KR101253505B1 - Novel Ferritin Having Iron-binding Activity and Gene Encoding the Same - Google Patents

Novel Ferritin Having Iron-binding Activity and Gene Encoding the Same Download PDF

Info

Publication number
KR101253505B1
KR101253505B1 KR1020100129045A KR20100129045A KR101253505B1 KR 101253505 B1 KR101253505 B1 KR 101253505B1 KR 1020100129045 A KR1020100129045 A KR 1020100129045A KR 20100129045 A KR20100129045 A KR 20100129045A KR 101253505 B1 KR101253505 B1 KR 101253505B1
Authority
KR
South Korea
Prior art keywords
ferritin
iron
present
polypeptide
sequence
Prior art date
Application number
KR1020100129045A
Other languages
Korean (ko)
Other versions
KR20120067569A (en
Inventor
주한승
최장원
Original Assignee
주식회사 고려비엔피
씨앤제이바이오텍(주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 고려비엔피, 씨앤제이바이오텍(주) filed Critical 주식회사 고려비엔피
Priority to KR1020100129045A priority Critical patent/KR101253505B1/en
Publication of KR20120067569A publication Critical patent/KR20120067569A/en
Application granted granted Critical
Publication of KR101253505B1 publication Critical patent/KR101253505B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/142—Amino acids; Derivatives thereof
    • A23K20/147—Polymeric derivatives, e.g. peptides or proteins
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/79—Transferrins, e.g. lactoferrins, ovotransferrins

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Polymers & Plastics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Food Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Animal Husbandry (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 신규한 페리틴, 이를 코딩하는 유전자, 이를 발현하는 발현벡터 및 숙주세포와 이들을 이용한 상기 페리틴의 생합성 방법에 관한 것이다.
본 발명의 페리틴은 기존에 알려진 다른 페리틴과 달리 단일 서브유닛으로서 구성되어 숙주 세포에서 대량 발현하는데 매우 유리할 뿐만 아니라, 철분 흡수율이 뛰어나고 여러 가지 부작용을 나타내지 않기 때문에 의약산업, 식품산업 및 사료산업 분야에서 유용하게 사용할 수 있다. The present invention relates to a novel ferritin, a gene encoding the same, an expression vector and a host cell expressing the same, and a method for biosynthesis of the ferritin using them.
Unlike other ferritins known in the art, the ferritin of the present invention is not only advantageous for mass expression in a host cell as a single subunit, but also has excellent iron absorption rate and does not exhibit various side effects in the pharmaceutical, food and feed industries. It can be useful.

Description

철 결합 활성을 갖는 신규한 페리틴 및 이를 암호화하는 유전자{Novel Ferritin Having Iron-binding Activity and Gene Encoding the Same}Novel Ferritin Having Iron-binding Activity and Gene Encoding the Same

본 발명은 철 결합 활성을 갖는 신규한 페리틴 및 이를 암호화하는 유전자에 관한 것이다. The present invention relates to a novel ferritin having iron binding activity and a gene encoding the same.

보다 상세하게는 두토막눈썹 참갯지렁이로부터 순수분리 되며, 약 20 kDa의 분자량을 갖는 서브유닛이 24 개로 이루어진 단독 중합체로서 페리틴 및 이 단백질을 암호화 하는 유전자에 관한 것이다.
More specifically, it is purely separated from the brow eyelid earthworm, and relates to ferritin and a gene encoding the protein as a homopolymer consisting of 24 subunits having a molecular weight of about 20 kDa.

철은 일반적으로 생물의 활동에 필수 요소로 생체 내에서 호흡에 필수적인 효소의 기능적 구성 성분으로서 헤모글로빈(hemoglobin)과 미오글로빈(myoglobin)의 구성성분, 영양분 연소 및 에너지 생성 과정에 관여하는 전자전달계 단백질의 구성성분, 페리틴(ferritin)과 같은 철 저장 단백질에 결합된 저장 형태 및 트랜스페린(transferrin)에 결합하여 이동 형태 등으로 체내에 존재하여 산소운반, 전자전달 등과 같은 생체 내의 생명 유지에 중요한 역할을 한다. 그 외, 철의 생리학적 기능은 DNA 복제에 필요한 아민류의 합성과 분해에도 관여하는 것으로 알려져 있으며(Dallman, Ann . Rev. Nutr . 6:13-40(1986)), 세포 손상을 일으키는 강력한 활성 산소인 수페록사이드(superoxide)와 페록사이드를 독성이 약한 물질로 전환시켜 주는 superoxide dismutase, catalase, peroxidase 및 glutathione peroxidase 와 같은 항산화 효소의 구성 성분(Basaga, Cell Biol . 68:989-998(1990); Floyd, FASEB J. 4:2587-2597(1990); Sies, Eur . J. Biochem . 215:213-219(1993)) 및 철 운반 단백질인 트랜스페린의 경우도 임파구 증식에 관여함으로서 인체 내 면역 작용에 필수적 요소로 인식되고 있으며(Anderson 등, In Vitro Cell . Develop . Biol . 18:766-774(1982)), 최근에는 페리틴이 핵에도 존재하여 DNA 보호 및 철에 의해 유도된 산화적 손상으로 부터 DNA의 악화를 막아주는 기능을 하는 것으로 보고되고 있다(Thompson 등, J. Cell Sci . 115:2155-2177(2002)). 따라서, 철이 결핍이 되었을 때 적혈구의 감소와 이로 인한 헤모글로빈 수의 감소로 인한 빈혈, 식용부진, 설사, 호흡곤란, 성장 부진 및 질병에 대한 면역력이 감소하는 등 중요한 생리작용을 하고 있는 필수 금속 이온이다. 이와 같이 중요한 요소로 작용하는 철은 동물에 있어서 꾸준한 공급이 요구되지만 철분은 생체내로 흡수될 때 체내 흡수율이 아주 낮아서 그의 이용울이 큰 문제점으로 제기되어 왔다. 현재, 가축에 철분 공급을 위해 시트르산 철(iron citrate), 푸르말산 철(iron fumarate) 및 숙신산 철(ferrous succinate) 등과 같은 유기 철 형태로 제조되어 공급하고 있으나 소화 흡수율 및 경제적인 면에서 많은 문제점을 가지고 있어 철의 흡수 문제점을 개선하기 위하여 효모를 이용한 철 급여 연구들이 시도되고 있다(Halliwell 등, Biochem . J. 219:114(1984); Askwith 등, Cell 76:403-410(1994); Georgatsou 등, Mol . Cell . Biol . 14:3065-3073(1994); Yun 등, J. Biol . Chem . 275:1070910715(2000)). 페리틴(Ferritin)은 세포 내의 대표적인 철 저장 단백질로 말의 비장과 간에서 최초로 분리가 이루어졌으며, 거의 모든 생물 종에 존재하며 지금까지 사람을 포함해서 동물, 식물 및 미생물 등 여러 생물체로부터 분리되었다. 대부분의 척추동물의 페리틴은 24개의 서브유닛으로 이루어진 분자량 약 450 kDa의 단백질로, 분자 중심에 생성된 내공(core)에는 옥시하이드로사이드 폴리머(oxyhydroxie polymer)가 있어 분자 당 헤모글로빈 1,200분자를 생합성할 수 있는 4500개의 철 원자를 결합할 수 있다(Aisen 등, Annu . Rev . Biochem . 49:357-393(1980); Theil 등, J. Biol . Chem . 265:4771-4774(1990); Harrison 등, Biochim . Biophys. Acta 1275:161-203(1996)). 페리틴의 주된 기능은 내공에 철을 Fe3 + 상태로 보유함으로써 철을 함유하는 단백질이 합성될 때 철을 공급하고, 유리된 철에 의한 세포 내 독성으로부터 세포를 보호할 수 있고, 또한 철을 필요로 할 때는 Fe2 + 상태로 환원시켜 공급한다(Baynes 등, Annu . Rev. Nutr . 10:133-148(1990); Theil, E. C., J. Biol . Chem . 265:4771-4774(1990)). 척추동물의 페리틴은 기능적 및 유전적으로 다른 두 가지 형태의 서브유닛, H(heavy/heart)형과 L(light/liver)형으로 구성되어 있으며 조직에 따라 그 조성 비율이 다른 여러 이소페리틴(isoferritin)이 존재한다. L형 서브유닛은 페리틴 분자의 내공을 형성하는데 관여하며, H형 서브유닛은 Fe2 +의 흡수에 필요한 페록시다제(ferroxidase) 활성을 가지고 있어 페리틴 흡수 촉진 및 Fe2 +의 산화 촉진 활성을 가지고 있어 H-rich 페리틴은 철분 운반의 기능이 높은 것으로 추측된다(Lawson 등, FEBS Lett . 254:207-210(1989); Stefanini 등, Bioche . 21:2293-2299(1982)). 전통적인 철분 공급원인 황산제일철 등의 무기물 제제는 철분 흡수 효율이 낮고 위염, 소화장애 등 부작용이 심해 철분 결핍증의 주요 대상이 유아 및 임산부임을 고려할 때 사용이 많은 제약점을 갖는다. 이를 대체할 제품은 페리틴으로 철분 결핍성 빈혈의 치료에 쓰이고 있어 무기물 제제보다 부작용이 작고 훨씬 효과가 있는 것으로 알려져 있다. 현재 국내 및 외국에서 생산되는 페리틴은 소나 말의 비장으로부터 추출한 제품으로 바이러스 및 광우병 등의 위험요소가 있어 현재는 모두 품목허가 취소된 상태로 이를 대체할 제품 개발이 시급한 실정이다. 현재까지 효모 및 대장균에서 유전자 재조합 페리틴의 생산을 위한 다양한 연구가 진행되고 있지만(Park 등. Korean J. Biotechnol. Bioeng . 17:446-451(2002); Lee 등, Biochem . Biophys . Res . Comm . 298:225-229(2002); Chang 등, Korean J. Biotechnol . Bioeng . 19;352-357(2004); Hwang E.H., J. East Asian Soc . Dietary Life 16:93-98(2006); Lee 등, J. Microbiol . Biotechnol . 18:926-932(2008); 특허출원 10-2000-0041859; 특허출원 10-2000-0070806; 특허출원 10-2001-0030975; 및 특허출원 10-2003-0018579), 대부분 페리틴의 이형집합체의 발현에 관한 것이다.
Iron is a functional component of enzymes that are essential for the respiration of living organisms, which are generally essential for the activity of living organisms, and are the components of hemoglobin and myoglobin, as well as the components of electron transport proteins involved in the process of nutrient burning and energy generation. It is a component, a storage form bound to iron storage proteins such as ferritin, and a transfer form by binding to transferrins, which are present in the body, and play an important role in maintaining life in the living body such as oxygen transport and electron transfer. In addition, the physiological function of iron is known to be involved in the synthesis and degradation of amines necessary for DNA replication (Dallman, Ann . Rev. Nutr . 6: 13-40 (1986)), and a powerful free radical that causes cellular damage. Constituents of antioxidant enzymes such as superoxide dismutase, catalase, peroxidase and glutathione peroxidase (Basaga, Cell) that convert phosphorus superoxide and peroxide into less toxic substances Biol . 68: 989-998 (1990); Floyd, FASEB J. 4: 2587-2597 (1990); Sies, Eur . J. Biochem . 215: 213-219 (1993)) and the iron transporter protein, transferrin, are also recognized as essential for immune function in humans by being involved in lymphocyte proliferation (Anderson et al., In Vitro Cell . Develop . Biol . 18: 766-774 (1982)), and recently, ferritin is also present in the nucleus and has been reported to function to prevent DNA deterioration from oxidative damage induced by DNA protection and iron (Thompson et al., J. Cell Sci . 115: 2155-2177 (2002). Therefore, when iron is deficient, it is an essential metal ion that has important physiological functions such as decreased red blood cells and a decrease in the number of hemoglobin resulting in anemia, inedible meals, diarrhea, dyspnea, poor growth, and immunity to disease. . Iron, which acts as such an important factor, requires a steady supply in animals, but iron has been raised as a major problem because its iron absorption rate is very low when absorbed into a living body. Currently, it is manufactured and supplied in the form of organic iron such as iron citrate, iron fumarate, and ferrous succinate for supplying iron to livestock, but has many problems in terms of digestion absorption and economic efficiency. In order to improve the iron absorption problem, iron feeding studies using yeast have been attempted (Halliwell et al . , Biochem . J. 219: 114 (1984); Askwith et al . , Cell 76: 403-410 (1994); Georgatsou et al. , Mol . Cell . Biol . 14: 3065-3073 (1994); Yun et al . , J. Biol . Chem . 275: 1070910715 (2000)). Ferritin, the first iron storage protein in cells, was first isolated from the spleen and liver of horses and is present in almost all species and has been isolated from many organisms, including humans, animals, plants and microorganisms. Ferritin in most vertebrates is a protein with a molecular weight of about 450 kDa consisting of 24 subunits. The core created at the center of the molecule contains an oxyhydroxie polymer, which can biosynthesize 1,200 molecules of hemoglobin per molecule. which can bind to the iron atom 4500 (Aisen et al., Annu Rev Biochem 49:... 357-393 (1980); Theil et al., J. Biol Chem 265:.. 4771-4774 (1990); Harrison et al., .. Biochim Biophys Acta 1275: 161-203 (1996)). The main function of ferritin can be supplied to the iron when the protein containing the iron by keeping the iron in the inner hole with Fe 3 + state synthesis, and protect cells from endotoxic cells by the glass steel, also require iron when to be supplied was reduced to Fe + 2 state (Baynes, etc., Annu Rev. Nutr 10:.. .. 133-148 (1990); Theil, EC, J. Biol Chem 265: 4771-4774 (1990)) . The ferritin of vertebrates is composed of two functionally and genetically distinct subunits, type H (heavy / heart) and type L (light / liver), and various isoferritins with different composition ratios depending on the tissue. This exists. L-subunit is involved in forming the inner hole of the ferritin molecule, H-type sub-unit has a peroxidase (ferroxidase) have activity it ferritin absorption facilitate and promote oxidation activity of the Fe 2 + required for the absorption of Fe 2 + It is estimated that H-rich ferritin has a high function of iron transport (Lawson et al., FEBS). Lett . 254: 207-210 (1989); Stefanini et al . , Bioche . 21: 2293-2299 (1982). Inorganic preparations such as ferrous sulfate, which is a traditional source of iron, have low iron absorption efficiency and severe side effects such as gastritis and digestive disorders, and therefore have many limitations in consideration of the main targets of iron deficiency as infants and pregnant women. The alternative product is ferritin, which is used to treat iron deficiency anemia. Currently, ferritin produced in domestic and foreign countries is a product extracted from the spleen of cattle or horses, and there are risk factors such as viruses and mad cow disease, so all products have been canceled and there is an urgent need to develop products to replace them. To date, various studies have been conducted for the production of recombinant ferritin in yeast and Escherichia coli (Park et al. Korean J. Biotechnol. Bioeng . 17: 446-451 (2002); Lee et al . , Biochem . Biophys . Res . Comm . 298:... 225-229 (2002 ); Chang , etc., Korean J. Biotechnol Bioeng 19; 352-357 (2004); Hwang EH, J. East Asian Soc Dietary Life 16: 93-98 (2006); Lee et al . , J. Microbiol . Biotechnol . 18: 926-932 (2008); Patent application 10-2000-0041859; Patent application 10-2000-0070806; Patent application 10-2001-0030975; And patent application 10-2003-0018579), most of which relate to the expression of heterozygotes of ferritin.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

본 발명자들은 철분 흡수 효율이 높고, 부작용 및 위험 요소가 없는 재조합 페리틴의 개발을 위하여 예의 연구 노력하였다. 그 결과 본 발명자들은 한국의 남해안 갯벌에 서식하고 있는 두토막눈썹 참갯지렁이로부터 유래된 페리틴이 철 결합 활성이 뛰어날 뿐 아니라, 다른 척추동물 유래의 페리틴과는 달리 단일 서브유닛으로 구성된 단백질임을 확인하고, 이의 아미노산 서열 및 염기서열을 분석하고 이를 숙주 세포에서 대량 발현하여 본 발명을 완성하였다.The present inventors earnestly researched for the development of recombinant ferritin with high iron absorption efficiency and no side effects and risk factors. As a result, the present inventors confirmed that ferritin derived from the crow's eyebrow worm earthworm inhabiting the south coast of Korea is not only excellent in iron binding activity, but also a protein composed of a single subunit, unlike ferritin derived from other vertebrates, The amino acid sequence and nucleotide sequence thereof were analyzed and mass-expressed in the host cell to complete the present invention.

따라서 본 발명의 목적은 부작용이 없고 철 결합 활성이 뛰어나며, 단일 서브유닛으로 구성되어 숙주 세포에서 대량 발현이 용이한 신규 페리틴을 제공하는 데 있다.Accordingly, an object of the present invention is to provide a novel ferritin, which has no side effects, is excellent in iron binding activity, is composed of a single subunit, and is easily expressed in a host cell.

본 발명의 다른 목적은 상기 페리틴을 코딩하는 유전자 및 이를 포함하는 발현벡터를 제공하는 데 있다.Another object of the present invention to provide a gene encoding the ferritin and an expression vector comprising the same.

본 발명의 또 다른 목적은 상기 페리틴을 대량으로 발현할 수 있는 상기 발현벡터로 형질전환된 숙주세포를 제공하는 데 있다.Still another object of the present invention is to provide a host cell transformed with the expression vector capable of expressing the ferritin in large quantities.

본 발명의 또 다른 목적은 상기 페리틴을 포함하는 철분 보충용 조성물을 제공하는 데 있다.Another object of the present invention to provide a composition for supplementing iron containing the ferritin.

본 발명의 또 다른 목적은 상기 페리틴 발현용 형질전환 세포의 제조방법 및 상기 페리틴 생합성 방법을 제공하는 데 있다.
Still another object of the present invention is to provide a method for preparing transformed cells for expressing ferritin and a method for synthesizing ferritin.

본 발명의 또 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 서열목록 제1서열 또는 제2서열로 표시되는 철 결합 활성 폴리펩타이드를 제공한다.According to one aspect of the present invention, the present invention provides an iron binding active polypeptide represented by SEQ ID NO: 1 or 2 sequence.

본 발명의 다른 양태에 따르면, 본 발명은 상기 철 결합 활성 폴리펩타이드를 서브유닛(subunit)으로서 포함하는 페리틴(ferritin)을 제공한다.
According to another aspect of the present invention, the present invention provides ferritin comprising the iron binding active polypeptide as a subunit.

본 발명자들은 철분 흡수 효율이 높고, 부작용 및 위험 요소가 없는 재조합 페리틴의 개발을 위하여 예의 연구 노력하였다. 그 결과 본 발명자들은 한국의 남해안 갯벌에 서식하고 있는 두토막눈썹 참갯지렁이로부터 유래된 페리틴이 철 결합 활성이 뛰어날 뿐 아니라, 다른 척추동물 유래의 페리틴과는 달리 단일 서브유닛으로 구성된 단백질임을 확인하고, 이의 아미노산 서열 및 염기서열을 분석하고 이를 숙주 세포에서 대량 발현하여 본 발명을 완성하였다.The present inventors earnestly researched for the development of recombinant ferritin with high iron absorption efficiency and no side effects and risk factors. As a result, the present inventors confirmed that ferritin derived from the crow's eyebrow worm earthworm inhabiting the south coast of Korea is not only excellent in iron binding activity, but also a protein composed of a single subunit, unlike ferritin derived from other vertebrates, The amino acid sequence and nucleotide sequence thereof were analyzed and mass-expressed in the host cell to complete the present invention.

상기 서열목록 제1서열은 본 발명의 페리틴 단백질의 일 서브유닛을 나타내는 아미노산 서열이고, 상기 서열목록 제2서열은 페리틴 서브유닛의 활성형(active form) 아미노산 서열을 나타낸다. 본 발명의 서열목록 제1서열 또는 제2서열로 표시되는 아미노산 서열을 포함하는 폴리펩타이드는 철 결합 활성을 나타내는 것으로서, 상기 아미노산 서열을 포함하는 한 그 출처에 관계없이 본 발명의 범위에 포함되는 것이다. The sequence listing first sequence is an amino acid sequence representing one subunit of the ferritin protein of the present invention, and the sequence listing second sequence represents an active form amino acid sequence of the ferritin subunit. Polypeptides comprising the amino acid sequence represented by the first or second sequence list of the present invention exhibits iron binding activity, so long as it includes the amino acid sequence, it is included within the scope of the present invention. .

바람직한 구현예에서, 본 발명의 철 결합 활성 폴리펩타이드는 두토막눈썹 참갯지렁이(Perinereis aibuhitensis, 이하 청충이라 함)로부터 유래한 것이며, 보다 바람직하게는 한국의 남해안 갯벌에 서식하고 있는 두토막눈썹 참갯지렁이로부터 유래한 것이다.In a preferred embodiment, the iron-binding active polypeptide of the present invention is derived from Perinereis aibuhitensis ( hereinafter referred to as Chungcheong), and more preferably, dull- eyebrow sparrowworm inhabiting the South Coast tidal flat in Korea. It is derived from.

본 발명에서 제공하는 신규한 페리틴 단백질은 상기 철 결합 활성 폴리펩타이드를 그 서브유닛으로 포함하는 것을 그 특징으로 한다.The novel ferritin protein provided by the present invention is characterized by including the iron binding active polypeptide as a subunit thereof.

바람직한 구현예에서, 본 발명의 페리틴은 단일 서브유닛(subunit)으로 구성됨을 특징으로 하며, 보다 바람직하게는 24개의 단일 서브유닛으로 구성된다. 본 발명의 페리틴은 기존에 알려진 재조합 페리틴 또는 다른 척추동물 유래의 페리틴과는 달리 단일 서브유닛으로 구성되기 때문에, 이를 숙주 세포에서 대량 발현하여 인공 합성하는데 있어 매우 유리한 장점을 갖는다.
In a preferred embodiment, the ferritin of the present invention is characterized by being composed of a single subunit, more preferably of 24 single subunits. Since the ferritin of the present invention is composed of a single subunit, unlike the known ferritin derived from recombinant ferritin or other vertebrates, it has a very advantageous advantage in the artificial synthesis by mass expression in a host cell.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 철 결합 활성 폴리펩타이드를 코딩하는 뉴클레오타이드 서열을 제공한다.According to another aspect of the invention, the invention provides a nucleotide sequence encoding said iron binding active polypeptide.

본 명세서에서 용어 "뉴클레오타이드 서열”은 DNA(gDNA 및 cDNA) 그리고 RNA 분자를 포괄적으로 포함하는 의미를 갖으며, 핵산 분자에서 기본 구성 단위인 뉴클레오타이드는 자연의 뉴클레오타이드뿐만 아니라, 당 또는 염기 부위가 변형된 유사체(analogue)도 포함한다(Scheit, Nucleotide Analogs, John Wiley, New York(1980); Uhlman 및 Peyman, Chemical Reviews, 90:543-584(1990)). 본 발명의 상기 철 결합 활성 폴리펩타이드를 코딩하는 뉴클레오타이드 서열은 변형될 수 있으며 상기 변형은 뉴클레오타이드의 추가, 결실 또는 비보존적 치환 또는 보존적 치환을 포함한다.As used herein, the term “nucleotide sequence” has the meaning of encompassing DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides that are the basic structural units in nucleic acid molecules are naturally modified nucleotides, as well as modified sugar or base sites. It includes analogs (analogue) Fig (Scheit, Nucleotide analogs, John Wiley , New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990). Nucleotide sequences encoding the iron binding active polypeptides of the invention can be modified and the modifications include addition, deletion or non-conservative substitutions or conservative substitutions of nucleotides.

본 발명에서 상기 철 결합 활성 폴리펩타이드를 코딩하는 뉴클레오타이드 서열은 인간의 간 cDNA 라이브러리로부터 중합연쇄반응으로 클로닝한 것을 사용하거나 말, 소, 돼지, 닭, 지렁이, 갯지렁이 및 식물 유래의 페리틴 유전자를 사용할 수도 있다.In the present invention, the nucleotide sequence encoding the iron-binding active polypeptide may be cloned by a polymerase chain reaction from a human liver cDNA library, or may use ferritin genes derived from horses, cattle, pigs, chickens, earthworms, worms, and plants. have.

본 발명의 바람직한 구현예에 따르면, 상기 철 결합 활성 폴리펩타이드를 코딩하는 뉴클레오타이드 서열은 서열목록 제3서열 또는 제4서열로 표시된다.According to a preferred embodiment of the present invention, the nucleotide sequence encoding the iron binding active polypeptide is represented by SEQ ID NO: 3 or 4 of the sequence listing.

철 결합 활성 폴리펩타이드를 코딩하는 본 발명의 뉴클레오타이드 서열은 상기한 서열목록 제3서열 또는 제4서열에 한정되지 않으며, 상기 뉴클레오타이드 서열에 대하여 실질적인 동일성을 나타내는 뉴클레오타이드 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은, degeneracy를 포함하며 상기한 본 발명의 뉴클레오타이드 서열과 임의의 다른 서열로서 제1서열 또는 제2서열로 표시되는 아미노산 서열과 100% 동일한 폴리펩타이드를 코딩하는 것이 아니라 하더라도, 그 결과물인 폴리펩타이드가 본 발명의 특징인 단일 서브유닛으로 페리틴을 구성할 수 있는 특성을 구비한 이상 본 발명의 뉴클레오타이드 서열에 대해 실질적 동일성을 갖는다고 할 것이다.The nucleotide sequence of the present invention encoding the iron binding active polypeptide is not limited to the third or fourth sequence set forth above, and is also construed to include nucleotide sequences showing substantial identity to the nucleotide sequence. Such substantial identity, even if not encoding a polypeptide 100% identical to the amino acid sequence represented by the first or second sequence as any other sequence, including the degeneracy and the above-described nucleotide sequence of the present invention It will be said that the phosphorus polypeptide has substantial identity to the nucleotide sequence of the present invention as long as it has the property to constitute ferritin as a single subunit which is a feature of the present invention.

본 발명의 또 다른 양태에 따르면 본 발명은 상기 폴리펩타이드를 코딩하는 뉴클레오타이드 서열을 포함하는 재조합 벡터를 제공한다.According to another aspect of the present invention, the present invention provides a recombinant vector comprising the nucleotide sequence encoding the polypeptide.

본 명세서에서 용어 “벡터”는 숙주 세포에서 목적 유전자를 발현시키기 위한 수단으로 플라스미드 벡터; 코즈미드 벡터; 그리고 박테리오파아지 벡터, 아데노바이러스 벡터, 레트로바이러스 벡터 및 아데노-연관 바이러스 벡터 같은 바이러스 벡터 등을 포함되며, 바람직하게는 플라스미드 벡터이다. As used herein, the term “vector” refers to a plasmid vector as a means for expressing a gene of interest in a host cell; Cosmid vectors; And viral vectors such as bacteriophage vectors, adenovirus vectors, retrovirus vectors, and adeno-associated virus vectors, and the like, and are preferably plasmid vectors.

본 발명의 바람직한 구현예에 따르면, 본 발명의 벡터에서 상기 철 결합 활성 폴리펩타이드를 코딩하는 뉴클레오타이드 서열은 프로모터와 작동적으로 결합(operatively linked)되어 있다.According to a preferred embodiment of the invention, the nucleotide sequence encoding the iron binding active polypeptide in the vector of the invention is operatively linked with the promoter.

본 명세서에서, 용어 “작동적으로 결합된”은 핵산 발현 조절 서열(예: 프로모터, 시그널 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산 서열사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및/또는 해독을 조절하게 된다.As used herein, the term “operably linked” refers to the functional binding between a nucleic acid expression control sequence (eg, an array of promoters, signal sequences, or transcriptional regulator binding sites) and other nucleic acid sequences, thereby The regulatory sequence will control the transcription and / or translation of said other nucleic acid sequence.

본 발명의 재조합 벡터 시스템은 당업계에 공지된 다양한 방법을 통해 구축될 수 있으며, 이에 대한 구체적인 방법은 문헌(Sambrook et al., Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Laboratory Press(2001))에 개시되어 있으며, 이 문헌은 본 명세서에 참조로서 삽입된다. The recombinant vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are described in Sambrook et al., Molecular Cloning , A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference.

본 발명의 벡터는 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있다. 또한, 본 발명의 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. The vector of the present invention can typically be constructed as a vector for cloning or as a vector for expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts.

예를 들어, 본 발명의 벡터가 발현 벡터이고, 원핵 세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터(예컨대, tac 프로모터, lac 프로모터, lacUV5 프로모터, lpp 프로모터, pL λ프로모터, pR λ프로모터, rac5 프로모터, amp 프로모터, recA 프로모터, SP6 프로모터, trp 프로모터 및 T7 프로모터 등), 해독의 개시를 위한 라이보좀 결합 자리 및 전사/해독 종결 서열을 포함할 수 있다. 숙주 세포로서 E. coli(예컨대, HB101, BL21, DH5α 등)가 이용되는 경우, E. coli 트립토판 생합성 경로의 프로모터 및 오퍼레이터 부위(Yanofsky, C., J. Bacteriol ., 158:1018-1024(1984)) 그리고 파아지 λ의 좌향 프로모터 (pL λ프로모터, Herskowitz, I. and Hagen, D., Ann. Rev . Genet ., 14:399-445(1980))가 조절 부위로서 이용될 수 있다. 숙주세포로서 바실러스 균이 이용되는 경우, 바실러스 츄린겐시스의 독소단백질 유전자의 프로모터(Appl . Environ . Microbiol. 64:3932-3938(1998); Mol . Gen . Genet . 250:734-741(1996)) 또는 바실러스균에서 발현 가능한 어떠한 프로모터(예컨대, AprE 프로모터)라도 조절부위로 이용될 수 있다.For example, when the vector of the present invention is an expression vector and the prokaryotic cell is used as a host, a strong promoter (for example, a tac promoter, lac) capable of promoting transcription can be obtained. Promoter, lac UV5 promoter, lpp promoter, p L λ promoter, p R λ promoter, rac 5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), ribosomal binding site for initiation of detoxification and Transcription / detox termination sequence. E. coli (eg, as a host cell) HB101, BL21, DH5α, etc.) is used, E. coli Promoter and operator sites of the tryptophan biosynthetic pathway (Yanofsky, C., J. Bacteriol . , 158: 1018-1024 (1984)) and the leftward promoter of phage λ (p L λ promoter, Herskowitz, I. and Hagen, D., . Ann Rev Genet, 14:. . 399-445 (1980)) may be used as a control region. When Bacillus bacteria are used as host cells, the promoter of the Bacillus Chuo toxin protein gene of ringen sheath (Appl Environ Microbiol 64: 3932-3938 ( 1998); Mol Gen Genet 250:...... 734-741 (1996) ) Or any promoter that can be expressed in Bacillus (eg, AprE promoter) can be used as a regulatory site.

한편, 본 발명에 이용될 수 있는 벡터는 당업계에서 종종 사용되는 플라스미드(예: pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX 시리즈, pET 시리즈, pUC19 및 pT7 시리즈 등), 파지(예: λgt4λB, λ-Charon, λΔz1 및 M13 등) 또는 바이러스 (예: SV40 등)를 조작하여 제작될 수 있다.On the other hand, vectors that can be used in the present invention are plasmids often used in the art (eg pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14). , pGEX series, pET series, pUC19 and pT7 series, etc.), phages (eg, λgt4λB, λ-Charon, λΔz1 and M13, etc.) or viruses (eg SV40, etc.) may be produced.

한편, 본 발명의 벡터가 발현 벡터이고, 진핵 세포를 숙주로 하는 경우에는, 포유동물 세포의 지놈으로부터 유래된 프로모터(예: 메탈로티오닌 프로모터, β-액틴 프로모터, 사람 헤모글로빈 프로모터 및 사람 근육 크레아틴 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터(예: 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토메갈로바이러스 프로모터, HSV의 tk 프로모터, 마우스 유방 종양 바이러스(MMTV) 프로모터 및 HIV의 LTR 프로모터)가 이용될 수 있으며, 전사 종결 서열로서 폴리아데닐화 서열을 일반적으로 갖는다.On the other hand, when the vector of the present invention is an expression vector and the eukaryotic cell is a host, promoters derived from the genome of mammalian cells (for example, metallothionine promoter, β-actin promoter, human hemoglobin promoter and human muscle creatine) Promoter) or a promoter derived from a mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk of HSV) Promoter, mouse breast tumor virus (MMTV) promoter and LTR promoter of HIV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

본 발명의 벡터는 그로부터 발현되는 폴리펩타이드의 정제를 용이하게 하기 위하여, 다른 서열과 융합될 수도 있다. 융합되는 서열은 예컨대, 글루타티온 S-트랜스퍼라제(Pharmacia, USA), 말토스 결합 단백질(NEB, USA), FLAG(IBI, USA) 및 6x His (hexahistidine; Quiagen, USA) 등이 있다.Vectors of the present invention may also be fused with other sequences to facilitate purification of the polypeptides expressed therefrom. Sequences to be fused include, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA).

또한, 본 발명의 발현 벡터는 선택표지로서, 당업계에서 통상적으로 이용되는 항생제 내성 유전자를 포함할 수 있으며, 예를 들어 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신, 카나마이신, 게네티신, 네오마이신 및/또는 테트라사이클린에 대한 내성 유전자를 포함할 수 있다.
In addition, the expression vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selectable label, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin Resistance genes for neomycin and / or tetracycline.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 재조합 벡터로 형질전환 된 숙주세포를 제공한다.According to another aspect of the present invention, the present invention provides a host cell transformed with the recombinant vector.

본 발명의 벡터를 안정되면서 연속적으로 클로닝 및 발현시킬 수 있는 숙주 세포는 당업계에 공지되어 어떠한 숙주 세포도 이용할 수 있으며, 예컨대, 에스케리치아 콜라이(Escherichia coli), 바실러스 서브틸리스 및 바실러스 츄린겐시스와 같은 바실러스 속 균주, 스트렙토마이세스(Streptomyces), 슈도모나스(Pseudomonas)(예를 들면, 슈도모나스 푸티다(Pseudomonas putida)), 프로테우스 미라빌리스(Proteus mirabilis) 또는 스타필로코쿠스(Staphylococcus)(예를 들면, 스타필로코쿠스 카르노수스(Staphylocus carnosus))와 같은 원핵 숙주 세포를 포함하나 이로 제한되는 것은 아니다. 상기 숙주세포는 바람직하게는 E. coli ER2738, E. coli XL-1 Blue, E. coli BL21(DE3), E. coli JM109, E. coli DH 시리즈, E. coli TOP10, E. coli TG1 또는 E. coli HB101와 같은 E. coli 또는 바실러스 서브틸리스이고 보다 바람직하게는 E. coli BL21(DE3) 또는 바실러스 서브틸리스이다. Host cells capable of stably and continuously cloning and expressing the vectors of the present invention are known in the art and can be used with any host cell, for example Escherichia coli), Bacillus sp, Streptomyces, such as Bacillus subtilis and Bacillus Chuo ringen sheath (Streptomyces), Pseudomonas (Pseudomonas) (e.g., Pseudomonas footage is (Pseudomonas putida ), Proteus mirabilis ) or Staphylococcus (e.g., Staphylocus prokaryotic host cells such as carnosus )), but are not limited to these. The host cell is preferably E. coli ER2738, E. coli XL-1 Blue , E. coli BL21 (DE3), E. coli JM109, E. coli DH series, TOP10 E. coli, E. coli TG1 or E. coli, such as E. coli HB101 Or Bacillus subtilis and more preferably E. coli BL21 (DE3) or Bacillus subtilis.

상기 벡터의 적합한 진핵세포 숙주 세포는 아스페르길러스 속(Aspergillus species)과 같은 진균, 피치아 파스토리스(Pichia pastoris), 사카로마이세스 세르비시아(Saccharomyces cerevisiae), 쉬조사카로마세스(Schizosaccharomyces) 및 뉴로스포라 크라사(Neurospora crassa)와 같은 효모, 그 밖의 하등 진핵세포, 그리고 곤충-유래 세포와 같은 고등 진핵생물의 세포를 포함한다. 또한, 식물 또는 포유동물로부터 유래한 세포도 숙주 세포로 이용할 수 있다.
Suitable eukaryotic host cells of the vector are of the genus Aspergillus. fungi, such as species, Pichia pastoris ), Saccharomyces cerevisiae ), yeasts such as Schizosaccharomyces and Neurospora crassa , other lower eukaryotic cells, and cells of higher eukaryotes such as insect-derived cells. In addition, cells derived from plants or mammals can also be used as host cells.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 철 결합 활성 폴리펩타이드를 포함하는 철분 보충용 식품조성물을 제공한다.According to another aspect of the present invention, the present invention provides a food supplement for iron supplement containing the iron binding active polypeptide.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 철 결합 활성 폴리펩타이드를 포함하는 철분결핍 예방 및 치료용 약제학적 조성물을 제공한다.According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing and treating iron deficiency comprising the iron binding active polypeptide.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 철 결합 활성 폴리펩타이드를 포함하는 사료첨가용 조성물을 제공한다.According to another aspect of the present invention, the present invention provides a feed additive composition comprising the iron binding active polypeptide.

본 발명의 조성물에 포함되는 폴리펩타이드는 상술한바와 같이 철 결합 활성이 뛰어난 단일 서브유닛으로서 페리틴 단백질을 구성하므로 이를 숙주 세포에서 대량 발현하는데 매우 유리할 뿐만 아니라, 무기물 철분 제제와 달리 철분 흡수율이 뛰어나고 여러 가지 부작용을 나타내지 않기 때문에 의약산업, 식품산업 및 사료산업 분야에서 유용하게 사용할 수 있다.As described above, the polypeptide included in the composition of the present invention constitutes a ferritin protein as a single subunit having excellent iron binding activity, and thus is very advantageous for mass expression in host cells, and, unlike inorganic iron preparations, has excellent iron absorption rate and various Because it does not show side effects, it can be usefully used in the pharmaceutical, food and feed industries.

본 발명의 조성물이 식품 조성물을 제공되는 경우, 식품 제조 시에 통상적으로 첨가되는 성분을 포함할 수 있으며, 예컨대 향미제 또는 천연 탄수화물을 추가 성분으로서 포함시킬 수 있다. 예를 들어, 천연 탄수화물은 모노사카라이드(예컨대, 글루코오스, 프럭토오스 등); 디사카라이드(예컨대, 말토스, 수크로오스 등); 올리고당; 폴리사카라이드(예컨대, 덱스트린, 시클로덱스트린 등); 및 당알코올(예컨대, 자일리톨, 소르비톨, 에리쓰리톨 등)를 포함하며 향미제로서는 천연 향미제(예컨대, 타우마틴, 스테비아 추출물 등) 및 합성 향미제(예컨대, 사카린, 아스파르탐 등)을 이용할 수 있다.When the composition of the present invention is provided with a food composition, it may include ingredients that are commonly added in the manufacture of food, such as flavoring agents or natural carbohydrates may be included as additional ingredients. For example, natural carbohydrates include monosaccharides (eg, glucose, fructose, etc.); Disaccharides (eg maltose, sucrose, etc.); oligosaccharide; Polysaccharides (eg, dextrins, cyclodextrins, etc.); And sugar alcohols (e.g., xylitol, sorbitol, erythritol, etc.), and natural flavoring agents (e.g., taumartin, stevia extract, etc.) and synthetic flavoring agents (e.g., saccharin, aspartame, etc.) Can be.

바람직한 구현예에서, 본 발명의 식품 조성물은 철분 보충용 기능성 식품을 제조하는 데 사용된다. 기능성식품이란 식품의약품안전청에서 개별인정을 통하여 약리 효과가 인정되는 식품을 의미한다.In a preferred embodiment, the food composition of the present invention is used to prepare functional foods for iron supplementation. Functional food means a food whose pharmacological effect is recognized through individual certification by the Food and Drug Administration.

상기 기능성식품은 본 발명의 유효성분인 본 발명의 철 결합 활성 폴리펩타이드 또는 이를 서브유닛으로 포함하는 페리틴 단백질을 음료, 차류, 향신료, 껌, 과자류 등의 식품소재에 첨가하거나, 캡슐화, 분말화, 현탁액 등으로 제조한 식품으로, 이를 섭취할 경우 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용시 발생할 수 있는 부작용 등이 없는 장점이 있다.The functional food is added to the food materials, such as beverages, teas, spices, chewing gum, confectionery, or the like, fermentin protein containing the iron-binding active polypeptide of the present invention or a subunit of the active ingredient of the present invention, encapsulated, powdered, Food prepared as a suspension, and when ingested there is an advantage that there is no side effect that can occur when taking long-term use of the drug as a raw material unlike the general medicine.

본 발명의 기능성식품에 있어 상기 철 결합 활성 폴리펩타이드 또는 이를 서브유닛으로 포함하는 페리틴 단백질의 첨가량은, 식품의 종류에 따라 달라 일률적으로 규정할 수 없지만, 식품 본래의 맛을 손상시키지 않는 범위에서 첨가하면 되며, 상기 기능성식품이 분말, 과립, 정제, 캡슐 또는 음료의 형태인 경우 대상 식품에 대하여 통상 0.01 내지 100 중량%, 바람직하기로는 1 내지 100 중량%의 범위로 첨가될 수 있다.In the functional food of the present invention, the addition amount of the iron-binding active polypeptide or ferritin protein containing the same as a subunit cannot be uniformly defined depending on the type of food, but is added within a range that does not impair the original taste of the food. When the functional food is in the form of powder, granules, tablets, capsules or beverages, the functional food may be added in the range of usually 0.01 to 100% by weight, preferably 1 to 100% by weight.

본 발명의 조성물이 철분결핍 예방 및 치료를 위한 약제학적 조성물로 제조되는 경우, 본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함할 수 있다. 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.When the composition of the present invention is prepared as a pharmaceutical composition for preventing and treating iron deficiency, the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like It doesn't happen. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and agents are Remington's Pharmaceutical Sciences (19th ed., 1995).

본 발명의 약제학적 조성물은 경구 또는 비경구 투여할 수 있으며, 비경구 투여인 경우에는 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 경피 투여 등으로 투여할 수 있다. The pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, or the like.

본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약제학적 조성물의 1일 투여량은 예컨대 0.001-100 ㎎/㎏이다.The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . The daily dosage of the pharmaceutical composition of the present invention is, for example, 0.001-100 mg / kg.

본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액, 시럽제 또는 유화액 형태이거나 엑스제, 산제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.The pharmaceutical compositions of the present invention may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. The formulation may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or in the form of extracts, powders, powders, granules, tablets or capsules, and may further comprise dispersants or stabilizers.

본 발명의 조성물이 사료 첨가용 조성물로 제조되는 경우, 사료의 품질을 개선하거나 가축의 건강 및 활동을 향상시킬 목적으로 첨가되는 영양분 등 기타 통상적으로 사용되는 첨가물을 추가적으로 포함할 수 있으며, 예컨대, 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
When the composition of the present invention is prepared as a feed additive composition, it may further include other commonly used additives such as nutrients added for the purpose of improving the quality of the feed or improving the health and activity of the livestock, for example, a lubricant , Wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents, preservatives and the like may be further included.

본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 상기 철 결합 활성 폴리펩타이드를 코딩하는 뉴클레오타이드 서열을 발현벡터에 삽입시키는 단계; 및 (b) 상기 뉴클레오타이드 서열이 삽입된 발현벡터로 세포를 형질전환시키는 단계를 포함하는 페리틴 발현용 형질전환 세포의 제조방법을 제공한다.According to another aspect of the present invention, the present invention comprises the steps of (a) inserting a nucleotide sequence encoding the iron binding active polypeptide into an expression vector; And (b) transforming the cell with the expression vector into which the nucleotide sequence is inserted.

본 발명의 철 결합 활성 폴리펩타이드를 발현하는 형질전환 세포의 제조방법은 재조합 숙주세포를 이용하여 상술한 철 결합 활성 폴리펩타이드를 생산하는 방법에 관한 것이므로 상술한 내용과 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다. Since the method for producing a transformed cell expressing the iron-binding active polypeptide of the present invention relates to a method for producing the above-described iron-binding active polypeptide using a recombinant host cell, the content in common with the above description is excessively complex in the present specification. In order to avoid, the description thereof is omitted.

본 명세서에서, 숙주 세포로의 “형질전환” 및/또는 “형질감염”은 핵산을 유기체, 세포, 조직 또는 기관에 도입하는 어떤 방법도 포함되며 당 분야에서 공지된 바와 같이 숙주 세포에 따라 적합한 표준 기술을 선택하여 수행할 수 있다. 이런 방법에는 전기충격유전자전달법(electroporation), 원형질 융합, 인산 칼슘(CaPO4)) 침전, 염화 칼슘(CaCl2) 침전, 실리콘 카바이드 섬유 이용한 교반, 아그로 박테리아 매개된 형질전환, PEG, 덱스트란 설페이트, 리포펙타민 및 건조/억제 매개된 형질전환 방법 등이 포함되나 이로 제한되지 않는다. 예를 들어 염화칼슘법을 이용하는 칼슘 처리 또는 일렉트로포레이션은 일반적으로 원핵세포에 대해 사용될 수 있다(Sambrook et al., Molecular Cloning : A Laboratory Manual (New York: Cold Spring Haror Laboratory Press)(1989)). 아그로박테리움 투메파시엔스(Agrobacterium tumefaciens)를 사용한 형질감염은 특정 식물 세포의 형질전환에 사용될 수 있다((Shaw et. al, Gene, 23:315(1983), 국제 공개특허 WO 89/05859). 또한 세포벽이 없는 포유동물 세포의 경우, 인산칼슘 침전법을 사용할 수 있다(Graham et .al,, Virology, 52:456-457(1978)). 포유동물 숙주 세포로의 형질전환의 일반적인 방법 및 특징은 미국 특허 제4,399,216호에 기재되어 있다. 효모 내로의 형질전환은 일반적으로 반 솔링겐(Van Solingen) 등의 문헌(J. Bact.,130:946(1977)) 및 히시아오(Hsiao) 등의 문헌(Proc . Natl . Acad . Sci .( USA ), 76:3829(1979))의 방법에 따라 수행될 수 있다.As used herein, “transformation” and / or “transfection” into a host cell includes any method of introducing a nucleic acid into an organism, cell, tissue, or organ and is a standard suitable for a host cell as is known in the art. The technique can be selected and performed. These methods include electroporation, protoplast fusion, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, agitation with silicon carbide fibers, agro bacterial mediated transformation, PEG, dextran sulfate , Lipofectamine and dry / inhibited mediated transformation methods, and the like. Calcium treatment or electroporation, for example using the calcium chloride method, can generally be used for prokaryotic cells (Sambrook et al., Molecular Cloning : A Laboratory Manual (New York: Cold Spring Haror Laboratory Press) (1989). Agrobacterium Tome Pacifico Enschede (Agrobacterium transfection with tumefaciens ) can be used for the transformation of certain plant cells (Shaw et. al, Gene , 23: 315 (1983), International Publication WO 89/05859). In this case, calcium phosphate precipitation may be used (Graham et. Al, Virology , 52: 456-457 (1978)). General methods and features of transformation into mammalian host cells are described in US Pat. No. 4,399,216. Transformation into yeast is generally described by Van Solingen et al . ( J. Bact ., 130: 946 (1977)) and Hsiao et al . ( Proc . Natl . Acad . Sci . ( USA ) , 76: 3829 (1979)).

일 구현예에서, 본 발명의 페리틴 발현용 형질전환 세포의 제조방법은 청충으로부터 총 세포 RNA 를 추출·정제하는 단계; 상기 추출·정제된 RNA로부터 mRNA를 정제하는 단계; 상기 정제한 mRNA 로부터 cDNA 라이브러리를 제조하는 단계; 상기 제조된 cDNA 라이브러리로부터 페리틴의 잘 보존된 서열을 바탕으로 디제너레이트 프라이머(degenerate primer)를 제작하고, 중합연쇄반응에 의해 클로닝하고 상기 클로닝된 유전자가 페리틴 유전자임을 자동 염기서열 분석기에 의해 확인하는 단계; 클로닝된 페리틴 유전자가 도입된 재조합 발현벡터를 제조하는 단계; 및 상기 재조합 페리틴 발현벡터를 발현용 균주에 형질전환시켜 재조합 균주를 제조하는 단계를 포함할 수 있다.In one embodiment, the method for producing a ferritin-expressing transformed cell of the present invention comprises the steps of extracting and purifying total cell RNA from the worms; Purifying mRNA from the extracted and purified RNA; Preparing a cDNA library from the purified mRNA; A degenerate primer was prepared based on the well-preserved sequence of ferritin from the prepared cDNA library, cloned by a polymerase chain reaction, and confirmed by an automatic sequencing analyzer that the cloned gene was a ferritin gene. step; Preparing a recombinant expression vector into which the cloned ferritin gene is introduced; And transforming the recombinant ferritin expression vector into an expression strain, thereby preparing a recombinant strain.

상기와 같이 제조한 형질전환 세포는 그 유전자를 발현시켜 페리틴을 다량으로 생산시킬 수 있으며, 이렇게 생산한 재조합 페리틴은 이를 유효성분으로 포함하는 철분 강화제, 사료 첨가제 또는 식품 첨가제 등의 제조에 유용하게 사용될 수 있다.
The transformed cells prepared as described above may produce a large amount of ferritin by expressing the gene, and the recombinant ferritin thus produced may be usefully used in the preparation of iron fortifying agents, feed additives or food additives including the same as an active ingredient. Can be.

본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 상기에서 상술한 형질전환 세포를 배양하여 폴리펩타이드를 생합성 하는 단계; 및 (b) 상기 생합성된 폴리펩타이드를 수득하는 단계를 포함하는 페리틴의 생합성 방법을 제공한다.According to another aspect of the present invention, the present invention comprises the steps of (a) culturing the above-described transformed cells to biosynthesize the polypeptide; And (b) provides a method of biosynthesis of ferritin comprising the step of obtaining the biosynthesized polypeptide.

본 발명의 철 결합 활성 폴리펩타이드 과발현용 형질전환 세포의 배양은 당업계에 공지된 통상의 배양 방법에 의해 배양될 수 있으며, 바람직하게는 단계 (a)는 발현 유도제(예컨대, IPTG) 존재 하에서 실시될 수 있다. Cultivation of the transformed cells for overexpression of the iron-binding active polypeptide of the present invention may be cultured by conventional culture methods known in the art, and preferably step (a) is performed in the presence of an expression inducing agent (eg, IPTG). Can be.

상기 형질전환 세포 내에서 생합성된 철 결합 활성 폴리펩타이드 또는 페리틴을 분리하는 단계는 당업계에 공지된 통상의 분리 또는 정제 방법에 따라 실시될 수 있다(참조: B. Aurousseau et al., Journal of the American Oil Chemists' Society, 57(3):1558-9331( 1980); Frank C. Magne et al., Journal of the American Oil Chemists' Society, 34(3):127-129(1957)).
The step of separating the biosynthesized iron binding active polypeptide or ferritin in the transformed cells can be carried out according to conventional separation or purification methods known in the art (see B. Aurousseau et al., Journal of the American Oil Chemists' Society , 57 (3): 1558-9331 (1980); Frank C. Magne et al., Journal of the american oil Chemists' Society , 34 (3): 127-129 (1957).

본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:

(ⅰ) 본 발명은 신규한 페리틴, 이를 코딩하는 유전자, 이를 발현하는 발현벡터 및 숙주세포와 이들을 이용한 상기 페리틴의 생합성 방법을 제공한다.(Iii) The present invention provides a novel ferritin, a gene encoding the same, an expression vector and host cell expressing the same, and a biosynthesis method of the ferritin using them.

(ⅱ) 본 발명의 페리틴은 기존에 알려진 다른 페리틴과 달리 단일 서브유닛으로서 구성되어 숙주 세포에서 대량 발현하는데 매우 유리할 뿐만 아니라, 철분 흡수율이 뛰어나고 여러 가지 부작용을 나타내지 않기 때문에 의약산업, 식품산업 및 사료산업 분야에서 유용하게 사용할 수 있다.
(Ii) The ferritin of the present invention, unlike other known ferritins, is composed of a single subunit, which is very advantageous for mass expression in a host cell, and has a high iron absorption rate and does not exhibit various side effects. It can be usefully used in industrial fields.

도 1은 본 발명의 Ferr-F1 프라이머와 Ferr-R1 프라이머 쌍을 이용하여 중합효소 연쇄반응한 결과를 나타내는 1% 아가로즈 겔 전기영동 사진이다.
레인 M: 1 kb 래더 DNA 분자량 마커
레인 1: 0 ng 청충 mRNA
레인 2: 50 ng 청충 mRNA
레인 3: 100 ng 청충 mRNA 를 주형으로하여 중합효소 연쇄반응한 생성물 화살표는 1 Kb 의 페리틴 cDNA 밴드를 나타낸다.
도 2는 중합효소 연쇄반응에서 얻은 1 Kb DNA 단편의 염기 서열 및 이 서열로 유도된 아미노산 서열이다.
도 3은 청충 유래 성숙 페리틴의 아미노산 서열이다.
도 4는 청충 유래 성숙 페리틴의 유전자가 클로닝되어 있는 대장균 발현용 플라스미드(pT7-Fer)의 모식도이다.
도 5는 청충 유래 성숙 페리틴 유전자가 클로닝되어 있는 pT7-Fer가 도입된 대장균 형질전환체에 IPTG를 첨가하여 배양함으로써 유도된 페리틴을 SDS-PAGE로 분석한 사진이다.
레인 M: 단백질 분자량 마커
레인 1: IPTG 유도전
레인 2: IPTG 유도후 1시간
레인 3: IPTG 유도후 2시간
레인 4: IPTG 유도후 4시간
화살표는 발현 유도된 성숙 페리틴 밴드를 나타낸다.
도 6은 청충 유래 성숙 페리틴의 유전자가 클로닝되어 있는 바실러스 발현용 플라스미드(pHPS-Fer)의 모식도이다.
PaprE 및 SS_AprE: AprE 프로모터 및 AprE 단백질 분비 시그널 서열
Ori322 및 Rep(pTA): 각각 E coli에서 플라스미드 복제에 필요한 복제원점 및 Bacillus Subtili에서 플라스미드 복제에 필요한 복제원점(replication origin)
Cm 및 Em: 각각 chloroamphenicol 및 erythromycin의 저항성을 갖는 선별마커(selection marker)이다.
도 7은 청충 유래 성숙 페리틴 유전자가 클로닝되어 있는 pHPS-Fer가 도입된 바실러스 형질전환체를 배양함으로써 유도된 페리틴을 SDS-PAGE(A) 및 Western blotting(B)으로 분석한 사진이다.
레인 M: 단백질 분자량 마커
레인 1: 접종 전
레인 2: 배양 후 12시간
레인 3: 배양 후 24시간
화살표는 발현된 성숙 페리틴 밴드를 나타낸다.
도 8은 청충 유래 재조합 페리틴의 유전자가 클로닝되어 있는 pHPS-Fer가 도입된 바실러스 형질전환체로부터 24 시간 동안 배양하여 생산된 재조합 페리틴의 native PAGE(A) 및 철 결합 활성을 철 staining (B)으로 분석한 사진이다. 화살표는 발현된 성숙 페리틴 밴드를 나타낸다.
도 8은 재조합 페리틴 단백질의 철 결합 활성 염색 결과를 분석한 사진이다.1 is a 1% agarose gel electrophoresis picture showing the results of polymerase chain reaction using the Ferr-F1 primer and Ferr-R1 primer pair of the present invention.
Lane M: 1 kb ladder DNA molecular weight marker
Lane 1: 0 ng Chungchung mRNA
Lane 2: 50 ng worm mRNA
Lane 3: Product arrow chained with 100 ng Chung mRNA as a template indicates a 1 Kb ferritin cDNA band.
Figure 2 shows the nucleotide sequence of the 1 Kb DNA fragment obtained from the polymerase chain reaction and the amino acid sequence derived from this sequence.
3 is the amino acid sequence of the larval derived mature ferritin.
4 is a schematic diagram of the E. coli expression plasmid (pT7-Fer) in which the gene of the worm-derived mature ferritin is cloned.
FIG. 5 is a photograph showing analysis of ferritin induced by SDS-PAGE by adding IPTG to E. coli transformants into which pT7-Fer, which is cloned from a worm-derived mature ferritin gene, was introduced.
Lane M: protein molecular weight marker
Lane 1: Before Induction of IPTG
Lane 2: 1 hour after induction of IPTG
Lane 3: 2 hours after IPTG induction
Lane 4: 4 hours after IPTG induction
Arrows indicate expression induced mature ferritin bands.
6 is a schematic diagram of Bacillus expression plasmid (pHPS-Fer) in which the gene of the worm-derived mature ferritin is cloned.
PaprE and SS_AprE: AprE promoter and AprE protein secretion signal sequence
Ori322 and Rep (pTA): Replication origin and Bacillus for plasmid replication in E coli , respectively Replication origin for plasmid replication in Subtili
Cm and Em: Selection markers with resistance of chloroamphenicol and erythromycin, respectively.
Figure 7 is a photograph of ferritin induced by culturing Bacillus transformants introduced with the pHPS-Fer cloned with the mature ferritin gene derived from the worms by SDS-PAGE (A) and Western blotting (B).
Lane M: protein molecular weight marker
Lane 1: Before Inoculation
Lane 2: 12 hours after incubation
Lane 3: 24 hours after incubation
Arrows indicate mature ferritin bands expressed.
FIG. 8 shows iron staining (B) of native PAGE (A) and iron binding activity of recombinant ferritin produced by incubating for 24 hours from a Bacillus transformant in which a PSPS-Fer-derived recombinant ferritin gene was cloned. It is a photograph analyzed. Arrows indicate mature ferritin bands expressed.
8 is a photograph analyzing the results of iron binding activity staining of recombinant ferritin protein.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명 하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not to be construed as limiting the scope of the present invention. It will be self-evident.

실시예Example

<실시예 1> 청충으로부터 mRNA 분리Example 1 mRNA Separation from Blackworm

본 발명에서는 페리틴의 아미노산 서열을 결정하기 위해 먼저 청충(두토막눈썹 참갯지렁이, Perinereis aibuhitensis, 여수 근교 갯벌 서식)으로부터 mRNA를 분리하여 이를 역전사반응시켜 cDNA를 제조하였다. 이를 위해 먼저 청충의 장 조직을 분리한 후 샘부르크 등의 방법(Sambrook 등 Molecular Cloning 3rd Ed. Cold Spring Harbor Laboratory, 2001)을 변형하여 mRNA를 분리하였다. 구체적으로, 청충으로부터 분리한 장 조직 1 g에 10 ㎖의 변성 용액(4 M 구아니디움 이소티오시아네이트, 25 mM 소듐 시트레이트, pH 7.0, 0.5% 사코실 및 0.1 M 2-머캅토에탄올)을 넣은 후 얼음 하에서 파쇄하고, 5,000 rpm에서 15분 동안 원심분리하여 상등액을 회수하였다. 이 상등액에 동량의 페놀과 클로로포름을 넣어 4 내지 5회 반복 추출하여 단백질을 제거하고, 상기 단백질 제거된 상등액에 2 M 초산 나트륨과 이소프로필 알콜(isopropanol, Sigma, USA)을 첨가하여 총 세포 RNA 침전물을 회수하여 여기에 DEPC(diethylpyrocarbonate, Sigma, USA)로 처리한 증류수를 첨가해 RNA 침전물을 녹여 RNA를 수득하였다. 올리고 dT(oligo-dT) 셀룰로스컬럼(Collaborative Biomedical Products, USA)을 사용하여 샘부르크 등의 방법에 따라 이렇게 수득된 총 세포 RNA로부터 mRNA를 정제하였다. 정제한 mRNA 용액을 260 nm와 280 nm의 파장에서 각각 흡광도를 측정하여 RNA의 양과 순도를 결정한 후 cDNA 합성을 위한 역전사 반응의 주형으로 사용하였다.
In the present invention, in order to determine the amino acid sequence of ferritin , cDNA was prepared by first separating the mRNA from the larvae (chima eyebrow earthworm , Perinereis aibuhitensis, Yeosu subtidal habitat) and reverse transcription. To this end, first, the intestinal tissues of the larvae were isolated, and mRNA was isolated by modifying the method of Samburg et al. (Sambrook et al., Molecular Cloning 3rd Ed. Cold Spring Harbor Laboratory, 2001). Specifically, 10 ml of denatured solution (4 M guanidium isothiocyanate, 25 mM sodium citrate, pH 7.0, 0.5% sacosyl and 0.1 M 2-mercaptoethanol) in 1 g of intestinal tissue isolated from larvae After crushing under ice and centrifuged for 15 minutes at 5,000 rpm to recover the supernatant. Into the supernatant, the same amount of phenol and chloroform were extracted 4 to 5 times to remove the protein, and 2 M sodium acetate and isopropyl alcohol (isopropanol, Sigma, USA) were added to the supernatant. The distilled water treated with DEPC (diethylpyrocarbonate, Sigma, USA) was added thereto to dissolve the RNA precipitate to obtain RNA. MRNA was purified from total cellular RNA thus obtained according to the method of Semburg et al. Using an oligo-dT cellulose column (Collaborative Biomedical Products, USA). Purified mRNA solution was used as a template for reverse transcription for cDNA synthesis after determining the amount and purity of RNA by measuring the absorbance at wavelengths of 260 nm and 280 nm, respectively.

<실시예 2> 청충의 cDNA 라이브러리 제조Example 2 Preparation of Chungcheong cDNA Library

상기 실시예 1에서 청충으로부터 분리한 mRNA를 이용해 cDNA 라이브러리 합성키트(BD Science, USA)를 이용하여 cDNA 라이브러리를 제조하였다. cDNA 라이브러리 제조 방법은 제조사의 방침에 따라 수행하였다. cDNA 라이브러리를 제조하기 위한 프라이머로는 하기의 서열을 갖는 프라이머를 사용하였다. cDNA의 제조는 구체적으로, 상기 실시예 1에서 분리한 mRNA 5 ㎍, 서열번호 5로 기재되는 CDS3' 프라이머(5' ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30NN 3', 10 uM) 1 ㎕, 서열번호 6으로 기재되는 CDS5' 프라이머(5' AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG 3', 10 uM) 1 ㎕, 적당량의 DEPC 처리된 물을 혼합하여 42℃에서 1시간 동안 반응한 후 25 mM NaOH 1 ㎕를 가하여 68℃에서 30분 동안 방치시켜 mRNA의 2차 구조를 제거하였다. 2차 구조가 제거된 상기 반응물 11 ㎕, DEPC 처리된 물 71 ㎕, 10 X 반응 완충용액 10 ㎕, 10 mM dNTP 혼합용액 2 ㎕, 서열번호 5로 기재되는 CDS3' 프라이머(10 uM) 2 ㎕, 서열번호 7로 기재되는 5' PCR 프라이머(5' AAGCAGTGGTATCAACGCAGAGT 3', 10 uM) 2 ㎕, 중합효소(Advantage 2 polymerase, 50X) 2 ㎕를 가하여 최종 부피가 100 ㎕가 되게 한 후 95℃에서 1분, 72℃에서 10분 동안 반응시킨 후, 95℃에서 1분, 68℃에서 10분 동안 반응을 3번 반복하여 이중 나선의 cDNA를 합성하고 페놀-클로로포름 추출과 에탄올 침전에 의해 합성된 cDNA를 회수하였다.CDNA library was prepared using cDNA library synthesis kit (BD Science, USA) using mRNA isolated from the worms in Example 1. The cDNA library preparation method was performed according to the manufacturer's policy. As a primer for preparing the cDNA library, a primer having the following sequence was used. Specifically, the preparation of cDNA was carried out by 5 μg of mRNA isolated from Example 1, CDS3 ′ primer (5 ′ ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) 30 NN 3 ′, 10 uM) described in SEQ ID NO: 5, 1 μl, SEQ ID NO: 6 1 μl of a CDS5 ′ primer (5 ′ AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG 3 ′, 10 uM) described above was mixed with an appropriate amount of DEPC treated water for 1 hour at 42 ° C., and 1 μl of 25 mM NaOH was added thereto for 30 minutes at 68 ° C. It was left to remove the secondary structure of the mRNA. 11 μl of the reaction with the secondary structure removed, 71 μl of DEPC treated water, 10 μl of 10 × reaction buffer, 2 μl of 10 mM dNTP mixed solution, 2 μl of CDS3 ′ primer (10 uM) as set forth in SEQ ID NO: 5, 2 μl of 5 ′ PCR primer (5 ′ AAGCAGTGGTATCAACGCAGAGT 3 ′, 10 uM) as set forth in SEQ ID NO: 7 and 2 μl of Polymerase (Advantage 2 polymerase, 50X) were added so that the final volume was 100 μl, followed by 1 minute at 95 ° C. After 10 minutes at 72 ° C, the reaction was repeated three times for 1 minute at 95 ° C and 10 minutes at 68 ° C to synthesize double-stranded cDNA, and recover the synthesized cDNA by phenol-chloroform extraction and ethanol precipitation. It was.

cDNA 라이브러리 제조를 쉽게 하기 위하여 회수한 cDNA를 79 ㎕의 DEPC 처리한 물에 녹이고, 10 ㎕의 10X Sfi I 반응 완충용액, 1 ㎕의 BSA 용액(10 ㎍/㎕) 및 10 ㎕의 Sfi I(10 U/㎕, Promega, USA)를 가한 뒤 50℃에서 2시간 동안 반응시켜 합성된 cDNA의 5' 말단 및 3' 말단에 Sfi I 제한 효소 자리가 생성되도록 하였다. Sfi I 으로 처리한 cDNA 용액을 크로마스핀-400 컬럼(BD Bioscience, USA)에 전개하여 컬럼으로부터 빠져나오는 용액을 1 방울씩 받아 cDNA의 크기별로 회수하여 0.5 kb 이상 되는 크기의 cDNA 만을 모았다. 상기 cDNA는 에탄올 침전에 의해 회수한 후 침전물을 7 ㎕의 멸균 수에 녹였다. 위의 cDNA 용액 1 ㎕, Sfi I 제한 효소로 처리한 람다 트리플렉스2 벡터(500 ng/㎕)(BD Science, USA) 1 ㎕, 10X 라이게이션 완충 용액 0.5 ㎕, 증류수 2 ㎕ 및 라이게이즈 효소 0.5 ㎕를 가하여 총 부피가 5 ㎕가 되게 하여 16℃에서 16시간 동안 반응시켜 상기 회수된 cDNA가 람다 트리플렉스2 벡터의 Sfi I 제한효소 인식부위에 삽입되도록 하였다.To facilitate cDNA library preparation, the recovered cDNA was dissolved in 79 μl of DEPC treated water, 10 μl of 10 × Sfi I reaction buffer, 1 μl of BSA solution (10 μg / μl) and 10 μl of Sfi I (10 U / μl, Promega, USA) was added and reacted at 50 ° C. for 2 hours to generate Sfi I restriction enzyme sites at the 5 ′ and 3 ′ ends of the synthesized cDNA. The cDNA solution treated with Sfi I was developed on a chromapin- 400 column (BD Bioscience, USA), and received one drop of the solution from the column, and collected by the size of the cDNA to collect only cDNA having a size of 0.5 kb or more. The cDNA was recovered by ethanol precipitation and then the precipitate was dissolved in 7 μl of sterile water. 1 μl cDNA solution above, 1 μl lambda triplex2 vector (500 ng / μl) treated with Sfi I restriction enzyme (BD Science, USA), 0.5 μl 10X ligation buffer solution, 2 μl distilled water and ligation enzyme 0.5 μl was added to a total volume of 5 μl and reacted at 16 ° C. for 16 hours to allow the recovered cDNA to be inserted into the Sfi I restriction enzyme recognition site of the lambda triplex2 vector.

다음으로, 제조사의 지침에 따라 시험관내 패키징(In vitro packaging, GigaPackII, Stratagene, USA) 반응을 시킨 다음, 이를 대장균 XL1-Blue MRF' 균주(Invitrogen, USA)에 감염시켰다. 상기 감염된 대장균을 탑 아가로즈와 섞어 IPTG와 X-Gal이 잘 도포된 한천배지 위에 플레이팅하여 37℃에서 배양하여 플라크를 형성하도록 하였다. 형성된 전체 플라크 수 및 흰 플라크의 수를 측정하여 재조합 플라크(white color)의 생성 효율을 확인하여 플라크 형성능(titer)을 결정하였다. 안정하고 높은 타이터를 갖는 라이브러리를 만들기 위해 재조합 파지를 한천 플레이트(150 mm) 당 50,000 플라크 정도가 형성 되도록 숙주 세포에 감염하여 증폭한 후 SM 용액(5.8 g NaCl, 2 g MgSO4, 1M Tris-HCl 50 ㎖, pH 7.5, 2% 젤라틴 2 ㎖/리터)을 사용하여 재조합 파지들을 추출하여 타이터를 결정하고(1x106 pfu), DMSO를 첨가하여 -80℃에 보관하였다. 또한, 이 초기 cDNA 라이브러리를 다시 숙주세포에 감염시켜 2 x 1011 pfu로 플라크를 증폭시켰다.
Next, in vitro packaging (In vitro packaging, GigaPackII, Stratagene, USA) reaction was carried out according to the manufacturer's instructions, and then infected with E. coli XL1-Blue MRF 'strain (Invitrogen, USA). The infected E. coli was mixed with top agarose and plated on agar plate coated with IPTG and X-Gal to incubate at 37 ° C. to form a plaque. Plaque formation ability (titer) was determined by measuring the total number of plaques formed and the number of white plaques to determine the production efficiency of the recombinant plaque (white color). To generate a stable, high titer library, recombinant phages were infected and amplified to host cells to form about 50,000 plaques per agar plate (150 mm), followed by SM solution (5.8 g NaCl, 2 g MgSO 4 , 1 M Tris-). Recombinant phages were extracted using HCl 50 mL, pH 7.5, 2 mL / liter 2% gelatin to determine titer (1 × 10 6 pfu), and DMSO was added and stored at −80 ° C. This initial cDNA library was also infected with host cells again to amplify plaques with 2 × 10 11 pfu.

<실시예 3> 청충 페리틴 유전자의 염기서열 분석 및 이로부터 번역되는 아미노산 서열의 분석<Example 3> Analysis of the nucleotide sequence of the Chungcheong ferritin gene and the amino acid sequence translated therefrom

본 발명은 청충 페리틴을 발현하는 유전자를 상기의 실시예 2에서 제조한 청충의 cDNA 라이브러리에서 중합연쇄반응 방법으로 증폭한 후에 클로닝하고 증폭된 페리틴 유전자는 대장균의 플라스미드인 pGEM T easy 플라스미드(Promega, USA)에 삽입하였다. 상기 실시예 2에서 제조한 청충 cDNA 라이브러리를 주형으로 하고 서열번호 8로 기재되는 Fer-F1 프라이머(5' AAAACTTTGATATCGACTGTATCTTGGGAC 3', 10 uM) 및 서열번호 9로 기재되는 Fer-R1 프라이머(5' CTCTTGACCTTATAGGTAGGTCATCTA 3', 10 uM) 쌍으로 하여 중합효소 연쇄반응을 시켰다. 이때, 중합효소 연쇄반응은 상기 기재된 프라이머를 각각 1 pmole 농도로 첨가하였으며, 10X 반응 완충용액, 0.5 mM dNTP, Taq DNA 중합효소 1-2 unit를 넣고 95℃에서 5분간 전처리 하고, 이후에 95℃ 1분, 65℃ 1분, 72℃ 2분의 연속 반응을 30회 반복하여 DNA를 증폭한 후에, 72℃에서 10분간 처리하여 반응을 마무리 지었다. 중합 연쇄반응 방법 후 1% 아가로즈 젤(TAE 완충용액) 전기영동으로 DNA 절편의 생산을 확인하고(도 1), 상기 증폭된 약 1 Kb 크기의 DNA 절편을 겔로부터 분리하여, 이를 pGEM-T easy 플라스미드에 서브클로닝하고 그의 염기서열을 결정한 뒤 그로부터 번역되는 아미노산 서열을 알아보았다. 그 결과, 클로닝된 페리틴은 서열번호 3으로 기재되는 염기서열을 가짐을 알 수 있었으며, 전체 DNA의 크기는 1027 bp로 개방해독틀(open reading frame)의 크기는 종료서열(TAA)를 포함하여 서열번호 4로 기재되는 522 bp이다. 본 발명에서 결정한 페리틴의 염기서열을 블라스트로 분석한 결과, 5’ 위치의 번역되지 않는 부분(5’-UTR)은 철 조절 단백질(iron regulatory protein)이 결합할 수 있도록 stem-loop 구조를 형성하는 iron response element 서열(서열 22-50번)을 가진다(도 2). 청충 유래의 페리틴 전구체는 서열번호 1로 기재되는 173개의 아미노산으로 구성되어 있으며(도 3), N-말단 부분에 16개의 아미노산으로 이루어진 분비서열 펩티드를 가지며 활성형 페리틴의 N-말단은 17번째 아미노산인 아스파트산(Asp)을 갖는 156개의 아미노산으로 구성되어 있음을 알 수 있었다. 서열번호 1로 기재되는 페리틴의 아미노산 서열을 비교 분석한 결과, 여러 종의 페리틴과 아미노산 서열의 유사성을 보였다. 구체적으로, 흰이빨참갯지렁이(Periserrula leucophryna) 87%, 소진드기( Rhipicephalus microplus) 83%, 빗갯지렁이(Pectinaria gouldii) 80%, 참굴(Crassostrea gigas) 79%, 우렁이(Lymnaea stagnalis) 79%, 갯민숭달팽이(Aplysia californica) 76%, 진주조개(Pinctada fucata) 76%, 꼬막(Tegillarca granosa) 76%, 붉은 지렁이(Eisenia andrei) 76%, 창고기(Branchiostoma lanceolatum) 76%, 오분자기(Haliotis diversicolor) 75%, 백합(Meretrix meretrix) 72%, 가리맛조개(Sinonovacula constricta) 75%, 개구리 64%, 사람 H 사슬 64%, 쥐 H 사슬 63%, 소 H 사슬 63%, 돼지 H 사슬 60%, 강낭콩 56% 및 초파리 36%의 아미노산 서열 유사성을 나타냄을 확인하였다. 이에, 본 발명의 청충 유래의 페리틴은 기존의 페리틴 단백질과 서열 상동성이 적어 신규한 페리틴 임을 알 수 있었다.
The present invention is cloned after amplifying the gene expressing the worm ferritin in the cDNA library of the worms prepared in Example 2 by the polymerase chain reaction method and the amplified ferritin gene is pGEM T easy plasmid (plasma of Escherichia coli) (Promega, USA ) Is inserted. Fer-F1 primer (5 'AAAACTTTGATATCGACTGTATCTTGGGAC 3', 10 uM) described in SEQ ID NO: 8, and the Fer-R1 primer described in SEQ ID NO: 9 (5 'CTCTTGACCTTATAGGTAGGTCATCTA 3) ', 10 uM) pairs were subjected to a polymerase chain reaction. At this time, the polymerase chain reaction was added the primers described above at 1 pmole concentration, respectively, 10X reaction buffer, 0.5 mM dNTP, Taq DNA polymerase 1-2 unit was added and pretreated for 5 minutes at 95 ℃, then 95 ℃ The reaction was repeated 30 times for 1 minute, 65 DEG C, 1 minute, and 72 DEG C for 2 minutes to amplify DNA, followed by 10 minutes at 72 DEG C to complete the reaction. After the polymerase chain reaction method, 1% agarose gel (TAE buffer) electrophoresis confirmed the production of DNA fragments (FIG. 1), and the amplified DNA fragments of about 1 Kb were separated from the gels, which were then pGEM-T. After subcloning into an easy plasmid and determining its nucleotide sequence, the amino acid sequence translated therefrom was examined. As a result, it was found that the cloned ferritin had the nucleotide sequence shown in SEQ ID NO: 3, the total DNA size was 1027 bp, and the size of the open reading frame included the termination sequence (TAA). 522 bp described by number 4. As a result of blast analysis of the nucleotide sequence of the ferritin determined in the present invention, the non-translated portion (5'-UTR) at the 5 'position forms a stem-loop structure to which iron regulatory proteins can bind. have an iron response element sequence (SEQ ID NOS: 22-50) (FIG. 2). The ferritin precursor derived from the worms is composed of 173 amino acids of SEQ ID NO: 1 (Fig. 3), and has a secretory sequence peptide consisting of 16 amino acids in the N-terminal part, and the N-terminal of the active ferritin is the 17th amino acid. It was found that it is composed of 156 amino acids having phosphoric aspartic acid (Asp). A comparative analysis of the amino acid sequence of ferritin described in SEQ ID NO: 1 showed similarities between the various ferritin and amino acid sequences. Specifically, white toothed worm ( Periserrula leucophryna ) 87%, small tick ( Rhipicephalus microplus ) 83%, Rainworm ( Pectinaria gouldii ) 80% oysters ( Crassostrea gigas ) 79%, Lymnaea stagnalis ) 79%, Nympho ( Aplysia) californica ) 76%, mother-of-pearl ( Pinctada) fucata ) 76%, cockle ( Tegillarca granosa ) 76%, red earthworm ( Eisenia andrei ) 76%, warehouse ( Branchiostoma lanceolatum ) 76%, Haliotis diversicolor ) 75%, lily ( Meretrix meretrix ) 72%, Sinonovacula constricta 75%, frog 64%, human H chain 64%, rat H chain 63%, bovine H chain 63%, pig H chain 60%, kidney beans 56% and fruit fly 36% It was confirmed to show amino acid sequence similarity. Therefore, it was found that the ferritin derived from the worms of the present invention is a novel ferritin because the sequence homology with the existing ferritin protein is small.

<< 실시예Example 4> 페리틴의  4> ferritin 대장균에서In E. coli 발현용 플라스미드 구축  Expression Plasmid Construction

본 발명에서 분석된 청충의 페리틴 유전자가 클로닝 되어있는 플라스미드로부터 서열번호 2로 기재되는 활성형 페리틴을 대량 생산하기 위하여 중합효소 연쇄 반응을 수행함으로써 활성형 페리틴을 코딩하는 유전자를 증폭하였다. 이 때, 각 프라이머는 강력한 T7 프로모터를 갖는 pT7-7 플라스미드(Tabor S and Richardson C, A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc Natl Acad Sci USA, 262:10741078(1985))에 삽입이 잘 되도록 5'-말단에 Nde I, 3'-말단에 Hind III 제한 효소 자리를 갖게끔 서열번호 10으로 기재되는 Ferr-T7F 프라이머(5' GGGGCATATGGAAGCAGGCATCAACAAACAGATCAAC 3' , 10 uM) 및 서열번호 11로 기재되는 Ferr-T7R 프라이머(5' CCCCAAGCTTTTAGCTGTCAAGGTCTTTGTCGAAGG 3', 10 uM)를 합성하였다. 상기의 Ferr-T7F 프라이머의 밑줄친 부분은 Nde I 제한효소 인식부위 서열이고, Ferr-T7R 프라이머의 밑줄친 부분은 Hind III 제한효소 인식부위 서열이다. 상기 Ferr-T7F 및 Ferr-T7R로 기재되는 프라이머 쌍을 사용하여 중합효소 연쇄 반응을 수행해 증폭된 DNA 단편을 아가로즈 겔 전기영동한 후 DNA 용출 키트를 사용하여 유전자를 순수하게 분리하였다. 상기 분리된 청충 유래 성숙 페리틴 유전자 및 발현용 플라스미드 pT7-7를 Nde I 및 Hind III 로 각각 처리하고 아가로즈 겔 전기영동한 후 DNA 용출 키트를 사용하여 각각을 순수하게 분리하였다. 분리한 플라스미드와 성숙 페리틴 유전자를 삼부르크 등의 방법에 따라 DNA 단편을 라이게이션하고 형질전환하였다. 형질전환용 세포 E. coli BL21(DE3)(Invitrogen, USA) 100 ㎕에 라이게이션 반응된 DNA 0.1 내지 0.5 ㎍을 첨가하여 얼음에 30분간 방치한 후 42℃에서 1.5분간 열 충격을 주고, 1 ㎖의 LB 배지를 첨가하여 37℃에서 1시간 동안 배양한 후, 앰피실린(50 ㎍/㎖), IPTG 및 X-gal이 첨가된 엘비 아가 평판 배지에 도말하고 37℃에서 16시간 동안 배양하여 형질 전환체들을 얻었다. 형질 전환된 대장균은 항생제가 첨가된 엘비 액체배지에 접종하여 배양하고, 그 배양액의 일부를 취하여 알칼라인 용해 방법에 따라 플라스미드를 추출하여 클로닝된 부위의 제한효소로 절단하여 페리틴 DNA 단편이 도입되었는지를 확인하였다. 이렇게 하여 성숙 페리틴 유전자가 도입된 발현용 벡터를 “pT7-Fer”로 명명하였다(도 4).
The gene encoding the active ferritin was amplified by performing a polymerase chain reaction in order to mass-produce the active ferritin described in SEQ ID NO: 2 from the plasmid in which the ferritin gene of the larvae analyzed in the present invention was cloned. At this time, each primer is a pT7-7 plasmid having a strong T7 promoter (Tabor S and Richardson C, A bacteriophage T7 RNA polymerase / promoter system for controlled exclusive expression of specific genes. Proc Natl Acad Sci USA , 262: 10741078 (1985)), Nde at the 5'-end for proper insertion. I, at the 3'-end Hind Ferr-T7F primer as described in SEQ ID NO: 10 (5 'GGGG CATATG GAAGCAGGCATCAACAAACAGATCAAC 3', 10 uM) to have a III restriction enzyme site and Ferr-T7R primer as described in SEQ ID NO: 11 (5 'CCCC AAGCTT TTAGCTGTCAAGGTCTTTGTCGAAGG 3', 10 uM) was synthesized. The underlined portion of the above Ferr-T7F primer is Nde I restriction enzyme recognition sequence and underlined portion of Ferr-T7R primer is Hind III restriction enzyme recognition site sequence. The amplified DNA fragments were subjected to agarose gel electrophoresis using polymerase chain reaction using the primer pairs described as Ferr-T7F and Ferr-T7R, followed by pure separation of genes using a DNA elution kit. The isolated larva derived mature ferritin gene and expression plasmid pT7-7 Nde I and Hind Each was treated with III and subjected to agarose gel electrophoresis, followed by pure separation using a DNA elution kit. The isolated plasmid and the mature ferritin gene were ligated and transformed by DNA fragments according to Samburg et al. To transform the cells for transformation E. coli BL21 (DE3) (Invitrogen, USA) added 0.1 to 0.5 ug of ligation reaction DNA and left on ice for 30 minutes, heat shock at 42 ℃ for 1.5 minutes, 1 ml Incubated at 37 ° C. for 1 hour with LB medium, and then transformed by smearing in Elbia agar plate medium containing ampicillin (50 μg / ml), IPTG and X-gal and incubating at 37 ° C. for 16 hours. Got sieves. The transformed Escherichia coli was inoculated and cultured in an Elbi liquid medium to which antibiotics were added, and a portion of the culture was taken to extract a plasmid according to the alkaline lysis method, and cut with a restriction enzyme at the cloned site to confirm that the ferritin DNA fragment was introduced. It was. In this way, the expression vector into which the mature ferritin gene was introduced was named “pT7-Fer” (FIG. 4).

<< 실시예Example 5>  5> 대장균에서In E. coli 재조합 페리틴 단백질 유도 및  Recombinant ferritin protein induction and SDSSDS -- PAGEPAGE 분석 analysis

상기 실시예 4에서 재조합 플라스미드 pT7-Fer로 형질 전환된 E. coli BL21(DE3)를 암피실린(50 ㎍/㎖)을 포함하는 LB 배지에 접종하여 37℃에서 밤새 배양하여 종균으로 사용하였다. 암피실린을 포함하는 100 ㎖의 LB 배지(500 ㎖ 삼각 플라스크)에 상기 종균 1 ㎖을 취하여 접종한 후, 600 nm에서 흡광도가 0.6 내지 0.8에 도달할 때까지 키웠다. 단백질의 합성을 유도하기 위하여 IPTG를 1 mM이 되도록 첨가한 다음, 매 시간별로 배양액 1 ㎖을 취하여 단백질 분석을 위한 시료 제조를 위하여 사용하였다. 배양액으로부터 얻어진 균체를 SDS-PAGE 시료 처리 용액(0.05 M Tris-HCl, pH 6.8, 0.1 M DTT, 2% SDS, 10% 글리세롤 및 0.1% 브로모페놀 블루) 20 ㎕에 현탁하여 100℃에서 5분간 가열하여 세포를 파괴한 후 단백질 분석을 위하여 사용하였다. 단백질 전기영동은 램리등의 방법(Laemmli 1970, Nature , 227, 680-685)으로 수행하였다. 일정한 전기장에서 분리가 끝난 젤은 쿠마시 브릴리언트 블루 용액(Coomassie brilliant blue)에 넣어 1시간 정도 염색한 후 탈색용액(30% 메탄올, 10% 아세트산)에 옮겨 탈색하여 생산된 단백질을 확인하였다. 그 결과, ITPG 유도에 의해 시간이 지남에 따라 본 발명의 페리틴의 발현이 유도됨을 확인하였다(도 5).
In Example 4, E. coli BL21 (DE3) transformed with the recombinant plasmid pT7-Fer was inoculated in LB medium containing ampicillin (50 µg / ml) and cultured overnight at 37 ° C to be used as a seed. 1 ml of the seed was inoculated into 100 ml of LB medium (500 ml Erlenmeyer flask) containing ampicillin and grown at 600 nm until the absorbance reached 0.6 to 0.8. In order to induce the synthesis of protein, IPTG was added to 1 mM, and then 1 ml of the culture medium was taken every hour and used for preparing a sample for protein analysis. The cells obtained from the culture were suspended in 20 µl of SDS-PAGE sample treatment solution (0.05 M Tris-HCl, pH 6.8, 0.1 M DTT, 2% SDS, 10% glycerol and 0.1% bromophenol blue) for 5 minutes at 100 ° C. The cells were destroyed by heating and used for protein analysis. Protein electrophoresis was performed by Lamley et al . (Laemmli 1970, Nature , 227, 680-685). After the gel was separated in a constant electric field, the gel was placed in Coomassie brilliant blue and dyed for about 1 hour, and then transferred to a decolorizing solution (30% methanol, 10% acetic acid) to identify the produced protein. As a result, it was confirmed that the expression of ferritin of the present invention is induced over time by ITPG induction (FIG. 5).

<< 실시예Example 6> 페리틴의  6> ferritin 바실러스Bacillus 발현용 플라스미드 구축  Expression Plasmid Construction

본 발명에서 분석된 청충 유래 페리틴을 코딩하는 서열번호 4의 DNA 서열이 클로닝 되어있는 pT7-Fer 플라스미드와 AprE 프로모터 및 세포 밖으로 단백질을 분비하기 위한 신호 서열(Signal sequence)을 갖는 바실러스 형질전환용 pHPS-SP(Cai Heng et al., Expression and secretion of an acid-stable a-amylase gene in Bacillus subtilis by SacB promoter and signal peptide, Biotechnology Letters 27:17311736(2005))을 Nde I과 Eco RI으로 처리하고 전기 영동한 후 DNA 용출 키트로 각각 분리하였다. 분리한 각 페리틴 DNA 단편 및 pHPS-SP DNA 단편을 접합시킨 후, E.coli JM109에 실시예 4와 같이 형질전환시켰다. 형질전환체로부터 플라스미드를 추출하여 클로닝된 부위의 제한효소로 절단하여 서열번호 4의 DNA 단편이 도입되었는지를 확인한 후, 상기 형질전환 벡터를 “pHPS-Fer”로 명명하였다(도 6). 형질전환된 대장균으로부터 pHPS-Fer 플리스미드를 분리하고 말로니 등(Mallonee 등 1989, Appl. Environ. Microbiol. 55: 2517-2521)의 방법으로 상기 pHPS-Fer 플리스미드 DNA로 바실러스 균주를 형질전환 하였다. 구체적으로, B. subtilis를 티에스비(TSB, trypsic soy browth) 배지에 접종하고 37℃에서 하루 동안 배양하였다. 상기 배양액을 12.5 ㎖의 PGY 배지(1.5% 펩톤/0.5% 포도당/0.5% 이스트 추출물)에 1% 되게 접종한 후 600 nm에서 흡광도가 약 0.5에 도달할 때까지 배양하고 12.5 ㎖의 PGY/0.5 M 수크로스 배지와 최종 농도가 10 U/ml 되게 페니실린을 가하고 2시간 동안 더 배양하였다. 원심분리하여 세포를 회수하고, 회수한 세포를 2.5 ㎖의 SMMT 용액(0.5M 수크로스/20mM 말레이트/20mM MgCl2/TSB)에 현탁시키고, 최종 농도가 10 mg/㎖되게 리소자임을 가하고 35℃에서 1 시간 반응하였다. 원심분리하여 세포를 회수하고, 회수한 세포를 2 ㎖의 SMMT 용액에 현탁시킨 후 0.1 ㎖씩 분주하여 형질 전환용 세포로 사용하였다. 상기의 방법으로 제조한 B. subtilis 형질전환용 세포용액 0.1 ㎖에 0.1 ㎖의 pHPS-Fer 플라스미드 DNA(약 1㎍), 1.5 ㎖의 40% PEG8000 용액을 가한 후 잘 혼합하여 주고 0℃에서 2.5 분간 방치 후 37℃에서 약 5 분 동안 더 배양하였다. 상기 배양액에 5 ㎖의 SMMP(0.5M 수크로스/20mM 말레이트/20mM MgCl2/1.5% 펩톤/0.5% 포도당/0.5% 이스트 추출물) 용액을 가한 후 간단하게 혼합한 후 원심분리하여 세포를 회수하였다. 상기의 회수한 세포에 1 ㎖의 SMMP 용액을 가한 후 30℃에서 약 30분 동안 배양하고 클로로암페니콜을 포함하는 TSB 아가 플레이트에 도말한 후 37℃에서 2-5 일간 배양하여 형질 전환체들을 얻었다. 형질 전환된 바실러스는 클로로암페니콜이 첨가된 TSB 액체배지에 접종하여 배양하고, 그 배양액의 일부를 취하여 알칼라인 용해 방법에 따라 플라스미드를 추출하여 클로닝된 부위의 제한효소로 절단하여 페리틴 DNA 단편이 도입되었는지를 확인하였다.
PHPS- for Bacillus transformation having a pT7-Fer plasmid in which the DNA sequence of SEQ ID NO: 4 encoding the worm-derived ferritin analyzed in the present invention and a signal sequence for secreting proteins outside the cell and AprE promoter SP: the (Cai Heng et al, Expression and secretion of an acid-stable a -amylase gene in Bacillus subtilis by SacB promoter and signal peptide, Biotechnology Letters 27. 17311736 (2005)) Nde I and Eco After treatment with RI and electrophoresis, each was separated by DNA elution kit. Each ferritin DNA fragment and pHPS-SP DNA fragment isolated were conjugated and transformed into E. coli JM109 as in Example 4. After extracting the plasmid from the transformant and cutting it with the restriction enzyme of the cloned site to confirm that the DNA fragment of SEQ ID NO: 4 was introduced, the transformation vector was named “pHPS-Fer” (FIG. 6). The pHPS-Fer plasmid was isolated from the transformed Escherichia coli, and the Bacillus strain was transformed with the pHPS-Fer plasmid DNA by Maloney et al. (Mallonee et al. 1989, Appl. Environ. Microbiol. 55: 2517-2521). . Specifically, B. subtilis was inoculated in TSB (trypsic soy browth) medium and incubated at 37 ° C. for one day. The culture was inoculated 1% in 12.5 ml PGY medium (1.5% peptone / 0.5% glucose / 0.5% yeast extract), and then cultured at 600 nm until the absorbance reached about 0.5 and 12.5 ml of PGY / 0.5 M Sucrose medium and penicillin were added to a final concentration of 10 U / ml and further incubated for 2 hours. The cells were recovered by centrifugation, and the cells were suspended in 2.5 ml of SMMT solution (0.5M sucrose / 20mM maleate / 20mM MgCl 2 / TSB), and lysozyme was added at a final concentration of 10 mg / ml, followed by 35 ° C. Reaction was carried out for 1 hour. The cells were recovered by centrifugation, and the recovered cells were suspended in 2 ml of SMMT solution and then aliquoted in 0.1 ml to be used as cells for transformation. B. subtilis prepared by the above method 0.1 ml of pHPS-Fer plasmid DNA (about 1 µg) and 1.5 ml of 40% PEG8000 solution were added to 0.1 ml of the cell solution for transformation, and the mixture was mixed well and left at 0 ° C. for 2.5 minutes and then at 37 ° C. for about 5 minutes. It was further cultured. 5 ml of SMMP (0.5M sucrose / 20mM maleate / 20mM MgCl 2 /1.5% peptone / 0.5% glucose / 0.5% yeast extract) solution was added to the culture, followed by simple mixing and centrifugation to recover the cells. . After adding 1 ml of SMMP solution to the recovered cells, the cells were incubated at 30 ° C. for about 30 minutes, plated on a TSB agar plate containing chloroamphenicol, and then cultured at 37 ° C. for 2-5 days to transformants. Got it. The transformed Bacillus was inoculated and cultured in TSB liquid medium to which chloroamphenicol was added, and a portion of the culture solution was taken, the plasmid was extracted according to the alkaline lysis method, and digested with restriction enzymes at the cloned site to introduce ferritin DNA fragments. It was confirmed.

<< 실시예Example 7>  7> 바실러스에서In Bacillus 재조합 페리틴 단백질 유도 및  Recombinant ferritin protein induction and SDSSDS -- PAGEPAGE 분석 analysis

상기 실시예 6에서 재조합 플라스미드 pHPS-Fer로 형질 전환된 B. subtilis를 클로로암페니콜을 포함하는 TSB 액체배지에 접종하여 37℃에서 밤새 배양하여 종균으로 사용하였다. 클로로암페니콜을 포함하는 100 ㎖의 TSB 배지(500 ㎖ 삼각 플라스크)에 상기 종균 1 ㎖을 취하여 접종한 후, 매 시간별로 배양액 1 ㎖을 취하여 원심분리(10,000 X g, 10 min)하여 세포 배양액을 회수하였다. 상기 배양액 0.1 ㎖에 2배 부피의 에탄올을 첨가하여 잘 혼합한 후 -20℃에서 약 1시간 동안 방치 후 원심분리(13,000 X g, 15 min)하여 침전물을 회수하고 상온에서 30분간 방치하여 잔존하는 에탄올을 제거하고 단백질 분석을 위한 시료 제조를 위하여 사용하였다. 상기 침전물을 SDS-PAGE 시료 처리 용액 20 ㎕에 현탁하여 100℃에서 5분간 가열하고 실시예 5의 방법으로 전기영동하여 본 발명의 페리틴 발현을 확인하였으며(도 7A), 페리틴 항체를 이용하여 항체 면역 블라팅(Western blotting) 한 결과 분자량 약 20 kDa에서 밴드를 나타내어 본 발명의 페리틴 발현을 확인하였다(도 7B).
 B. subtilis transformed with recombinant plasmid pHPS-Fer in Example 6 was inoculated in TSB liquid medium containing chloroamphenicol and incubated overnight at 37 ° C. to be used as a seed. 1 ml of the seed was inoculated into 100 ml TSB medium (500 ml Erlenmeyer flask) containing chloroamphenicol, and then 1 ml of the culture medium was taken every hour and centrifuged (10,000 X g, 10 min). Was recovered. After mixing well with 0.1 mL of the culture volume, double volume of ethanol was mixed well and left for 1 hour at -20 ° C, followed by centrifugation (13,000 X g, 15 min) to recover the precipitate and left to stand at room temperature for 30 minutes. Ethanol was removed and used for sample preparation for protein analysis. The precipitate was suspended in 20 μl of SDS-PAGE sample treatment solution, heated at 100 ° C. for 5 minutes and electrophoresed by the method of Example 5 to confirm the expression of ferritin of the present invention (FIG. 7A). Blotting (Western blotting) showed a band at a molecular weight of about 20 kDa to confirm the ferritin expression of the present invention (Fig. 7B).

<< 실시예Example 8> 재조합 페리틴 단백질의 철 결합 활성 염색 8> Iron-binding Active Staining of Recombinant Ferritin Proteins

상기 실시예 7에서 생산한 재조합 페리틴의 철 결합 활성 여부 문헌(Joo 등, J. Microbiol . 44:54-63(2006))에 기재된 방법에 따라 측정하였다. 구체적으로 상기 배양액 0.1 ㎖에 2배 부피의 에탄올을 첨가하여 잘 혼합한 후 -20℃에서 약 1시간 동안 방치 후 원심분리(13,000 X g, 15분)하여 침전물을 회수하고 상온에서 30분간 방치하여 잔존하는 에탄올을 제거하고 철 결합 활성 분석을 위한 시료 제조를 위하여 사용하였다. 상기 침전물을 native PAGE 시료 처리 용액(0.05 M Tris-HCl, pH 6.8, 10% 글리세롤 및 0.1% 브로모페놀 블루) 20 ㎕에 현탁하고, 전기영동은 램리(Laemmli) 등의 방법으로 수행하였다. 이 때, 사용한 native PAGE 젤 농도는 8%로 하였으며, 전개 용액은 SDS를 제거한 용액을 사용하였으며, 냉장실에서 전기영동을 실시하여, PAGE 젤의 열 발생을 최소화 하였다. 일정한 전기장에서 분리가 끝난 젤은 쿠마시 브릴리언트 블루 용액(Coomassie brilliant blue)에 넣어 1시간 정도 염색한 후 탈색용액(30% 메탄올, 10% 아세트산)에 옮겨 탈색하여 생산된 단백질을 확인하였다(도 8A). 철 결합 활성은 다음의 방법으로 실시하였다. 간단하게 설명하면, 25 ㎖의 용액 A(1 ㎖ HCl/24 ㎖ 증류수)와 25 ㎖의 용액 B(1 g potassium ferricyanide/25 ㎖ 의 증류수)를 혼합한 용액에 PAGE 겔을 조심스럽게 넣고 상온에서 약 15분간 서서히 저어 주어주었다. 이 때, PAGE 겔은 용액에 완전히 잠기도록 하였다. 교반 후, 반응 용액을 버리고 겔을 50 ㎖의 증류수를 가하고 상온에서 약 5분간 서서히 저어 주면서 겔을 세척하였으며, 세척 과정은 3 번 반복하였다. 세척한 겔에 50 ㎖의 기질용액(25 mg 디아미노벤지딘을 50 ㎖의 50 mM Tris-HCl, pH 7.5 용액에 녹인 용액) 및 40 ㎕의 H2O2를 가하고 상온에서 약 30-60분간 서서히 저어 주면서 밴드를 확인하였다. 실험결과 갈색의 밴드가 뚜렷하게 관찰되어 본 발명의 재조합 페리틴의 우수한 철 결합 활성을 확인할 수 있었다(도 8B).
Iron binding activity of the recombinant ferritin produced in Example 7 was measured according to the method described in Joo et al . , J. Microbiol . 44: 54-63 (2006). Specifically, the culture medium was mixed well by adding 2 times the volume of ethanol and left for 1 hour at -20 ° C, followed by centrifugation (13,000 X g, 15 minutes) to recover the precipitate and allowed to stand at room temperature for 30 minutes. Residual ethanol was removed and used for sample preparation for iron binding activity analysis. The precipitate was suspended in 20 µl of native PAGE sample treatment solution (0.05 M Tris-HCl, pH 6.8, 10% glycerol and 0.1% bromophenol blue), and electrophoresis was performed by Laemmli et al. At this time, the concentration of the native PAGE gel used was 8%, and the developing solution was used to remove the SDS, electrophoresis was performed in the refrigerating chamber to minimize the heat generation of the PAGE gel. After the gel was separated in a constant electric field, it was placed in Coomassie brilliant blue and stained for about 1 hour, and then transferred to a decolorizing solution (30% methanol, 10% acetic acid) to identify the produced protein (FIG. 8A). ). Iron binding activity was performed by the following method. In brief, a PAGE gel is carefully added to a solution of 25 ml of Solution A (1 ml HCl / 24 ml of distilled water) and 25 ml of Solution B (1 g potassium ferricyanide / 25 ml of distilled water) at room temperature. Stir gently for 15 minutes. At this time, the PAGE gel was completely submerged in solution. After stirring, the reaction solution was discarded and the gel was added to 50 ml of distilled water, and the gel was washed with gentle stirring at room temperature for about 5 minutes, and the washing process was repeated three times. To the washed gel, 50 ml of substrate solution (25 mg diaminobenzidine dissolved in 50 ml of 50 mM Tris-HCl, pH 7.5 solution) and 40 µl of H 2 O 2 were added slowly at room temperature for about 30-60 minutes. Stir and check the band. As a result, the brown band was clearly observed, confirming the excellent iron binding activity of the recombinant ferritin of the present invention (Fig. 8B).

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims (14)

서열목록 제1서열 또는 제2서열로 표시되는 아미노산 서열을 가지는 철 결합 활성 폴리펩타이드.
Iron binding active polypeptide having an amino acid sequence represented by SEQ ID NO: 1 or 2 sequence.
제 1 항에 있어서, 상기 폴리펩타이드는 두토막눈썹 참갯지렁이(Perinereis aibuhitensis)로부터 유래한 것을 특징으로 폴리펩타이드.
The method of claim 1, wherein the polypeptide is scum worms ( Perinereis aibuhitensis ) polypeptide.
제 1 항의 폴리펩타이드를 서브유닛(subunit)으로서 포함하는 페리틴(ferritin).
A ferritin comprising the polypeptide of claim 1 as a subunit.
제 3 항에 있어서, 상기 페리틴은 단일 서브유닛으로 구성된 것을 특징으로 하는 페리틴.
4. The ferritin of claim 3, wherein the ferritin consists of a single subunit.
제 1 항의 폴리펩타이드를 코딩하는 뉴클레오타이드.
A nucleotide encoding the polypeptide of claim 1.
제 5 항에 있어서, 상기 뉴클레오타이드는 서열목록 제3서열 또는 제4서열로 표시되는 것을 특징으로 하는 뉴클레오타이드.
The nucleotide according to claim 5, wherein the nucleotide is represented by a third sequence or a fourth sequence of the sequence listing.
제 5 항 또는 제 6 항의 뉴클레오타이드를 포함하는 발현벡터.
An expression vector comprising the nucleotide of claim 5 or claim 6.
제 7 항에 있어서, 상기 발현벡터는 대장균 발현용 플라스미드 또는 바실러스 발현용 플라스미드인 것을 특징으로 하는 발현벡터.
8. The expression vector according to claim 7, wherein the expression vector is E. coli plasmid for expression or Bacillus expression plasmid.
제 7 항의 발현벡터로 형질전환된 숙주세포.
A host cell transformed with the expression vector of claim 7.
제 1 항 또는 제 2 항의 폴리펩타이드를 포함하는 철분 보충용 식품조성물.
A food composition for supplementing iron comprising the polypeptide of claim 1 or 2.
삭제delete 제 1 항 또는 제 2 항의 폴리펩타이드를 포함하는 사료첨가용 조성물.
Feed composition comprising a polypeptide of claim 1 or claim 2.
다음 단계를 포함하는 페리틴(ferritin) 발현용 형질전환 세포의 제조방법:
(a) 제 5 항 또는 제 6 항의 뉴클레오타이드를 발현벡터에 삽입시키는 단계; 및
(b) 상기 뉴클레오타이드가 삽입된 발현벡터로 세포를 형질전환시키는 단계.
Method for producing a transformed cell for ferritin expression (ferritin) comprising the following steps:
(a) inserting the nucleotide of claim 5 or 6 into an expression vector; And
(b) transforming the cell with the expression vector into which the nucleotide is inserted.
(a) 제 13 항의 형질전환 세포를 배양하여 폴리펩타이드를 생합성 하는 단계; 및 (b) 상기 생합성된 폴리펩타이드를 수득하는 단계를 포함하는 페리틴(ferritin) 생합성 방법.(a) culturing the transformed cells of claim 13 to biosynthesize the polypeptide; And (b) obtaining the biosynthesized polypeptide.
KR1020100129045A 2010-12-16 2010-12-16 Novel Ferritin Having Iron-binding Activity and Gene Encoding the Same KR101253505B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020100129045A KR101253505B1 (en) 2010-12-16 2010-12-16 Novel Ferritin Having Iron-binding Activity and Gene Encoding the Same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020100129045A KR101253505B1 (en) 2010-12-16 2010-12-16 Novel Ferritin Having Iron-binding Activity and Gene Encoding the Same

Publications (2)

Publication Number Publication Date
KR20120067569A KR20120067569A (en) 2012-06-26
KR101253505B1 true KR101253505B1 (en) 2013-04-11

Family

ID=46686547

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100129045A KR101253505B1 (en) 2010-12-16 2010-12-16 Novel Ferritin Having Iron-binding Activity and Gene Encoding the Same

Country Status (1)

Country Link
KR (1) KR101253505B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102346499B1 (en) 2020-08-26 2022-01-03 (주)터틀바이오 Recombinant Vector for Mass Production of Ferritin Protein and Mass Production Method of Ferritin Protein using the Recombinant Vector

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106800596B (en) * 2016-12-15 2020-08-04 大连海洋大学 Perinereis aibuhitensis G α recombinant protein, polyclonal antibody and G α protein E L ISA detection method

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020008530A (en) * 2000-07-21 2002-01-31 정봉현 Transformed recombinant yeast strain producing ferritin and process for preparation thereof
KR20020037634A (en) * 2000-11-15 2002-05-22 정웅 Method for mass-producing human ferritin using recombinant methylotropic yeasts
KR20020041062A (en) * 2000-11-27 2002-06-01 김대혁 Yeast expressing a ferritin protein for the bioavailability of an iron
JP2002218980A (en) * 2001-01-23 2002-08-06 Central Res Inst Of Electric Power Ind New ferritin

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020008530A (en) * 2000-07-21 2002-01-31 정봉현 Transformed recombinant yeast strain producing ferritin and process for preparation thereof
KR20020037634A (en) * 2000-11-15 2002-05-22 정웅 Method for mass-producing human ferritin using recombinant methylotropic yeasts
KR20020041062A (en) * 2000-11-27 2002-06-01 김대혁 Yeast expressing a ferritin protein for the bioavailability of an iron
JP2002218980A (en) * 2001-01-23 2002-08-06 Central Res Inst Of Electric Power Ind New ferritin

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102346499B1 (en) 2020-08-26 2022-01-03 (주)터틀바이오 Recombinant Vector for Mass Production of Ferritin Protein and Mass Production Method of Ferritin Protein using the Recombinant Vector

Also Published As

Publication number Publication date
KR20120067569A (en) 2012-06-26

Similar Documents

Publication Publication Date Title
EP3250692B1 (en) Promoter and uses thereof
CN108138206B (en) Method for preparing ergodiselenine
KR20130006513A (en) Enzyme involved in synthesis of equol
KR101511361B1 (en) Recombinant microorganism having enhanced heme productivity and biological method of producing heme using the same
US20110213142A1 (en) Method for Producing Biological Heme Iron, and Iron Supplementing Composition Containing the Heme Iron Produced By Same
KR101488481B1 (en) Glycoside hydrolase From lactic acid bacteria And Use Thereof
DK2570478T3 (en) REDUCTION AGENT OF MICROORGANISM RELATED TO BACILLUS GENES AND USE OF SAME
Amano et al. Recombinant expression, molecular characterization and crystal structure of antitumor enzyme, L-lysine α-oxidase from Trichoderma viride
KR20220121815A (en) Methods and compositions for culturing hemoglobin-dependent bacteria
KR101253505B1 (en) Novel Ferritin Having Iron-binding Activity and Gene Encoding the Same
CN108085333B (en) Method for delaying physiological deterioration of potato plants
JP2019500877A (en) Methods for preparing capsinoids by a biosynthetic process
KR101083974B1 (en) Gene encoding glutathione synthetase from Candida utilis
KR20120122990A (en) Glycoside hydrolase From lactic acid bacteria And Use Thereof
JP2009060807A (en) New chlorella, method for producing the same, and health food containing the chlorella
JP2023532703A (en) Amuc-1100 Polypeptide Variants to Confer Immune Signaling and/or Affect Intestinal Barrier Function and/or Modulate Metabolic State
WO2001068822A2 (en) Method of treating phenylketonuria and means therefor
KR102187479B1 (en) PGRP-SC2 protein from Rock bream and uses thereof
US20230383269A1 (en) Tetrameric alpha/beta hydrolase variants with increased temperature stability and methods of using and producing thereof
Seo et al. Molecular cloning and co-expression of phytoene synthase gene from Kocuria gwangalliensis in Escherichia coli
KR102513450B1 (en) Novel ectoine synthase and uses thereof
JP2001505773A (en) Tripaledoxin expression plasmid, production method, use, test system and drug
KR102427080B1 (en) Composition for alleviating or treating obesity comprising peptide fragment of SOCS6
KR102346499B1 (en) Recombinant Vector for Mass Production of Ferritin Protein and Mass Production Method of Ferritin Protein using the Recombinant Vector
KR102379746B1 (en) PRODUCTION OF γ-amino butyric acid BY RECOMBINANT GLUTAMATE DECARBOXYLASE FROM LACTOCOCCUS GARVIEAE MJF010

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
N231 Notification of change of applicant
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20160325

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20170104

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20180103

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20190108

Year of fee payment: 7