CN106800596B

CN106800596B - Perinereis aibuhitensis G α recombinant protein, polyclonal antibody and G α protein E L ISA detection method

Info

Publication number: CN106800596B
Application number: CN201611161183.0A
Authority: CN
Inventors: 赵欢; 周一兵; 李娜; 杨大佐; 赵子涵
Original assignee: Dalian Ocean University
Current assignee: Dalian Ocean University
Priority date: 2016-12-15
Filing date: 2016-12-15
Publication date: 2020-08-04
Anticipated expiration: 2036-12-15
Also published as: CN106800596A

Abstract

The invention discloses a perinereis aibuhitensis G α recombinant protein, a polyclonal antibody and a G α protein E L ISA detection method, which designs a specific primer through a G α open reading frame and obtains a target fragment through PCR, constructs a prokaryotic expression system of perinereis aibuhitensis G α protein, obtains purified perinereis aibuhitensis G α recombinant protein, prepares the polyclonal antibody thereof, establishes an E L ISA detection method of perinereis aibuhitensis G α protein, can determine the change condition of the perinereis aibuhitensis G α protein under the pollution of environmental estrogen by utilizing an E L ISA technology with simple method and strong specificity, and can provide an experimental basis and basis for a mechanism of the toxic effect of the environmental estrogen on the perinereis aibuhitensis.

Description

Perinereis aibuhitensis G α recombinant protein, polyclonal antibody and G α protein E L ISA detection method

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a perinereis aibuhitensis G α recombinant protein, a polyclonal antibody and a G α protein E L ISA detection method.

Background

The G protein is widely present on cell membranes and participates in various intracellular signal transduction processes, plays an important physiological role in a body, extracellular signals such as hormones, neurotransmitters, odors, chemotactic factors and the like firstly stimulate corresponding GPCRs on the cell membranes, and the activated GPCRs are coupled with the G protein to activate corresponding cell signal pathways to generate corresponding biological effects. Recent studies found that G protein and estrogen receptor coupled with the G protein mediate non-genomic effect of environmental estrogen in organisms, which provides possibility for detecting environmental estrogen effect by using G protein as biomarker. Perinereis aibuhitensis (P. aibuhitensis) belongs to Annelida, Polychaeta and Nereididae, and is a benthic organism inhabiting in sediments in intertidal zones. Unlike marine fishes, the clam worms, as a benthic organism, have a feeding property of humus and a life habit of being not easy to migrate remotely, so that the species is very easy to contact environmental pollutants, and some domestic scholars have started to use the organism as an ecological monitoring indicator organism for relevant research.

However, the current reports about the in vitro expression of the G protein are mostly concentrated on the G protein expression of invertebrate insects or the expression of virus G protein, but the in vitro induced expression of G α protein of Perinereis aibuhitensis and the preparation of polyclonal antibodies are not reported, so that the molecular level transcription mechanism of the Perinereis aibuhitensis under the environmental estrogen pollution cannot be deeply researched by adopting the E L ISA method.

Disclosure of Invention

The invention aims to solve the technical problems in the prior art and provides a polyclonal antibody of perinereis aibuhitensis G α protein and a G α protein E L ISA detection method.

The technical scheme of the invention is that the perinereis aibuhitensis G α recombinant protein is characterized by being prepared by the following steps in sequence:

a. extracting the total RNA of the perinereis aibuhitensis and synthesizing a cDNA first chain;

b. performing PCR amplification reaction by using a first strand of Perinereis aibuhitensis cDNA as a template, wherein the DNA sequences of an upstream primer and a downstream primer of the PCR reaction are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2;

c. recovering 1061bp of an amplification product, connecting a recovered target fragment with pMD18-T to construct a cloning plasmid pMD18-T-G α, recovering the cloning plasmid pMD18-T-G α, then transforming the recovered cloning plasmid pMD18-T-G α into competent cells DH5 α, and selecting a single clone;

d. transferring the monoclonal to 5ml Amp 100 mug/m L L B liquid culture medium, shaking at 37 ℃ and 200rpm for overnight culture, and extracting a recombinant plasmid pMD18-T-G α;

e. the recombinant plasmid pMD18-T-G α and the plasmid were digested with the restriction enzymes BamH I and Xho I, respectively

pET-28a, cutting glue and recovering a G α target fragment and a plasmid pET-28a, connecting the recovered G α target fragment and the plasmid pET-28a according to the molar ratio of 2.25: 1 by T4 DNA ligase at 16 ℃ for 14h, cutting glue and recovering a recombinant plasmid pET-28a-G α, then transforming the recombinant plasmid pET-28a-G α into a competent cell DH5 α, and picking a single clone;

f. transferring the monoclonal to 5ml Kan 100 mug/m L L B liquid culture medium, shaking and culturing at 37 ℃ and 200rpm overnight, and extracting a recombinant plasmid pET-28a-G α;

g. transforming a recombinant plasmid pET-28a-G α into a competent cell B L21 (DE 3), picking a single smooth bacterial colony in a flat plate, placing the single smooth bacterial colony in 5ml Kan 40 mu G/m L L B liquid culture medium, culturing for 12-16 h at 37 ℃, 200rpm in a shaking way, sucking 4ml from a cultured bacterial liquid, adding the bacterial liquid into 200ml sterilized Kan 40 mu G/m L L B liquid culture medium, culturing for 0.5-0.6 at 37 ℃, at 200rpm in a shaking way until OD600nm is 0.5-0.6, adding IPTG (isopropyl-beta-D) until the final concentration of the IPTG is 1.0 mmol/L for induction expression, continuing to culture for 4h at 37 ℃, at 200rpm, collecting bacterial liquid, centrifuging the bacterial liquid for 5min at 4 ℃, 12000rpm, collecting PBS, washing the collected bacterial cells for 2 times by using a volume ratio of 5:1, centrifuging for 5min at 4 ℃, collecting PBS for 5min, washing the cells for 2 times, then using 1% Triton X-100 to resuspend the cells by using PBS, resuspending, crushing the cells, removing the supernatant after ultrasonic, centrifuging for 4 rpm, removing the supernatant after resuspension, and resuspending the cells, and centrifuging for;

h. adding 15ml of washing solution into the thallus obtained from each 100ml of culture medium for resuspension and precipitation, washing for 5min, centrifuging at 4 ℃ and 12000rpm for 20min, and washing for 2 times in total; adding 10ml of denaturant into each 100ml of the thallus obtained from the culture medium, resuspending and precipitating, reacting in a refrigerator at 4 ℃ overnight until the denaturant is clear, centrifuging at 12000rpm for 20min at 4 ℃, and taking the supernatant to store at-20 ℃;

the washing solution comprises: 0.5M NaCl, 20mM Tris-HCl, 2M urea, pH 7.9;

the denaturant liquid comprises: 0.5M NaCl, 20mM Tris-HCl, 8M urea, pH 7.9;

i. purifying the obtained supernatant by using a Ni-NAT prepacked column in an imidazole gradient purification mode, and collecting target protein eluted by an elution buffer solution by using a 1.5ml centrifugal tube, wherein the preparation system of the used reagent is as follows:

binding buffer: 0.5M NaCl, 20mM Tris-HCl, 20mM imidazole, 8M urea, pH 7.9;

rinsing buffer solution: 0.5M NaCl, 20mM Tris-HCl, 80mM imidazole, 8M urea, pH 7.9;

0.5M NaCl, 20mM Tris-HCl, 100mM imidazole, 8M urea, pH 7.9;

elution buffer: 0.5M NaCl, 20mM Tris-HCl, 1M imidazole, 8M urea, pH 7.9;

j. collecting purified protein, performing protein renaturation by using a dialysis bag and adopting a gradient renaturation method, namely putting the dialysis bag containing the purified protein into 2L renaturation buffer solution, wherein the renaturation buffer solution is provided with 5 concentration gradients according to different urea concentrations, the buffer solution system comprises 0.5M NaCl, 20mM Tris-HCl, urea 6M, 4M, 2M, 1M, 0M, pH7.9 and 4 ℃ and is magnetically stirred and dialyzed for 8h, after one gradient dialysis, putting the dialysis bag into the dialysis buffer solution of the next gradient for dialysis until the dialysis is finished, collecting the protein at 4 ℃, centrifuging for 15min at 12000g, collecting supernatant and discarding precipitates.

A polyclonal antibody of the perinereis aibuhitensis G α protein prepared from the perinereis aibuhitensis G α recombinant protein is characterized by being prepared by immunizing a New Zealand rabbit once every 3 weeks for 4 times in total by using 40ug/kg of antigen dose, uniformly mixing the perinereis aibuhitensis G α recombinant protein with an isovolumetric Freund's complete adjuvant for the first immunization, uniformly mixing the perinereis aibuhitensis G α recombinant protein with an isovolumetric Freund's incomplete adjuvant for the subsequent 3 immunizations, collecting blood 7 days after the 4 th immunization, standing blood at 4 ℃ until layering, and taking serum to obtain the polyclonal antibody of the perinereis aibuhitensis G α protein.

A method for detecting G α protein E L ISA by using the polyclonal antibody of the perinereis aibuhitensis G α protein is characterized by sequentially comprising the following steps:

diluting a protein to be detected by using E L ISA coating liquid, adding 100ul of the diluted protein into a 96-well plate per well, coating overnight at 4 ℃, pouring out the coating liquid, washing 3 times per well by 100ul of PBST, adding 200ul of 3% bovine serum albumin per well, sealing 4 hours at 37 ℃, discarding the sealing liquid, washing 3 times per well by 100ul of PBST, adding 100ul of 1:4000 diluted polyclonal antibody of G α protein of Perinereis aibuhitensis into each well, incubating for 1 hour at 37 ℃, discarding polyclonal antibody of G α protein of Perinereis aihitensis, washing for 3 times by PBST, adding 100ul of 1:4000 diluted goat anti-rabbit IgG to each well, incubating for 1 hour at 37 ℃, discarding goat anti-rabbit IgG, washing for 3 times by PBST, adding 100ul of E L ISA developing liquid per well, developing for 10 minutes in a dark place at room temperature, adding 50ul of stop reagent, and detecting a light absorption value at 450nm wavelength of an enzyme labeling instrument.

The invention obtains the full-length fragment of the open reading frame of G α by designing primers at two ends of the open reading frame of G α, constructs an escherichia coli prokaryotic expression system of G α protein, and induces and expresses the perinereis aibuhitensis G α protein in vitro for the first time, thereby obtaining the perinereis aibuhitensis G α polyclonal antibody for the first time, and establishes an E L ISA detection method of the perinereis aibuhitensis G α protein, and the change condition of the perinereis aibuhitensis G α protein under the environmental estrogen pollution is determined by utilizing the E L ISA technology which is simple in method and strong in specificity, so that an experimental basis and basis can be provided for a mechanism of the toxic effect of environmental estrogen on the perinereis aibuhitensis.

Drawings

FIG. 1 is a 2% agarose gel electrophoresis of Perinereis aibuhitensis total RNA according to an embodiment of the present invention.

FIG. 2 is a 2% agarose gel electrophoresis picture of a perinereis aibuhitensis G α gene amplification product according to an embodiment of the invention.

FIG. 3 is a 2% agarose gel electrophoresis of plasmid pMD18-T-G α according to an embodiment of the present invention.

FIG. 4 shows the electrophoresis of plasmid pMD18-T-G α and plasmid pET-28a on 2% agarose gel by double digestion.

FIG. 5 shows the result of 2% agarose gel electrophoresis of recombinant plasmid pET-28a-G α according to the present invention.

FIG. 6 is a SDS-PAGE electrophoresis chart of the expression of G α protein according to example of the present invention.

FIG. 7 is a SDS-PAGE electrophoresis of inclusion body G α recombinant protein after being solubilized according to the embodiment of the present invention.

FIG. 8 is an SDS-PAGE electrophoresis of the purified recombinant protein G α according to example of the present invention.

FIG. 9 is a standard curve for the determination of the concentration of recombinant protein G α in example of the present invention.

FIG. 10 is a diagram showing the Western Blot detection result of the polyclonal antibody of G α according to the present invention.

FIG. 11 is a standard curve of E L ISA of G α protein of Perinereis aibuhitensis according to the embodiment of the present invention.

FIG. 12 is a schematic diagram of detecting the expression quantity of G α protein in female clam worm body wall induced by bisphenol A at different concentrations by using the E L ISA detection method of G α protein of Perinereis aibuhitensis in the embodiment of the invention.

FIG. 13 is a schematic diagram of the detection method of E L ISA of G α protein of Perinereis aibuhitensis according to the embodiment of the invention for detecting the expression quantity of G α protein of male nereis aibuhitensis wall induced by bisphenol A with different concentrations.

Detailed Description

Example 1:

the perinereis aibuhitensis G α recombinant protein is prepared by the following steps in sequence:

a. shearing the wall tissues of the perinereis aibuhitensis wall, grinding in liquid nitrogen, extracting Nereis aiso Plus, synthesizing a cDNA first strand by using a Takara Reverse Transcriptase M-M L V (RNase H-) kit, and subjecting the extracted perinereis aibuhitensis total RNA to 2% agarose gel electrophoresis, wherein M is D L2000 DNA marker in figure 1, and lanes 1-3 are the extraction results of the perinereis aibuhitensis total RNA.

b. Specific primers are designed and synthesized at two ends (206 bp-1267 bp) of an open reading frame according to the full length (Gene Bank: JQ 914104) of a G α Gene, a BamH I restriction site and a protective base are added at the 5 'end of an upstream primer, a DNA sequence is shown as SEQ ID NO. 1, an Xho I restriction site and a protective base are added at the 5' end of a downstream primer, a DNA sequence is shown as SEQ ID NO. 2, a PCR amplification reaction is carried out by taking a first strand of Perinereis aibuhitensis cDNA as a template, and an amplification product of the G α Gene of Perinereis aibuhitensis is shown as a 2% agarose gel electrophoresis picture in figure 2, wherein M is D L2000 DNA marker in figure 2, and a Lane No. 1 is a G α open reading frame amplification product.

c. The method comprises the steps of using a TIANGEN agarose gel DNA recovery kit to cut gel and recover fragments of amplified products, connecting recovered target fragments (1061 bp) with pMD18-T to construct a cloned plasmid pMD18-T-G α, recovering the cut gel of the cloned plasmid pMD18-T-G α, transforming the cut gel into a competent cell DH5 α, selecting a monoclonal, sequencing the monoclonal, and obtaining a sequencing result which is consistent with the sequence of the G α target fragment, wherein the pMD18-T-G α plasmid is subjected to 2 percent agarose gel electrophoresis, and the plasmid extraction result of M is D L5000 DNAmarker in figure 3 and the plasmid extraction result of 1 is pMD18-T-G α in figure 3 is shown in the figure.

d. Transferring the monoclonal to 5ml Amp 100 mu G/m L L B liquid culture medium, shaking at 37 ℃ and 200rpm for overnight culture, and extracting recombinant plasmid pMD18-T-G α by using the TIANGEN common plasmid small extract kit;

e. digesting recombinant plasmids pMD18-T-G α and plasmid pET-28a respectively by using restriction enzymes BamH I and Xho I, cutting gel to recover a G α target fragment and plasmid pET-28a, converting the recovered G α target fragment and plasmid pET-28a into competent cells 5 α according to the molar ratio of 2.25: 1 by using T4 DNA ligase at 16 ℃ for 14h, cutting gel to recover recombinant plasmids pET-28a-G α, picking up single clones, sequencing the picked single clones to obtain a sequencing result which is consistent with the sequence of the G α target fragment, plasmid pMD18-T- α and plasmid pET-28a, carrying out double digestion by 2% agarose gel electrophoresis, wherein M is D α 05000 DNA mar00 in figure 4, plasmid pET-28a plasmid pED α -T-18-G-5000-9 a in figure 5-M is extracted from a gel, and the DNA plasmid pET-28a is extracted from PCR products of PCR products No. 5-9, No. 5-25, No. 7, and FIG. 7 is shown in figure 5-9;

f. transferring the selected monoclonal into 5ml Kan 100 mu G/m L L B liquid culture medium, shaking at 37 ℃ and 200rpm for overnight culture, and extracting recombinant plasmids pET-28a-G α by using a TIANGEN common plasmid small extract kit;

g. transforming the recombinant plasmid pET-28a-G α into competent cells B L21 (DE 3), picking a single smooth bacterial colony in a flat plate, placing the single smooth bacterial colony in 5ml Kan 40 mu G/m L L B liquid culture medium, shaking at 37 ℃, 200rpm, culturing for 12-16 h, sucking 4ml from the cultured bacterial liquid, adding the bacterial liquid into 200ml sterilized Kan 40 mu G/m L L B liquid culture medium, shaking at 37 ℃, 200rpm, culturing until OD600nm is 0.5-0.6, adding IPTG until the final concentration of the IPTG is 1.0 mmol/L for induction expression, continuing shaking at 37 ℃, 200rpm/min for 4h, collecting the bacterial liquid, centrifuging the bacterial liquid at 4 ℃, 12000rpm for 5min, collecting PBS, washing the collected bacterial cells according to the volume ratio of 5:1, centrifuging at 4 ℃, 12000rpm for 5min, washing 2 times, collecting the bacterial cells, then using 1% Triton-100 to resuspend the PBS, crushing the bacterial cells after ultrasonic wave, crushing the cells, and centrifuging at 4 ℃ for 15ml, removing the supernatant after resuspending the bacterial cells, and using 15 ml.

Respectively taking 20 mul of the whole bacteria, the supernatant and the precipitate of the blank control bacteria liquid and the bacteria liquid after induction expression in a PCR tube, adding 5 mul of 5 × SDS L applying buffer, uniformly mixing, boiling in boiling water for 10min, returning to room temperature, and then loading a polypropylene gel with an SDS-PAGE electrophoresis chart as shown in figure 6, wherein in figure 6, M is a protein Marker, a lane 1 is the expression condition of the whole bacterial protein after induction breakage, a lane 2 is the expression condition of the broken supernatant protein, and a lane 3 is the expression condition of the broken precipitate protein.

After Coomassie brilliant blue staining and decoloring, the recombinant protein G α is judged to be expressed in a large amount in the precipitate and exists in the form of inclusion bodies.

h. Adding 15ml of washing solution into the thallus obtained from each 100ml of culture medium for resuspension and precipitation, washing for 5min, centrifuging at 4 ℃ and 12000rpm for 20min, and washing for 2 times in total; adding 10ml of denaturant into each 100ml of the thallus obtained from the culture medium, resuspending and precipitating, reacting in a refrigerator at 4 ℃ overnight until the denaturant is clear, centrifuging at 12000rpm for 20min at 4 ℃, and taking the supernatant (dissolved denatured protein) to store at-20 ℃;

the washing solution comprises: 0.5M NaCl, 20mM Tris-HCl, 2M urea, pH 7.9;

the denaturant liquid comprises: 0.5M NaCl, 20mM Tris-HCl, 8M urea, pH 7.9.

The SDS-PAGE electrophoresis picture of the solubilized inclusion body G α recombinant protein is shown in FIG. 7, wherein M is a protein Marker, lane 1 is supernatant after solubilization, and lane 2 is precipitate after solubilization;

i. purifying the obtained supernatant (denatured dissolved protein) by using a Ni-NAT prepacked column in an imidazole gradient purification mode, and collecting target protein eluted by an elution buffer solution by using a 1.5ml centrifugal tube, wherein a preparation system of used reagents is as follows:

binding buffer: 0.5M NaCl, 20mM Tris-HCl, 20mM imidazole, 8M urea, pH 7.9;

0.5M NaCl, 20mM Tris-HCl, 100mM imidazole, 8M urea, pH 7.9;

elution buffer: 0.5M NaCl, 20mM Tris-HCl, 1M imidazole, 8M urea, pH 7.9.

The SDS-PAGE electrophoresis of the collected proteins after purification is shown in FIG. 8: m is protein Marker, lane 1 is protein sample before purification, lane 2 is collected solution before rinsing, lanes 3-4 are rinsed with 80mM imidazole, lanes 5-6 are rinsed with 100mM imidazole, and lane 7 is eluted with 1M imidazole.

The protein concentration of the collected supernatant was measured using the BCA protein concentration measurement kit, and the protein concentration was adjusted to 1mg/ml, and the standard curve for measuring the protein concentration was shown in FIG. 9.

Example 2:

a polyclonal antibody of the perinereis aibuhitensis G α protein prepared from the perinereis aibuhitensis G α recombinant protein is prepared by immunizing a New Zealand rabbit once every 3 weeks for 4 times by using 40ug/kg of antigen dose, uniformly mixing the perinereis aibuhitensis G α recombinant protein with an isovolume of Freund's complete adjuvant for the first immunization, uniformly mixing the perinereis aibuhitensis G α recombinant protein with an isovolume of Freund's incomplete adjuvant for the subsequent 3 immunizations, collecting blood 7 days after the 4 th immunization, standing blood at 4 ℃ until layering, and taking serum to obtain the polyclonal antibody of the perinereis aibuhitensis G α protein.

Western Blot detection of specificity of polyclonal antibody of Perinereis aibuhitensis G α protein is carried out by extracting total protein of Perinereis aibuhitensis by RIPA lysate, adding 5 μ l 5 × SDS L loading buffer into 20 μ l total protein, boiling in boiling water for 10min after mixing, carrying out SDS-PAGE electrophoresis, transferring membrane for 35min at 120V, sealing with 3% BSA at 4 ℃ overnight, adding 1:4000 diluted polyclonal antibody of Perinereis aibuhitensis G α protein of the invention example 2, incubating for 1h at 37 ℃, washing TBS for 3 times, adding 1:4000 diluted goat antibody IgG, incubating for 1h at 37 ℃, washing TBS for 3 times, developing 5-10min by DAB kit, washing for 3 times by ddH2O, drying and observing the color development.

The results are shown in FIG. 10: in FIG. 10, M is a protein Marker, and a lane 1 is a Western Blot identification result.

The result shows that the position of the target band has a color development band, which shows that the prepared antibody can be effectively combined with G α protein in the nereis body, and the prepared polyclonal antibody can be used for detecting the existence of the G protein in the nereis body.

Example 3:

the G α protein E L ISA detection method of the invention is carried out according to the following steps in sequence:

diluting a protein to be detected by using E L ISA coating liquid, adding 100ul of the diluted protein into a 96-well plate per hole, coating overnight at 4 ℃, pouring out 100ul of PBST of the coating liquid per hole, washing for 3 times, adding 200ul of 3% bovine serum albumin per hole, sealing for 4 hours at 37 ℃, removing the sealing liquid, washing for 3 times by using 100ul of PBST per hole, adding 100ul of 1:4000 diluted polyclonal antibody of perinereis aibuhitensis G α protein into each hole, incubating for 1 hour at 37 ℃, removing polyclonal antibody of perinereis aibuhitensis G α protein, washing for 3 times by using PBST, adding 100ul of 1:4000 diluted goat anti-rabbit IgG into each hole, incubating for 1 hour at 37 ℃, removing goat anti-rabbit IgG, washing for 3 times by using PBST, adding 100ul of E L ISA developing liquid per hole, developing for 10 minutes in a dark place at room temperature, adding 50ul of light absorption stop liquid, and detecting a detection value at a wavelength of 450nm of an enzyme labeling instrument.

Experimental example 1 according to the method of the present invention, the recombinant protein of the present invention example G α diluted in concentration gradient was directly coated into a 96-well plate to perform the experiment, and the value of OD450 was measured under a microplate reader.an indirect E L ISA measurement standard curve of the G α recombinant protein was plotted with the net absorbance (positive OD 450-negative OD 450) as abscissa and the logarithm of each G α recombinant protein concentration as ordinate, as shown in FIG. 11. in the case of the protein concentration of 6.25ng/ml, the absorbance is not in the linear range, so the data was discarded.the standard curve R2=0.9903 has a good linear relationship, and the measurement range of G α is 12.5-400 ng.

Experimental example 2 inducing female and male Perinereis aibuhitensis by using environmental estrogen bisphenol A, extracting total protein from the wall of the Perinereis aibuhitensis at 4d, 7d and 14d respectively, and detecting the content of G α protein by using the method of the invention in example 3. the detection results are shown in FIGS. 12-13. in FIGS. 12-13, the difference is very significant (p <0.01) compared with the control group, the difference is significant (p <0.05) compared with the control group

The result shows that the content of G α protein in nereis can be obviously changed due to different concentrations of bisphenol A, and the method provided by the embodiment 3 of the invention can timely reflect the response mechanism of organisms to environmental estrogen.

Sequence listing

<110> university of Dalian ocean

<120> Perinereis aibuhitensis G α recombinant protein, polyclonal antibody and G α protein E L ISA detection method

<160>2

<170>PatentIn version 3.3

<210>1

<211>25

<212>DNA

<213> upstream primer

<400>1

TTGGATCCATGGCTTGCTGTCTGAG 25

<210>2

<211>29

<212>DNA

<213> downstream primer

<400>2

CGCTCGAGCACTAAGTTGTACTCTTTCAG 29

Claims

1. A preparation method of perinereis aibuhitensis G α recombinant protein is characterized by comprising the following steps in sequence:

step 1, extracting the total RNA of perinereis aibuhitensis, and synthesizing a first cDNA chain;

step 2, taking the first strand of Perinereis aibuhitensis cDNA as a template, and carrying out PCR amplification reaction, wherein the DNA sequences of an upstream primer and a downstream primer of the PCR reaction are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2;

step 3, recovering 1061bp of an amplification product, connecting a recovered target fragment with pMD18-T to construct a cloning plasmid pMD18-T-G α, recovering the cloning plasmid pMD18-T-G α, carrying out gel cutting, transforming the recovered cloning plasmid pMD18-T-G α into a competent cell DH5 α, and selecting a single clone;

step 4, transferring the monoclonal antibody into 5ml Amp 100 mug/m L L B liquid culture medium, shaking overnight at 37 ℃ and 200rpm, and extracting a recombinant plasmid pMD18-T-G α;

step 5. Using restriction enzyme BamH

And Xho

Digesting recombinant plasmid pMD18-T-G α and plasmid pET-28a respectively, cutting gel to recover a G α target fragment and plasmid pET-28a, connecting the recovered G α target fragment and plasmid pET-28a with T4 DNA ligase according to the molar ratio of 2.25: 1 at 16 ℃ for 14h, cutting gel to recover recombinant plasmid pET-28a-G α, transforming the recombinant plasmid pET-28a-G α into a competent cell DH5 α, and selecting a monoclonal;

step 6, transferring the monoclonal antibody into 5ml Kan 100 mug/m L L B liquid culture medium, shaking overnight at 37 ℃ and 200rpm, and extracting a recombinant plasmid pET-28a-G α;

step 7, transforming the recombinant plasmid pET-28a-G α intoIn a competent cell B L21 (DE 3), a single smooth colony in a flat plate is picked up and put into 5ml Kan 40 mu g/m L L B liquid culture medium, the temperature is 37 ℃, the rpm is 200, the shaking culture is carried out for 12-16 h, 4ml of the cultured bacterial liquid is sucked and added into 200ml of sterilized Kan 40 mu g/m L L B liquid culture medium, the temperature is 37 ℃, the rpm is 200, the shaking culture is carried out until the bacterial liquid is OD_600nmAdding IPTG (isopropyl-beta-thiogalactoside) into the mixture at a temperature of 0.5-0.6, enabling the final concentration of the IPTG to be 1.0 mmol/L for induced expression, continuously performing shake culture at 37 ℃ and 200rpm for 4 hours, collecting bacterial liquid, centrifuging the bacterial liquid at 4 ℃ and 12000rpm for 5 minutes, collecting thalli, cleaning the collected thalli by PBS according to the volume ratio of 5:1, centrifuging the thalli at 4 ℃ and 12000rpm for 5 minutes, cleaning for 2 times in total, collecting the thalli, then performing resuspension on the thalli by PBS containing 1% Triton X-100, performing ultrasonic crushing after resuspension, centrifuging the thalli at 4 ℃ and 12000rpm for 30 minutes, discarding supernatant, resuspending the precipitate by 15ml of PBS, and storing at 4 ℃;

step 8, adding 15ml of washing liquid into the thalli obtained from each 100ml of culture medium for resuspension and precipitation, washing for 5min, centrifuging at 4 ℃ and 12000rpm for 20min, and washing for 2 times in total; adding 10ml of denaturant into each 100ml of the thallus obtained from the culture medium, resuspending and precipitating, reacting in a refrigerator at 4 ℃ overnight until the denaturant is clear, centrifuging at 12000rpm for 20min at 4 ℃, and taking the supernatant to store at-20 ℃; the washing solution comprises: 0.5M NaCl, 20mM Tris-HCl, 2M urea, pH 7.9; the denaturant liquid comprises: 0.5M NaCl, 20mM Tris-HCl, 8M urea, pH 7.9;

step 9, purifying the obtained supernatant by selecting a Ni-NAT prepacked column and adopting an imidazole gradient purification mode,

the target protein eluted by the elution buffer is collected by a 1.5ml centrifuge tube, and the preparation system of the used reagent is as follows:

binding buffer: 0.5M NaCl, 20mM Tris-HCl, 20mM imidazole, 8M urea, pH 7.9;

0.5M NaCl, 20mM Tris-HCl, 100mM imidazole, 8M urea, pH 7.9;

elution buffer: 0.5M NaCl, 20mM Tris-HCl, 1M imidazole, 8M urea, pH 7.9;

and step 10, collecting the purified protein, utilizing dialysis bags to perform protein renaturation by adopting a gradient renaturation method, namely putting the dialysis bags filled with the purified protein into 2L renaturation buffer solution, wherein the renaturation buffer solution is provided with 5 concentration gradients according to different urea concentrations, the buffer solution system comprises 0.5M NaCl, 20mM Tris-HCl, 6M, 4M, 2M, 1M, 0M urea, pH7.9 and 4 ℃ under magnetic stirring and dialyzing for 8 hours, after one gradient dialysis, putting the dialysis bag into the dialysis buffer solution of the next gradient for dialysis until the dialysis is finished, collecting the protein, centrifuging for 15 minutes at 12000g at 4 ℃, collecting supernatant and discarding precipitates.