fgw-GTUGT91 and Rgw-UGT91-NOSTOP primers (Table GS3) and cloned into pMDC45 and pMDC83, respectively. Fluorescent fusion protein constructs were verified using RFP- or GFP-specific sequencing primers (Table GS3).
Expression of recombinant proteins in Escherichia coli. Chemically competent E. coli Rosetta cells were transformed with pH9GW expression vectors following the manufacturer’s instructions. Selected transformants were cultured in Lysogeny Broth (LB) with kanamycin (100 mg/ml) and chloramphenicol (35 mg/ml) selection at 37°C and 220 rpm. Overnight cultures were diluted 100-fold into fresh LB with antibiotics and grown at 37°C, 200 rpm until the cultures reached an OD600 between 0.5-0.6. The cultures were acclimatised for 30 minutes at 16°C at 200 rpm, then 0.05 mM isopropyl-b-D-thiogalactopyranoside (IPTG) (Sigma-Aldrich) was added. Cells were grown for 4-5 hours (for AsTG-NOSIG) or overnight (for UGTs) and harvested by centrifugation at 3220 x g for 10 minutes. The supernatant was discarded and the cell pellets stored at -80°C. The frozen cell pellets were allowed to thaw on ice and were resuspended in 6 ml of chilled sonication buffer (300 mM NaCI, 50 mM Tris-HCI pH 7.8, 20 mM imidazole, 5% glycerol, complete™ EDTA-free protease inhibitor cocktail (Roche) (1 tablet per 50 ml sonication buffer), 0.1 % Tween 20 (Sigma- Aldrich)). Resuspended cells were sonicated with a bench top ultrasonic disintegrator (Soniprep 150 plus, MSE) in ice water for 5 x 10 seconds (amplitude = 7.0) with 20 seconds rest. Cell lysates were centrifuged at 12 000 x g for 20 minutes at 4°C. Supernatants were incubated with 150 pre-equilibrated pi Ni-NTA Agarose beads (Roche) with agitation at 4°C for 1 hour. Beads were transferred to 1.5 ml Eppendorf tubes and washed 3 times with 500 mI filtered Buffer A (300mM NaCI, 50mM Tris-HCI pH 7.8, 20mM imidazole, 5% glycerol). Proteins were eluted with 3 x 200 mI Buffer B (300mM NaCI, 50mM Tris-HCI pH 8, 500 mM imidazole, 5% glycerol). Protein elution fractions were combined, and the buffer exchanged by adding 2 x 2 ml 50 mM Tris- HCI pH 7.5 and concentrating in Amicon®Ultra-4 Centrifugal Filter Units with Ultracel- 10 membranes (Merck) at 3220 x g, with a final volume of approximately 250 mI. Protein concentration was estimated using a Bradford assay (Bio-Rad Protein Assay Kit I, with bovine y-globulin standard) as per manufacturer’s instructions and the protein purity assessed by SDS-PAGE.
In vitro glycosylation assays. To assess UGT activity, reactions contained 50 mM Tris-HCI pH 7.5, 0.5 mM UDP- od-glucose (Sigma-Aldrich) and 150 mM bis- or mono-deglucosylated avenacin A-1 in a total volume of 50 mI. Reactions were started with the addition of 4 mg of the recombinant partially purified UGTs, incubated at 25°C overnight and were stopped by the addition of 50 mI methanol. Control reactions were set up as above, except UGT protein preparations had been boiled at 95°C for 10 minutes (inactive enzymes). To assess AsTG activity, reactions contained 50 mM citrate buffer pH 5.75, 5 mM p-nitrophenyl glucose and 150 mM bis- or mono- deglucosylated avenacin A-1 in a total volume of 50 mI, with two biological repeats. Reactions were started with the addition of approximately 1 mg of the recombinant partially purified AsTG-NOSIG (AsTG missing the predicted N-terminal signal sequence), incubated at 30°C overnight and were stopped by the addition of 50 pi methanol. Control reactions were set up as above, except that the AsTG-NOSIG protein preparations had been boiled at 95°C for 10 minutes. Reaction mixtures were centrifuged and product analysis was carried out by reverse phase HPLC using a 50x2.1 mm 2.6 m Kinetex XB-C18 column (Phenomenex) with a column oven temperature of 30°C. Detection was by UV/Vis ab- sorbance (Shimadzu SPD-M20A), collecting spectra from 200-600nm. Electrospray MS data (Shimadzu LC-2020 dual source MS) were collected by electrospray in positive mode and negative mode from m/z 50-1500. The gradient was run at 0.3 ml/min with 100% water as Buffer A, 100% acetonitrile as Buffer B and was as follows: 25% Buffer B from 0-0.6 minutes; 25- 80% Buffer B from 0.6-7 minutes; 80-100% Buffer B from 7-7.2 minutes; a linear gradient between 7.2-8 minutes; 100 to 25% Buffer B from 8-8.1 minutes, and held at 25% Buffer B until 10 minutes.
Transient expression in N. benthamiana. pEAQ-HT-DEST1 vectors were transformed into chemically competent A. tumefaciens strain LBA4404 by flash freezing in liquid nitrogen (Reed et al., 2017). Strain cultures and agroinfiltrations were carried out as described previously (Sainsbury et al., 2012; Reed et al., 2017). Transformed A. tumefaciens LBA4404 glycerol stocks were streaked out onto fresh LB agar plates with kanamycin (50 mg/ml), streptomycin (100 mg/ml) and rifampicin (50 mg/ml) and grown overnight at 28°C. Colonies were picked and grown in 10 ml or 50 ml LB with antibiotics at 28°C and 200 rpm for 15-18 hours. Cultures were pelleted by centrifugation at 3220 x g for 12 minutes and the supernatant discarded. The cells were resuspended in 10 ml (or 20 ml for 50 ml cultures) of MMA solution (10 mM MES-KOH, 10 mM MgCI2, 150 mM acetosyringone) and incubated at room temperature in the dark for one hour. The concentration of the cell cultures was determined by measuring the optical density at 600 nm of culture dilutions in a spectrophotometer. A strain containing green fluorescent protein (GFP) in pEAQ-HT- DEST1 (Lomonossoff group; Reed, 2016) was used as a control to maintain the same concentration of bacteria in all infiltration combinations. Culture densities were adjusted with MMA solution to a final OD600 of n x c, where n = the number of bacterial strains to be combined and c is between 0.1 and 0.2, adjusted so that the final OD600 did not exceed 1. Diluted cell suspensions of individual strains were combined in equal ratios. The bacterial suspension mixes were hand-infiltrated into the underside of 5-week-old N. benthamiana leaves using a needle-less syringe. Plants were grown under the same greenhouse conditions following infiltration.
Analysis of metabolites from N. benthamiana leaves. Five days after infiltration (see above), N. benthamiana leaves were harvested, frozen at -80°C, and freeze- dried. Dried leaves were stored at -80°C. Leaf samples (10 mg) were measured into 2 ml screw-cap tubes. Two tungsten beads (3mm) were added, and leaf tissues were disrupted at 1000 rpm for 2 x 30 seconds in a Geno/Grinder SPEX Sample Prep 2010. After brief centrifugation, 500 mI of 80% MeOH with 20 mM digitoxin standard (Merck) was added. Samples were agitated at 1400 rpm at 18 °C for 20 minutes, then centrifuged at 20 000 x g at 4°C for 2 minutes. The supernatent (400 mI) was removed to a fresh pre-chilled 1.5 ml Eppendorf tube on ice, and samples were partitioned twice with 400 mI hexane. Aliquots (200 mI) of aqueous fractions were dried in a Genevac EZ-2 Elite centrifugal evaporator at a maximum temperature of 30°C and stored at -80°C. For high-performance liquid chromatography, samples were resuspended in 75 mI methanol and filtered through Corning®Costar®Spin- X®centrifuge tube filters (Sigma-Aldrich). The filtrate (50 mI) was combined with 50 mI 50% MeOH and 10 mI was analysed by reverse phase HPLC using a 50x2.1 mm 2.6 m Kinetex XB-C18 column (Phenomenex) and detection by HPLC-CAD-MS. The column oven temperature was set at 30°C and detection was by charged aerosol detector (CAD, Corona Ultra RS from Dionex), as well as electrospray MS (Shimadzu LC-2020 dual source MS) collected in positive mode and negative mode from m/z 50 -1500. The gradient was run at 0.3 ml/min with 100% water as Buffer A, 100% acetonitrile as Buffer B and was as follows: 15% Buffer B from 0-1.5 minutes; 15- 60% Buffer B from 1.5-26 minutes; 60-100% Buffer B from 26-26.5 minutes; a linear gradient between 26.5-28.5 minutes; 100 to 15% Buffer B from 28.5-29 minutes, and held at 15% Buffer B until 30 minutes.
Subcellular localisation assays. A. tumefaciens strain GV3101 was used for all fluorescent protein fusion assays. pEAQ-HT-DEST1-AsUGT91 G16 and pEAQ-HT- DEST1-AsTG were transformed into A. tumefaciens strain GV3101.To assess enzymatic activity of the fluorescent protein fusion constructs, agroinfiltrations were carried out as per the method above, with the following changes: antibiotic selection was gentamycin (25 mg/ml) rifampicin (50 mg/ml) and spectinamycin (100 mg/ml) for pB7RWG2-derived vectors or kanamycin (50 mg/ml) for pDESTI -, pMDC45- and pMDC83-derived vectors. Metabolites were detected by HPLC using a 50x2.1 mm 2.6 m Kinetex XB-C18 column (Phenomenex) with a column oven temperature of 25°C. Detection was by Charged Aerosol detector (CAD, Corona Ultra RS from Dionex). The gradient was run at 0.3 ml/min with 100% water as Buffer A, 100% acetonitrile as Buffer B and was as follows: 10% Buffer B from 0-1.5 minutes; 10-50% Buffer B from
1.5-21 minutes; 50-95% Buffer B from 21-21.5 minutes; a linear gradient between
21 .5-23.5 minutes; 95 to 10% Buffer B from 23.5-24 minutes, and held at 10% until 25 minutes. To assess the expression of fusion constructs in N. benthamiana leaves, agroinfiltrations were carried out as above (the pEAQ-/-/T-DEST1-GFP expressing strain to maintain equal bacterial concentrations was omitted and replaced by MMA) and imaged by Dr Ingo Appelhagen (JIC) with a Leica TCS SP8X confocal microscope.
Large-scale extraction and purification of the AsUGT91 G16 product N.
benthamiana plants (n=150) were vacuum infiltrated with a culture suspension mix of A. tumefaciens strain LBA4404 containing pEAQ-/-/T-DEST1 -tHMGR; pEAQ-HT- DEST1-AsbAS1 ; pEAQ-HT-DEST1-AsCYP51 H10; pEAQ-HT-DEST1-AsAAT1 and pEAQ-HT-DEST1 -AsUGT91 G16 as in Reed et al. (2017). After five days, the leaves were harvested and freeze-dried. The freeze-dried leaf material (40 g) was ground loosely in a pestle and mortar, and combined 1 :1 v:v with quartz sand (0.3-0.9 mm). This mixture was layered in between 3 cm layers of quartz sand (0.3-0.9 mm) in a 120 ml extraction cell. Extraction was performed using a SpeedExtractor E-914 (Buchi) with 6 cycles at 90°C and 130 bar pressure. Cycle one (ethyl acetate) had zero hold time, cycle two (ethyl acetate) had five minutes hold time and cycles 3-6 (methanol) had five minutes hold time. The run finished with a two minute solvent flush and six minute N2 flush. The ethyl acetate and methanol fractions were analysed by HPLC-CAD-MS, using a 50x2.1 mm 2.6 m Kinetex XB-C18 column (Phenomenex) with a column oven temperature of 30°C. Detection was by charged aerosol detector (CAD, Corona Ultra RS from Dionex), as well as electrospray MS (Shimadzu LC-2020 dual source MS) collected in positive mode and negative mode from m/z 50 -1500. The gradient was run at 0.3 ml/min with 100% water as Buffer A, 100% acetonitrile as Buffer B and was as follows: 25% Buffer B from 0-1.5 minutes; 25-60% Buffer B from 1.5-21 minutes; 60-100% Buffer B from 21 -21.5 minutes; a linear gradient between 21.5-23.5 minutes; 100 to 25% Buffer B from 23.5-24 minutes, and held at 15% Buffer B until 25 minutes. The ethyl acetate and methanol fractions were combined and dried, resuspended in methanol, dried onto di- atomaceous earth (Celite, Sigma-Aldrich), and separated through a column of silica gel 60 (Material Harvest) with DCM:MeOH (90:10, v:v) over 3 litres, DCM:MeOH (80:20, v:v) over 1 litre and DCM:MeOH (70:30, v:v) over 1 litre. Fractions containing the AsUGT91 product as assessed by thin layer chromatography were combined, dried onto diatomaceous earth (Celite, Sigma-Aldrich), and separated on a
Biotage®SNAP KP-Sil 50 g column with a flow rate of 100 ml/min as follows; 100 % DCM (Solvent A) and 0% methanol (Solvent B) for 330 ml; 0-10% Solvent B over 500 ml; 10% Solvent B for 200 ml; 10-15% Solvent B over 260 ml; 15% Solvent B for 250 ml; 15-20% Solvent B over 230 ml and 20% Solvent B for 240 ml. Fractions containing the AsUGT91 G16 product as assessed by thin layer chromatography were combined, dried onto diatomaceous earth (Celite, Sigma-Aldrich), and separated on a Biotage®SNAP C18 30g column with a flow rate of 25 ml/min as follows: 45% water (Solvent A) and 55% methanol (Solvent B) for 165 ml; 55-80% Solvent B over 990 ml; 80-100% Solvent B over 33 ml; 100% Solvent B for 165 ml. Fractions containing the AsUGT91 G16 product as assessed by thin layer
chromatography were combined, dried and analysed by NMR analysis.
Identification of AsUGT91G16 and AsTG mutants. Genomic DNA was extracted with an in-house extraction method by the Genotyping Scientific Service of the John Innes Centre. The AsUGT91G16 gene was sequenced in 47 uncharacterised sodium azide-generated avenacin deficient mutants. The AsTG gene was sequenced in four independent sad3 mutants (Mylona et al., 2008). Purified PCR products were sequenced (GATC Biotech) and searched for Single Nucleotide Polymorphisms (SNPs). Amplification and sequencing primers are listed in Supplementary Table GS3.
Root extract analysis. Mutant seedlings (20 per mutant) were grown on water agar plates and whole roots were harvested from three-day-old seedlings ( #85, #543, #1073 and #1473 mutant seedlings were 4-day-old due to short roots), flash-frozen in liquid N2 and stored at -80°C. Frozen oat roots (26-27 mg) were weighed into 2 ml screw- capped tubes. Two tungsten beads (3mm) were added with 500 pi 80% methanol and samples were incubated at 1400 rpm at 25°C for 1 hour, then the temperature was increased to 42°C for 30 minutes. Samples were centrifuged briefly at 16 000 x g and 450 mI was removed to a fresh 1.5 ml Eppendorf tube and partitioned twice with hexane. An aliquot (200 mI) of the methanolic fraction was dried down in a Genevac EZ-2 Elite centrifugal evaporator and resuspended in 100 mI methanol, filtered through Corning®Costar®Spin-X®centrifuge tube filters (Sigma- Aldrich). An aliquot (50 mI) of this filtrate was added to 50 mI of 50% methanol and analysed by HPLC-CAD-UV-MS using a 50x2.1 mm 2.6 m Kinetex XB-C18 column (Phenomenex) with a column oven temperature of 30°C. Detection was by charged aerosol detector (CAD, Corona Ultra RS from Dionex), UV/Vis absorbance collecting spectra from 200- 500nm (Shimadzu SPD-M20A), and electrospray MS (Shimadzu LC-2020 dual source MS) collected in positive mode and negative mode from m/z 50-1500. The gradient was run at 0.3 ml/min with 100% water as Buffer A, 100% acetonitrile as Buffer B and was as follows: 20% Buffer B from 0-3 minutes; 20-60% Buffer B from 3-28 minutes; 60-100% Buffer B from 28-30 minutes; a linear gradient between 30-33 minutes; 100 to 20% Buffer B from 33-34 minutes, and held at 20% Buffer B until 35 minutes.
F2 population analysis Seeds were grown on distilled water agar plates. For F2 seeds from the AsUGT91G16 x wild type crosses, four-day-old seedlings were phenotyped for root length and reduced fluorescence. Seedlings were grown for a further three days, and the root length phenotype verified before transfer to soil in 96- well trays and growth under glasshouse conditions. For F2 seeds from the
sad3/AsTG #1139 x wild type S75 cross, three-day-old seedlings were phenotyped for reduced fluorescence and transferred to soil in 96-well trays and grown under glasshouse conditions. Approximately 100 mg of leaf material was harvested from two-week-old seedlings and genomic DNA was ex- tracted with an in-house extraction method by the Genotyping Scientific Service of the John Innes Centre. DNA fragments spanning the region of each respective SNP were amplified by PCR and crude PCR products were se- quenced by PlateSeq Kit PCR (Eurofins).
Amplification and sequencing primers are listed in Supplementary Table GS3.
Take-all assay. Agar plugs containing actively-growing G. graminis var. tritici (isolate T5) inoculum were placed on 30 ml of loosely packed sterile moist vermiculite in 50- ml sterile plastic tubes and covered with a further 2 ml of wet vermiculite. Mock- inoculated tubes received plugs of sterile agar. Four-day old oat seedlings were sown on top and covered with a further thin layer of vermiculite and the tubes sealed with Parafilm. Tubes were incubated at 22°C with a light-dark cycle of 16 hours of light and 8 hours of dark. Seedlings were carefully removed from the vermiculite 21 days after inoculation, and symptoms were scored. Pathogenicity was scored on an arbitrary score of 0 to 8; 0, no disease symptoms; 1 , some browning of the roots, which may be nonspecific; 2, several lesions visible; 3, as 2, but with lesions confluent with seed; 4, as 3, with browning of the leaf sheath; 5, as 4, with more extensive browning of the leaf sheath; 6, extensive root necrosis and browning of the leaf sheath; 7, as 6 and leaves wilting and chlorotic; 8, as 6, and leaves brown and necrotic.
Table GS1 Table of UGTs used as queries in tBLASTn searches to mine a 454- based transcriptomic dataset from A. strigosa roots tips.
UGT Enzyme GenBank Protein Organism
group accession
A GjUGT94E5 BAM28984 Gardenia jasminoides
A GmUGT91 H4 BAI99585 Glycine max
A AtUGT91 B1 Q9LSM0 Arabidopsis thaliana
B AtUGT89B1 NP_177529 Arabidopsis thaliana
C PoUGT90A7 ACB56926 Pilosella officinarum
D AtUGT73B3 AAM47999 Arabidopsis thaliana
E AtUGT72B1 Q9M156 Arabidopsis thaliana
E AtUGT88A1 AEE75831 Arabidopsis thaliana
E MtUGT71 G1 AAW56092 Medicago truncatula
F AtUGT78D1 Q9S9P6 Arabidopsis thaliana
G AtUGT85A1 AAF18537 Arabidopsis thaliana
H AtUGT76B1 NP_187742 Arabidopsis thaliana
I AtUGT83A1 Q9SGA8 Arabidopsis thaliana
J AtUGT87A1 064732 Arabidopsis thaliana
K AtUGT86A1 Q9SJL0 Arabidopsis thaliana
L AtUGT84A1 Q5XF20 Arabidopsis thaliana
L McUGT75L4 ABL85474 Madura pom if era
N AtUGT82A1 Q9LHJ2 Arabidopsis thaliana
O ZmcisZOGl AAK53551 Zea mays
O ZmcisZOG2 AAL92460 Zea mays
P ZmUGT P DAA40852 Zea mays
Figure imgf000125_0001
SIGAME18 XP_004243 A Solarium Steroidal alkaloid 3-O-glucoside [1 ,2]- Itkin et al. (2013)
636 lycopersicum glucosyltransferase
VpUGT94F1 BAI44133 UGT9 A Veronica persica Flavonoid 3-O-glucoside [1 ,2]- Ono et al. (2010)
4 glucosyltransferase
AtUGT89C1 AAF80123 UGT8 B Arabidopsis thaliana Flavonol 7-O-rhamnosyltransferase Yonekura- 9 Sakakibara et al.
(2007)
UGT89A2- Q9LZD8 UGT8 B Arabidopsis thaliana Dihydroxybenzoic acid xylosyltransferase Chen and Li (2017)
Col-0 9
PoUGT90A7 ACB56926 UGT9 C Pilosella officinarum flavonol glucosyltransferase Witte et al. (2009)
0
AlcUGT73G1 AAP88406 UGT7 D Allium cepa Flavonoid glucosyltransferase Kramer et al. (2003)
3
AtUGT73B3 AAM47999 UGT7 D Arabidopsis thaliana Flavonoid-7-O-glucosyltransferase Kim et al. (2006)
3
AtUGT73C1 AEC09294 UGT7 D Arabidopsis thaliana Cytokinin glucosyltransferase 1 Gandia-Herrero et al.
3 (2008)
BavUGT73C AFN26666 UGT7 D Barbarea vulgaris Triterpene-3-O-glucosyltransferase Augustin et al. (2012)
10 3
CbBet50GT CAB56231 UGT7 D Cleretum bellidiforme betanidin-5-O-glucosyltransferase Vogt et al. (1999)
3
CsUGT73A2 AL019886 UGT7 D Camellia sinensis
0 3
CsUGT73AM KGN59015 UGT7 D Cucumis sativus Triterpene-3-O-glucosyltranferase Zhong et al. (2017)
3 3
GmUGT73F2 BAM29362 UGT7 D Glycin max Triterpene 22-O-arabinoside [1 ,3]- Sayama et al. (2012)
3 glucosyltransferase
GmUGT73F4 BAM29363 UGT7 D Glycin max Triterpene 22-O-arabinoside [1 ,3]- Sayama et al. (2012)
3 xylosyltransferase
GmUGT73P2 BAI99584 UGT7 D Glycin max Triterpene 3-O-glucoronide [1 ,2]- Shibuya et al. (2010)
3 galactosyltransferase
GuUGAT ANJ03631 UGT7 D Glycyrhiza uralensis Triterpene 3-0- Xu et al. (2016)
3 glucoronosyltransferase/T riterpene 3-0- glucuronide [1 ,2]-glucuronosyltransferase
MtUGT73F3 ACT34898 UGT7 D Medicago trunctula Triterpene 28-O-glucosyltransferase Naoumkina et al.
3 (2010)
SIUGT73L4 ADQ37966 UGT7 D Solanum Steroidal alkaloid 3-O-glucoside [1 ,3]- Itkin et al. (2013)
3 lycopersicum xylosyltransferase
StSGT3 ABB84472 UGT7 D Solanum tuberosum Steroidal alkaloid 3-0- McCue et al. (2007)
3 glucoside/galactoside [1 ,2]- rhamnosyltransferase
CrsUGT707B CCG85331 UGT7 E Crocus sativus Flavonol 3-O-glucoside [1 ,2]- Trapero et al. (2012)
1 07 glucosyltransferase
FcCGT BBA18062 UGT7 E Citrus Flavonoid 3'-C/5'-C-glucosyltransferase Ito et al. (2017)
08 paradisi/Fortunella
crassifolia
AtUGT71 B6 UGT7 E Arabidopsis thaliana Abscisate beta-glucosyltransferase Priest et al. (2006)
NP_188815 1
AtUGT71 C1 UGT7 E Arabidopsis thaliana UDP-glucosyl transferase 71 C1 Lim et al. (2008)
NP_180536 1
OsUGT707A BAC83989 UGT7 E Oryza sativa Flavonoid 3-O-glycosyltransferase Ko et al. (2008)
3 1
AtUGT72B1 Q9M156 UGT7 E Arabidopsis thaliana UDP-glycosyltransferase 72B1 Brazier-Hicks et al.
2 (2007
AtUGT72E2 AED98252 UGT7 E Arabidopsis thaliana Hydroxycinnamate 4-beta- Lanot et al. (2006)
2 glucosyltransferase
MtUGT72L1 ACC38470 UGT7 E Medicago truncatula P roa nt hocya n id i n p re cu rso r-s pe cif ic Pang et al. (2008)
2 U D P-g lycosy Itra nsferase
AmUGT88D3 ABR57234 UGT8 E Antirrhinum majus chalcone 4'-0-glucosyltransferase Ono et al. (2006)
8
MdPGTI B3TKC8 UGT8 E Malus domestica Phloretin 2'-0-glucosyltransferase Jugde et al. (2008)
8
RhGT1 BAD99560 UGT8 E Rosa hybrida Anthocyanidin 5/3-O-glucosyltransferase Ogata et al. (2005)
8
ScUGT5 BAJ1 1653 UGT8 E Sinningia cardinalis U D P-g I u cose : 3-d eoxya nt hocya n id i n 5-0- Nakatsuka and
8 glucosyltransferase Nishihara (2010)
GmUGT708D I1 L3T1 E Glycine max Hydroxyflavanone-2-C- Hirade et al. (2015)
1 glucosyltransferase
GtUF6CGT1 BAQ 19550 E Gentiana triflora Flavonoid 6-C-glucosyltransferase Sasaki et al. (2015)
OsCGT CAQ77160 E Oryza sativa C-glucosyltransferase Brazier-Hicks et al.
(2009)
AtUGT78D1 Q9S9P6 UGT7 F Arabidopsis thaliana Flavonol 3-O-glucosyltransferase Jones et al. (2003)
8
Fh3GT1 ADK75021 UGT7 F Freesia hybrid Anthocyanidin 3-O-glucosyltransferase Sun et al. (2016)
8 cultivar
VmUF3GaT BAA36972 UGT7 F Vigna mungo Flavonoid 3-O-galactosyltransferase Mato et al. (1998)
8
VvGT1 AAB81683 UGT7 F Vitis vinifera Anthocyanidin 3-O-glucosyltransferase Ford et al. (1998)
8
AtUGT85A1 AAF 18537 UGT8 Arabidopsis thaliana Cytokinin-O-glucosyltransferase 2 Hou et al. (2004)
5 G
PdUGT85A1 ABV68925 UGT8 Prunus dulcis Cyanohydrin glucoside [1 ,6]- Franks et al. (2008)
9 5 G glucosyltransferase
SbUGT85B1 AAF17077 UGT8 Sorghum bicolor Cyanohydrin glycosyltransferase Hansen et al. (2003)
5 G UGT85B1
AtUGT76D1 AEC07843 UGT7 H Arabidopsis thaliana Flavonoid-7-O-glucosyltransferase Lim et al. (2004)
6
SrUGT76G1 AAR06912 UGT7 H Stevia rebaudiana Diterpenoid 13-O-glucoside [1 ,3]- Richman et al.
6 glucosyltransferase (2005)
ZmBx8 AAL57037 UGT7 H Zea mays UDP-glucosyltransferase BX8 von Rad et al. (2001 )
6
AtUGT83A1 Q9SGA8 UGT8 I Arabidopsis thaliana Ross et al. (2001 )
3
Figure imgf000129_0001
Figure imgf000130_0001
Figure imgf000131_0001
Table GS3 Characterised GT Family 1 UGTs with glycoside-specific glycosyltransferase activity
UGT
Enzyme name Group Activity Plant species Publication
family
Flavonol 3-O-galactoside [1 ,2]- Yonekura-Sakakibara
AtUGT79B6 UGT79 A Arabidopsis thaliana
glucosyltransferase et al. (2014)
Anthocyanidin 3-O-glucoside [1 ,2]-
BpUGT94B1 UGT94 A Beilis perennis Sawada et al. (2005) glucuronosyltransferase
Flavonol 3-O-glucoside [1 ,6]-
CaUGT3 UGT94 A Catharanthus roseus Masada et al. (2009) glucosyltransferase (processive)
Flavonol 7-O-glucoside [1 ,2]-
Cm1-2RhaT1 UGT94 A Citrus maxima Frydman et al. (2013) rhamnosyltransferase
Flavonol 7-0/3-0 glucoside [1 ,6]-
Cs1-6RhaT UGT91 A Citrus sinensis Frydman et al. (2013) rhamnosyltransferase
Apocarotenoid glucoside [1 ,6]- Gardenia Nagatoshi et al.
GjUGT94E5 UGT94 A
glucosyltransferase jasminoides (2012)
Flavonol 3-O-glucoside/galactoside [1 ,6]- Rojas Rodas et al.
GmUGT79A6 UGT79 A Glycine max
rhamnosyltransferase (2014)
Flavonol 3-O-glucoside/galactoside [1 ,6]- Rojas Rodas et al.
GmUGT79A7 UGT79 A Glycine max
glucosyltransferase (2016)
Flavonol 3-O-glucoside/galactoside [1 ,2]-
GmUGT79B30 UGT79 A Glycine max Di et al. (2015)
glucosyltransferase
Figure imgf000132_0001
Flavonol 3-O-glucoside [1 ,6]-
LeABRT2 UGT79 A Lobelia erinus Hsu et al. (2017) rhamnosyltransferase
Figure imgf000133_0001
Figure imgf000134_0001
Table GS4 Primers
Name Sequence Annealing PCR
Temperatur Cycles e
Primers used for UGT expression profiling
GAPDH-RT- GGTGGTCATTTCAGCCCCTA 58°C 27
PCR-F
GAPDH-RT- CTCCCACCTCTCCAGTCCTT 58°C 27
PCR-R
SAD10FWD GAGGGAGGAGTTGGAGAGGT 58°C 30
SAD10REV GGGCCACAGATCGATCCATT 58°C 30
Frt- GAAGCCTCACTGGATCTTCG 58°C 30
UGT91 G15
Rrt- ATCGTGCACCTCTCTTTCGT 58°C 30
UGT91 G15
Futr- GGACTACGACGATGGGTCAT 58°C 30
UGT91 F1 1
Rutr- AGCAACCAGGCTCACAACTC 58°C 30
UGT91 F1 1
Futr- CGAGCTCCTCTGCAACTACC 58°C 30
UGT93B16
Rutr- G AC AT G C ATTT G G C AAG AAA 58°C 30
UGT93B16
Futr- AATGCCATTCAGCGAGTCAT 58°C 30
UGT93B8
Rutr- T G G AAT GT AAACT GG GAG AACA 58°C 30
UGT93B8
Futr- AGCTGATCGTGGACGTTCTT 58°C 30
UGT701A5
Rutr- G CT CATTCGTTAACAT GAAT CAA 58°C 30
UGT701A5
Fp- GAT GAT GAT GAT G CAGTGGTGG AG 58°C 30
UGT705A4bi
s
Rp- TGCTGCTAGATATTGGCGGC 58°C 30
UGT705A4bi
s
Fep- AGGCTGCCCCTTGAAATAGT 58°C 30
AsUGT99C4
Rep- ACGT GT CCTTGGT CAT CT CC 58°C 30
AsUGT99C4
Frp- T CCAGGAAGAGAAGCTT GGA 58°C 30
AsUGT99B9
Rrp- TTGTATCGCTGCTCTCGTTG 58°C 30
AsUGT99B9
Futr- AGGAGAGAGGGGTGGGACTA 58°C 35 UGT91 G16lik
e
Rutr- G G AAC C AT ATT G AAAAAT C G CTTA 58°C 35
UGT91 G16bi
s
Frp- CAT CAATGGAT GAGGCACAG 58°C 35
UGT98B4
Rrp- TTTCACTCCAACCTCCAACC 58°C 35
UGT98B4
Frt-UGT99D1 CGAGCACAACGT CCACGAGT 58°C 35
Rrt-UGT99D1 TTCGCCTCTACAGGTGGTGG 58°C 35
Frt-UGT99A6 GGTTGAGGCCGCTGTGAG 60°C 35
Rrt-UGT99A6 ATGTCACCTCCACCGGTTCC 60°C 35
Primers used for TG expression profiling
GAPDH-RT- GGTGGTCATTTCAGCCCCTA 55°C 30
PCR-F
GAPDH-RT- CTCCCACCTCTCCAGTCCTT 55°C 30
PCR-R
Sad 1 -1 -5 ATGTGGAGGCTAACAATAGG 55°C 30
Sad 1 -2-3 T AT CT CAT G ACG AT GTT CCG 55°C 30
F-AsTG-8 CT CGGGAGT CT ACT CGACCA 55°C 30
R-AsTG-8 GGGTGTTTCCATTTGCGAGC 55°C 30
Primers used for cloning
attB 1 F-1 G G GGAC AAGTTT GTACAAAAAAG CAG G C 50°C 25
TTA
attB2R-1 GGGGACCACTTTGTACAAGAAAGCTGGG 50°C 25
TA
attLF-1 TCGCGTTAACGCTAGCATGGATCTC 50°C 25 attLR-2 GTAACAT CAG AGATTTT GAG AC AC 50°C 25
Fgw- AAAAAGCAGGCTTAATGGCCGCCTCTGCT 60°C 18
UGT91 G16 TCC
Rgw- G AAAGCT GG GTAT CAGT CCAT GT AAGAC 60°C 18
UGT91 G16 GTGAGCTGCTG
Fgw- AAAAAGCAGGCTTAATGGCGACGCTGCC 60°C 18
GTUGT99B9 GGAGCTGCAC
Rgw- AGAAAG CTG GGT ATT AAG ACT GT ACT G AC 60°C 18
GTUGT99B9 AGTGC
Fgw-AsTG AAAAAGCAGGCTTAATGGCACTGCTGCTC 60°C 18
TGC
Rgw-AsTG AGAAAGCTGGGTATCACGCAGAGTCGTA 60°C 18
ATATTGT
Fgw- AAAAAGCAGGCTTAATGGGAGACGTTGT 60°C 18 nosigAsTG GGTGGCG
Primers used to amplify AsUGT91 G16 gene in avenacin deficient mutants
F- GCCCGCTACCTATTTGAATGGTGG 67°C 40
UGT91 G16- 0816 RoutUGT91 G GT GTT GACCAT GCACGAAT CT CC 67°C 40 16
Primers used to sequence AsUGT91 G16 gene in avenacin deficient mutants
F- GCCCGCTACCTATTTGAATGGTGG
UGT91 G16- 0816
Rutr- G G AAC C AT ATT G AAAAAT C G CTT A
UGT91 G16- bis
Primers used to amplify AsUGT91 G16 for F2 analysis
FUTR- TGTTTTTGTAAGCAGCGGGC 67°C 40
UGT91 G16-
0516
RUTR- AGGTAGTACACTCGCTCGCT 67°C 40
UGT91 G16-
0516
Primer used to sequence AsUGT91 G16 for F2 analysis
Rrt- ACGACCAGCT GAAGCTT GCC
UGT91 G16
Primers used to amplify AsTG gene in avenacin deficient mutants
R-AsTG-tot-1 GCGCGGTCTCAAACTTGTTT 65°C 40 F-AsTG-3 TGTCTTCCAGGCTAGTGGGA 65°C 40
Primers used to sequence AsTG gene in avenacin deficient mutants
R-AsTG-3 TGCT GCAACAT CT CCGGT AG
F-AsTG-4 TGTTTCTCTTCAGCCTCCGG
F-AsTG-5 GATTATAAGCAAGCCGCCGC
R-AsTG-6 G CTT GAG ATT GAAGGCGTGC
F-AsTG-7 GGACTACCCTCCGGTGATGA
R-AsTG-7 CAGCCCGT CCT GAAT GAAGT
F-AsTG-8 CT CGGGAGT CT ACT CGACCA
R-AsTG-9 TCTTGCCGACAAAGAGCCAT
F-AsTG-10 ACTCCGCCAGATGGTACTCT
R-AsTG-10 GTT GTT GGACCACCT AGCGA
Primers used to amplify AsTG for F2 analysis
F-AsTG-7 GGACTACCCTCCGGTGATGA 66°C 40
R-AsTG-7 CAGCCCGT CCT GAAT GAAGT 66°C 40
Primers used to amplify AsTG for F2 analysis
R-AsTG-7 CAGCCCGTCCTGAAT GAAGT
Primers used to clone C-terminal RFP fusion constructs
Fgw- G G GGACAAGTTT GTACAAAAAAG CAGG CTT AAT GGCACTGCTGCT
AsTGsig- CTGC
FULL
Fgw-AsTG- G G GGACAAGTTT GTACAAAAAAG CAGG CTT AAT GGG AG ACGTT GT
NOSIG-FULL GGTGGCG
Rgw-AsTG- G G GGACCACTTT GTACAAGAAAGCTGG GT ACG CAGAG
NOSTOP- TC GT AAT ATT GTTT C FULL
Primers used to clone N-terminal GFP AsUGT91 G16 fusion constructs
AsUGT91 - AAAAAGCAGGCTTATGGCCGCCTCTGCTTCC
NTGW
Rgw- G AAAGCT GG GTAT CAGT CCAT GT AAGAC 60°C 18
UGT91 G16 GTGAGCTGCTG _
Primers used to clone C-terminal GFP fusion AsUGT91 G16 constructs
Fgw- AAAAAGCAGGCTTAATGGCCGCCTCTGCT 60°C 18
UGT91 G16 TCC
Rgw-UGT91 - AGAAAGCTGGGTAGTCCATGTAAGACGTGAGCTGCTG
NOSTOP
Primers used to construct a GFP-only control
Spel-GFP- TCTAGAACTAGTCCGGGTACCGGTAGAAAAAATGAGTAAAGG For
GFP+STOP+ AAATT CGAGCTCTT ATTT GTATAGTT CAT C CAT G C C
Sacl-Rev
Primers used to verify fluorescent fusion contructs
midRFP-Rev GAGCCGTACTGGAACTGAGG
midGFP-Rev GTAGTT CCCGT CGT CCTT GA
midGFP-For T CAAG GAG G ACG G AAAC AT C
midRFP-For CATCCCCGACTACTTGAAGC
Table GS5 Characterised plant transglucosidases (TGs)
Enzyme Accession Full name Subcellular Plant species Reference name Localisation
AtSFR2 Q93Y07 SENSITIVE TO FREEZING 2 chloroplast Arabidopsis thaliana Moellering et al.
membrane (2010)
AaAA7GT BAM2930 Acyl-glucose-dependent not determined Agapanthus africanus Miyahara et al.
4 anthocyanin 7-0- (2012)
glucosyltransferase
CmAA7GT BA09625 Acyl-glucose-dependent not determined Campanula medium Miyahara et al.
0 anthocyanin 7-0- (2014)
glucosyltransferase
DgAA7GT E3W9M3 Acyl-glucose-dependent vacuolar Delphinium grandiflorum Matsuba et al.
anthocyanin 7-0- (2010) glucosyltransferase
DgAA7BG- BAO0417 Acyl-glucose-dependent vacuolar Delphinium grandiflorum Nishizaki et al.
GT1 8 anthocyanin (2013)
glucosyltransferase
DgAA7BG- BAO0418 Acyl-glucose-dependent vacuolar Delphinium grandiflorum Nishizaki et al.
GT2 1 anthocyanin (2013)
glucosyltransferase
DcAA5GT E3W9M2 Acyl-glucose-dependent vacuolar Dianthus caryophyllus Matsuba et al.
anthocyanin 5-0- (2010) glucosyltransferase
Os9bglu31 B7F7K7 Acyl-glucose-dependent vacuolar Oryza sativa Japonica Luang et al. (2013) flavonol/phytohormone/pheny Group
Ipropanoid
glucosyltransferase
References for Example 13, Tables GS1-5 and Figures 18-28.
Augustin, J. M., Drok, S., Shinoda, T., Sanmiya, K., Nielsen, J. K., Khakimov, B., Olsen,
C. E., Hansen, E. H., Kuzina, V., Ekstrom, C. T., Hauser, T., and Bak, S. (2012). UDP- glycosyltransferases from the UGT73C subfamily in Barbarea vulgaris catalyze sapogenin 3-O-glucosylation in saponin-mediated insect resistance. Plant Physiol., 160:1881-95.
Bowyer, P., Clarke, B., Lunness, P., Daniels, M., and Osbourn, A. (1995). Host range of a plant pathogenic fungus determined by a saponin detoxifying enzyme. Science,
267(5196):371-374.
Brazier-Hicks, M., Evans, K. M., Gershater, M. C., Puschmann, H., Steel, P. G., and Edwards, R. (2009). The C- glycosylation of flavonoids in cereals. J. Biol. Chem., 284:17926-34.
Brazier-Hicks, M., Offen, W. A., Gershater, M. C., Revett, T. J., Lim, E.-K., Bowles, D. J., Davies, G. J., and Edwards, R. (2007). Characterization and engineering of the bifunctional N- and O-glucosyltransferase involved in xenobiotic metabolism in plants. Proc. Natl. Acad. Sci. U.S.A., 104:20238-43.
Brugliera, F., Holton, T. A., Stevenson, T. W., Farcy, E., Lu, C. Y., and Cornish, E. C. (1994). Isolation and characterization of a cDNA clone corresponding to the Rt locus of Petunia hybrida. Plant J., 5:81-92.
Bryan, G. T., Labourdette, E., Melton, R. E., Nicholson, P., Daniels, M. J., and Osbourn, A. E. (1999). DNA polymor- phism and host range in the take-all fungus,
Gaeumannomyces graminis. Mycol. Res., 103(3):319 - 327.
Chen, H.-Y. and Li, X. (2017). Identification of a residue responsible for UDP-sugar donor selectivity of a dihydrox- ybenzoic acid glycosyltransferase from Arabidopsis natural accessions. Plant J., 89:195-203.
Curtis, M. D. and Grossniklaus, U. (2003). A gateway cloning vector set for high- throughput functional analysis of genes in planta. Plant Physiol., 133(2):462-469. daSilva, L. L. P., Taylor, J. P., Hadlington, J. L., Hanton, S. L., Snowden, C. J., Fox, S. J., Foresti, O., Brandizzi, F., and Denecke, J. (2005). Receptor salvage from the prevacuolar compartment is essential for e cient vacuolar protein targeting. Plant Cell, 17:132-48.
Di, S., Yan, F., Rodas, F. R., Rodriguez, T. O., Murai, Y., Iwashina, T., Sugawara, S., Mori, T., Nakabayashi, R., Yonekura-Sakakibara, K., Saito, K., and Takahashi, R. (2015). Linkage mapping, molecular cloning and functional analysis of soybean gene Fg3 encoding flavonol 3-O-glucoside/galactoside (1 -> 2) glucosyltransferase. BMC Plant Biol., 15:126. Eudes, A., Bozzo, G. G., Waller, J. C., Naponelli, V., Lim, E.-K., Bowles, D. J., Gregory, J. F. r., and Hanson, A. D. (2008). Metabolism of the folate precursor p-aminobenzoate in plants: glucose ester formation and vacuolar storage. J. Biol. Chem., 283:15451-9.
Ford, C. M., Boss, P. K., and Hoj, P. B. (1998). Cloning and characterization of Vitis vinifera UDP-glucose:flavonoid 3-O-glucosyltransferase, a homologue of the enzyme encoded by the maize Bronze-1 locus that may primarily serve to glucosylate
anthocyanidins in vivo. J. Biol. Chem., 273:9224-33.
Franks, T. K., Yadollahi, A., Wirthensohn, M. G., Guerin, J. R., Kaiser, B. N., Sedgley, M., and Ford, C. M. (2008). A seed coat cyanohydrin glucosyltransferase is associated with bitterness in almond ( Prunus dulcis) kernels. Funct. Plant Biol., 35(3):236-246.
Frigerio, L, de Virgilio, M., Prada, A., Faoro, F., and Vitale, A. (1998). Sorting of phaseolin to the vacuole is saturable and requires a short C-terminal peptide. Plant Cell, 10(6):1031— 1042.
Frydman, A., Liberman, R., Huhman, D. V., Carmeli-Weissberg, M., Sapir-Mir, M., Ophir, R., W Sumner, L., and Eyal, Y. (2013). The molecular and enzymatic basis of bitter/non bitter flavor of citrus fruit: evolution of branch- forming rhamnosyltransferases under domestication. Plant J., 73:166-78.
Gandia-Herrero, F., Lorenz, A., Larson, T., Graham, I. A., Bowles, D. J., Rylott, E. L., and Bruce, N. C. (2008). Detoxification of the explosive 2,4,6-trinitrotoluene in Arabidopsis : discovery of bifunctional O- and C- glucosyltransferases. Plant J., 56:963-74.
Hansen, K. S., Kristensen, C., Tattersall, D. B., Jones, P. R., Olsen, C. E., Bak, S., and Moller, B. L. (2003). The in vitro substrate regiospecificity of recombinant UGT85B1 , the cyanohydrin glucosyltransferase from Sorghum bicolor. Phytochemistry, 64:143-51.
Haralampidis, K., Bryan, G., Qi, X., Papadopoulou, K., Bakht, S., Melton, R., and
Osbourn, A. (2001 ). A new class of oxidosqualene cyclases directs synthesis of antimicrobial phytoprotectants in monocots. Proc. Natl. Acad. Sci. U.S.A., 98(23):13431- 13436.
He, F., Chen, W.-K., Yu, K.-J., Ji, X.-N., Duan, C.-Q., Reeves, M. J., and Wang, J. (2015). Molecular and biochemical characterization of the UDP-glucose: Anthocyanin 5-0- glucosyltransferase from Vitis amurensis. Phytochemistry, 1 17:363-72.
Hirade, Y., Kotoku, N., Terasaka, K., Saijo-Hamano, Y., Fukumoto, A., and Mizukami, H. (2015). Identification and functional analysis of 2-hydroxyflavanone C-glucosyltransferase in soybean ( Glycine max). FEBS Lett., 589:1778- 86.
Hou, B., Lim, E.-K., Higgins, G. S., and Bowles, D. J. (2004). /V-glucosylation of cytokinins by glycosyltransferases of Arabidopsis thaliana. J. Biol. Chem., 279:47822-32. Hsu, Y.-H., Tagami, T., Matsunaga, K., Okuyama, M., Suzuki, T., Noda, N., Suzuki, M., and Shimura, H. (2017). Func- tional characterization of UDP-rhamnose-dependent rhamnosyltransferase involved in anthocyanin modification, a key enzyme determining blue coloration in Lobelia erinus. Plant J., 89:325-337.
Itkin, M., Davidovich-Rikanati, R., Cohen, S., Portnoy, V., Doron-Faigenboim, A., Oren,
E., Freilich, S., Tzuri, G., Baranes, N., Shen, S., Petreikov, M., Sertchook, R., Ben-Dor,
S., Gottlieb, H., Hernandez, A., Nelson, D. R., Paris, H. S., Tadmor, Y., Burger, Y., Lewinsohn, E., Katzir, N., and Schaffer, A. (2016). The biosynthetic pathway of the nonsugar, high-intensity sweetener mogroside V from Siraitia grosvenorii. Proc. Natl. Acad. Sci. U.S.A., 1 13:E7619- E7628.
Itkin, M., Heinig, U., Tzfadia, O., Bhide, A. J., Shinde, B., Cardenas, P. D., Bocobza, S.
E., Unger, T., Malitsky, S., Finkers, R., Tikunov, Y., Bovy, A., Chikate, Y., Singh, P., Rogachev, I., Beekwilder, J., Giri, A. P., and Aharoni, A. (2013). Biosynthesis of antinutritional alkaloids in solanaceous crops is mediated by clustered genes. Science, 341 :175-9.
Ito, T., Fujimoto, S., Suito, F., Shimosaka, M., and Taguchi, G. (2017). C- glycosyltransferases catalyzing the formation of di-C-glucosyl flavonoids in citrus plants. Plant J., 91 :187-198.
Jones, P., Messner, B., Nakajima, J.-l., Schaffner, A. R., and Saito, K. (2003). UGT73C6 and UGT78D1 , glycosyltrans- ferases involved in flavonol glycoside biosynthesis in Arabidopsis thaliana. J. Biol. Chem., 278:43910-8.
Jugde, H., Nguy, D., Moller, I., Cooney, J. M., and Atkinson, R. G. (2008). Isolation and characterization of a novel glycosyltransferase that converts phloretin to phlorizin, a potent antioxidant in apple. FEBS J., 275:3804-14.
Jung, S.-C., Kim, W., Park, S. C., Jeong, J., Park, M. K., Lim, S., Lee, Y., Im, W.-T., Lee, J. H., Choi, G., and Kim, S. C. (2014). Two ginseng UDP-glycosyltransferases synthesize ginsenoside Rg3 and Rd. Plant Cell Physiol., 55:2177-88.
Karimi, M., Inze, D., and Depicker, A. (2002). Gateway vectors for Agrobacterium- mediated plant transformation. Trends Plant Sci., 7(5):193-195.
Kim, J. H., Kim, B. G., Park, Y., Ko, J. H., Lim, C. E., Lim, J., Lim, Y., and Ahn, J.-H. (2006). Characterization of flavonoid 7-O-glucosyltransferase from Arabidopsis thaliana. Biosci. Biotechnol. Biochem., 70:1471-7.
Kita, M., Hirata, Y., Moriguchi, T., Endo-lnagaki, T., Matsumoto, R., Hasegawa, S., Suhayda, C. G., and Omura, M. (2000). Molecular cloning and characterization of a novel gene encoding limonoid UDP-glucosyltransferase in Citrus. FEBS Lett., 469:173-8. Ko, J. H., Kim, B. G., Kim, J. H., Kim, H., Lim, C. E., Lim, J., Lee, C., Lim, Y., and Ahn, J.- H. (2008). Four glucosyl- transferases from rice: cDNA cloning, expression, and characterization. J. Plant Physiol., 165:435-44.
Kramer, C. M., Prata, R. T. N., Willits, M. G., De Luca, V., Steffens, J. C., and Graser, G. (2003). Cloning and regiospecificity studies of two flavonoid glucosyltransferases from Allium cepa. Phytochemistry, 64:1069-76.
Kumar, S., Stecher, G., and Tamura, K. (2016). MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol., 33:1870-4.
Lanot, A., Hodge, D., Jackson, R. G., George, G. L., Elias, L., Lim, E.-K., Vaistij, F. E., and Bowles, D. J. (2006). The glucosyltransferase UGT72E2 is responsible for monolignol 4-O-glucoside production in Arabidopsis thaliana. Plant J., 48:286-95.
Lim, C. E., Choi, J. N., Kim, I. A., Lee, S. A., Hwang, Y.-S., Lee, C. H., and Lim, J. (2008). Improved resistance to oxidative stress by a loss-of-function mutation in the Arabidopsis UGT71 C1 gene. Mol. Cells, 25:368-75.
Lim, E.-K., Ashford, D. A., Hou, B., Jackson, R. G., and Bowles, D. J. (2004). Arabidopsis glycosyltransferases as biocat- alysts in fermentation for regioselective synthesis of diverse quercetin glucosides. Biotechnol. Bioeng., 87:623-31.
Luang, S., Cho, J.-L, Mahong, B., Opassiri, R., Akiyama, T., Phasai, K., Komvongsa, J., Sasaki, N., Hua, Y.-l., Matsuba, Y., Ozeki, Y., Jeon, J.-S., and Cairns, J. R. K. (2013). Rice Os9BGIu31 is a transglucosidase with the capacity to equilibrate phenylpropanoid, flavonoid, and phytohormone glycoconjugates. J. Biol. Chem., 288(14):1011 1—10123.
Lunkenbein, S., Bellido, M., Aharoni, A., Salentijn, E. M. J., Kaldenhoff, R., Coiner, H. A., Munoz-Bianco, J., and Schwab, W. (2006). Cinnamate metabolism in ripening fruit.
Characterization of a UDP-glucose:cinnamate gluco- syltransferase from strawberry. Plant Physiol., 140:1047-58.
Martin, R. C., Mok, M. C., Habben, J. E., and Mok, D. W. (2001 ). A maize cytokinin gene encoding an O- glucosyltransferase specific to cis-zeatin. Proc. Natl. Acad. Sci. U.S.A., 98:5922-6.
Masada, S., Terasaka, K., Oguchi, Y., Okazaki, S., Mizushima, T., and Mizukami, H. (2009). Functional and structural characterization of a flavonoid glucoside 1 ,6- glucosyltransferase from Catharanthus roseus. Plant Cell Physiol., 50:1401-15.
Mato, M., Ozeki, Y., Itoh, Y., Higeta, D., Yoshitama, K., Teramoto, S., Aida, R., Ishikura, N., and Shibata, M. (1998). Isolation and characterization of a cDNA clone of UDP- galactose: flavonoid 3-O-galactosyltransferase (UF3GaT) expressed in Vigna mungo seedlings. Plant Cell Physiol., 39:1145-55. Matsuba, Y., Sasaki, N., Tera, M., Okamura, M., Abe, Y., Okamoto, E., Nakamura, H., Funabashi, H., Takatsu, M., Saito, M., Matsuoka, H., Nagasawa, K., and Ozeki, Y.
(2010). A novel glucosylation reaction on anthocyanins catalyzed by acyl-glucose- dependent glucosyltransferase in the petals of carnation and delphinium. Plant Cell,
22(10):3374-3389.
McCue, K. F., Allen, P. V., Shepherd, L. V. T., Blake, A., Maccree, M. M., Rockhold, D.
R., Novy, R. G., Stewart, D., Davies, H. V., and Belknap, W. R. (2007). Potato glycosterol rhamnosyltransferase, the terminal step in triose side-chain biosynthesis. Phytochemistry, 68:327-34.
Meesapyodsuk, D., Balsevich, J., Reed, D. W., and Covello, P. S. (2007). Saponin biosynthesis in Saponaria vaccaria. cDNAs encoding b-amyrin synthase and a triterpene carboxylic acid glucosyltransferase. Plant Physiol., 143:959- 69.
Michlmayr, H., Malachova, A., Varga, E., Kleinova, J., Lemmens, M., Newmister, S., Rayment, I., Berthiller, F., and Adam, G. (2015). Biochemical characterization of a recombinant UDP-glucosyltransferase from rice and enzymatic production of
deoxynivalenol-3-O-b-d-glucoside. Toxins, 7:2685-700.
Milkowski, C., Baumert, A., and Strack, D. (2000). Identification of four A rabidopsis genes encoding hydroxycinna- mate glucosyltransferases. FEBS Lett., 486:183-4.
Mittasch, J., Mikolajewski, S., Breuer, F., Strack, D., and Milkowski, C. (2010). Genomic microstructure and dif- ferential expression of the genes encoding UDP-glucose:sinapate glucosyltransferase (UGT84A9) in oilseed rape ( Brassica napus). Theor. Appl. Genet., 120:1485-500.
Miyahara, T., Takahashi, M., Ozeki, Y., and Sasaki, N. (2012). Isolation of an acyl- glucose-dependent anthocyanin 7-O-glucosyltransferase from the monocot Agapanthus africanus. J. Plant Physiol., 169(13): 1321 -1326.
Miyahara, T., Tani, T., Takahashi, M., Nishizaki, Y., Ozeki, Y., and Sasaki, N. (2014). Isolation of anthocyanin 7-0- glucosyltransferase from canterbury bells (Campanula medium). Plant Biotechnology, 31 (5):555-559.
Moellering, E. R., Muthan, B., and Benning, C. (2010). Freezing tolerance in plants requires lipid remodeling at the outer chloroplast membrane. Science, 330(6001 ):226- 228.
Moglia, A., Lanteri, S., Comino, C., Hill, L., Knevitt, D., Cagliero, C., Rubiolo, P.,
Bornemann, S., and Martin, C. (2014). Dual catalytic activity of hydroxycinnamoyl- coenzyme A quinate transferase from tomato allows it to moonlight in the synthesis of both mono- and dicaffeoylquinic acids. Plant Physiol., 166(4):1777-1787. Moraga, A. R., Mozos, A. T., Ahrazem, O., and Gomez-Gomez, L. (2009). Cloning and characterization of a glucosyl- transferase from Crocus sativus stigmas involved in flavonoid glucosylation. BMC Plant Biol., 9:109.
Morita, Y., Hoshino, A., Kikuchi, Y., Okuhara, H., Ono, E., Tanaka, Y., Fukui, Y., Saito,
N., Nitasaka, E., Noguchi, H., and lida, S. (2005). Japanese morning glory dusky mutants displaying reddish-brown or purplish-gray flow- ers are deficient in a novel glycosylation enzyme for anthocyanin biosynthesis, UDP-glucose:anthocyanidin 3-0- glucoside-2"-0- glucosyltransferase, due to 4-bp insertions in the gene. Plant J., 42:353-63.
Mylona, P., Owatworakit, A., Papadopoulou, K., Jenner, H., Qin, B., Findlay, K., Hill, L.,
Qi, X., Bakht, S., Melton, R., and Osbourn, A. (2008). Sad3 and Sad4 are required for saponin biosynthesis and root development in oat. Plant Cell, 20(1 ):201-212.
Nagatoshi, M., Terasaka, K., Owaki, M., Sota, M., Inukai, T., Nagatsu, A., and Mizukami, H. (2012). UGT75L6 and UGT94E5 mediate sequential glucosylation of crocetin to crocin in Gardenia jasminoides. FEBS Lett., 586:1055-61 .
Nakatsuka, T. and Nishihara, M. (2010). UDP-glucose:3-deoxyanthocyanidin 5-0- glucosyltransferase from Sinningia cardinalis. Planta, 232:383-92.
Naoumkina, M. A., Modolo, L. V., Huhman, D. V., Urbanczyk-Wochniak, E., Tang, Y., Sumner, L. W., and Dixon, R. A. (2010). Genomic and coexpression analyses predict multiple genes involved in triterpene saponin biosynthesis in Medicago truncatula. Plant Cell, 22:850-66.
Nelson, B. K., Cai, X., and Nebenfuhr, A. (2007). A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J., 51 (6): 1126— 1 136.
Nishizaki, Y., Yasunaga, M., Okamoto, E., Okamoto, M., Hirose, Y., Yamaguchi, M., Ozeki, Y., and Sasaki, N. (2013). p-hydroxybenzoyl-glucose is a zwitter donor for the biosynthesis of 7-polyacylated anthocyanin in Delphinium. Plant Cell, 25(10):4150-4165.
Noguchi, A., Fukui, Y., luchi-Okada, A., Kakutani, S., Satake, H., Iwashita, T., Nakao, M., Umezawa, T., and Ono, E. (2008). Sequential glucosylation of a furofuran lignan, (+)- sesaminol, by Sesamum indicum UGT71A9 and UGT94D1 glucosyltransferases. Plant J., 54:415-27.
Ogata, J., Kanno, Y., Itoh, Y., Tsugawa, H., and Suzuki, M. (2005). Plant biochemistry: anthocyanin biosynthesis in roses. Nature, 435:757-8.
O’Maille, P. E., Malone, A., Dellas, N., Andes Hess, B. J., Smentek, L., Sheehan, I., Greenhagen, B. T., Chappell, J., Manning, G., and Noel, J. P. (2008). Quantitative exploration of the catalytic landscape separating divergent plant sesquiterpene synthases. Nature chemical biology, 4:617-23. Ono, E., Fukuchi-Mizutani, M., Nakamura, N., Fukui, Y., Yonekura-Sakakibara, K., Yamaguchi, M., Nakayama, T., Tanaka, T., Kusumi, T., and Tanaka, Y. (2006). Yellow flowers generated by expression of the aurone biosynthetic pathway. Proc. Natl. Acad. Sci. U.S.A., 103:1 1075-80.
Ono, E., Ruike, M., Iwashita, T., Nomoto, K., and Fukui, Y. (2010). Co-pigmentation and flavonoid glycosyltrans- ferases in blue Veronica persica flowers. Phytochemistry, 71 :726-35.
Pang, Y., Peel, G. J., Sharma, S. B., Tang, Y., and Dixon, R. A. (2008). A transcript profiling approach reveals an epicatechin-specific glucosyltransferase expressed in the seed coat of Medicago truncatula. Proc. Natl. Acad. Sci. U.S.A., 105:14210-5.
Papadopoulou, K., Melton, R. E., Leggett, M., Daniels, M. J., and Osbourn, A. E. (1999). Compromised disease resistance in saponin-deficient plants. Proc. Natl. Acad. Sci.
U.S.A., 96(22): 12923-12928.
Pereira, C., Pereira, S., Satiat-Jeunemaitre, B., and Pissarra, J. (2013). Cardosin A contains two vacuolar sorting signals using different vacuolar routes in tobacco epidermal cells. Plant J., 76:87-100.
Priest, D. M., Ambrose, S. J., Vaistij, F. E., Elias, L., Higgins, G. S., Ross, A. R. S., Abrams, S. R., and Bowles, D. J. (2006). Use of the glucosyltransferase UGT71 B6 to disturb abscisic acid homeostasis in Arabidopsis thaliana. Plant J., 46:492-502.
Qi, X., Bakht, S., Qin, B., Leggett, M., Hemmings, A., Mellon, F., Eagles, J., Werck- Reichhart, D., Schaller, H., Lesot, A., Melton, R., and Osbourn, A. (2006). A different function for a member of an ancient and highly conserved cytochrome P450 family: From essential sterols to plant defense. Proc. Natl. Acad. Sci. U.S.A., 103(49):18848- 18853.
Reed, J., Stephenson, M. J., Miettinen, K., Brouwer, B., Leveau, A., Brett, P., Goss, R. J. M., Goossens, A., O’Connell, M. A., and Osbourn, A. (2017). A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules. Metab. Eng., 42:185-193.
Richman, A., Swanson, A., Humphrey, T., Chapman, R., McGarvey, B., Poes, R., and Brandle, J. (2005). Functional genomics uncovers three glucosyltransferases involved in the synthesis of the major sweet glucosides of Stevia rebaudiana. Plant J., 41 :56-67.
Rojas Rodas, F., Di, S., Murai, Y., Iwashina, T., Sugawara, S., Mori, T., Nakabayashi, R., Yonekura-Sakakibara, K., Saito, K., and Takahashi, R. (2016). Cloning and
characterization of soybean gene Fg1 encoding flavonol 3-0- glucoside/galactoside (1- >6) glucosyltransferase. Plant Mol. Biol., 92:445-456.
Rojas Rodas, F., Rodriguez, T. O., Murai, Y., Iwashina, T., Sugawara, S., Suzuki, M., Nakabayashi, R., Yonekura- Sakakibara, K., Saito, K., Kitajima, J., Toda, K., and
Takahashi, R. (2014). Linkage mapping, molecular cloning and functional analysis of soybean gene Fg2 encoding flavonol 3-O-glucoside (1 -> 6) rhamnosyltransferase. Plant Mol. Biol., 84:287-300.
Ross, J., Li, Y., Lim, E., and Bowles, D. J. (2001 ). Higher plant glycosyltransferases. Genome Biol., 2:REVIEWS3004.
Sainsbury, F., Saxena, P., Geisler, K., Osbourn, A., and Lomonossoff, G. P. (2012).
Using a virus-derived system to manipulate plant natural product biosynthetic pathways. Methods Enzymol., 517:185 - 202. Natural Product Biosynthesis by Microorganisms and Plants, Part C.
Saitou, N. and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4:406-25.
Sasaki, N., Nishizaki, Y., Yamada, E., Tatsuzawa, F., Nakatsuka, T., Takahashi, H., and Nishihara, M. (2015). Iden- tification of the glucosyltransferase that mediates direct flavone C-glucosylation in Gentiana triflora. FEBS Lett., 589:182-7.
Sasaki, N., Wada, K., Koda, T., Kasahara, K., Adachi, T., and Ozeki, Y. (2005). Isolation and characterization of cDNAs encoding an enzyme with glucosyltransferase activity for cyclo-DOPA from four o’clocks and feather cockscombs. Plant Cell Physiol., 46:666-70.
Sawada, S., Suzuki, H., Ichimaida, F., Yamaguchi, M.-A., Iwashita, T., Fukui, Y., Hemmi, H., Nishino, T., and Nakayama, T. (2005). UDP-glucuronic acid:anthocyanin
glucuronosyltransferase from red daisy ( Beilis perennis) flowers. Enzymology and phylogenetics of a novel glucuronosyltransferase involved in flower pigment biosynthe sis. J. Biol. Chem., 280:899-906.
Sayama, T., Ono, E., Takagi, K., Takada, Y., Horikawa, M., Nakamoto, Y., Hirose, A., Sasama, H., Ohashi, M., Hasegawa, H., Terakawa, T., Kikuchi, A., Kato, S., Tatsuzaki,
N., Tsukamoto, C., and Ishimoto, M. (2012). The Sg-1 glycosyltransferase locus regulates structural diversity of triterpenoid saponins of soybean. Plant Cell, 24:2123-38.
Schweiger, W., Boddu, J., Shin, S., Poppenberger, B., Berthiller, F., Lemmens, M., Muehlbauer, G. J., and Adam, G. (2010). Validation of a candidate deoxynivalenol- inactivating UDP-glucosyltransferase from barley by heterolo- gous expression in yeast. Mol. Plant. Microbe Interact., 23:977-86.
Shibuya, M., Nishimura, K., Yasuyama, N., and Ebizuka, Y. (2010). Identification and characterization of glycosyl- transferases involved in the biosynthesis of soyasaponin i in Glycine max. FEBS Lett., 584:2258-64.
Sun, W., Liang, L., Meng, X., Li, Y., Gao, F., Liu, X., Wang, S., Gao, X., and Wang, L. (2016). Biochemical and molecular characterization of a flavonoid 3-0- glycosyltransferase responsible for anthocyanins and flavonols biosynthesis in Freesia hybrida. Front. Plant Sci., 7:410. Szerszen, J. B., Szczyglowski, K., and Bandurski, R. S. (1994). iaglu, a gene from Zea mays involved in conjugation of growth hormone indole-3-acetic acid. Science, 265:1699- 701.
Tian, L, Blount, J. W., and Dixon, R. A. (2006). Phenylpropanoid glycosyltransferases from osage orange ( Madura pomifera ) fruit. FEBS Lett., 580:6915-20.
Tognetti, V. B., Van Aken, O., Morreel, K., Vandenbroucke, K., van de Cotte, B., De Clercq, I., Chiwocha, S., Fenske, R., Prinsen, E., Boerjan, W., Genty, B., Stubbs, K. A., Inze, D., and Van Breusegem, F. (2010). Perturbation of indole-3-butyric acid
homeostasis by the UDP-glucosyltransferase UGT74E2 modulates Arabidopsis architecture and water stress tolerance. Plant Cell, 22:2660-79.
Trapero, A., Ahrazem, O., Rubio-Moraga, A., Jimeno, M. L., Gomez, M. D., and Gomez- Gomez, L. (2012). Charac- terization of a glucosyltransferase enzyme involved in the formation of kaempferol and quercetin sophorosides in Crocus sativus. Plant Physiol., 159:1335-54.
Vogt, T., Grimm, R., and Strack, D. (1999). Cloning and expression of a cDNA encoding betanidin 5-0- glucosyltransferase, a betanidin- and flavonoid-specific enzyme with high homology to inducible glucosyltrans- ferases from the Solanaceae. Plant J., 19:509-19. von Rad, U., Huttl, R., Lottspeich, F., Gierl, A., and Frey, M. (2001 ). Two
glucosyltransferases are involved in detoxi- fication of benzoxazinoids in maize. Plant J., 28:633-42.
Wang, B., Jin, S.-H., Hu, H.-Q., Sun, Y.-G., Wang, Y.-W., Han, P„ and Hou, B.-K. (2012). UGT87A2, an Arabidopsis glycosyltransferase, regulates flowering time via FLOWERING LOCUS C. New Phytol., 194:666-75.
Witte, S., Moco, S., Vervoort, J., Matern, U., and Martens, S. (2009). Recombinant expression and functional charac- terisation of regiospecific flavonoid
glucosyltransferases from Hieracium pilosella L. Planta, 229:1 135-46.
Xu, G., Cai, W., Gao, W., and Liu, C. (2016). A novel glucuronosyltransferase has an unprecedented ability to catalyse continuous two-step glucuronosylation of glycyrrhetinic acid to yield glycyrrhizin. New Phytol., 212:123-35.
Yahyaa, M., Davidovich-Rikanati, R., Eyal, Y., Sheachter, A., Marzouk, S., Lewinsohn, E., and Ibdah, M. (2016). Iden- tification and characterization of UDP-glucose:phloretin 4’-0- glycosyltransferase from Malus x domestica Borkh. Phytochemistry, 130:47-55.
Yamazaki, M., Gong, Z., Fukuchi-Mizutani, M., Fukui, Y., Tanaka, Y., Kusumi, T., and Saito, K. (1999). Molecular cloning and biochemical characterization of a novel anthocyanin 5-O-glucosyltransferase by mRNA differential display for plant forms regarding anthocyanin. J. Biol. Chem., 274:7405-1 1. Yano, R., Takagi, K., Tochigi, S., Fujisawa, Y., Nomura, Y., Tsuchinaga, H., Takahashi,
Y., Takada, Y., Kaga, A., Anai, T., Tsukamoto, C., Seki, H., Muranaka, T., and Ishimoto, M. (2018). Isolation and characterization of the soybean sg-3 gene that is involved in genetic variation in sugar chain composition at the c-3 position in soyasaponins. Plant & cell physiology, 59:792-805.
Yonekura-Sakakibara, K., Fukushima, A., Nakabayashi, R., Hanada, K., Matsuda, F., Sugawara, S., Inoue, E., Kuro- mori, T., Ito, T., Shinozaki, K., Wangwattana, B.,
Yamazaki, M., and Saito, K. (2012). Two glycosyltransferases involved in anthocyanin modification delineated by transcriptome independent component analysis in Arabidop- sis thaliana. Plant J., 69:154-67.
Yonekura-Sakakibara, K., Nakabayashi, R., Sugawara, S., Tohge, T., Ito, T., Koyanagi, M., Kitajima, M., Takayama, H., and Saito, K. (2014). A flavonoid 3-0-glucoside:2"-0- glucosyltransferase responsible for terminal modification of pollen-specific flavonols in Arabidopsis thaliana. Plant J., 79:769-82.
Yonekura-Sakakibara, K., Tohge, T., Niida, R., and Saito, K. (2007). Identification of a flavonol 7-0- rhamnosyltransferase gene determining flavonoid pattern in Arabidopsis by transcriptome coexpression analysis and reverse genetics. J. Biol. Chem., 282:14932-41.
Zhong, Y., Xue, X., Liu, Z., Ma, Y., Zeng, K., Han, L., Qi, J., Ro, D.-K., Bak, S., Huang, S., Zhou, Y., and Shang, Y. (2017). Developmental^ regulated glucosylation of bitter triterpenoid in cucumber by the UDP-glucosyltransferase UGT73AM3. Mol. Plant, 10:1000-1003.
Zuckerkandl, E. and Pauling, L. (1965). Evolutionary Divergence and Convergence in Proteins, volume 97, pages 97 - 166. Academic Press.
Example 14 - investigation into AsAATI acceptor promiscuity and utilities
Incubation of the recombinant AsAAT 1 enzyme preparation with a range of different potential triterpenoid acceptors revealed new products with oleanolic acid, hederagenin and the avenacin pathway intermediate 12,13-epoxy-16-hydroxy- b-amyrin (ErHbA) acceptors when UDP-Ara was supplied as the sugar donor (Fig. 29. A).
Only a small conversion is detected when AsAATI is incubated with UDP-GIc and 12,13- epoxy-16-hydroxy-b-amyrin (ErHbA).
In tests with a larger panel of triterpenoids and steroids particularly efficient conversion was observed with oleanolic acid, 18b-glycyrrhetinic acid and lupeol (Fig. 29. B). Steroids were not recognised as acceptors.
A combinatorial approach was conducted to explore AsAATI acceptor promiscuity using our Nicotiana benthamiana translational synthetic biology platform (Reed et al., 2017). Combination of P450s together with the b-amyrin synthase SAD1 from oat have been shown to yield various oxygenated b-amyrin derivatives (Haralampidis et al., 2001 ; Reed et al., 2017). Eight of these combinations have been chosen regarding their structure and accumulation (potentially bioactive scaffolds with sufficient accumulation of the oxygenated product to be used in glycosylation reaction). SAD1 as well as GFP were used as control combinations (Fig. 30.A).
For each of the eight combinations a new peak could be detected by charged aerosol detection with a corresponding mass of the expected triterpenoid pentoside (MS detection; Fig. 30. B & 30. C). NMR assignment was done for compound F03 and B03 (Louveau et al. unpublished). Additional NMR studies are still required but the present results suggest an extreme promiscuity of AsAATI combined with sugar donor specificity as well as conserved regiospecificity for C-3 position of the triterpenoid acceptor.
AsAATI was also tested in combination to enzymes involved in building dammarenane scaffolds present in bioactive ginsenosides (Wee, Mee Park, & Chung, 2011 ). This includes a SAD1 mutant producing dammarenediol II as well as panax ginseng enzyme CYP716A47 that are sufficient to produce protopanaxadiol (Han, Kim, Kwon, & Choi, 201 1 ; Salmon et al., 2016).
When co-expressed with SAD1 mutant and CYP716A47, AsAATI led to the accumulation of a new compound with a mass corresponding to protopanaxadiol pentoside (Fig. 31 ). The corresponding peak seen with charged aerosol detection suggest a very good accumulation of the product. A similar product is also detected when co-expressing only AsAATI and the SAD1 mutant with mass corresponding to dammarenediol II pentoside (data not shown).
Together these results suggest that AsAAT 1 acceptor promiscuity extend to dammarane scaffolds to produce new-to-nature ginsenosides. These arabino-ginsenosides may be purified and tested for bioactivity.
In a similar way to oleanane-type products it seems that arabinosylation of dammarane- type triterpenoids prevents further modifications triggered by endogenous enzymes of N. benthamiana onto corresponding glucosides or aglycones.
References for Example 14
Han, J. Y., Kim, H. J., Kwon, Y. S., & Choi, Y. E. 201 1. The Cyt P450 enzyme
CYP716A47 catalyzes the formation of protopanaxadiol from dammarenediol-ll during ginsenoside biosynthesis in Panax ginseng. Plant Cell Physiol 52(12): 2062-2073.
Haralampidis, K., Bryan, G., Qi, X., Papadopoulou, K., Bakht, S., Melton, R., & Osbourn, A. 2001. A new class of oxidosqualene cyclases directs synthesis of antimicrobial phytoprotectants in monocots. Proc Natl Acad Sci U S A, 98(23): 13431-13436. Reed, J., Stephenson, M. J., Miettinen, K., Brouwer, B., Leveau, A., Brett, P., Goss, R. J.
M., Goossens, A., O'Connell, M. A., & Osbourn, A. 2017. A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules. Metab Eng, 42: 185-193.
Salmon, M., Thimmappa, R. B., Minto, R. E., Melton, R. E., Hughes, R. K., O'Maille, P. E., Hemmings, A. M., & Osbourn, A. 2016. A conserved amino acid residue critical for product and substrate specificity in plant triterpene synthases. Proc Natl Acad
Sci U S A.
Wee, J. J., Mee Park, K., & Chung, A. S. 201 1. Biological Activities of Ginseng and Its Application to Human Health. In nd, I. F. F. Benzie, & S. Wachtel-Galor (Eds.), Herbal Medicine: Biomolecular and Clinical Aspects. Boca Raton (FL).

Claims

Claims
1 An isolated nucleic acid molecule which comprises a nucleotide sequence encoding a triterpenoid arabinosyltransferase (AT) enzyme capable of transferring an arabinoside moiety from UDP-Ara to a triterpenoid acceptor to form a triterpenoid arabinoside.
2 An isolated nucleic acid as claimed in claim 1 wherein the AT enzyme is a GT family 1 , UGT group D enzyme.
3 An isolated nucleic acid as claimed in claim 1 or claim 2 wherein the AT enzyme is plant derived, optionally from a monocot plant, which is optionally an Avena spp. plant.
4 An isolated nucleic acid as claimed in any one of claims 1 to 3 wherein the acceptor is selected from a scaffold of the oleanane-type, ursane-type, lupane-type or dammarane-type.
5 An isolated nucleic acid as claimed in any one of claims 1 to 4 wherein the AT enzyme is capable of transferring the arabinoside to the C-3 position of the triterpenoid acceptor.
6 An isolated nucleic acid as claimed in claim 1 or claim 2 wherein the AT enzyme is plant derived, optionally from a dicot plant, which is optionally Glycine max.
7 An isolated nucleic acid as claimed in any one of claims 1 to 6 wherein the AT enzyme comprises a PSPG motif in which motif the amino acid residue corresponding to residue 404 in AsAATI (SEQ ID No: 2) is a His residue.
8 An isolated nucleic acid as claimed in claim 7 wherein in the PSPG motif the amino acid residue corresponding to residue 376 in AsAATI (SEQ ID No: 2) is a Thr residue.
9 An isolated nucleic acid as claimed in claim 7 or claim 8 wherein in the PSPG motif is as shown in Table TTG2, including said His residue at the amino acid residue corresponding to residue 404 in AsAATI .
10 An isolated nucleic acid molecule which comprises a nucleotide sequence encoding a glycosyl hydrolase family 1 (GH1 ) transglucosidase enzyme capable of transferring a glucoside moiety via a 1 ,4 link to the arabinoside moiety of a triterpenoid arabinoside 1 ,2-glucoside acceptor to form a triterpene triglycoside.
11 An isolated nucleic acid as claimed in claim 10 wherein the polypeptide sequence encoded by the nucleotide sequence comprises a vacuolar targeting sequence. 12 An isolated nucleic acid molecule which nucleic acid comprises a nucleotide sequence encoding an enzyme having triterpenoid glycosylation (TTG) activity, wherein the nucleotide sequence:
(i) encodes all or part of the polypeptide SEQ ID NO: 2, 4, 6, 8, or 10; or
(ii) encodes a variant polypeptide which is a homologous variant of SEQ ID NO 2, 4, 6, 8, or 10 which shares at least about 50% identity with said SEQ ID NO, which polypeptide has the respective activity of said SEQ ID NO. shown in Table TTG1 b.
13 A nucleic acid as claimed in claim 12 wherein the nucleotide sequence is selected from SEQ ID NO: 1 , 3, 5, 7, or 9 or the genomic equivalent thereof.
14 A nucleic acid as claimed in claim 13 wherein the nucleotide sequence encodes a derivative of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, or 10 by way of addition, insertion, deletion or substitution of one or more amino acids.
15 A nucleic acid as claimed in claim 13 wherein the nucleotide sequence consists of an allelic or other homologous or orthologous variant of the nucleotide sequence of claim 13.
16 An isolated nucleic acid molecule which nucleic acid comprises a nucleotide sequence encoding an enzyme having triterpenoid glycosylation (TTG) activity, wherein the nucleotide sequence encodes a variant polypeptide which is a homologous variant of the amino acid sequence shown in SEQ ID NO 2, 4, or 6 and which shares at least about 50% identity with said SEQ ID NO,
wherein the nucleotide sequence encodes a derivative of said amino acid sequence wherein the His residue at the amino acid residue corresponding to residue 404 in SEQ ID NO. 2 has been substituted or deleted to alter the sugar specificity thereof compared to the respective activity of said SEQ ID NO. shown in Table TTG1 b.
17 A nucleic acid as claimed in claim 15 wherein the nucleotide sequence wherein the His has been substituted for Gin.
18 An isolated nucleic acid molecule which nucleic acid comprises a nucleotide sequence encoding an enzyme having triterpenoid glycosylation (TTG) activity, wherein the nucleotide sequence encodes a variant polypeptide which is a homologous variant of the amino acid sequence of a triterpenoid glucosyltransferase,
wherein the nucleotide sequence encodes a derivative of said amino acid sequence wherein the Gin residue at the amino acid residue corresponding to residue 404 in SEQ ID NO. 2 has been substituted or deleted such as to convert said
glucosyltransferase to an arabinosyltransferase. 19 A process for producing a nucleic acid as claimed in any one of claims 14, 16 or 17 comprising the step of modifying a nucleic acid as claimed in claim 13.
20 A method for identifying or cloning a nucleic acid as claimed in claim 15, which method employs all or part of a nucleic acid as claimed in claim 13 or the complement thereof.
21 A method as claimed in claim 20, which method comprises the steps of:
(a) providing a preparation of nucleic acid from a plant cell;
(b) providing a nucleic acid molecule which is a probe, said nucleic acid molecule having a sequence, which sequence is present in a nucleotide sequence of claim 13, or the complement of either;
(c) contacting nucleic acid in said preparation with said nucleic acid molecule under conditions for hybridisation; and,
(d) identifying nucleic acid in said preparation which hybridises with said nucleic acid molecule.
22 A method as claimed in claim 20, which method comprises the steps of:
(a) providing a preparation of nucleic acid from a plant cell;
(b) providing a pair of nucleic acid molecule primers suitable for PCR, at least one of said primers being a sequence of at least about 16-24 nucleotides in length, which sequence is present in a nucleotide sequence of claim 13, or the complement of either;
(c) contacting nucleic acid in said preparation with said primers under conditions for performance of PCR; and,
(d) performing PCR and determining the presence or absence of an amplified PCR product.
23 A method for identifying a nucleic acid as claimed in claim 15, which method employs all or part of the nucleotide sequence of a nucleic acid as claimed in claim 13 or the complement thereof as query sequence to interrogate a database of plant genomic sequences, and identifying the target nucleic acid as claimed in claim 15 based on sequence similarity and clustering of the target nucleic acid with other TTG sequences.
24 A recombinant vector which comprises the nucleic acid of any one of claims 1 to 18.
25 A vector as claimed in claim 24 wherein the nucleic acid is operably linked to a promoter for transcription in a host cell, wherein the promoter is optionally an inducible promoter.
26 A vector as claimed in claim 24 or claim 25 which is a plant vector, a microbial vector, an insect cell vector, or a mammalian cell vector. 27 A vector as claimed in claim 26 wherein the vector is a plant vector which comprises an expression cassette comprising:
(i) a promoter, operably linked to
(ii) an enhancer sequence derived from the RNA-2 genome segment of a bipartite RNA virus, in which a target initiation site in the RNA-2 genome segment has been mutated;
(iii) the nucleotide sequence encoding the enzyme;
(iv) a terminator sequence; and optionally
(v) a 3’ UTR located upstream of said terminator sequence.
28 A method which comprises the step of introducing the vector of any one of claims 24 to 27 into a host cell, optionally such as to cause recombination between the nucleic acid in the vector and the host cell genome such as to transform the host cell.
29 A host cell containing or transformed with a heterologous nucleic acid according to any one of claims 1 to 16 or vector of any one of claims 24 to 27.
30 A host cell as claimed in claim 29 which is microbial.
31 A host cell as claimed in claim 29 which is a plant cell, optionally having a heterologous nucleic acid as claimed in any one of claims 1 to 18 within its chromosome.
32 A plant having a heterologous nucleic acid as claimed in any one of claims 1 to 18 or vector of any one of claims 24 to 27 in one or more of its cells.
33 A method for producing a transgenic plant, which method comprises the steps of:
(a) performing a method as claimed in claim 28 wherein the vector is a plant vector and the host cell is a plant cell,
(b) regenerating a plant from the transformed plant cell.
34 A transgenic plant which is obtainable by the method of claim 33, or which is a clone, or selfed or hybrid progeny or other descendant of said transgenic plant, which in each case includes a heterologous nucleic acid of any one of claims 1 to 18.
35 An edible portion or propagule from a plant as claimed in claim 32 or claim 34, which in either case includes a heterologous nucleic acid of any one of claims 1 to 18.
36 A method, host cell or plant as claimed in any one of claims 28 to 35 wherein the nucleic acid comprises one, two or three of the following heterologous nucleic acids comprising a nucleotide sequence encoding an enzyme having triterpenoid glycosylation (TTG) activity: (i) nucleic acid having a nucleotide sequence encoding all or part of the polypeptide SEQ ID NO: 2 or 6, or encoding a variant polypeptide which is a homologous variant of SEQ ID NO 2 or 6 which shares at least about 50% identity with said SEQ ID NO;
(ii) nucleic acid having a nucleotide sequence encoding all or part of the polypeptide SEQ ID NO: 8, or encoding a variant polypeptide which is a homologous variant of SEQ ID NO 8 which shares at least about 50% identity with said SEQ ID NO;
(iii) nucleic acid having a nucleotide sequence encoding all or part of the polypeptide SEQ ID NO: 10, or encoding a variant polypeptide which is a homologous variant of SEQ ID NO 10 which shares at least about 50% identity with said SEQ ID NO;
wherein in each case the polypeptide has the respective activity of said SEQ ID NO. shown in Table TTG1 b.
37 A method, host cell or plant as claimed in any claim 36 wherein the nucleic acid comprises the heterologous nucleic acid (i) such as to provide a triterpenoid glycosylation activity which adds an arabinose moiety to the triterpenoid acceptor.
38 A method, host cell or plant as claimed in any claim 36 wherein the nucleic acid comprises all heterologous nucleic acids (ii) to (iii) such as to provide a triterpenoid glycosylation activity which adds two glucose moieties to an arabinose moiety on the triterpenoid acceptor.
39 An isolated polypeptide which is encoded by the nucleotide sequence of any one of claims 1 to 18.
40 Use of a recombinant polypeptide of claim 39 in a method of catalyse triterpenoid glycosylation in vivo or in vitro, optionally wherein the triterpenoid is non-naturally occurring.
41 Use as claimed in claim 40 for catalyzing one or more of the following reactions:
(i) in vitro modification of a purified triterpene substrate to deliver a desired product or intermediate;
(ii) in vivo generation of a desired triterpene product or intermediate which is recovered;
(iii) in vivo generation of a desired triterpene product or intermediate which is recovered and subject to in vitro modification by chemical modification
42 Use as claimed in claim 40 or claim 41 wherein:
(i) the recombinant polypeptide is all or part of the polypeptide SEQ ID NO: 2 or 6, or is a variant polypeptide which is a homologous variant of SEQ ID NO 2 or 6 which shares at least about 50% identity with said SEQ ID NO; or
(ii) the recombinant polypeptide is all or part of the polypeptide SEQ ID NO: 4, or is a variant polypeptide which is a homologous variant of SEQ ID NO 4 which shares at least about 50% identity with said SEQ ID NO; or (iii) the recombinant polypeptide is all or part of the polypeptide SEQ ID NO: 8, or is a variant polypeptide which is a homologous variant of SEQ ID NO 8 which shares at least about 50% identity with said SEQ ID NO; or
(iv) the recombinant polypeptide is all or part of the polypeptide SEQ ID NO: 10, or is a variant polypeptide which is a homologous variant of SEQ ID NO 10 which shares at least about 50% identity with said SEQ ID NO;
to catalyse the respective activity of said SEQ ID NO. shown in Table TTG1 b.
43 Use as claimed in claim 40 or claim 41 wherein the polypeptide is as described in any one of claims 16 to 18.
44 A method of making the polypeptide of claim 39, which method comprises the step of causing or allowing expression from a nucleic acid of any one of claims 1 to 18 in a host cell.
45 A method for influencing or affecting the triterpenoid glycosylation in a host, the method comprising the step of causing or allowing expression of a heterologous nucleic acid as claimed in any one of claims 1 to 18 within the host.
46 A method for influencing or affecting triterpenoid glycosylation in a host, which method comprises the step of:
(i) causing or allowing expression of a heterologous nucleic acid as claimed in any one of claims 1 to 18 within the cells of the host, following an earlier step of introducing the nucleic acid into a cell of the host or an ancestor thereof, or
(ii) introducing a silencing agent capable of silencing expression of a nucleotide sequence as described in claim 15 into a cell of the host or an ancestor thereof.
47 A method for influencing or affecting triterpenoid glycosylation in a host, which method comprises any of the following steps of:
(i) causing or allowing transcription from a nucleic acid comprising the complement sequence of a nucleotide sequence as described in claim 15 such as to reduce the respective encoded polypeptide activity by an antisense mechanism;
(ii) causing or allowing transcription from a nucleic acid encoding a stem loop precursor comprising 20-25 nucleotides, optionally including one or more mismatches, of a nucleotide sequence as described in claim 15 such as to reduce the respective encoded polypeptide activity by an miRNA mechanism;
(iii) causing or allowing transcription from nucleic acid encoding double stranded RNA corresponding to 20-25 nucleotides, optionally including one or more mismatches, of a nucleotide sequence as described in claim 15 such as to reduce the respective encoded polypeptide activity by an siRNA mechanism.
48 A method of producing a glycosylated triterpene, or modifying the glycosylation of a triterpene, in a host, which is optionally a plant, which method comprises performing a method as claimed in any one of claims 28 to 38, claims 45 to 47, or the use of any one of claims 40 to 43, and optionally isolating the glycosylated triterpene from the plant.
49 A method as claimed in any one of claims 45 to 47 for reduction or increase in glycosylated triterpene quality or quantity in the host.
50 A method as claimed in any one of claims 45 to 47 for inhibiting endogenous modifications of a triterpenoid scaffold and\or accumulating arabinosyl-conjugates of a triterpenoid scaffold, wherein a heterologous nucleic acid encoding a triterpenoid arabinosyltransferase (AT) enzyme is expressed within the cells of the host, following an earlier step of introducing the nucleic acid into a cell of the host or an ancestor thereof.
51 A method as claimed in claim 49 or claim 50 for altering a phenotype in the host which is a plant, which phenotype is selected from:
(i) enhanced herbivore and\or pathogen resistance;
(ii) improved flavour or reducing bitterness;
(iii) improving health promoting properties.
52 A method as claimed in claim 51 for altering resistance to at least one fungal disease, which is optionally the root disease take-all.
53 A method as claimed in claim 51 for reducing bitterness caused by triterpenoid glycosylation in a host, wherein the method reduces the activity of the polypeptide encoded by the nucleotide sequence of SEQ ID NO 3 or an allelic or other homologous or orthologous variant of said nucleotide sequence.
54 A nucleic acid, process, method, vector, host cell, plant, edible portion or propagule from a plant, or use, as claimed in any one of claims 1 to 53 wherein the triterpene acceptor is selected from a scaffold of the oleanane-type, ursane-type, lupane- type or dammarane-type and\or the triterpene or triterpenoid is selected from: a soyasaponin which is optionally selected from a group A saponin, which is optionally Ab, Ac, Ad, Af and Ah; an avenacin which is optionally selected from Avenacin A-1 , A-2, B-1 and B-2.
55 A nucleic acid, process, method, vector, host cell, plant, edible portion or propagule from a plant, or use, as claimed in any one of claims 1 to 53 wherein the triterpene acceptor is a scaffold of the oleanane type and the triterpene or triterpenoid is b-amyrin. 56 A nucleic acid, process, method, vector, host cell, plant, edible portion or propagule from a plant, or use, as claimed in any one of claims 1 to 53 wherein the triterpene acceptor is a scaffold of the dammarane and the triterpene or triterpenoid is ginsenoside.
57 A novel glycosylated triterpene obtained or obtainable by the method of claim 48.
58 Double-stranded RNA which comprises an RNA sequence equivalent to part of a nucleotide sequence as described in claim 15.
59 Double-stranded RNA as claimed in claim 58 which is a siRNA duplex consisting of between 20 and 25 bps.
60 A method for assessing the triterpene glycosylation phenotype of a plant, the method comprising the step of determining the presence and/or identity of an allele therein comprising the use of a nucleotide sequence as described in claim 15 or a part thereof.
61 An antibody which specifically binds the polypeptide of claim 39.
PCT/EP2019/063369 2018-05-25 2019-05-23 Triterpene glycosylation WO2019224321A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1808617.3A GB201808617D0 (en) 2018-05-25 2018-05-25 Scaffold modification
GB1808617.3 2018-05-25

Publications (1)

Publication Number Publication Date
WO2019224321A1 true WO2019224321A1 (en) 2019-11-28

Family

ID=62812411

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2019/063369 WO2019224321A1 (en) 2018-05-25 2019-05-23 Triterpene glycosylation

Country Status (2)

Country Link
GB (1) GB201808617D0 (en)
WO (1) WO2019224321A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111690629A (en) * 2020-05-29 2020-09-22 浙江工业大学 Endoglucanase mutant, gene, engineering bacterium and application thereof
CN113755478A (en) * 2020-06-02 2021-12-07 东北林业大学 Method for changing activity or function of 2,3-oxidosqualene cyclase
CN114107240A (en) * 2021-10-22 2022-03-01 中国农业科学院作物科学研究所 Tartary buckwheat-derived emodin glycosyltransferase and coding gene and application thereof
CN115125266A (en) * 2022-06-14 2022-09-30 北京理工大学 Recombinant vector, transformant and application of recombinant vector and transformant in glycosylation modification of pentacyclic triterpenoid
CN117244053A (en) * 2023-10-16 2023-12-19 国药中生生物技术研究院有限公司 Adjuvant use of compound with hederagenin-O-Ara structure

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114480323B (en) * 2020-11-11 2023-10-13 东北林业大学 Oat glycosyltransferase AsUGT73E1 and application thereof in steroid saponin synthesis

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0194809A1 (en) 1985-03-07 1986-09-17 Lubrizol Genetics Inc. RNA transformation vector
WO1992001047A1 (en) 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US5231020A (en) 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
WO1995034668A2 (en) 1994-06-16 1995-12-21 Biosource Technologies, Inc. The cytoplasmic inhibition of gene expression
WO2006044508A1 (en) 2004-10-15 2006-04-27 Plant Bioscience Limited Enzymes involved in triterpene synthesis
WO2007135480A1 (en) 2006-05-22 2007-11-29 Plant Bioscience Limited Bipartite system, method and composition for the constitutive and inducible expression of high levels of foreign proteins in plants
WO2009087391A1 (en) 2008-01-08 2009-07-16 Plant Bioscience Limited Protein expression systems
WO2014151749A1 (en) * 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Maize microrna sequences and targets thereof for agronomic traits

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0194809A1 (en) 1985-03-07 1986-09-17 Lubrizol Genetics Inc. RNA transformation vector
US5231020A (en) 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
WO1992001047A1 (en) 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO1995034668A2 (en) 1994-06-16 1995-12-21 Biosource Technologies, Inc. The cytoplasmic inhibition of gene expression
WO2006044508A1 (en) 2004-10-15 2006-04-27 Plant Bioscience Limited Enzymes involved in triterpene synthesis
WO2007135480A1 (en) 2006-05-22 2007-11-29 Plant Bioscience Limited Bipartite system, method and composition for the constitutive and inducible expression of high levels of foreign proteins in plants
WO2009087391A1 (en) 2008-01-08 2009-07-16 Plant Bioscience Limited Protein expression systems
WO2014151749A1 (en) * 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Maize microrna sequences and targets thereof for agronomic traits

Non-Patent Citations (295)

* Cited by examiner, † Cited by third party
Title
ACHNINE L ET AL.: "Genomics-based selection and functional characterization of triterpene glycosyltransferases from the model legume Medicago truncatula", PLANT J., vol. 41, no. 6, 2005, pages 875 - 887
ACHNINE, L.HUHMAN, D. V.FARAG, M. A.SUMNER, L. W.BLOUNT, J. W.DIXON, R. A.: "Genomics-based selection and functional characterization of triterpene glycosyltransferases from the model legume Medicago truncatula", PLANT J, vol. 41, no. 6, 2005, pages 875 - 887
AMORN OWATWORAKIT ET AL: "Glycosyltransferases from Oat ( Avena ) Implicated in the Acylation of Avenacins", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 288, no. 6, 8 February 2013 (2013-02-08), US, pages 3696 - 3704, XP055601808, ISSN: 0021-9258, DOI: 10.1074/jbc.M112.426155 *
ANGELLBAULCOMBE, THE EMBO JOURNAL, vol. 16, no. 12, 1997, pages 3675 - 3684
ARMAH CN ET AL.: "The membrane-permeabilizing effect of avenacin A-1 involves the reorganization of bilayer cholesterol", BIOPHYS. J., vol. 76, no. 1, 1999, pages 281 - 290
ARMAH, C. N.A. R. MACKIEC. ROYK. PRICEA. E. OSBOURNP. BOWYERS. LADHA: "The membrane-permeabilizing effect of avenacin A-1 involves the reorganization of bilayer cholesterol", BIOPHYS J, vol. 76, no. 1, 1999, pages 281 - 290
ARMITAGE ET AL., NATURE, vol. 357, 1992, pages 80 - 82
AUGUSTIN, J. M.DROK, S.SHINODA, T.SANMIYA, K.NIELSEN, J. K.KHAKIMOV, B.OLSEN, C. E.HANSEN, E. H.KUZINA, V.EKSTROM, C. T.: "UDP-glycosyltransferases from the UGT73C subfamily in Barbarea vulgaris catalyze sapogenin 3-O-glucosylation in saponin-mediated insect resistance", PLANT PHYSIOL, vol. 160, no. 4, 2012, pages 1881 - 1895
AUGUSTIN, J. M.DROK, S.SHINODA, T.SANMIYA, K.NIELSEN, J. K.KHAKIMOV, B.OLSEN, C. E.HANSEN, E. H.KUZINA, V.EKSTROM, C. T.: "UDP-glycosyltransferases from the UGT73C subfamily in Barbarea vulgaris catalyze sapogenin 3-O-glucosylation in saponin-mediated insect resistance", PLANT PHYSIOL., vol. 160, no. 4, 2012, pages 1881 - 1895
AUGUSTIN, J. M.KUZINA, V.ANDERSEN, S. B.BAK, S.: "Molecular activities, biosynthesis and evolution of triterpenoid saponins", PHYTOCHEMISTRY, vol. 72, no. 6, 2011, pages 435 - 457, XP028368007, DOI: doi:10.1016/j.phytochem.2011.01.015
BARRANGOU, R. ET AL., SCIENCE, vol. 315, 2007, pages 1709 - 1712
BEGLEY, M. J.CROMBIE, L.CROMBIE, W. M. L.WHITING, D. A.: "The isolation of avenacins A-1, A-2, B-1, and B-2, chemical defences against cereal 'take-all' disease. Structure of their 'aglycones', the avenestergenins, and their anhydro dimers", J. CHEM. SOC. PERKIN TRANS., vol. 1, 1986, pages 1905 - 1915
BENKERT, P.TOSATTO, S. C.SCHOMBURG, D.: "QMEAN: A comprehensive scoring function for model quality assessment", PROTEINS, vol. 71, no. 1, 2008, pages 261 - 277
BERNARD FX ET AL.: "Glycosylated flavones as selective inhibitors of topoisomerase IV", ANTIMICROB. AGENTS CHEMOTHER., vol. 41, no. 5, 1997, pages 992 - 998
BERNARD, F. X.S. SABLEB. CAMERONJ. PROVOSTJ. F. DESNOTTESJ. CROUZETF. BLANCHE: "Glycosylated flavones as selective inhibitors of topoisomerase IV", ANTIMICROB AGENTS CHEMOTHER, vol. 41, no. 5, 1997, pages 992 - 998
BHAYA, D.DAVISON, M.BARRANGOU, R., ANNUAL REVIEW OF GENETICS, vol. 45, 2011, pages 273 - 297
BISSARO, B.MONSAN, P.FAURE, R.O'DONOHUE, M. J.: "Glycosynthesis in a waterworld: new insight into the molecular basis of transglycosylation in retaining glycoside hydrolases", BIOCHEM. J., vol. 467, no. 1, 2015, pages 17 - 35
BOURQUE, PLANT SCIENCE, vol. 105, 1995, pages 125 - 149
BOWLES DLIM EKPOPPENBERGER BVAISTIJ FE: "Glycosyltransferases of lipophilic small molecules", ANNU. REV. PLANT BIOL., vol. 57, 2006, pages 567 - 597, XP002758668, DOI: doi:10.1146/annurev.arplant.57.032905.105429
BOWLES, D.E. K. LIMB. POPPENBERGERF. E. VAISTIJ: "Glycosyltransferases of lipophilic small molecules", ANNU REV PLANT BIOL, vol. 57, 2006, pages 567 - 597, XP002758668, DOI: doi:10.1146/annurev.arplant.57.032905.105429
BOWYER, P.CLARKE, B.LUNNESS, P.DANIELS, M.OSBOURN, A.: "Host range of a plant pathogenic fungus determined by a saponin detoxifying enzyme", SCIENCE, vol. 267, no. 5196, 1995, pages 371 - 374, XP001312613
BRADFORD, M. M.: "A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding", ANAL BIOCHEM, vol. 72, 1976, pages 248 - 254, XP025650297, DOI: doi:10.1016/0003-2697(76)90527-3
BRAZIER-HICKS, M.EVANS, K. M.GERSHATER, M. C.PUSCHMANN, H.STEEL, P. G.EDWARDS, R.: "The C- glycosylation of flavonoids in cereals", J. BIOL. CHEM., vol. 284, 2009, pages 17926 - 34, XP055590066, DOI: doi:10.1074/jbc.M109.009258
BRAZIER-HICKS, M.OFFEN, W. A.GERSHATER, M. C.REVETT, T. J.LIM, E.-K.BOWLES, D. J.DAVIES, G. J.EDWARDS, R.: "Characterization and engineering of the bifunctional N- and O-glucosyltransferase involved in xenobiotic metabolism in plants", PROC. NATL. ACAD. SCI. U.S.A., vol. 104, 2007, pages 20238 - 43
BRUGLIERA, F.HOLTON, T. A.STEVENSON, T. W.FARCY, E.LU, C. Y.CORNISH, E. C.: "Isolation and characterization of a cDNA clone corresponding to the Rt locus of Petunia hybrida", PLANT J., vol. 5, 1994, pages 81 - 92
BRYAN, G. T.LABOURDETTE, E.MELTON, R. E.NICHOLSON, P.DANIELS, M. J.OSBOURN, A. E.: "DNA polymor- phism and host range in the take-all fungus, Gaeumannomyces graminis", MYCOL. RES., vol. 103, no. 3, 1999, pages 319 - 327
CAPUTI LMALNOY MGOREMYKIN VNIKIFOROVA SMARTENS S: "A genome-wide phylogenetic reconstruction of family 1 UDP-glycosyltransferases revealed the expansion of the family during the adaptation of plants to life on land", PLANT J., vol. 69, no. 6, 2011, pages 1030 - 1042
CAPUTI, L.MALNOY, M.GOREMYKIN, V.NIKIFOROVA, S.MARTENS, S.: "A genome-wide phylogenetic re- construction of family 1 UDP-glycosyltransferases revealed the expansion of the family during the adaptation of plants to life on land", PLANT J., vol. 69, 2012, pages 1030 - 42
CAPUTI, L.MALNOY, M.GOREMYKIN, V.NIKIFOROVA, S.MARTENS, S.: "A genome-wide phylogenetic reconstruction of family 1 UDP-glycosyltransferases revealed the expansion of the family during the adaptation of plants to life on land", PLANT J, vol. 69, no. 6, 2011, pages 1030 - 1042
CARTER, J. P.SPINK, J.CANNON, P. F.DANIELS, M. J.OSBOURN, A. E.: "Isolation, characterization, and avenacin sensitivity of a diverse collection of cereal-root-colonizing fungi", APPL ENVIRON MICROBIOL, vol. 65, no. 8, 1999, pages 3364 - 3372
CHEN, H.-Y.LI, X.: "Identification of a residue responsible for UDP-sugar donor selectivity of a dihydrox- ybenzoic acid glycosyltransferase from Arabidopsis natural accessions", PLANT J., vol. 89, 2017, pages 195 - 203
CHEN, V. B.ARENDALL, W. B., 3RDHEADD, J. J.KEEDY, D. A.IMMORMINO, R. M.KAPRAL, G. J.MURRAY, L. W.RICHARDSON, J. S.RICHARDSON, D. C: "MolProbity: all-atom structure validation for macromolecular crystallography", ACTA CRYSTALLOGR D BIOL CRYSTALLOGR, vol. 66, 2010, pages 12 - 21
CROMBIE, L. M. W.CROMBIE, L.: "Distribution of avenacins A-1, A-2, B-1 and B-2 in oat roots: Their fungicidal activity towards 'take-all' fungus", PHYTOCHEMISTRY, vol. 25, no. 9, 1986, pages 2069 - 2073
CROMBIE, L.CROMBIE, W. M. L.WHITING, D. A.: "Isolation of avenacins A-1, A-2, B-1, and B-2 from oat roots: structures of their 'aglycones', the avenestergenins", J. CHEM. SOC. CHEM. COMMUN., vol. 4, 1984, pages 244 - 246
CROMBIE, L.CROMBIE, W. M. L.WHITING, D. A.: "Structures of the four avenacins, oat root resistance factors to 'take-all' disease", J. CHEM. SOC., CHEM. COMMUN., vol. 4, 1984, pages 246 - 248
CROMBIE, L.CROMBIE, W. M. L.WHITING, D. A.: "Structures of the oat root resistance factors to 'take-all' disease, avenancins A-1, A-2, B-1 and B-2 and their companion substances", J. CHEM. SOC. PERKIN TRANS., vol. 1, 1986, pages 1917 - 1922
CURTIS, M. D.GROSSNIKLAUS, U.: "A gateway cloning vector set for high-throughput functional analysis of genes in planta", PLANT PHYSIOL., vol. 133, no. 2, 2003, pages 462 - 469, XP055257706, DOI: doi:10.1104/pp.103.027979
DAI L ET AL.: "Functional characterization of cucurbitadienol synthase and triterpene glycosyltransferase involved in biosynthesis of mogrosides from Siraitia grosvenorii", PLANT CELL PHYSIOL., vol. 56, no. 6, 2015, pages 1172 - 1182
DAI, L.LIU, C.ZHU, Y.ZHANG, J.MEN, Y.ZENG, Y.SUN, Y.: "Functional characterization of cucurbitadienol synthase and triterpene glycosyltransferase involved in biosynthesis of mogrosides from Siraitia grosvenorii", PLANT CELL PHYSIOL, vol. 56, no. 6, 2015, pages 1172 - 1182
DASILVA, L. L. P.TAYLOR, J. P.HADLINGTON, J. L.HANTON, S. L.SNOWDEN, C. J.FOX, S. J.FORESTI, O.BRANDIZZI, F.DENECKE, J.: "Receptor salvage from the prevacuolar compartment is essential for e cient vacuolar protein targeting", PLANT CELL, vol. 17, 2005, pages 132 - 48
DATABASE UniProt [online] 23 May 2018 (2018-05-23), "RecName: Full=Glycosyltransferase {ECO:0000256|RuleBase:RU362057}; EC=2.4.1.- {ECO:0000256|RuleBase:RU362057};", XP002792629, retrieved from EBI accession no. UNIPROT:I1KZ41 Database accession no. I1KZ41 *
DE COSTA, F.BARBER, C. J. S.KIM, Y. B.REED, D. W.ZHANG, H.FETT-NETO, A. G.COVELLO, P. S.: "Molecular cloning of an ester-forming triterpenoid: UDP-glucose 28-O-glucosyltransferase involved in saponin biosynthesis from the medicinal plant Centella asiatica", PLANT SCI, vol. 262, 2017, pages 9 - 17
DEBOLT, S.SCHEIBLE, W. R.SCHRICK, K.AUER, M.BEISSON, F.BISCHOFF, V.BOUVIER-NAVE, P.CARROLL, A.HEMATY, K.LI, Y.: "Mutations in UDP-glucose:sterol glucosyltransferase in Arabidopsis cause transparent testa phenotype and suberization defect in seeds", PLANT PHYSIOL, vol. 151, no. 1, 2009, pages 78 - 87
DI, S.YAN, F.RODAS, F. R.RODRIGUEZ, T. O.MURAI, Y.IWASHINA, T.SUGAWARA, S.MORI, T.NAKABAYASHI, R.YONEKURA-SAKAKIBARA, K.: "Linkage mapping, molecular cloning and functional analysis of soybean gene Fg3 encoding flavonol 3-O-glucoside/galactoside (1 -> 2) glucosyltransferase", BMC PLANT BIOL., vol. 15, 2015, pages 126, XP021222518, DOI: doi:10.1186/s12870-015-0504-7
ELENA, CLAUDIA ET AL.: "Expression of codon optimized genes in microbial systems: current industrial applications and perspectives", FRONTIERS IN MICROBIOLOGY, vol. 5, 2014, XP002765948, DOI: doi:10.3389/fmicb.2014.00021
ENGLISH ET AL., THE PLANT CELL, vol. 8, 1996, pages 179 - 188
EUDES, A.BOZZO, G. G.WALLER, J. C.NAPONELLI, V.LIM, E.-K.BOWLES, D. J.GREGORY, J. F. R.HANSON, A. D.: "Metabolism of the folate precursor p-aminobenzoate in plants: glucose ester formation and vacuolar storage", J. BIOL. CHEM., vol. 283, 2008, pages 15451 - 9
FIRE A. ET AL., NATURE, vol. 391, 1998
FIRE, TRENDS GENET., vol. 15, 1999, pages 358 - 363
FLAVELL, PNAS USA, vol. 91, 1994, pages 3490 - 3496
FORD, C. M.BOSS, P. K.HOJ, P. B.: "Cloning and characterization of Vitis vinifera UDP-glucose:flavonoid 3-O-glucosyltransferase, a homologue of the enzyme encoded by the maize Bronze-1 locus that may primarily serve to glucosylate anthocyanidins in vivo", J. BIOL. CHEM., vol. 273, 1998, pages 9224 - 33, XP001183688, DOI: doi:10.1074/jbc.273.15.9224
FRANCIS, G.Z. KEREMH. P. MAKKARK. BECKER: "The biological action of saponins in animal systems: a review", BR J NUTR, vol. 88, no. 6, 2002, pages 587 - 605, XP008022748, DOI: doi:10.1079/BJN2002725
FRANKS, T. K.YADOLLAHI, A.WIRTHENSOHN, M. G.GUERIN, J. R.KAISER, B. N.SEDGLEY, M.FORD, C. M.: "A seed coat cyanohydrin glucosyltransferase is associated with bitterness in almond (Prunus dulcis) kernels", FUNCT. PLANT BIOL., vol. 35, no. 3, 2008, pages 236 - 246
FRIGERIO, L.DE VIRGILIO, M.PRADA, A.FAORO, F.VITALE, A.: "Sorting of phaseolin to the vacuole is saturable and requires a short C-terminal peptide", PLANT CELL, vol. 10, no. 6, 1998, pages 1031 - 1042
FRISCH, D. A.L. W. HARRIS-HALLER ET AL.: "Complete Sequence of the binary vector Bin 19", PLANT MOLECULAR BIOLOGY, vol. 27, 1995, pages 405 - 409, XP000654452, DOI: doi:10.1007/BF00020193
FRYDMAN, A.LIBERMAN, R.HUHMAN, D. V.CARMELI-WEISSBERG, M.SAPIR-MIR, M.OPHIR, R.SUMNER, L. W.EYAL, Y.: "The molecular and enzymatic basis of bitter/non-bitter flavor of citrus fruit: evolution of branch-forming rhamnosyl-transferases under domestication", PLANT JOURNAL, vol. 73, no. 1, 2013, pages 166 - 178
FRYDMAN, A.LIBERMAN, R.HUHMAN, D. V.CARMELI-WEISSBERG, M.SAPIR-MIR, M.OPHIR, R.W SUMNER, L.EYAL, Y.: "The molecular and enzymatic basis of bitter/non-bitter flavor of citrus fruit: evolution of branch- forming rhamnosyltransferases under domestication", PLANT J., vol. 73, 2013, pages 166 - 78
FUKUCHI-MIZUTANI, M.OKUHARA, H.FUKUI, Y.NAKAO, M.KATSUMOTO, Y.YONEKURA-SAKAKIBARA, K.KUSUMI, T.HASE, T.TANAKA, Y.: "Biochemical and molecular characterization of a novel UDP-glucose : anthocyanin 3 '-0-glucosyltransferase, a key enzyme for blue anthocyanin biosynthesis, from gentian", PLANT PHYSIOLOGY, vol. 132, no. 3, 2003, pages 1652 - 1663, XP002309423
GANDIA-HERRERO, F.LORENZ, A.LARSON, T.GRAHAM, I. A.BOWLES, D. J.RYLOTT, E. L.BRUCE, N. C.: "Detoxification of the explosive 2,4,6-trinitrotoluene in Arabidopsis: discovery of bifunctional O- and C- glucosyltransferases", PLANT J., vol. 56, 2008, pages 963 - 74
GARNEAU, J.E. ET AL., NATURE, vol. 468, 2010, pages 67 - 71
GEISLER, K.HUGHES, R. K.SAINSBURY, F.LOMONOSSOFF, G. P.REJZEK, M.FAIRHURST, S.OLSEN, C. E.MOTAWIA, M. S.MELTON, R. E.HEMMINGS, A. : "Biochemical analysis of a multifunctional cytochrome P450 (CYP51) enzyme required for synthesis of antimicrobial triterpenes in plants", PROC NATL ACAD SCI USA, vol. 110, no. 35, 2013, pages 3360 - 3367
GEISLER, K.HUGHES, R. K.SAINSBURY, F.LOMONOSSOFF, G. P.REJZEK, M.FAIRHURST, S.OLSEN, C.-E.MOTAWIA, M. S.MELTON, R. E.HEMMINGS, A. : "Biochemical analysis of a multifunctional cytochrome P450 (CYP51) enzyme required for synthesis of antimicrobial triterpenes in plants", PROC. NATL. ACAD. SCI. U.S.A., vol. 110, no. 35, 2013, pages E3360 - 7
GEISLER, K.R. K. HUGHESF. SAINSBURYG. P. LOMONOSSOFFM. REJZEKS. FAIRHURSTC. E. OLSENM. S. MOTAWIAR. E. MELTONA. M. HEMMINGS: "Biochemical analysis of a multifunctional cytochrome P450 (CYP51) enzyme required for synthesis of antimicrobial triterpenes in plants", PROC NATL ACAD SCI U S A, vol. 110, no. 35, 2013, pages 3360 - 3367
GRILLE, S.ZASLAWSKI, A.THIELE, S.PLAT, J.WARNECKE, D.: "The functions of steryl glycosides come to those who wait: Recent advances in plants, fungi, bacteria and animals", PROG LIPID RES, vol. 49, no. 3, 2010, pages 262 - 288, XP027050740
GROTEWOLD ET AL.: "Engineering Secondary Metabolites in Maize Cells by Ectopic Expression of Transcription Factors", PLANT CELL, vol. 10, 1998, pages 721 - 740, XP002145082, DOI: doi:10.1105/tpc.10.5.721
GUERINEAUMULLINEAUX: "Plant Molecular Biology Labfax", 1993, BIOS SCIENTIFIC PUBLISHERS, article "Plant transformation and expression vectors", pages: 121 - 148
HALDRUP ET AL., PLANT MOLECULAR BIOLOGY, vol. 37, 1998, pages 287 - 296
HAMMOND ET AL., NATURE REV. GENES, vol. 2, 2001, pages 1110 - 1119
HAN SHKIM BGYOON JACHONG YAHN JH: "Synthesis of flavonoid O-pentosides by Escherichia coli through engineering of nucleotide sugar pathways and glycosyltransferase", APPL. ENVIRON. MICROBIOL., vol. 80, no. 9, 2014, pages 2754 - 2762
HAN, J. Y.KIM, H. J.KWON, Y. S.CHOI, Y. E.: "The Cyt P450 enzyme CYP716A47 catalyzes the formation of protopanaxadiol from dammarenediol-II during ginsenoside biosynthesis in Panax ginseng", PLANT CELL PHYSIOL, vol. 52, no. 12, 2011, pages 2062 - 2073, XP055268027, DOI: doi:10.1093/pcp/pcr150
HAN, S. H.KIM, B. G.YOON, J. A.CHONG, Y.AHN, J. H.: "Synthesis of flavonoid O-pentosides by Escherichia coli through engineering of nucleotide sugar pathways and glycosyltransferase", APPL ENVIRON MICROBIOL, vol. 80, no. 9, 2014, pages 2754 - 2762
HANSEN, K. S.KRISTENSEN, C.TATTERSALL, D. B.JONES, P. R.OLSEN, C. E.BAK, S.MOLLER, B. L.: "The in vitro substrate regiospecificity of recombinant UGT85B1, the cyanohydrin glucosyltransferase from Sorghum bicolor", PHYTOCHEMISTRY, vol. 64, no. 1, 2003, pages 143 - 151, XP004448630, DOI: doi:10.1016/S0031-9422(03)00261-9
HARALAMPIDIS K ET AL.: "A new class of oxidosqualene cyclases directs synthesis of antimicrobial phytoprotectants in monocots", PROC NATL ACAD SCI U SA, vol. 98, no. 23, 2001, pages 13431 - 13436, XP002367435, DOI: doi:10.1073/pnas.231324698
HARALAMPIDIS, K.BRYAN, G.QI, X.PAPADOPOULOU, K.BAKHT, S.MELTON, R.OSBOURN, A.: "A new class of oxidosqualene cyclases directs synthesis of antimicrobial phytoprotectants in monocots", PROC NATL ACAD SCI USA, vol. 98, no. 23, 2001, pages 13431 - 13436, XP002367435, DOI: doi:10.1073/pnas.231324698
HARALAMPIDIS, K.BRYAN, G.QI, X.PAPADOPOULOU, K.BAKHT, S.MELTON, R.OSBOURN, A.: "A new class of oxidosqualene cyclases directs synthesis of antimicrobial phytoprotectants in monocots", PROC. NATL. ACAD. SCI. U.S.A., vol. 98, no. 23, 2001, pages 13431 - 13436, XP002367435, DOI: doi:10.1073/pnas.231324698
HARALAMPIDIS, K.G. BRYANX. QIK. PAPADOPOULOUS. BAKHTR. MELTONA. OSBOURN: "A new class of oxidosqualene cyclases directs synthesis of antimicrobial phytoprotectants in monocots", PROC NATL ACAD SCI U S A, vol. 98, no. 23, 2001, pages 13431 - 13436, XP002367435, DOI: doi:10.1073/pnas.231324698
HARTLEY, J. L.TEMPLE, G. F.BRASCH, M. A.: "DNA cloning using in vitro site-specific recombination", GENOME RES, vol. 10, no. 11, 2000, pages 1788 - 1795, XP002187669, DOI: doi:10.1101/gr.143000
HARTLEY, J. L.TEMPLE, G. F.BRASCH, M. A.: "DNA cloning using in vitro site-specific recombination", GENOME RES., vol. 10, no. 11, 2000, pages 1788 - 1795, XP002187669, DOI: doi:10.1101/gr.143000
HE XZWANG XDIXON RA: "Mutational analysis of the Medicago glycosyltransferase UGT71 G1 reveals residues that control regioselectivity for (iso)flavonoid glycosylation", J. BIOL. CHEM., vol. 281, no. 45, 2006, pages 34441 - 34447
HE, F.CHEN, W.-K.YU, K.-J.JI, X.-N.DUAN, C.-Q.REEVES, M. J.WANG, J.: "Molecular and biochemical characterization of the UDP-glucose: Anthocyanin 5-0-glucosyltransferase from Vitis amurensis", PHYTOCHEMISTRY, vol. 117, 2015, pages 363 - 72
HE, X. Z.WANG, X.DIXON, R. A.: "Mutational analysis of the Medicago glycosyltransferase UGT71 G1 reveals residues that control regioselectivity for (iso)flavonoid glycosylation", J BIOL CHEM, vol. 281, no. 45, 2006, pages 34441 - 34447, XP008077979, DOI: doi:10.1074/jbc.M605767200
HENG, L.VINCKEN, J.-P.VAN KONINGSVELD, G.LEGGER, A.GRUPPEN, H.VAN BOEKEL, T.ROOZEN, J.VORAGEN, F.: "Bitterness of saponins and their content in dry peas", J. SCI. FOOD AGRIC., vol. 86, no. 8, 2006, pages 1225 - 1231
HIRADE, Y.KOTOKU, N.TERASAKA, K.SAIJO-HAMANO, Y.FUKUMOTO, A.MIZUKAMI, H.: "Identification and functional analysis of 2-hydroxyflavanone C-glucosyltransferase in soybean (Glycine max)", FEBS LETT., vol. 589, 2015, pages 1778 - 86
HIROTANI, M.KURODA, R.SUZUKI, H.YOSHIKAWA, T.: "Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis", PLANTA, vol. 210, no. 6, 2000, pages 1006 - 1013, XP055234245, DOI: doi:10.1007/PL00008158
HOU, B.LIM, E. K.HIGGINS, G. S.BOWLES, D. J.: "N-glucosylation of cytokinins by glycosyltransferases of Arabidopsis thaliana", J BIOL CHEM, vol. 279, no. 46, 2004, pages 47822 - 47832, XP002320077, DOI: doi:10.1074/jbc.M409569200
HOU, B.LIM, E.-K.HIGGINS, G. S.BOWLES, D. J.: "N-glucosylation of cytokinins by glycosyltransferases of Arabidopsis thaliana", J. BIOL. CHEM., vol. 279, 2004, pages 47822 - 32, XP002320077, DOI: doi:10.1074/jbc.M409569200
HSU, Y.-H.TAGAMI, T.MATSUNAGA, K.OKUYAMA, M.SUZUKI, T.NODA, N.SUZUKI, M.SHIMURA, H.: "Func- tional characterization of UDP-rhamnose-dependent rhamnosyltransferase involved in anthocyanin modification, a key enzyme determining blue coloration in Lobelia erinus", PLANT J., vol. 89, 2017, pages 325 - 337
HUGHES, J.M. A. HUGHES: "Multiple secondary plant product UDP-glucose glucosyltransferase genes expressed in cassava (Manihot esculenta Crantz) cotyledons", DNA SEQ, vol. 5, no. 1, 1994, pages 41 - 49, XP002025913
HUSAR, S.BERTHILLER, F.FUJIOKA, S.ROZHON, W.KHAN, M.KALAIVANAN, F.ELIAS, L.HIGGINS, G. S.LI, Y.SCHUHMACHER, R.: "Overexpression of the UGT73C6 alters brassinosteroid glucoside formation in Arabidopsis thaliana", BMC PLANT BIOL, vol. 11, 2011, pages 51, XP021096444, DOI: doi:10.1186/1471-2229-11-51
IMAYAMA, T.YOSHIHARA, N.FUKUCHI-MIZUTANI, M.TANAKA, Y.INO, I.YABUYA, T.: "Isolation and characterization of a cDNA clone of UDP-glucose: anthocyanin 5-O-glucosyltransferase in Iris hollandica", PLANT SCIENCE, vol. 167, no. 6, 2004, pages 1243 - 1248, XP004572677, DOI: doi:10.1016/j.plantsci.2004.06.020
ITKIN, M.DAVIDOVICH-RIKANATI, R.COHEN, S.PORTNOY, V.DORON-FAIGENBOIM, A.OREN, E.FREILICH, S.TZURI, G.BARANES, N.SHEN, S.: "The biosynthetic pathway of the nonsugar, high-intensity sweetener mogroside V from Siraitia grosvenorii", PROC. NATL. ACAD. SCI. U.S.A., vol. 113, 2016, pages E7619 - E7628, XP055578320, DOI: doi:10.1073/pnas.1604828113
ITKIN, M.HEINIG, U.TZFADIA, O.BHIDE, A. J.SHINDE, B.CARDENAS, P. D.BOCOBZA, S. E.UNGER, T.MALITSKY, S.FINKERS, R.: "Biosynthesis of antinutritional alkaloids in solanaceous crops is mediated by clustered genes", SCIENCE, vol. 341, no. 6142, 2013, pages 175 - 179, XP002742821, DOI: doi:10.1126/science.1240230
ITKIN, M.ROGACHEV, I.ALKAN, N.ROSENBERG, T.MALITSKY, S.MASINI, L.MEIR, S.LIJIMA, Y.AOKI, K.DE VOS, R.: "GLYCOALKALOID METABOLISM1 is required for steroidal alkaloid glycosylation and prevention of phytotoxicity in tomato", PLANT CELL, vol. 23, no. 12, 2011, pages 4507 - 4525, XP055023663, DOI: doi:10.1105/tpc.111.088732
ITO, T.FUJIMOTO, S.SUITO, F.SHIMOSAKA, M.TAGUCHI, G.: "C-glycosyltransferases catalyzing the formation of di-C-glucosyl flavonoids in citrus plants", PLANT J., vol. 91, 2017, pages 187 - 198
JONES, P.MESSNER, B.NAKAJIMA, J.-I.SCHAFFNER, A. R.SAITO, K.: "UGT73C6 and UGT78D1, glycosyltrans-ferases involved in flavonol glycoside biosynthesis in Arabidopsis thaliana", J. BIOL. CHEM., vol. 278, 2003, pages 43910 - 8
JUGDE, H.NGUY, D.MOLLER, I.COONEY, J. M.ATKINSON, R. G.: "Isolation and characterization of a novel glycosyltransferase that converts phloretin to phlorizin, a potent antioxidant in apple", FEBS J., vol. 275, 2008, pages 3804 - 14, XP002609965, DOI: doi:10.1111/j.1742-4658.2008.06526.x
JUNG, S.-C.KIM, W.PARK, S. C.JEONG, J.PARK, M. K.LIM, S.LEE, Y.IM, W.-T.LEE, J. H.CHOI, G.: "Two ginseng UDP-glycosyltransferases synthesize ginsenoside Rg3 and Rd", PLANT CELL PHYSIOL., vol. 55, 2014, pages 2177 - 88, XP055246444, DOI: doi:10.1093/pcp/pcu147
KAMO, S.S. SUZUKIT. SATO: "The content of soyasaponin and soyasapogenol in soy foods and their estimated intake in the Japanese", FOOD SCI NUTR, vol. 2, no. 3, 2014, pages 289 - 297
KANNANGARA, R.MOTAWIA, M. S.HANSEN, N. K.PAQUETTE, S. M.OLSEN, C. E.MOLLER, B. L.JORGENSEN, K.: "Characterization and expression profile of two UDP-glucosyltransferases, UGT85K4 and UGT85K5, catalyzing the last step in cyanogenic glucoside biosynthesis in cassava", PLANT J, vol. 68, no. 2, 2011, pages 287 - 301
KARIMI, M.INZE, D.DEPICKER, A.: "Gateway vectors for Agrobacterium-mediated plant transformation", TRENDS PLANT SCI., vol. 7, no. 5, 2002, pages 193 - 195, XP002714178, DOI: doi:10.1016/S1360-1385(02)02251-3
KEMEN AC ET AL.: "Investigation of triterpene synthesis and regulation in oats reveals a role for beta-amyrin in determining root epidermal cell patterning", PROC NATL ACAD SCI USA, vol. 111, no. 23, 2014, pages 8679 - 8684
KEMEN, A. C.HONKANEN, S.MELTON, R. E.FINDLAY, K. C.MUGFORD, S. T.HAYASHI, K.HARALAMPIDIS, K.ROSSER, S. J.OSBOURN, A.: "Investigation of triterpene synthesis and regulation in oats reveals a role for beta-amyrin in determining root epidermal cell patterning", PROC NATL ACAD SCI U S A, vol. 111, no. 23, 2014, pages 8679 - 8684
KEMEN, A. C.HONKANEN, S.MELTON, R. E.FINDLAY, K. C.MUGFORD, S. T.HAYASHI, K.HARALAMPIDIS, K.ROSSER, S. J.OSBOURN, A.: "Investigation of triterpene synthesis and regulation in oats reveals a role for β-amyrin in determining root epidermal cell patterning", PROC. NATL. ACAD. SCI. U.S.A., vol. 111, 2014, pages 8679 - 84
KETUDAT CAIRNS, J. R.PENGTHAISONG, S.LUANG, S.SANSENYA, S.TANKRATHOK, A.SVASTI, J.: "Protein- carbohydrate interactions leading to hydrolysis and transglycosylation in plant glycoside hydrolase family 1 en- zymes", J. APPL. GLYCOSCI., vol. 59, no. 2, 2012, pages 51 - 62
KIM, J. H.KIM, B. G.PARK, Y.KO, J. H.LIM, C. E.LIM, J.LIM, Y.AHN, J. H.: "Characterization of flavonoid 7-O-glucosyltransferase from Arabidopsis thaliana", BIOSCI BIOTECHNOL BIOCHEM, vol. 70, no. 6, 2006, pages 1471 - 1477, XP055234241, DOI: doi:10.1271/bbb.60006
KIM, J. H.KIM, B. G.PARK, Y.KO, J. H.LIM, C. E.LIM, J.LIM, Y.AHN, J.-H.: "Characterization of flavonoid 7-O-glucosyltransferase from Arabidopsis thaliana", BIOSCI. BIOTECHNOL. BIOCHEM., vol. 70, 2006, pages 1471 - 7, XP055234241, DOI: doi:10.1271/bbb.60006
KITA, M.HIRATA, Y.MORIGUCHI, T.ENDO-INAGAKI, T.MATSUMOTO, R.HASEGAWA, S.SUHAYDA, C. G.OMURA, M.: "Molecular cloning and characterization of a novel gene encoding limonoid UDP-glucosyltransferase in Citrus", FEBS LETT., vol. 469, 2000, pages 173 - 8, XP004261071, DOI: doi:10.1016/S0014-5793(00)01275-8
KO, J. H.KIM, B. G.HUR, H. G.LIM, Y.AHN, J. H.: "Molecular cloning, expression and characterization of a glycosyltransferase from rice", PLANT CELL REP, vol. 25, no. 7, 2006, pages 741 - 746, XP019423743, DOI: doi:10.1007/s00299-006-0119-4
KO, J. H.KIM, B. G.KIM, J. H.KIM, H.LIM, C. E.LIM, J.LEE, C.LIM, Y.AHN, J. H.: "Four glucosyltransferases from rice: cDNA cloning, expression, and characterization", J PLANT PHYSIOL, vol. 165, no. 4, 2008, pages 435 - 444, XP022491956, DOI: doi:10.1016/j.jplph.2007.01.006
KO, J. H.KIM, B. G.KIM, J. H.KIM, H.LIM, C. E.LIM, J.LEE, C.LIM, Y.AHN, J.-H.: "Four glucosyl- transferases from rice: cDNA cloning, expression, and characterization", J. PLANT PHYSIOL., vol. 165, 2008, pages 435 - 44
KOSHLAND, D. E.: "Stereochemistry and the mechanism of enzymatic reactions", BIOL. REV., vol. 28, no. 4, 1953, pages 416 - 436
KRAMER, C. M.PRATA, R. T. N.WILLITS, M. G.DE LUCA, V.STEFFENS, J. C.GRASER, G.: "Cloning and regiospecificity studies of two flavonoid glucosyltransferases from Allium cepa", PHYTOCHEMISTRY, vol. 64, 2003, pages 1069 - 76, XP004463958, DOI: doi:10.1016/S0031-9422(03)00507-7
KUBO, A.ARAI, Y.NAGASHIMA, S.YOSHIKAWA, T.: "Alteration of sugar donor specificities of plant glycosyltransferases by a single point mutation", ARCH BIOCHEM BIOPHYS, vol. 429, no. 2, 2004, pages 198 - 203, XP004526682, DOI: doi:10.1016/j.abb.2004.06.021
KUMAR, S.STECHER, G.TAMURA, K.: "MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets", MOL. BIOL. EVOL., vol. 33, 2016, pages 1870 - 4
KUMAR, S.STECHER, G.TAMURA, K.: "MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets", MOLECULAR BIOLOGY AND EVOLUTION, vol. 33, no. 7, 2016, pages 1870 - 1874
LANOT, A.HODGE, D.JACKSON, R. G.GEORGE, G. L.ELIAS, L.LIM, E. K.VAISTIJ, F. E.BOWLES, D. J.: "The glucosyltransferase UGT72E2 is responsible for monolignol 4-O-glucoside production in Arabidopsis thaliana", PLANT J, vol. 48, no. 2, 2006, pages 286 - 295
LANOT, A.HODGE, D.JACKSON, R. G.GEORGE, G. L.ELIAS, L.LIM, E.-K.VAISTIJ, F. E.BOWLES, D. J.: "The glucosyltransferase UGT72E2 is responsible for monolignol 4-O-glucoside production in Arabidopsis thaliana", PLANT J., vol. 48, 2006, pages 286 - 95
LI YBALDAUF SLIM EKBOWLES DJ: "Phylogenetic analysis of the UDP-glycosyltransferase multigene family of Arabidopsis thaliana", J. BIOL. CHEM., vol. 276, no. 6, 2001, pages 4338 - 4343
LI, Y.BALDAUF, S.LIM, E. K.BOWLES, D. J.: "Phylogenetic analysis of the UDP-glycosyltransferase multigene family of Arabidopsis thaliana", J BIOL CHEM, vol. 276, no. 6, 2001, pages 4338 - 4343
LIM, C. E.CHOI, J. N.KIM, I. A.LEE, S. A.HWANG, Y.-S.LEE, C. H.LIM, J.: "Improved resistance to oxidative stress by a loss-of-function mutation in the Arabidopsis UGT71C1 gene", MOL. CELLS, vol. 25, 2008, pages 368 - 75
LIM, E.-K.ASHFORD, D. A.HOU, B.JACKSON, R. G.BOWLES, D. J.: "Arabidopsis glycosyltransferases as biocat- alysts in fermentation for regioselective synthesis of diverse quercetin glucosides", BIOTECHNOL. BIOENG., vol. 87, 2004, pages 623 - 31
LIU Z ET AL.: "Regulation, evolution, and functionality of flavonoids in cereal crops", BIOTECHNOL. LETT., vol. 35, no. 11, 2013, pages 1765 - 1780
LIU, Z.Y. LIUZ. PUJ. WANGY. ZHENGY. LIY. WEI: "Regulation, evolution, and functionality of flavonoids in cereal crops", BIOTECHNOL LETT, vol. 35, no. 11, 2013, pages 1765 - 1780
LUANG, S.CHO, J.-I.MAHONG, B.OPASSIRI, R.AKIYAMA, T.PHASAI, K.KOMVONGSA, J.SASAKI, N.HUA, Y.-I.MATSUBA, Y.: "Rice Os9BGlu31 is a transglucosidase with the capacity to equilibrate phenylpropanoid, flavonoid, and phytohormone glycoconjugates", J. BIOL. CHEM., vol. 288, no. 14, 2013, pages 10111 - 10123
LUNKENBEIN, S.BELLIDO, M.AHARONI, A.SALENTIJN, E. M. J.KALDENHOFF, R.COINER, H. A.MUNOZ-BLANCO, J.SCHWAB, W.: "Cinnamate metabolism in ripening fruit. Characterization of a UDP-glucose:cinnamate gluco- syltransferase from strawberry", PLANT PHYSIOL., vol. 140, 2006, pages 1047 - 58
MACKENZIE, P. I.I. S. OWENSB. BURCHELLK. W. BOCKA. BAIROCHA. BELANGERS. FOURNEL-GIGLEUXM. GREEND. W. HUMT. LYANAGI: "The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence", PHARMACOGENETICS, vol. 7, no. 4, 1997, pages 255 - 269, XP002113206
MARRAFFINI, L.A.SONTHEIMER, E.J., SCIENCE, vol. 322, 2008, pages 1843 - 1845
MARSHALLHODGSON, NATURE BIOTECHNOLOGY, vol. 16, 1998, pages 177 - 180
MARTIN, R. C.MOK, M. C.HABBEN, J. E.MOK, D. W.: "A maize cytokinin gene encoding an O- glucosyltransferase specific to cis-zeatin", PROC. NATL. ACAD. SCI. U.S.A., vol. 98, 2001, pages 5922 - 6, XP002194543, DOI: doi:10.1073/pnas.101128798
MARTIN, R. C.MOK, M. C.HABBEN, J. E.MOK, D. W.: "A maize cytokinin gene encoding an O-glucosyltransferase specific to cis-zeatin", PROC NATL ACAD SCI USA, vol. 98, no. 10, 2001, pages 5922 - 5926, XP002194543, DOI: doi:10.1073/pnas.101128798
MASADA, S.TERASAKA, K.OGUCHI, Y.OKAZAKI, S.MIZUSHIMA, T.MIZUKAMI, H.: "Functional and structural characterization of a flavonoid glucoside 1,6-glucosyltransferase from Catharanthus roseus", PLANT CELL PHYSIOL., vol. 50, 2009, pages 1401 - 15
MATO, M.OZEKI, Y.ITOH, Y.HIGETA, D.YOSHITAMA, K.TERAMOTO, S.AIDA, R.ISHIKURA, N.SHIBATA, M.: "Isolation and characterization of a cDNA clone of UDP-galactose: flavonoid 3-O-galactosyltransferase (UF3GaT) expressed in Vigna mungo seedlings", PLANT CELL PHYSIOL., vol. 39, 1998, pages 1145 - 55
MATSUBA, Y.SASAKI, N.TERA, M.OKAMURA, M.ABE, Y.OKAMOTO, E.NAKAMURA, H.FUNABASHI, H.TAKATSU, M.SAITO, M.: "A novel glucosylation reaction on anthocyanins catalyzed by acyl-glucose-dependent glucosyltransferase in the petals of carnation and delphinium", PLANT CELL, vol. 22, no. 10, 2010, pages 3374 - 3389, XP055080765, DOI: doi:10.1105/tpc.110.077487
MCCUE, K. F.ALLEN, P. V.SHEPHERD, L. V. T.BLAKE, A.MACCREE, M. M.ROCKHOLD, D. R.NOVY, R. G.STEWART, D.DAVIES, H. V.BELKNAP, W. R.: "Potato glycosterol rhamnosyltransferase, the terminal step in triose side-chain biosynthesis", PHYTOCHEMISTRY, vol. 68, 2007, pages 327 - 34, XP005836304, DOI: doi:10.1016/j.phytochem.2006.10.025
MEESAPYODSUK DBALSEVICH JREED DWCOVELLO PS: "Saponin biosynthesis in Saponaria vaccaria. cDNAs encoding beta-amyrin synthase and a triterpene carboxylic acid glucosyltransferase", PLANT PHYSIOL., vol. 143, no. 2, 2007, pages 959 - 969, XP055559076, DOI: doi:10.1104/pp.106.088484
MEESAPYODSUK, D.BALSEVICH, J.REED, D. W.COVELLO, P. S.: "Saponin biosynthesis in Saponaria vaccaria. cDNAs encoding b-amyrin synthase and a triterpene carboxylic acid glucosyltransferase", PLANT PHYSIOL., vol. 143, 2007, pages 959 - 69, XP055559076, DOI: doi:10.1104/pp.106.088484
MEESAPYODSUK, D.BALSEVICH, J.REED, D. W.COVELLO, P. S.: "Saponin biosynthesis in Saponaria vaccaria. cDNAs encoding beta-amyrin synthase and a triterpene carboxylic acid glucosyltransferase", PLANT PHYSIOL, vol. 143, no. 2, 2007, pages 959 - 969, XP055559076, DOI: doi:10.1104/pp.106.088484
MEISSNER, D.ALBERT, A.BOTTCHER, C.STRACK, D.MILKOWSKI, C.: "The role of UDP-glucose:hydroxycinnamate glucosyltransferases in phenylpropanoid metabolism and the response to UV-B radiation in Arabidopsis thaliana", PLANTA, vol. 228, no. 4, 2008, pages 663 - 674, XP019630365
MESSNER, B.THULKE, O.SCHAFFNER, A. R.: "Arabidopsis glucosyltransferases with activities toward both endogenous and xenobiotic substrates", PLANTA, vol. 217, no. 1, 2003, pages 138 - 146, XP001180743
MICHLMAYR, H.MALACHOVA, A.VARGA, E.KLEINOVA, J.LEMMENS, M.NEWMISTER, S.RAYMENT, I.BERTHILLER, F.ADAM, G.: "Biochemical characterization of a recombinant UDP-glucosyltransferase from rice and enzymatic production of deoxynivalenol-3-O-b-d-glucoside", TOXINS, vol. 7, 2015, pages 2685 - 700
MILKOWSKI, C.BAUMERT, A.STRACK, D.: "Identification of four Arabidopsis genes encoding hydroxycinna- mate glucosyltransferases", FEBS LETT., vol. 486, 2000, pages 183 - 4
MITTASCH, J.MIKOLAJEWSKI, S.BREUER, F.STRACK, D.MILKOWSKI, C.: "Genomic microstructure and dif- ferential expression of the genes encoding UDP-glucose:sinapate glucosyltransferase (UGT84A9) in oilseed rape (Brassica napus)", THEOR. APPL. GENET., vol. 120, 2010, pages 1485 - 500
MIYAHARA, T.TAKAHASHI, M.OZEKI, Y.SASAKI, N.: "Isolation of an acyl-glucose-dependent anthocyanin 7-O-glucosyltransferase from the monocot Agapanthus africanus", J. PLANT PHYSIOL., vol. 169, no. 13, 2012, pages 1321 - 1326
MIYAHARA, T.TANI, T.TAKAHASHI, M.NISHIZAKI, Y.OZEKI, Y.SASAKI, N.: "Isolation of anthocyanin 7-0- glucosyltransferase from canterbury bells (Campanula medium)", PLANT BIOTECHNOLOGY, vol. 31, no. 5, 2014, pages 555 - 559
MODOLO, L. V.LI, L.PAN, H.BLOUNT, J. W.DIXON, R. A.WANG, X.: "Crystal structures of glycosyltransferase UGT78G1 reveal the molecular basis for glycosylation and deglycosylation of (iso)flavonoids", J MOL BIOL, vol. 392, no. 5, 2009, pages 1292 - 1302, XP026603415, DOI: doi:10.1016/j.jmb.2009.08.017
MOEHS, C. P.ALLEN, P. V.FRIEDMAN, M.BELKNAP, W. R.: "Cloning and expression of solanidine UDP-glucose glucosyltransferase from potato", PLANT J, vol. 11, no. 2, 1997, pages 227 - 236, XP002910721, DOI: doi:10.1046/j.1365-313X.1997.11020227.x
MOELLERING, E. R.MUTHAN, B.BENNING, C.: "Freezing tolerance in plants requires lipid remodeling at the outer chloroplast membrane", SCIENCE, vol. 330, no. 6001, 2010, pages 226 - 228
MOGLIA, A.LANTERI, S.COMINO, C.HILL, L.KNEVITT, D.CAGLIERO, C.RUBIOLO, P.BORNEMANN, S.MARTIN, C.: "Dual catalytic activity of hydroxycinnamoyl-coenzyme A quinate transferase from tomato allows it to moonlight in the synthesis of both mono- and dicaffeoylquinic acids", PLANT PHYSIOL., vol. 166, no. 4, 2014, pages 1777 - 1787, XP002744831, DOI: doi:10.1104/pp.114.251371
MORAGA, A. R.MOZOS, A. T.AHRAZEM, O.GOMEZ-GOMEZ, L.: "Cloning and characterization of a glucosyl- transferase from Crocus sativus stigmas involved in flavonoid glucosylation", BMC PLANT BIOL., vol. 9, 2009, pages 109
MORITA, Y.HOSHINO, A.KIKUCHI, Y.OKUHARA, H.ONO, E.TANAKA, Y.FUKUI, Y.SAITO, N.NITASAKA, E.NOGUCHI, H.: "Japanese morning glory dusky mutants displaying reddish-brown or purplish-gray flowers are deficient in a novel glycosylation enzyme for anthocyanin biosynthesis, UDP-glucose:anthocyanidin 3-0-glucoside-2''-0-glucosyltransferase, due to 4-bp insertions in the gene", PLANT J, vol. 42, no. 3, 2005, pages 353 - 363, XP002479039, DOI: doi:10.1111/j.1365-313X.2005.02383.x
MORITA, Y.HOSHINO, A.KIKUCHI, Y.OKUHARA, H.ONO, E.TANAKA, Y.FUKUI, Y.SAITO, N.NITASAKA, E.NOGUCHI, H.: "morning glory dusky mutants displaying reddish-brown or purplish-gray flow- ers are deficient in a novel glycosylation enzyme for anthocyanin biosynthesis, UDP-glucose:anthocyanidin 3-0- glucoside-2''-O-glucosyltransferase, due to 4-bp insertions in the gene", PLANT J., vol. 42, 2005, pages 353 - 63
MOSES, T.PAPADOPOULOU, K. K.OSBOURN, A.: "Metabolic and functional diversity of saponins, biosynthetic intermediates and semi-synthetic derivatives", CRIT. REV. BIOCHEM. MOL. BIOL., vol. 49, 2014, pages 439 - 62, XP055560155, DOI: doi:10.3109/10409238.2014.953628
MUGFORD, S. T.LOUVEAU, T.MELTON, R.QI, X.BAKHT, S.HILL, L.TSURUSHIMA, T.HONKANEN, S.ROSSER, S. J.LOMONOS- SOFF, G. P.: "Modularity of plant metabolic gene clusters: a trio of linked genes that are collectively required for acylation of triterpenes in oat", PLANT CELL, vol. 25, no. 3, 2013, pages 1078 - 1092
MUGFORD, S. T.LOUVEAU, T.MELTON, R.QI, X.BAKHT, S.HILL, L.TSURUSHIMA, T.HONKANEN, S.ROSSER, S. J.LOMONOSSOFF, G. P.: "Modularity of plant metabolic gene clusters: A trio of linked genes that are collectively required for acylation of triterpenes in oat", PLANT CELL, vol. 25, no. 3, 2013, pages 1078 - 1092
MUGFORD, S. T.QI, X.BAKHT, S.HILL, L.WEGEL, E.HUGHES, R. K.PAPADOPOULOU, K.MELTON, R.PHILO, M.SAINS- BURY, F.: "A serine carboxypeptidase-like acyltransferase is required for synthesis of antimicrobial compounds and disease resistance in oats", PLANT CELL, vol. 21, no. 8, 2009, pages 2473 - 2484
MYLONA, P.OWATWORAKIT, A.PAPADOPOULOU, K.JENNER, H.QIN, B.FINDLAY, K.HILL, L.QI, X.BAKHT, S.MELTON, R.: "Sad3 and Sad4 are required for saponin biosynthesis and root development in oat", PLANT CELL, vol. 20, no. 1, 2008, pages 201 - 212
NAGASHIMA, S.INAGAKI, R.KUBO, A.HIROTANI, M.YOSHIKAWA, T.: "cDNA cloning and expression of isoflavonoid-specific glucosyltransferase from Glycyrrhiza echinata cell-suspension cultures", PLANTA, vol. 218, no. 3, 2004, pages 456 - 459, XP008077944, DOI: doi:10.1007/s00425-003-1118-0
NAGATOSHI, M.TERASAKA, K.NAGATSU, A.MIZUKAMI, H.: "Iridoid-specific glucosyltransferase from Gardenia jasminoides", J BIOL CHEM, vol. 286, no. 37, 2011, pages 32866 - 32874, XP055159543, DOI: doi:10.1074/jbc.M111.242586
NAGATOSHI, M.TERASAKA, K.OWAKI, M.SOTA, M.INUKAI, T.NAGATSU, A.MIZUKAMI, H.: "UGT75L6 and UGT94E5 mediate sequential glucosylation of crocetin to crocin in Gardenia jasminoides", FEBS LETT., vol. 586, 2012, pages 1055 - 61, XP055190430, DOI: doi:10.1016/j.febslet.2012.03.003
NAKATSUKA, T.NISHIHARA, M.: "UDP-glucose:3-deoxyanthocyanidin 5-0-glucosyltransferase from Sinningia cardinalis", PLANTA, vol. 232, 2010, pages 383 - 92, XP019848674
NAOUMKINA, M. A.MODOLO, L. V.HUHMAN, D. V.URBANCZYK-WOCHNIAK, E.TANG, Y.SUMNER, L. W.DIXON, R. A.: "Genomic and coexpression analyses predict multiple genes involved in triterpene saponin biosynthesis in Medicago truncatula", PLANT CELL, vol. 22, no. 3, 2010, pages 850 - 866, XP055023717, DOI: doi:10.1105/tpc.109.073270
NELSON, B. K.CAI, X.NEBENFUHR, A.: "A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants", PLANT J., vol. 51, no. 6, 2007, pages 1126 - 1136
NISHIZAKI, Y.YASUNAGA, M.OKAMOTO, E.OKAMOTO, M.HIROSE, Y.YAMAGUCHI, M.OZEKI, Y.SASAKI, N.: "p-hydroxybenzoyl-glucose is a zwitter donor for the biosynthesis of 7-polyacylated anthocyanin in Delphinium", PLANT CELL, vol. 25, no. 10, 2013, pages 4150 - 4165
NOGUCHI, A.FUKUI, Y.LUCHI-OKADA, A.KAKUTANI, S.SATAKE, H.IWASHITA, T.NAKAO, M.UMEZAWA, T.ONO, E.: "Sequential glucosylation of a furofuran lignan, (+)-sesaminol, by Sesamum indicum UGT71A9 and UGT94D1 glucosyltransferases", PLANT J., vol. 54, 2008, pages 415 - 27, XP002683609, DOI: doi:10.1111/J.1365-313X.2008.03428.X
NOGUCHI, A.HORIKAWA, M.FUKUI, Y.FUKUCHI-MIZUTANI, M.LUCHI-OKADA, AISHIGURO, M.KISO, Y.NAKAYAMA, T.ONO, E.: "Local differentiation of sugar donor specificity of flavonoid glycosyltransferase in Lamiales", PLANT CELL, vol. 21, no. 5, 2009, pages 1556 - 1572, XP055080762, DOI: doi:10.1105/tpc.108.063826
NOGUCHI, A.SAITO, A.HOMMA, Y.NAKAO, M.SASAKI, N.NISHINO, T.TAKAHASHI, S.NAKAYAMA, T.: "A UDP-glucose:isoflavone 7-O-glucosyltransferase from the roots of soybean (Glycine max) seedlings. Purification, gene cloning, phylogenetics, and an implication for an alternative strategy of enzyme catalysis", J BIOL CHEM, vol. 282, no. 32, 2007, pages 23581 - 23590
NOGUCHI, A.SASAKIB, N.NAKAOA, M.FUKAMIA, H.TAKAHASHIB, S.NISHINOB, T.NAKAYAMAB, T.: "cDNA cloning of glycosyltransferases from Chinese wolfberry (Lycium barbarum L.) fruits and enzymatic synthesis of a catechin glucoside using a recombinant enzyme (UGT73A10", JOURNAL OF MOLECULAR CATALYSIS B: ENZYMATIC, vol. 55, no. 1-2, 2008, pages 84 - 92, XP023316739, DOI: doi:10.1016/j.molcatb.2008.02.001
OGATA, J.KANNO, Y.ITOH, Y.TSUGAWA, H.SUZUKI, M.: "Plant biochemistry: anthocyanin biosynthesis in roses", NATURE, vol. 435, 2005, pages 757 - 8, XP002587221
O'MAILLE, P. E.MALONE, A.DELLAS, N.ANDES HESS, B. J.SMENTEK, L.SHEEHAN, I.GREENHAGEN, B. T.CHAPPELL, J.MANNING, G.NOEL, J. P.: "Quantitative exploration of the catalytic landscape separating divergent plant sesquiterpene synthases", NATURE CHEMICAL BIOLOGY, vol. 4, 2008, pages 617 - 23, XP055087627, DOI: doi:10.1038/nchembio.113
O'MAILLE, P. E.MALONE, A.DELLAS, N.ANDES HESS, B., JR.SMENTEK, L.SHEEHAN, I.GREENHAGEN, B. T.CHAPPELL, J.MANNING, G.NOEL, J. P.: "Quantitative exploration of the catalytic landscape separating divergent plant sesquiterpene synthases", NAT CHEM BIOL, vol. 4, no. 10, 2008, pages 617 - 623, XP055087627, DOI: doi:10.1038/nchembio.113
ONO, E.FUKUCHI-MIZUTANI, M.NAKAMURA, N.FUKUI, Y.YONEKURA-SAKAKIBARA, K.YAMAGUCHI, M.NAKAYAMA, T.TANAKA, T.KUSUMI, T.TANAKA, Y.: "Yellow flowers generated by expression of the aurone biosynthetic pathway", PROC. NATL. ACAD. SCI. U.S.A., vol. 103, 2006, pages 11075 - 80, XP002411051, DOI: doi:10.1073/pnas.0604246103
ONO, E.RUIKE, M.IWASHITA, T.NOMOTO, K.FUKUI, Y.: "Co-pigmentation and flavonoid glycosyltrans- ferases in blue Veronica persica flowers", PHYTOCHEMISTRY, vol. 71, 2010, pages 726 - 35
OOSTENBRINK, C.VILLA, A.MARK, A. E.VAN GUNSTEREN, W. F.: "A biomolecular force field based on the free enthalpy of hydration and solvation: the GROMOS force-field parameter sets 53A5 and 53A6", J COMPUT CHEM, vol. 25, no. 13, 2004, pages 1656 - 1676
OPASSIRI, R.POMTHONG, B.ONKOKSOONG, T.AKIYAMA, T.ESEN, A.KETUDAT CAIRNS, J. R.: "Analysis of rice glycosyl hydrolase family 1 and expression of Os4bglu12 beta-glucosidase", BMC PLANT BIOL., vol. 6, 2006, pages 33, XP021022659, DOI: doi:10.1186/1471-2229-6-33
OSBOURN A: "Saponins and plant defence - a soap story", TRENDS PLANT SCI., vol. 1, no. 1, 1996, pages 4 - 9, XP004792950, DOI: doi:10.1016/S1360-1385(96)80016-1
OSBOURN, A.: "Saponins and plant defence - a soap story", TRENDS IN PLANT SCIENCE, vol. 1, no. 1, 1996, pages 4 - 9, XP004792950, DOI: doi:10.1016/S1360-1385(96)80016-1
OSBOURN, A.BOWYER, P.LUNNESS, P.CLARKE, B.DANIELS, M.: "Fungal pathogens of oat roots and tomato leaves employ closely related enzymes to detoxify different host plant saponins", MOL PLANT MICROBE INTERACT, vol. 8, no. 6, 1995, pages 971 - 978
OSBOURN, A.CLARKE, B.DOW, J.DANIELS, M.: "Partial characterization of avenacinase from Gaeumanno- myces graminis var. avenae", PHYSIOL. MOL. PLANT PATHOL., vol. 38, no. 4, 1991, pages 301 - 312
OSBOURN, A.CLARKE, B.LUNNESS, P.SCOTT, P.DANIELS, M.: "An oat species lacking avenacin is susceptible to infection by Gaeumannomyces graminis var. tritici", PHYSIOL. MOL. PLANT PATHOL., vol. 45, no. 6, 1994, pages 457 - 467
OSBOURN, A.GOSS, R. J. M.FIELD, R. A.: "The saponins: polar isoprenoids with important and diverse biological activities", NAT. PROD. REP., vol. 28, 2011, pages 1261 - 8
OSBOURN, A.R. J. GOSSR. A. FIELD: "The saponins: polar isoprenoids with important and diverse biological activities", NAT PROD REP, vol. 28, no. 7, 2011, pages 1261 - 1268
OSMANI SABAK SIMBERTY AOLSEN CEMOLLER BL: "Catalytic key amino acids and UDP-sugar donor specificity of a plant glucuronosyltransferase, UGT94B1: molecular modeling substantiated by site-specific mutagenesis and biochemical analyses", PLANT PHYSIOL., vol. 148, no. 3, 2008, pages 1295 - 1308, XP055264432
OSMANI, S. A.S. BAKA. IMBERTYC. E. OLSENB. L. MOLLER: "Catalytic key amino acids and UDP-sugar donor specificity of a plant glucuronosyltransferase, UGT94B1: molecular modeling substantiated by site-specific mutagenesis and biochemical analyses", PLANT PHYSIOL, vol. 148, no. 3, 2008, pages 1295 - 1308, XP055264432
OSMANI, S. A.S. BAKB. L. MOLLER: "Substrate specificity of plant UDP-dependent glycosyltransferases predicted from crystal structures and homology modeling", PHYTOCHEMISTRY, vol. 70, no. 3, 2009, pages 325 - 347, XP026013453, DOI: doi:10.1016/j.phytochem.2008.12.009
OWATWORAKIT A ET AL.: "Glycosyltransferases from oat (Avena) implicated in the acylation of avenacins", J. BIOL. CHEM., vol. 288, no. 6, 2012, pages 3696 - 3704
OWATWORAKIT, A.TOWNSEND, B.LOUVEAU, T.JENNER, H.REJZEK, M.HUGHES, R. K.SAALBACH, G.QI, X.BAKHT, S.DEB ROY, A.: "Glycosyltransferases from oat (Avena) implicated in the acylation of avenacins", J BIOL CHEM, vol. 288, no. 6, 2012, pages 3696 - 3704
OWATWORAKIT, A.TOWNSEND, B.LOUVEAU, T.JENNER, H.REJZEK, M.HUGHES, R. K.SAALBACH, G.QI, X.BAKHT, S.ROY, A. D.: "Glycosyltransferases from oat (Avena) implicated in the acylation of avenacins", J. BIOL. CHEM., vol. 288, no. 6, 2013, pages 3696 - 3704
PANG, Y.PEEL, G. J.SHARMA, S. B.TANG, Y.DIXON, R. A.: "A transcript profiling approach reveals an epicatechin-specific glucosyltransferase expressed in the seed coat of Medicago truncatula", PROC. NATL. ACAD. SCI. U.S.A., vol. 105, 2008, pages 14210 - 5, XP009127069, DOI: doi:10.1073/pnas.0805954105
PAPADOPOULOU KMELTON RELEGGETT MDANIELS MJOSBOURN AE: "Compromised disease resistance in saponin-deficient plants", PROC NATL ACAD SCI USA, vol. 96, no. 22, 1999, pages 12923 - 12928, XP002170237, DOI: doi:10.1073/pnas.96.22.12923
PAPADOPOULOU, K.MELTON, R. E.LEGGETT, M.DANIELS, M. J.OSBOURN, A. E.: "Compromised disease resistance in saponin-deficient plants", PROC NATL ACAD SCI U S A, vol. 96, no. 22, 1999, pages 12923 - 12928, XP002170237, DOI: doi:10.1073/pnas.96.22.12923
PAPADOPOULOU, K.MELTON, R. E.LEGGETT, M.DANIELS, M. J.OSBOURN, A. E.: "Compromised disease resistance in saponin-deficient plants", PROC. NATL. ACAD. SCI. U.S.A., vol. 96, no. 22, 1999, pages 12923 - 12928, XP002170237, DOI: doi:10.1073/pnas.96.22.12923
PEREIRA, C.PEREIRA, S.SATIAT-JEUNEMAITRE, B.PISSARRA, J.: "Cardosin A contains two vacuolar sorting signals using different vacuolar routes in tobacco epidermal cells", PLANT J., vol. 76, 2013, pages 87 - 100
PETTERSEN, E. F.GODDARD, T. D.HUANG, C. C.COUCH, G. S.GREENBLATT, D. M.MENG, E. C.FERRIN, T. E.: "UCSF Chimera--a visualization system for exploratory research and analysis", J COMPUT CHEM, vol. 25, no. 13, 2004, pages 1605 - 1612
PIOCHON, M.J. LEGAULTC. GAUTHIERA. PICHETTE: "Synthesis and cytotoxicity evaluation of natural alpha-bisabolol beta-D-fucopyranoside and analogues", PHYTOCHEMISTRY, vol. 70, no. 2, 2009, pages 228 - 236
POLLIER, J.MORREEL, K.GEELEN, D.GOOSSENS, A.: "Metabolite profiling of triterpene saponins in Medicago truncatula hairy roots by liquid chromatography Fourier transform ion cyclotron resonance mass spectrometry", J NAT PROD, vol. 74, no. 6, 2011, pages 1462 - 1476
POPPENBERGER, B.FUJIOKA, S.SOENO, K.GEORGE, G. L.VAISTIJ, F. E.HIRANUMA, S.SETO, H.TAKATSUTO, S.ADAM, G.YOSHIDA, S.: "The UGT73C5 of Arabidopsis thaliana glucosylates brassinosteroids", PROC NATL ACAD SCI USA, vol. 102, no. 42, 2005, pages 15253 - 15258
PRIEST, D. M.AMBROSE, S. J.VAISTIJ, F. E.ELIAS, L.HIGGINS, G. S.ROSS, A. R. S.ABRAMS, S. R.BOWLES, D. J.: "Use of the glucosyltransferase UGT71 B6 to disturb abscisic acid homeostasis in Arabidopsis thaliana", PLANT J., vol. 46, 2006, pages 492 - 502, XP002475566
PRIEST, D. M.JACKSON, R. G.ASHFORD, D. A.ABRAMS, S. R.BOWLES, D. J.: "The use of abscisic acid analogues to analyse the substrate selectivity of UGT71 B6, a UDP-glycosyltransferase of Arabidopsis thaliana", FEBS LETT, vol. 579, no. 20, 2005, pages 4454 - 4458
QI, X.BAKHT, S.LEGGETT, M.MAXWELL, C.MELTON, R.OSBOURN, A.: "A gene cluster for secondary metabolism in oat: implications for the evolution of metabolic diversity in plants", PROC NATL ACAD SCI USA, vol. 101, no. 21, 2004, pages 8233 - 8238, XP002367434, DOI: doi:10.1073/pnas.0401301101
QI, X.BAKHT, S.QIN, B.LEGGETT, M.HEMMINGS, A.MELLON, F.EAGLES, J.WERCK-REICHHART, D.SCHALLER, H.LESOT, A.: "A different function for a member of an ancient and highly conserved cytochrome P450 family: from essential sterols to plant defense", PROC NATL ACAD SCI USA, vol. 103, no. 49, 2006, pages 18848 - 18853, XP002535336, DOI: doi:10.1073/PNAS.0607849103
QI, X.BAKHT, S.QIN, B.LEGGETT, M.HEMMINGS, A.MELLON, F.EAGLES, J.WERCK-REICHHART, D.SCHALLER, H.LESOT, A.: "A different function for a member of an ancient and highly conserved cytochrome P450 family: From essential sterols to plant defense", PROC. NATL. ACAD. SCI. U.S.A., vol. 103, no. 49, 2006, pages 18848 - 18853, XP002535336, DOI: doi:10.1073/PNAS.0607849103
QIN, B.EAGLES, J.MELLON, F. A.MYLONA, P.PENA-RODRIGUEZ, L.OSBOURN, A. E.: "High throughput screening of mutants of oat that are defective in triterpene synthesis", PHYTOCHEMISTRY, vol. 71, no. 11-12, 2010, pages 1245 - 1252, XP027114107
REED, J.STEPHENSON, M. J.MIETTINEN, K.BROUWER, B.LEVEAU, A.BRETT, P.GOSS, R. J. M.GOOSSENS, A.O'CONNELL, M. A.OSBOURN, A.: "A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules", METAB ENG, vol. 42, 2017, pages 185 - 193, XP085136198, DOI: doi:10.1016/j.ymben.2017.06.012
REED, J.STEPHENSON, M. J.MIETTINEN, K.BROUWER, B.LEVEAU, A.BRETT, P.GOSS, R. J. M.GOOSSENS, A.O'CONNELL, M. A.OSBOURN, A.: "A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules", METAB. ENG., vol. 42, 2017, pages 185 - 193, XP085136198, DOI: doi:10.1016/j.ymben.2017.06.012
REHMAN, H. M.M. A. NAWAZZ. H. SHAHS. H. YANGG. CHUNG: "Functional characterization of naturally occurring wild soybean mutant (sg-5) lacking astringent saponins using whole genome sequencing approach", PLANT SCI, vol. 267, 2018, pages 148 - 156
REUBEN, S.L. J. CSEKEV. S. BHINUK. NARASIMHANM. JEYAKUMARS. SWARUP ET AL.: "Natural products from plants", 2006, CRC PRESS/TAYLOR & FRANCIS, article "Molecular biology of plant natural products", pages: 611 - 202
RICHMAN, A.SWANSON, A.HUMPHREY, T.CHAPMAN, R.MCGARVEY, B.POCS, R.BRANDLE, J.: "Functional genomics uncovers three glucosyltransferases involved in the synthesis of the major sweet glucosides of Stevia rebaudiana", PLANT J., vol. 41, 2005, pages 56 - 67, XP002686584, DOI: doi:10.1111/J.1365-313X.2004.02275.X
ROJAS RODAS, F.DI, S.MURAI, Y.IWASHINA, T.SUGAWARA, S.MORI, T.NAKABAYASHI, R.YONEKURA-SAKAKIBARA, K.SAITO, K.TAKAHASHI, R.: "Cloning and characterization of soybean gene Fg1 encoding flavonol 3-0- glucoside/galactoside (1->6) glucosyltransferase", PLANT MOL. BIOL., vol. 92, 2016, pages 445 - 456
ROJAS RODAS, F.RODRIGUEZ, T. O.MURAI, Y.IWASHINA, T.SUGAWARA, S.SUZUKI, M.NAKABAYASHI, R.YONEKURA- SAKAKIBARA, K.SAITO, K.KITAJIMA: "Linkage mapping, molecular cloning and functional analysis of soybean gene Fg2 encoding flavonol 3-O-glucoside (1 -> 6) rhamnosyltransferase", PLANT MOL. BIOL., vol. 84, 2014, pages 287 - 300
ROSS, J.LI, Y.LIM, E.BOWLES, D. J.: "Higher plant glycosyltransferases", GENOME BIOL, vol. 2, no. 2, 2001, pages 3004
ROSS, J.LI, Y.LIM, E.BOWLES, D. J.: "Higher plant glycosyltransferases", GENOME BIOL., vol. 2, 2001, pages 3004
SAINSBURY, F.SAXENA, P.GEISLER, K.OSBOURN, A.LOMONOSSOFF, G. P.: "Using a virus-derived system to manipulate plant natural product biosynthetic pathways", METHODS ENZYMOL., vol. 517, 2012, pages 185 - 202
SAINSBURY, F.THUENEMANN, E. C.LOMONOSSOFF, G. P.: "pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants", PLANT BIOTECHNOL J, vol. 7, no. 7, 2009, pages 682 - 693
SAITOU, N.NEI, M.: "The neighbor-joining method: a new method for reconstructing phylogenetic trees", MOL BIOL EVOL, vol. 4, no. 4, 1987, pages 406 - 425, XP001154601
SAITOU, N.NEI, M.: "The neighbor-joining method: a new method for reconstructing phylogenetic trees", MOL. BIOL. EVOL., vol. 4, 1987, pages 406 - 25, XP001154601
SALI ABLUNDELL TL: "Comparative protein modelling by satisfaction of spatial restraints", J. MOL. BIOL., vol. 234, no. 3, 1993, pages 779 - 815, XP024008717, DOI: doi:10.1006/jmbi.1993.1626
SALI, A.BLUNDELL, T. L.: "Comparative protein modelling by satisfaction of spatial restraints", J MOL BIOL, vol. 234, no. 3, 1993, pages 779 - 815, XP024008717, DOI: doi:10.1006/jmbi.1993.1626
SALMON, M.THIMMAPPA, R. B.MINTO, R. E.MELTON, R. E.HUGHES, R. K.O'MAILLE, P. E.HEMMINGS, A. M.OSBOURN, A.: "A conserved amino acid residue critical for product and substrate specificity in plant triterpene synthases", PROC NATL ACAD SCI U S A., 2016
SASAKI, N.ADACHI, T.KODA, T.OZEKI, Y.: "Detection of UDP-glucose:cyclo-DOPA 5-O-glucosyltransferase activity in four o'clocks (Mirabilis jalapa L.", FEBS LETT, vol. 568, no. 1-3, 2004, pages 159 - 162, XP004516426, DOI: doi:10.1016/j.febslet.2004.04.097
SASAKI, N.NISHIZAKI, Y.YAMADA, E.TATSUZAWA, F.NAKATSUKA, T.TAKAHASHI, H.NISHIHARA, M.: "Iden- tification of the glucosyltransferase that mediates direct flavone C-glucosylation in Gentiana triflora", FEBS LETT., vol. 589, 2015, pages 182 - 7
SASAKI, N.WADA, K.KODA, T.KASAHARA, K.ADACHI, T.OZEKI, Y.: "Isolation and characterization of cDNAs encoding an enzyme with glucosyltransferase activity for cyclo-DOPA from four o'clocks and feather cockscombs", PLANT CELL PHYSIOL, vol. 46, no. 4, 2005, pages 666 - 670
SASAKI, N.WADA, K.KODA, T.KASAHARA, K.ADACHI, T.OZEKI, Y.: "Isolation and characterization of cDNAs encoding an enzyme with glucosyltransferase activity for cyclo-DOPA from four o'clocks and feather cockscombs", PLANT CELL PHYSIOL., vol. 46, 2005, pages 666 - 70
SAWADA, S.SUZUKI, H.ICHIMAIDA, F.YAMAGUCHI, M.-A.IWASHITA, T.FUKUI, Y.HEMMI, H.NISHINO, T.NAKAYAMA, T.: "UDP-glucuronic acid:anthocyanin glucuronosyltransferase from red daisy (Bellis perennis) flowers. Enzymology and phylogenetics of a novel glucuronosyltransferase involved in flower pigment biosynthesis", J. BIOL. CHEM., vol. 280, 2005, pages 899 - 906, XP055098066, DOI: doi:10.1074/jbc.M410537200
SAWAI, S.K. SAITO: "Triterpenoid biosynthesis and engineering in plants", FRONT PLANT SCI, vol. 2, 2011, pages 25
SAYAMA, T.ONO, E.TAKAGI, K.TAKADA, Y.HORIKAWA, M.NAKAMOTO, Y.HIROSE, A.SASAMA, H.OHASHI, M.HASEGAWA, H.: "The Sg-1 glycosyltransferase locus regulates structural diversity of triterpenoid saponins of soybean", PLANT CELL, vol. 24, no. 5, 2012, pages 2123 - 2138
SCHWAB ET AL., PLANT CELL, vol. 18, 2006, pages 1121 - 1133
SCHWEIGER, W.BODDU, J.SHIN, S.POPPENBERGER, B.BERTHILLER, F.LEMMENS, M.MUEHLBAUER, G. J.ADAM, G.: "Validation of a candidate deoxynivalenol-inactivating UDP-glucosyltransferase from barley by heterolo- gous expression in yeast", MOL. PLANT. MICROBE INTERACT., vol. 23, 2010, pages 977 - 86
SCHWEIGER, W.BODDU, J.SHIN, S.POPPENBERGER, B.BERTHILLER, F.LEMMENS, M.MUEHLBAUER, G. J.ADAM, G.: "Validation of a candidate deoxynivalenol-inactivating UDP-glucosyltransferase from barley by heterologous expression in yeast", MOL PLANT MICROBE INTERACT, vol. 23, no. 7, 2010, pages 977 - 986
SHAO, H.HE, X.ACHNINE, L.BLOUNT, J. W.DIXON, R. A.WANG, X.: "Crystal structures of a multifunctional triterpene/flavonoid glycosyltransferase from Medicago truncatula", PLANT CELL, vol. 17, no. 11, 2005, pages 3141 - 3154
SHARP, GENES DEV., vol. 15, 2001, pages 485 - 490
SHIBUYA MNISHIMURA KYASUYAMA NEBIZUKA Y: "Identification and characterization of glycosyltransferases involved in the biosynthesis of soyasaponin I in Glycine max", FEBS LETT., vol. 584, no. 11, 2010, pages 2258 - 2264, XP027093698
SHIBUYA, M.NISHIMURA, K.YASUYAMA, N.EBIZUKA, Y.: "Identification and characterization of glycosyl- transferases involved in the biosynthesis of soyasaponin i in Glycine max", FEBS LETT., vol. 584, 2010, pages 2258 - 64
SHIBUYA, M.NISHIMURA, K.YASUYAMA, N.EBIZUKA, Y.: "Identification and characterization of glycosyltransferases involved in the biosynthesis of soyasaponin I in Glycine max", FEBS LETT, vol. 584, no. 11, 2010, pages 2258 - 2264, XP027093698
SINNOTT, M. L.: "Catalytic mechanism of enzymic glycosyl transfer", CHEM. REV., vol. 90, no. 7, 1990, pages 1171 - 1202
SMITH, NATURE, vol. 334, 1988, pages 724 - 726
SUN, W.LIANG, L.MENG, X.LI, Y.GAO, F.LIU, X.WANG, S.GAO, X.WANG, L.: "Biochemical and molecular characterization of a flavonoid 3-0-glycosyltransferase responsible for anthocyanins and flavonols biosynthesis in Freesia hybrida", FRONT. PLANT SCI., vol. 7, 2016, pages 410
SZERSZEN, J. B.SZCZYGLOWSKI, K.BANDURSKI, R. S.: "iaglu, a gene from Zea mays involved in conjugation of growth hormone indole-3-acetic acid", SCIENCE, vol. 265, 1994, pages 1699 - 701, XP002913128, DOI: doi:10.1126/science.8085154
TAKASHI SAYAMA ET AL: "The Sg-1 Glycosyltransferase Locus Regulates Structural Diversity of Triterpenoid Saponins of Soybean", THE PLANT CELL, vol. 24, no. 5, 26 May 2012 (2012-05-26), US, pages 2123 - 2138, XP055601841, ISSN: 1040-4651, DOI: 10.1105/tpc.111.095174 *
TARRAGA, S.LISON, P.LOPEZ-GRESA, M. P.TORRES, C.RODRIGO, I.BELLES, J. M.CONEJERO, V.: "Molecular cloning and characterization of a novel tomato xylosyltransferase specific for gentisic acid", J EXP BOT, vol. 61, no. 15, 2010, pages 4325 - 4338
THIMMAPPA, R.GEISLER, K.LOUVEAU, T.O'MAILLE, P.OSBOURN, A.: "Triterpene biosynthesis in plants", ANNU REV PLANT BIOL, vol. 65, 2014, pages 225 - 257, XP055560165, DOI: doi:10.1146/annurev-arplant-050312-120229
THIMMAPPA, R.GEISLER, K.LOUVEAU, T.O'MAILLE, P.OSBOURN, A.: "Triterpene biosynthesis in plants", ANNU. REV. PLANT BIOL., vol. 65, 2014, pages 225 - 257, XP055560165, DOI: doi:10.1146/annurev-arplant-050312-120229
THOMAS LOUVEAU ET AL: "Analysis of Two New Arabinosyltransferases Belonging to the Carbohydrate-Active Enzyme (CAZY) Glycosyl Transferase Family1 Provides Insights into Disease Resistance and Sugar Donor Specificity", THE PLANT CELL, vol. 30, no. 12, 14 November 2018 (2018-11-14), US, pages 3038 - 3057, XP055601802, ISSN: 1040-4651, DOI: 10.1105/tpc.18.00641 *
THOMAS LOUVEAU: "Investigation of glycosyltransferases from oat", 1 January 2013 (2013-01-01), XP055601829, Retrieved from the Internet <URL:https://ueaeprints.uea.ac.uk/50619/1/2014LouveauTPhD.pdf> [retrieved on 20190703] *
THORLBY, G.FOURRIER, N.WARREN, G.: "The SENSITIVE TO FREEZING2 gene, required for freezing toler ance in Arabidopsis thaliana, encodes a 3-glucosidase", PLANT CELL, vol. 16, no. 8, 2004, pages 2192 - 2203
TIAN, L.BLOUNT, J. W.DIXON, R. A.: "Phenylpropanoid glycosyltransferases from osage orange (Maclura pomifera) fruit", FEBS LETT, vol. 580, no. 30, 2006, pages 6915 - 6920, XP028061618, DOI: doi:10.1016/j.febslet.2006.11.056
TIAN, L.BLOUNT, J. W.DIXON, R. A.: "Phenylpropanoid glycosyltransferases from osage orange (Maclura pomifera) fruit", FEBS LETT., vol. 580, 2006, pages 6915 - 20, XP028061618, DOI: doi:10.1016/j.febslet.2006.11.056
TOGNETTI, V. B.VAN AKEN, O.MORREEL, K.VANDENBROUCKE, K.VAN DE COTTE, B.DE CLERCQ, I.CHIWOCHA, S.FENSKE, R.PRINSEN, E.BOERJAN, W.: "Perturbation of indole-3-butyric acid homeostasis by the UDP-glucosyltransferase UGT74E2 modulates Arabidopsis architecture and water stress tolerance", PLANT CELL, vol. 22, 2010, pages 2660 - 79
TOHGE, T.NISHIYAMA, Y.HIRAI, M. Y.YANO, M.NAKAJIMA, J.AWAZUHARA, M.INOUE, E.TAKAHASHI, H.GOODENOWE, D. B.KITAYAMA, M.: "Functional genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing an MYB transcription factor", PLANT J, vol. 42, no. 2, 2005, pages 218 - 235, XP002516050, DOI: doi:10.1111/J.1365-313X.2005.02371.X
TRAPERO, A.AHRAZEM, O.RUBIO-MORAGA, A.JIMENO, M. L.GOMEZ, M. D.GOMEZ-GOMEZ, L.: "Charac- terization of a glucosyltransferase enzyme involved in the formation of kaempferol and quercetin sophorosides in Crocus sativus", PLANT PHYSIOL., vol. 159, 2012, pages 1335 - 54
TURNER, E. M.: "The nature of the resistance of oats to the take-all fungus", J. EXP. BOT., vol. 4, no. 11, 1953, pages 264 - 271
TUSCHL, CHEM. BIOCHEM., vol. 2, 2001, pages 239 - 245
TYANOVA, S.TEMU, T.COX, J.: "The MaxQuant computational platform for mass spectrometry-based shotgun proteomics", NAT PROTOC, vol. 11, no. 12, 2016, pages 2301 - 2319
VAN DER KROL ET AL., THE PLANT CELL, vol. 2, 1990, pages 279 - 289
VAN DER SPOEL, D.LINDAHL, E.HESS, B.GROENHOF, G.MARK, A. E.BERENDSEN, H. J.: "GROMACS: fast, flexible, and free", J COMPUT CHEM, vol. 26, no. 16, 2005, pages 1701 - 1718, XP055028875, DOI: doi:10.1002/jcc.20291
VASIL ET AL.: "Laboratory Procedures and Their Applications", vol. I, II, III, 1984, ACADEMIC PRESS, article "Cell Culture and Somatic Cell Genetics of Plants"
VEACH, Y. K.MARTIN, R. C.MOK, D. W.MALBECK, J.VANKOVA, R.MOK, M. C.: "O-glucosylation of cis-zeatin in maize. Characterization of genes, enzymes, and endogenous cytokinins", PLANT PHYSIOL, vol. 131, no. 3, 2003, pages 1374 - 1380
VETTER, J.: "Plant cyanogenic glycosides", TOXICON, vol. 38, no. 1, 2000, pages 11 - 36
VINCKEN, J. P.L. HENGA. DE GROOTH. GRUPPEN: "Saponins, classification and occurrence in the plant kingdom", PHYTOCHEMISTRY, vol. 68, no. 3, 2007, pages 275 - 297, XP005836300, DOI: doi:10.1016/j.phytochem.2006.10.008
VOGT TJONES P: "Glycosyltransferases in plant natural product synthesis: characterization of a supergene family", TRENDS PLANT SCI., vol. 5, no. 9, 2000, pages 380 - 386, XP002247408, DOI: doi:10.1016/S1360-1385(00)01720-9
VOGT, T.GRIMM, R.STRACK, D.: "Cloning and expression of a cDNA encoding betanidin 5-0- glucosyltransferase, a betanidin- and flavonoid-specific enzyme with high homology to inducible glucosyltrans- ferases from the Solanaceae", PLANT J., vol. 19, 1999, pages 509 - 19
VOGT, T.JONES, P.: "Glycosyltransferases in plant natural product synthesis: characterization of a supergene family", TRENDS PLANT SCI, vol. 5, no. 9, 2000, pages 380 - 386, XP002247408, DOI: doi:10.1016/S1360-1385(00)01720-9
VOINNETBAULCOMBE, NATURE, vol. 389, 1997, pages 553
VON RAD, U.HUTTL, R.LOTTSPEICH, F.GIERL, A.FREY, M.: "Two glucosyltransferases are involved in detoxi- fication of benzoxazinoids in maize", PLANT J., vol. 28, 2001, pages 633 - 42
VON RAD, U.HUTTL, R.LOTTSPEICH, F.GIERL, A.FREY, M.: "Two glucosyltransferases are involved in detoxification of benzoxazinoids in maize", PLANT J, vol. 28, no. 6, 2001, pages 633 - 642, XP002276049, DOI: doi:10.1046/j.1365-313x.2001.01161.x
WANG P ET AL.: "Production of bioactive ginsenosides Rh2 and Rg3 by metabolically engineered yeasts", METAB. ENG., vol. 29, 2015, pages 97 - 105, XP029590692, DOI: doi:10.1016/j.ymben.2015.03.003
WANG X: "Structure, mechanism and engineering of plant natural product glycosyltransferases", FEBS LETT., vol. 583, no. 20, 2009, pages 3303 - 3309, XP026693927, DOI: doi:10.1016/j.febslet.2009.09.042
WANG, B.JIN, S.-H.HU, H.-Q.SUN, Y.-G.WANG, Y.-W.HAN, P.HOU, B.-K.: "UGT87A2, an Arabidopsis glycosyltransferase, regulates flowering time via FLOWERING LOCUS C", NEW PHYTOL., vol. 194, 2012, pages 666 - 75
WANG, P.WEI, Y.FAN, Y.LIU, Q.WEI, W.YANG, C.ZHANG, L.ZHAO, G.YUE, J.YAN, X.: "Production of bioactive ginsenosides Rh2 and Rg3 by metabolically engineered yeasts", METAB ENG, vol. 29, 2015, pages 97 - 105, XP029590692, DOI: doi:10.1016/j.ymben.2015.03.003
WANG, X.: "Structure, mechanism and engineering of plant natural product glycosyltransferases", FEBS LETT, vol. 583, no. 20, 2009, pages 3303 - 3309, XP026693927, DOI: doi:10.1016/j.febslet.2009.09.042
WARNECKE, D. C.BALTRUSCH, M.BUCK, F.WOLTER, F. P.HEINZ, E.: "UDP-glucose:sterol glucosyltransferase: cloning and functional expression in Escherichia coli", PLANT MOL BIOL, vol. 35, no. 5, 1997, pages 597 - 603, XP002055894, DOI: doi:10.1023/A:1005806119807
WEE, J. J.MEE PARK, K.CHUNG, A. S.: "Herbal Medicine: Biomolecular and Clinical Aspects", 2011, article "Biological Activities of Ginseng and Its Application to Human Health"
WEI, W.WANG, P.WEI, Y.LIU, Q.YANG, C.ZHAO, G.YUE, J.YAN, X.ZHOU, Z.: "Characterization of Panax ginseng UDP-glycosyltransferases catalyzing protopanaxatriol and biosyntheses of bioactive ginsenosides F1 and Rh1 in metabolically engineered yeasts", MOL PLANT, vol. 8, no. 9, 2015, pages 1412 - 1424, XP055295736, DOI: doi:10.1016/j.molp.2015.05.010
WEISSBACHWEISSBACH: "Molecular Cloning: a Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS, pages: 120
WITTE, S.MOCO, S.VERVOORT, J.MATERN, U.MARTENS, S.: "Recombinant expression and functional charac- terisation of regiospecific flavonoid glucosyltransferases from Hieracium pilosella L", PLANTA, vol. 229, 2009, pages 1135 - 46
WITTE, S.MOCO, S.VERVOORT, J.MATERN, U.MARTENS, S.: "Recombinant expression and functional characterisation of regiospecific flavonoid glucosyltransferases from Hieracium pilosella L", PLANTA, vol. 229, no. 5, 2009, pages 1135 - 1146, XP019715524
WURM, FLORIAN M.: "Production of recombinant protein therapeutics in cultivated mammalian cells", NATURE BIOTECHNOLOGY, vol. 22.11, 2004, pages 1393
XU, G. J.CAI, W.GAO, W.LIU, C. S.: "A novel glucuronosyltransferase has an unprecedented ability to catalyse continuous two-step glucuronosylation of glycyrrhetinic acid to yield glycyrrhizin", NEW PHYTOLOGIST, vol. 212, no. 1, 2016, pages 123 - 135, XP055324545, DOI: doi:10.1111/nph.14039
XU, G.CAI, W.GAO, W.LIU, C.: "A novel glucuronosyltransferase has an unprecedented ability to catalyse continuous two-step glucuronosylation of glycyrrhetinic acid to yield glycyrrhizin", NEW PHYTOL., vol. 212, no. 1, 2016, pages 123 - 135, XP055324545, DOI: doi:10.1111/nph.14039
XU, Z.ESCAMILLA-TREVINO, L.ZENG, L.LALGONDAR, M.BEVAN, D.WINKEL, B.MOHAMED, A.CHENG, C.-L.SHIH, M.-C.POULTON, J.: "Functional genomic analysis of Arabidopsis thaliana glycoside hydrolase family 1", PLANT MOL. BIOL., vol. 55, no. 3, 2004, pages 343 - 367, XP019262500, DOI: doi:10.1007/s11103-004-0790-1
YAHYAA, M.DAVIDOVICH-RIKANATI, R.EYAL, Y.SHEACHTER, A.MARZOUK, S.LEWINSOHN, E.IBDAH, M.: "Iden- tification and characterization of UDP-glucose:phloretin 4'-0-glycosyltransferase from Malus x domestica Borkh", PHYTOCHEMISTRY, vol. 130, 2016, pages 47 - 55
YAMAZAKI, M.GONG, Z.FUKUCHI-MIZUTANI, M.FUKUI, Y.TANAKA, Y.KUSUMI, T.SAITO, K.: "Molecular cloning and biochemical characterization of a novel anthocyanin 5-O-glucosyltransferase by mRNA differential display for plant forms regarding anthocyanin", J. BIOL. CHEM., vol. 274, 1999, pages 7405 - 11
YAN, X.FAN, Y.WEI, W.WANG, P.LIU, Q.WEI, Y.ZHANG, L.ZHAO, G.YUE, J.ZHOU, Z.: "Production of bioactive ginsenoside compound K in metabolically engineered yeast", CELL RES, vol. 24, no. 6, 2014, pages 770 - 773, XP055428161, DOI: doi:10.1038/cr.2014.28
YANG J ET AL.: "The I-TASSER Suite: protein structure and function prediction", NAT. METHODS, vol. 12, no. 1, 2015, pages 7 - 8
YANG, J.YAN, R.ROY, A.XU, D.POISSON, J.ZHANG, Y.: "The I-TASSER Suite: protein structure and function prediction", NAT METHODS, vol. 12, no. 1, 2015, pages 7 - 8
YANG, S. H.E. K. AHNJ. A. LEET. S. SHINC. TSUKAMOTOJ. W. SUHI. MEIG. CHUNG: "Soyasaponins Aa and Ab exert an anti-obesity effect in 3T3-L1 adipocytes through downregulation of PPARgamma", PHYTOTHER RES, vol. 29, no. 2, 2015, pages 281 - 287
YANO, R.TAKAGI, K.TOCHIGI, S.FUJISAWA, Y.NOMURA, Y.TSUCHINAGA, H.TAKAHASHI, Y.TAKADA, Y.KAGA, A.ANAI, T.: "Isolation and characterization of the soybeansg-3 gene that is involved in genetic variation in sugar chain composition at the c-3 position in soyasaponins", PLANT & CELL PHYSIOLOGY, vol. 59, 2018, pages 792 - 805
YONEKURA-SAKAKIBARA, K.FUKUSHIMA, A.NAKABAYASHI, R.HANADA, K.MATSUDA, F.SUGAWARA, S.INOUE, E.KURO- MORI, T.ITO, T.SHINOZAKI, K.: "Two glycosyltransferases involved in anthocyanin modification delineated by transcriptome independent component analysis in Arabidopsis thaliana", PLANT J., vol. 69, 2012, pages 154 - 67, XP055105057, DOI: doi:10.1111/j.1365-313X.2011.04779.x
YONEKURA-SAKAKIBARA, K.NAKABAYASHI, R.SUGAWARA, S.TOHGE, T.ITO, T.KOYANAGI, M.KITAJIMA, M.TAKAYAMA, H.SAITO, K.: "A flavonoid 3-0-glucoside:2''-0-glucosyltransferase responsible for terminal modification of pollen-specific flavonols in Arabidopsis thaliana", PLANT J., vol. 79, 2014, pages 769 - 82
YONEKURA-SAKAKIBARA, K.TOHGE, T.MATSUDA, F.NAKABAYASHI, R.TAKAYAMA, H.NIIDA, R.WATANABE-TAKAHASHI, A.INOUE, E.SAITO, K.: "Comprehensive flavonol profiling and transcriptome coexpression analysis leading to decoding gene-metabolite correlations in Arabidopsis", PLANT CELL, vol. 20, no. 8, 2008, pages 2160 - 2176
YONEKURA-SAKAKIBARA, K.TOHGE, T.NIIDA, R.SAITO, K.: "Identification of a flavonol 7-0- rhamnosyltransferase gene determining flavonoid pattern in Arabidopsis by transcriptome coexpression analysis and reverse genetics", J. BIOL. CHEM., vol. 282, 2007, pages 14932 - 41
YU, H. S.MA, L. Q.ZHANG, J. X.SHI, G. L.HU, Y. H.WANG, Y. N.: "Characterization of glycosyltransferases responsible for salidroside biosynthesis in Rhodiola sachalinensis", PHYTOCHEMISTRY, 2011
ZAMORE P.D., NATURE STRUCTURAL BIOLOGY, vol. 8, no. 9, 2001, pages 746 - 750
ZHANG ET AL., THE PLANT CELL, vol. 4, 1992, pages 1575 - 1588
ZHONG, Y.XUE, X.LIU, Z.MA, Y.ZENG, K.HAN, L.QI, J.RO, D.-K.BAK, S.HUANG, S.: "Developmentally regulated glucosylation of bitter triterpenoid in cucumber by the UDP-glucosyltransferase UGT73AM3", MOL. PLANT, vol. 10, 2017, pages 1000 - 1003
ZUCKERKANDL, E.PAULING, L.: "Evolutionary Divergence and Convergence in Proteins", vol. 97, 1965, ACADEMIC PRESS, pages: 97 - 166

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111690629A (en) * 2020-05-29 2020-09-22 浙江工业大学 Endoglucanase mutant, gene, engineering bacterium and application thereof
CN111690629B (en) * 2020-05-29 2022-04-19 浙江工业大学 Endoglucanase mutant, gene, engineering bacterium and application thereof
CN113755478A (en) * 2020-06-02 2021-12-07 东北林业大学 Method for changing activity or function of 2,3-oxidosqualene cyclase
CN113755478B (en) * 2020-06-02 2023-05-26 东北林业大学 Method for changing activity or function of 2, 3-oxidation squalene cyclase
CN114107240A (en) * 2021-10-22 2022-03-01 中国农业科学院作物科学研究所 Tartary buckwheat-derived emodin glycosyltransferase and coding gene and application thereof
CN114107240B (en) * 2021-10-22 2024-02-02 中国农业科学院作物科学研究所 Tartary buckwheat-derived large Huang Sutang transferase, and encoding gene and application thereof
CN115125266A (en) * 2022-06-14 2022-09-30 北京理工大学 Recombinant vector, transformant and application of recombinant vector and transformant in glycosylation modification of pentacyclic triterpenoid
CN115125266B (en) * 2022-06-14 2024-02-13 北京理工大学 Recombinant vector, transformant and application thereof in glycosylation modification of pentacyclic triterpene compound
CN117244053A (en) * 2023-10-16 2023-12-19 国药中生生物技术研究院有限公司 Adjuvant use of compound with hederagenin-O-Ara structure
CN117244053B (en) * 2023-10-16 2024-04-26 国药中生生物技术研究院有限公司 Adjuvant use of compound with hederagenin-O-Ara structure

Also Published As

Publication number Publication date
GB201808617D0 (en) 2018-07-11

Similar Documents

Publication Publication Date Title
WO2019224321A1 (en) Triterpene glycosylation
US20230106588A1 (en) Transferase enzymes
Yonekura‐Sakakibara et al. A flavonoid 3‐O‐glucoside: 2 ″‐O‐glucosyltransferase responsible for terminal modification of pollen‐specific flavonols in A rabidopsis thaliana
Sun et al. Biochemical and molecular characterization of a flavonoid 3-O-glycosyltransferase responsible for anthocyanins and flavonols biosynthesis in Freesia hybrida
Louveau et al. Analysis of two new arabinosyltransferases belonging to the carbohydrate-active enzyme (CAZY) glycosyl transferase family1 provides insights into disease resistance and sugar donor specificity
Park et al. Molecular and functional characterization of Oryza sativa flavonol synthase (OsFLS), a bifunctional dioxygenase
Lam et al. Completion of tricin biosynthesis pathway in rice: cytochrome P450 75B4 is a unique chrysoeriol 5′-hydroxylase
Trapero et al. Characterization of a glucosyltransferase enzyme involved in the formation of kaempferol and quercetin sophorosides in Crocus sativus
US9580725B2 (en) Methods and compositions for modifying plant flavonoid composition and disease resistance
Irmisch et al. Discovery of UDP-glycosyltransferases and BAHD-acyltransferases involved in the biosynthesis of the antidiabetic plant metabolite montbretin A
Ahrazem et al. Ectopic expression of a stress-inducible glycosyltransferase from saffron enhances salt and oxidative stress tolerance in Arabidopsis while alters anchor root formation
US20220217934A1 (en) Cellulose-synthase-like enzymes and uses thereof
Gomez Roldan et al. An O‐methyltransferase modifies accumulation of methylated anthocyanins in seedlings of tomato
BR112020012316A2 (en) metabolic engineering
Confalonieri et al. Enhanced triterpene saponin biosynthesis and root nodulation in transgenic barrel medic (Medicago truncatula Gaertn.) expressing a novel β‐amyrin synthase (AsOXA1) gene
Lui et al. Convergent recruitment of 5′‐hydroxylase activities by CYP75B flavonoid B‐ring hydroxylases for tricin biosynthesis in Medicago legumes
EP2235051B1 (en) Glycosyltransferases, polynucleotides encoding these and methods of use
Feng et al. Enzymatic basis for stepwise C‐glycosylation in the formation of flavonoid di‐C‐glycosides in sacred lotus (Nelumbo nucifera Gaertn.)
Wang et al. Biosynthesis of the dihydrochalcone sweetener trilobatin requires phloretin glycosyltransferase2
Navarro Gallón et al. Virus-induced gene silencing of the two squalene synthase isoforms of apple tree (Malus× domestica L.) negatively impacts phytosterol biosynthesis, plastid pigmentation and leaf growth
CA2687559A1 (en) Enzymes involved in triterpene synthesis
CN115485377A (en) Glycosyltransferases, polynucleotides encoding them, and methods of use thereof
WO2020249698A1 (en) Biosynthetic genes and polypeptides
Gallón et al. Virus-induced gene silencing of the two squalene synthase isoforms of apple tree (Malus× domestica L.) negatively impacts phytosterol biosynthesis, plastid pigmentation and leaf growth
Sun et al. Molecular cloning and characterization of three isoprenyl diphosphate synthase genes from alfalfa

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19727605

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19727605

Country of ref document: EP

Kind code of ref document: A1