CN110051832A - A kind of heart worm disease vaccine - Google Patents

Abstract

The present invention relates to field of biotechnology, disclose a kind of heart worm disease vaccine, including heart worm small heat shock protein and immunologic adjuvant.Vaccine of the present invention is using heart worm small heat shock protein as immunogene and is aided with immunologic adjuvant, related experiment is as the result is shown, heart worm small heat shock protein can be identified by the dog serum of natural infection heartworm disease, the rabbit-anti IgG of heart worm small heat shock protein preparation can identify heart worm small heat shock protein, antibody level can be maintained for a long time after immune dog, and there is good immunogenicity and reactionogenicity；High sensibility and specificity is shown in indirect ELISA method simultaneously, various results prove that heart worm small heat shock protein has the potentiality of exploitation heart worm disease vaccine.

Description

A kind of heart worm disease vaccine

Technical field

The present invention relates to field of biotechnology, in particular to a kind of heart worm disease vaccine.

Background technique

Heartworm disease is one kind by mosquito-borne entomophila property parasitic disease.Heart worm (Dirofilaria Immitis) main parasitic can cause host in the pulmonary artery and right ventricle of dog, cat, the heart worm adult for colonizing in pulmonary artery Vascular lesion and the reaction such as pulmonary hypertension.Medicine is mainly used to the prevention and control of animal heartworm disease both at home and abroad at present Object precautionary measures prevent this disease by giving the Macrocyclolactone lactone kind medicine of preventive dose.Animal in Prevalent district, generally The addition drug in food is begun to from 8 week old to be prevented.Common main prophylactic agent has: ivermectin (ivermcetin), milbemycin (milbemycin) and selamectin (selamectin) etc..These Macrocyclolactone lactone kind medicines It is widely used in the prevention of heartworm disease for a long time, has played important function in the prevention of this disease.But due to macrolides The long-term low dose of drug is using the generation that can induce heart worm drug resistance, and all over the world, repeatedly report finds dog so far Dislike the Macrocyclolactone lactone kind medicine drug resistance worm strain of filaria.Research finds heart worm microfilaria P glycoprotein mononucleotide polymorphic position Point, the mutation of P glycoprotein gene and the having of ivermectin drug resistance related with the sensibility reduction of Macrocyclolactone lactone kind medicine Significant correlation.Simultaneously, it was found that heart worm abc transport protein family B subfamily P glycoprotein (Dim-pgp-11) gene with The drug effect of ivermectin reduces closely related.Macrocyclolactone lactone kind medicine generates mechanism and the polypide abc transport albumen man of drug resistance The drug concentration that race reduces receptor site is related, wherein B, and C, drug can be actively pumped out cell by G subfamily, so as to cause more Weight drug resistance (multi-drug resistance, MDR).

Under the overall situation of global warming, the spread speed of heartworm disease is being gradually increased.As heart worm is to big There is very big risk in the generation of cyclic lactone class drug resistance, chemoprophylaxis.Therefore it can be opened from early days by vaccinology approach How the generation of beginning prevention heartworm disease proposes that the immunogene for having exploitation heartworm disease Vaccine Potential dislikes prevention and control dog Filariasis has important practical significance.

Summary of the invention

In view of this, the purpose of the present invention is to provide a kind of heart worm disease vaccine, so that the vaccine dislikes silk with dog Worm small heat shock protein (Di-sHSP12.6) is immunogene, can not only produce and maintain higher antibody level, and dog for a long time The rabbit-anti IgG for disliking the preparation of filaria small heat shock protein can identify heart worm small heat shock protein, meet as the immune of vaccine The requirement of originality and reactionogenicity.

For achieving the above object, the invention provides the following technical scheme:

A kind of heart worm disease vaccine, including heart worm small heat shock protein and immunologic adjuvant.

In the specific embodiment of the invention, the heart worm small heat shock protein concentration is 100-200 μ g/mL；Institute Stating immunologic adjuvant is incomplete Freund's adjuvant, Freund's complete adjuvant or saponin, wherein the incomplete Freund's adjuvant and Freund are complete Full adjuvant concentration is 100-200 μ g/mL, and the saponin concentration is 3-6 μ g/mL, preferably 5 μ g/mL.

Herein, heart worm small heat shock protein can be non-natural, e.g. synthesizing or by manually carrying (being frequently referred to recombinant protein rDi-sHSP12.6 in the industry) that body surface reaches.Term " non-natural " refers to that target substance is not nature Naturally occurring, the non-natural substances and naturally occurring material structure and/or composition having the same are not precluded in this.

In nematode, it has now been found that 14 kinds of small heat shock proteins (small heat shock protein, SHSP), be segmented into 6 groups: sHSP12s according to the difference of molecular mass (including HSP12.1, HSP12.2, HSP12.3 and HSP12.6), sHSP16s (HSP16.1, HSP16.2, HSP16.41, HSP16.48 and newfound F08H9.3, F08H9.4), HSP25, HSP43, HSP17.5 and stress-inducing albumen -1 (stress-induced protein-1, SIP-1), Research confirms that it can not only maintain protein conformation necessary to cell under stressed condition, protection cell activities with Cells survival is maintained, and in protein folding, transdermal delivery, transhipment, immunity of organism, Apoptosis, cytoskeleton and bony nodule It plays an important role in the basic functions such as frame stabilization.Currently, heart worm small heat shock protein (Di-sHSP12.6) is in dog There is not been reported for correlative study in dirofilariasis.

The present invention obtains recombination heart worm small heat shock protein (rDi-sHSP12.6, and Di- by prokaryotic expression SHSP12.6 has identical amino acid sequence, as shown in SEQ ID NO:1), carry out immunoblotting to it, ELISA with And the foundation of method of early diagnosis.Immunoblot results show that the rabbit-anti IgG of recombinant protein rDi-sHSP12.6 preparation can be identified Recombinant protein rDi-sHSP12.6, recombinant protein rDi-sHSP12.6 can identify by the dog serum of natural infection heartworm disease, It cannot be identified by healthy dog serum, illustrate that heart worm small heat shock protein has good immunogenicity and reactionogenicity.

Result of indirect ELISA is shown, with 24 parts of heart worm positive serums of rDi-sHSP12.6 Protein Detection and 24 portions of dogs Filaria negative serum is disliked, the results show that 22 parts of positive serum OD450 > critical values, 2 parts of positive serums and 24 parts of negative serums OD450 < critical value (0.699), then the sensibility for assessing this method is 91.6% (22/24)；Meanwhile not with dog particulate spine ball silk ribbon Worm positive serum, dog cysticercus tenuicollis positive serum and dog hookworm positive serum (totally 18 parts) generation cross reaction, the 18 of detection Slight cross reactions occur for only 2 parts in part Toxocara canis positive serum, then the specificity for assessing this method is 91.6% (34/36)；In conclusion rDi-sHSP12.6 sensibility and specificity with higher, and cross reacting rate is low.

In addition, the present invention also carries out the immune of dog (6) using recombination rDi-sHSP12.6+ immunologic adjuvant, the results show that Antibody reach to peak value after immune 2 weeks still maintains higher antibody level in dog body in 3 months after immune, in conjunction with foregoing immune trace and Result of indirect ELISA shows that heart worm small heat shock protein has the potentiality of vaccine development.

From the above technical scheme, the present invention provides a kind of heart worm disease vaccines, are stopped with the small heat of heart worm Gram albumen as immunogene and is aided with immunologic adjuvant, and related experiment is the results show that heart worm small heat shock protein can be by nature The dog serum identification of heartworm disease is infected, the rabbit-anti IgG of heart worm small heat shock protein preparation can identify that heart worm is small Heat shock protein can maintain antibody level after dog is immunized for a long time, have good immunogenicity and reactionogenicity；Exist simultaneously High sensibility and specificity is shown in indirect ELISA method, various results prove that heart worm small heat shock protein has Develop the potentiality of heart worm disease vaccine.

Detailed description of the invention

Fig. 1 show the PCR amplification of Di-sHSP12.6 gene；Wherein, M is DNA molecular quality standard (DL2000)；1- 4:Di-sHSP12.6PCR product；

Fig. 2 show the double digestion identification of recombinant plasmid pET32a (+)-sHSP12.6；Wherein, M:DNA molecular mass mark Quasi- (DL2000)；The double enzyme digestion product of 1-4:pET32a (+)-sHSP12.6；

Fig. 3 show the expression of recombination Di-sHSP12.6 albumen；Wherein, M: protein standard；1:IPTG is lured That leads does not contain the Escherichia coli of pET32a (+)-sHSP12.6；The large intestine containing pET32a (+)-sHSP12.6 of 2-4:IPTG induction Bacillus；

Fig. 4 show the soluble analysis of rDi-sHSP12.6；Wherein, M: protein standard；1:8M urea Dissolution；The dissolution of 2:4M urea；The dissolution of 3:2M urea；4: supernatant；

Fig. 5 show the expression, purifying and immunoblotting assay of rDi-sHSP12.6；Wherein, what 1:IPTG was induced does not contain There are the Escherichia coli of recombination pET32a (+)-sHSP12.6；2:IPTG induction contains the big of recombination pET32a (+)-sHSP12.6 Enterobacteria；3: the IgG of the rabbit-anti rDi-sHSP12.6 after ni-sepharose purification；4: the rDi-sHSP12.6 after ni-sepharose purification；5: The dog positive serum specific recognition rDi-sHSP12.6 of natural infection heart worm；6: the rabbit-anti rDi- after ni-sepharose purification The IgG of sHSP12.6 identifies rDi-sHSP12.6；7: healthy negative dog serum identifies rDi-sHSP12.6；

Fig. 6 show the indirect immunofluorescence positioning of female and male heart worm cross section Di-sHSP12.6 albumen；Its In, I: intestines；UT: uterus；TE: testis；MU: muscle；HY: funiculus lateralis；PS: pseudocoele；Scale bar: 200 μm；A, B: female adult；C, D: Male worm；Note: green fluorescence region is that albumen is distributed Position Approximate；

Fig. 7 show the indirect ELISA (specificity) of recombinant protein rDi-sHSP12.6；

Fig. 8 show the indirect ELISA (sensibility) of recombinant protein rDi-sHSP12.6；

Fig. 9 show the antibody level testing result that rDi-sHSP12.6 is immunized after dog；Wherein, 1: preimmune serum；2- 8: Post-immunisation serum (blood sampling in every 15 days is primary).

Specific embodiment

The invention discloses a kind of heart worm disease vaccine, those skilled in the art can use for reference present disclosure, suitably change Into realization of process parameters.In particular, it should be pointed out that all similar substitutions and modifications are aobvious for a person skilled in the art And be clear to, they are considered as being included in the present invention.Vaccine of the present invention is described by embodiment, related Personnel can obviously not depart from the content of present invention, vaccine described herein is being modified or suitably changed in spirit and scope and group It closes, carrys out implementation and application the technology of the present invention.

The present invention is by extracting heart worm adult polypide total serum IgE, and reverse transcription is cDNA, and dog is expanded from cDNA and dislikes silk Worm small heat shock protein (Di-sHSP12.6) coded sequence.After T is cloned, amplified production is imported in a manner of digestion connection In expression vector, the rDi-sHSP12.6 that prokaryotic expression obtains recombination is carried out with Escherichia coli.

In the experiment of specific embodiment party, all experimental animals are in strict accordance with " People's Republic of China's Animal Protection Law " (draft of publication on September 18th, 2009) is handled.All programs are in strict accordance with " the animal welfare committee, Sichuan Agricultural University Experimental animal care guidelines " (China, Yaan；Approval number: 2013-028) implement.All methods are according to correlation criterion and regulation It carries out, including any correlative detail.

Dog of the heart worm polypide from Sichuan Province's natural infection and dissect, polypide are clear using PBS from after the separation of dog heart It washes, is heart worm through Morphological Identification referring to related documents and materials.Heartworm disease positive serum picks up from Sichuan Province's natural sense Contaminate the positive dog of heart worm.The dog that serum for cross reaction picks up from the dissect after excrement inspection or natural death is (dead It is preceding to have acquired blood)；Negative serum picks up from spring through inside and outside expelling parasite treated 3 monthly age beasle dogs (testing dedicated dog).

Experimental animal is 2 healthy new zealand rabbits, and female, at or so 3 monthly ages, 1.5~2.0kg reaches large biology purchased from Chengdu Co., Ltd.

Bacterial strain and plasmid: bacillus coli DH 5 alpha, e. coli bl21 (DE3) are purchased from Tiangeng company；TaKaRa pMD19-T Vector is purchased from Dalian treasured bioengineering Co., Ltd；Prokaryotic expression carrier pET32a (+) is purchased from Invitrogen.

Just a kind of heart worm disease vaccine provided by the present invention is described further below.

Embodiment 1: gene magnification

1, the extraction of heart worm total serum IgE

Be prepared in advance -80 DEG C of mortars being pre-chilled, and is removed from liquid nitrogen heart worm adult polypide (about 20mg), shreds Afterwards, a little liquid nitrogen is added and is fully ground, is indicated then according to Tiangeng animal tissue RNA extracts kit, extracts heart worm Total serum IgE, -80 DEG C of preservations.

2, first chain of cDNA is synthesized

Using the heart worm total serum IgE of extraction as template, OligodT (18) is primer, is tried according to the reverse transcription of Thermo company The instruction of agent box, synthesizes first chain of cDNA.

3, the design and synthesis of primer

Referring to Wuchereria malayi sHSP12.6 nucleotide sequence (gb:XM_001900555.1) in NCBI, utilize Primerpremier5.0 design primer, underscore part are restriction enzyme site (BamH I and Xho I):

Di-sHSP12.6 upstream primer (F): CGGATCCATGGAAGAAAAGGTAGTGGA

Di-sHSP12.6 downstream primer (R): CGAGCTCTCATGCTTTCTTTTTGGC

4, amplification program and system

PCR amplification is carried out by substrate template of heart worm cDNA.Amplification program is shown in Table 1, and amplification system is shown in Table 2:

Table 1

Table 2

5, product recycles

After above-mentioned product is carried out nucleic acid gel electrophoresis, it is whether correct that stripe size is compared under gel imaging system.So It cuts purpose band in the UV lamp afterwards, and DNA is carried out to purpose band according to Tiangeng biotechnology company's plastic recovery kit Recycling, -20 DEG C of preservations.

6, the amplification of Di-sHSP12.6 gene and basic physical and chemical attribute

Go out the band (Fig. 1,1-4 swimming lane) of 340bp or so using heart worm cDNA as template amplification, raw work biology has Limit company sequencing result shows that the sequence homology in the sequence and NCBI reaches 100%.

The Di-sHSP12.6 mrna length that the present invention expands encodes 113 amino through amino acid sequence analysis for 342bp Acid (last 3 bases be terminator codon, do not encode amino acid), molecular mass 13052.71, thus it is speculated that its molecular formula is C₅₇₅H₉₁₀N₁₆₂O₁₇₉S₃, ProtParam prediction Di-sHSP12.6 albumen mainly contain Val, Thr, Lys and Asp.Signal peptide point Di-sHSP12.6 no signal peptide, transmembrane region predictive display Di-sHSP12.6 are located at extracellular region as the result is shown for analysis.

Embodiment 2: clone and identification

1, it connects

The purpose band DNA fragmentation of recycling is connected with pMD19-T carrier, 16 DEG C (are no more than 16h) overnight, connector System is shown in Table 3:

Table 3

2, it converts

It takes out the 8 μ L of product connected to be placed in the EP pipe of 1mL, 30 μ LE.coliDH5 α competent cells is added, use is micro- Amount sample injector mixes gently, ice bath 30min, 42 DEG C of water-bath 90s, then ice bath 5min.600 μ LLB Liquid Cultures are added into EP pipe Base takes 100 μ L bacterium solutions to be uniformly inoculated in the solid of benzyl containing ammonia (AMP) resistance after cultivating 1.5h in 37 DEG C, 180r/min environment On culture medium, 12h is cultivated in 37 DEG C of constant incubators.

3, sequencing identification

Select that form is normal, the single bacterium colony of dispersion is inoculated in 1mLLB fluid nutrient medium (containing 1 μ LAMP), and 37 DEG C 6h is cultivated in 180r/min environment, the band that whether can amplify target fragment size identified, purpose will be amplified by bacterium solution PCR The bacterium solution of segment takes 400 μ L that raw work biology Co., Ltd is sent to be sequenced.Bacterium solution PCR reaction system is shown in Table 4:

Table 4

Embodiment 3: construction of expression vector

1, plasmid is extracted

Correct bacterium solution is sequenced in embodiment 2 to expand culture, is extracted according to the small extraction reagent kit specification of Tiangeng plasmid The plasmid of Di-sHSP12.6, and finally draw 5 μ L mixing, 5 μ Lloadingbuffer and carry out accounting gel electrophoresis, detect plasmid Purity.

2, the digestion recycling of target gene plasmid and expression vector plasmid

The plasmid of expression vector pET32a (+) is obtained by target gene plasmid and according to the method for 2.3.1, use is identical The fast enzyme cutting of Takara carries out digestion, obtains identical cohesive terminus,cohesive termini.With (BamH I and Sac I) fast enzyme cutting to Di-sHSP12.6 and PET32a (+) expression vector plasmid carries out digestion.Target gene plasmid after digestion and expression are carried according to the method in embodiment 1 The DNA fragmentation of constitution grain carries out glue recycling.

3, target gene connects expression vector

The DNA fragmentation recycled in 2 is taken respectively, is attached with T4 ligase, building pET32a (+)-recombinant protein expression Vector plasmid.After brief centrifugation, 22 DEG C of connection 2h in PCR instrument.It is converted according to method in embodiment 2.

4, the double digestion identification of recombinant plasmid

Recombinant plasmid is obtained according to method in 1, respectively with corresponding fast enzyme cutting to recombinant plasmid double digestion, and carries out nucleic acid Gel electrophoresis determines that target gene has been coupled on expression vector.400 μ L are taken to send raw work biology limited public affairs determining bacterium solution Department's sequencing.

Through nucleic acid gel electroresis appraisal, recombinant plasmid energy digestion goes out the segment with target gene size, with expected results phase With (Fig. 2).Recombination Di-sHSP12.6 plasmid is transferred in BL21 Escherichia coli, after the plate screening via AMP resistance, is chosen The single bacterium colony of form rule is taken to carry out bacterium colony PCR identification, positive bacteria send raw work biology Co., Ltd to be sequenced, sequencing sequence and mesh Gene order it is identical, show construction of expression vector success.

Embodiment 4: the prokaryotic expression of albumen

(1) correct bacterium solution will be sequenced in embodiment 2 to expand culture, and obtains recombination according to method in embodiment 3 Plasmid.

(2) it takes 10 μ L plasmids to be placed in the EP pipe of 1mL, 50 μ LE.coliBL21 competent cells is added, use micro sample-adding Device mixes gently, ice bath 30min, 42 DEG C of water-bath 90s, then ice bath 5min.600 μ LLB liquid mediums are added into EP pipe, in 37 DEG C, after cultivating 1.5h in 180r/min environment, 150 μ L bacterium solutions is taken uniformly to be inoculated in the solid culture of benzyl containing ammonia (AMP) resistance On base, 12h is cultivated in 37 DEG C of constant incubators.

(3) PCR identification is carried out according to method in embodiment 2, PCR is accredited as positive bacterium solution and carries out 5mL expansion culture, 37 DEG C, 180r/min is cultivated to value=0.6 OD, and inducer IPTG (1mmol/L) is added and induces 6h, another bottle is not added IPTG and does sky White control.

(4) bacterium solution after taking 1mL to induce 4 DEG C, 12000r/min, is centrifuged 1min, collects bacterial sediment, 40 μ are added LddH2O and 10 μ L5 × SDS loading Buffer is mixed.

(5) after heating 10min in boiling water, 4 DEG C, 12000r/min, it is centrifuged 1min, appropriate supernatant is taken to carry out SDS-PAGE.

(6) PAGE glue is removed, is put into the container equipped with coomassie brilliant blue staining agent, dyeing 30min or so, in boiling water Decolourize 10min, observes result under gel imaging system.

SDS-PAGE shows to obtain about 30KDa, and (Di-sHSP12.6 size is about 12KDa, and His tag size is about 18KDa) (Fig. 3).

Embodiment 5: the soluble analysis of recombinant protein

Will the bacterium of successful expression be inoculated in 1LLB fluid nutrient medium (g/mL of μ containing AMP100), 37 DEG C, 180r/min 3h is cultivated, to OD=0.6,10mLIPTG is added and induces 6h.By 4 DEG C of all bacterium solutions, 12000r/min is centrifuged 10min, abandons supernatant Retain remaining thallus and suspension is then put into mixture of ice and water with the Tris-HCl lytic cell wall of 10mL (50mmol/L) In, sonicated cells.4 DEG C, 12000r/min, it is centrifuged 10min, takes supernatant according to method sample preparation in embodiment 4.Sediment point Not Yong the dissolution of gradient urea, then supernatant is collected by centrifugation respectively according to method sample preparation in embodiment 4.Gained sample is subjected to SDS- After PAGE, it is imaged in gel imaging system.RDi-sHSP12.6 albumen is expressed at supernatant (Fig. 4) as the result is shown.

Embodiment 6: the purifying of recombinant protein

Will the bacterium of successful expression be inoculated in 1LLB fluid nutrient medium (g/mL of μ containing AMP100), 37 DEG C, 180r/min 3h is cultivated, to OD=0.6,10mLIPTG is added and induces 6h, obtains recombinant protein bacterium solution.

(1) by 4 DEG C, 12000r/min of all bacterium solutions, it is centrifuged 10min, abandons supernatant, retains thallus.

(2) suspension, is then put into mixture of ice and water by the Tris-HCl lytic cell wall for using 10mL (50mmol/L), Sonicated cells.

(3) 4 DEG C, 12000r/min, it is centrifuged 10min, collects supernatant.

(4) precipitating uses 2mol/L, 4mol/L, 6mol/L respectively, and the urea liquid of 8mol/L washs, then 4 DEG C, 12000r/ Min is centrifuged 10min, collects supernatant.

(5) it with the above-mentioned gained supernatant of 0.45 μm of membrane filtration, is placed in spare in mixture of ice and water.

(6) with 0.22 μm of membrane filtration BandingBuffer and ElutionBuffer, it is placed in ice together with 20% alcohol It is spare in aqueous mixtures, bubble removing is removed using preceding ultrasound 1-2min.

(7) nickel ion affinity chromatograph column is taken out, is connected on protein purification instrument, with BandingBuffer balance 5-10 Bed volume.

(8) albumen is injected, balances 5-10 bed volume to BandingBuffer, is started respectively with 13%, 25%, 50%, 75% and 100% ElutionBuffer (imidazoles containing 400mM) is eluted, eluting peak to appear, starts to collect albumen sample Product.

(9) ultrafiltration that recombinant protein is carried out according to super filter tube application method, is during which added after 0.22 μm of membrane filtration and goes out The PBS of bacterium carries out the displacement of imidazoles and other substances.

(10) albumen after ultrafiltration measures protein concentration using ultramicron ultraviolet specrophotometer, 1-2 drop glycerol is added - 80 DEG C of preservations afterwards, to guarantee the stabilization of albumen.

The purification effect of rDi-sHSP12.6 (Fig. 5, swimming lane 4) albumen is good as the result is shown.

Embodiment 7: the analysis of recombinant protein immunogenicity and reactionogenicity

2.7.1 the preparation of rabbit-anti recombinant protein IgG

The incomplete Freund's adjuvant or Freund's complete adjuvant of equivalent will be added in albumen after purification, so that albumen is dense eventually Degree is 0.2mg/mL, and ultrasound is to Water-In-Oil state emulsion formulation (instill water in 1min indiffusion) in Ultrasonic Cell Disruptor.Points 4 times right New zealand rabbit carries out subcutaneous injection and is immunized, and specific immune programme is shown in Table 5:

Table 5

4th time immune 7 days latter, from rabbit ear edge vein exploitating blood, and separates -20 DEG C of serum preservations.

2, the thick of IgG mentions

(1) it takes 10mL serum to add physiological saline 10mL, then (NH is added dropwise₄)₂SO₄Saturated solution 5mL is (until generate wadding Until shape precipitates), make 20% (NH₄)₂SO₄Solution, it is stirring while adding, stand 30min

It (2) 4 DEG C, 3000r/min, is centrifuged 20min, abandons precipitating (except defibrinating).

(3) (NH4) 2SO4 saturated solution 15mL or so is added into supernatant, makes 50% (NH₄)₂SO₄Solution, it is quiet Set 30min.

(4) 4 DEG C, 3000r/min, it is centrifuged 20min, abandons supernatant.

(5) precipitating can go up column purification with A2BangdingBuffer after completely dissolution.

3, the purifying of IgG

(1) purification column is installed on instrument by correct step, with preceding 20% alcohol rinse instrument pipe, until balance.

(2) pillar is balanced with A2BangdingBuffer, until ion line balance.

(3) IgG slightly mentioned is injected into instrument, is continued A2BangdingBuffer and is balanced pillar to ion line balance.

(4) it is then eluted with BBuffer, after there is eluting peak, controls as low flow velocity, collect IgG sample after purification, stand It is neutralized with Tris, PH=8.0 or so.

(5) the step of repeating sample-adding purifying, repeating (2)-(4).

(6) after having purified, it is full of instrumentation tube with 20% alcohol, until ion line balance.

(7) a small amount of IgG after purification is taken to verify according to method sample preparation in embodiment 4.

Rabbit-anti r-Di-sHSP12.6 (Fig. 5, swimming lane 3) protein I gG is prepared according to the method described above, and passes through the affine layer of nickel column Analysis purifies rabbit-anti recombinant protein IgG, works well, and occurs the heavy chain of 50KDa or so and 25KDa or so respectively Light chain.

4, the immunoblotting of Di-sHSP12.6 albumen

(1) recombinant protein is subjected to SDS-PAGE.

(2) gel redundance is cut, 24 layers of filter paper (2) and nitrocellulose filter (NC film) is cut respectively, sets jointly It is balanced 3 times in transferring film buffer, each 5min.

(3) gel by balance after good, filter paper and NC film, according to negative battery plate, filter paper, gel, NC film, the sequence of filter paper It stacks, and removes intermediate extra bubble with glass rod.

(4) anode battery plate is covered, electric current is configured according to 1mA/cm2, and corotation moves 30min.

(5) after transferring film, gel coomassie brilliant blue staining is taken out, the effect of transferring film is observed in gel imaging system Rate.

(6) NC film is put into container, carries out washing 3 times, each 5min with TBST.

(7) skimmed milk power that 5% is added into container closes 2h, and primary antibody (heart worm positive serum or preparation is added Rabbit-anti IgG), after being diluted according to 1:100,4 DEG C, overnight.

(8) primary antibody is abandoned, is washed 3 times, each 5min with TBST, secondary antibody (HRP- marks rabbit-anti dog IgG) is added, according to After PBS1:2000 dilution, it is incubated for 2h at room temperature.

(9) secondary antibody is abandoned, is washed 3 times, each 5min with TBST, NC film is taken out and is placed in clean container, be added dropwise on NC film Diaminobenzidine (DAB) developing solution of fresh configuration.

(10) it after there is band, is terminated react with distilled water immediately, taken pictures in gel imaging system.

It is analyzed according to immunogenicity and reactionogenicity of the method among the above to rDi-sHSP12.6 albumen.Diagnosis of Sghistosomiasis R-Di-sHSP12.6 albumen has good immunogenicity and reactionogenicity to mark as the result is shown.The rabbit-anti IgG of recombinant protein preparation It can identify that recombinant protein (Fig. 5, swimming lane 6, shown in white arrow), recombinant protein can be by the dog blood of natural infection heartworm disease Clear identification, cannot be identified by healthy dog serum, illustrate the albumen have good reactionogenicity and immunogenicity (Fig. 5, swimming lane 5, Shown in white arrow).

5, indirect immunofluorescence positions

(1) it is sliced: by the fixed heart worm female insect paraffin embedding of 4% paraformaldehyde and being sliced (thickness 4mm).

(2) it bakes piece: slice is placed in 2h in 60 DEG C of insulating boxs.

(3) by baked slice in the following order carry out dewaxing and aquation: dimethylbenzene I (7min), dimethylbenzene II (7min), 100% alcohol I (3min), 100% alcohol II (3min), 95% alcohol (3min), 85% alcohol (3min), 75% alcohol (3min), distilled water (8min).

(4) slice after the completion of dewaxing and aquation is put into antigen hot repair in sodium citrate buffer solution to answer, 95 DEG C or more add Hot 15min.Slice is rinsed 3 times, 5min/ times with PBS after cooling.

(5) organizationally with 3%H2O2 drop, it 37 DEG C, 25min, is washed 3 times, 5min/ times with PBS.

(6) 5%BSA confining liquid, room temperature, 45min is added dropwise to tissue.

(7) surplus liquid is abandoned, rabbit-anti recombinant protein IgG (1:100 dilution) is added, 4 DEG C of overnight incubations in wet box；PBS is washed It washs 3 times, 4min/ times.

(8) goat anti-rabbit igg (1:100 dilution) marked with the 0.1% diluted FITC of Azo-Blue is added, 37 DEG C are protected from light It is incubated for 1h.

(9) PBS is washed 3 times, 4min/ times.

(10) mounting is carried out with qs glycerin buffer, slice is placed in fluorescence microscopy under the microscope and be imaged.

Indirect IF staining detects Di-sHSP12.6 in the distribution of female and male heart worm adult cross section, SHSP12.6 is distributed mainly in the epidermis and intestines of female heart worm as the result is shown, there is a small amount of distribution in muscle；In male dogs It dislikes in filaria body and is distributed mainly on epidermis, and can be secreted into enteron aisle, also there was only a small amount of distribution map 6, A, B, C, D in muscle, Wherein A, C are the positive, and B, D are feminine gender).

The foundation of embodiment 8:rDi-sHSP12.6 albumen indirect ELISA method

1, operating method

(1) 96 hole elisa Plates are taken, dilute recombinant protein (antigen) with coating buffer, 0 hole μ L/ of protein 10 that addition has diluted, 4 DEG C, coating is overnight.

(2) protein liquid is abandoned, wash 3 times with PBST, 5min/ time, concussion is cleaned in Yu Weiliang concussion instrument, (it fills it up with as far as possible, but Hole cannot be gone here and there).

(3) 5% skimmed milk power is added, 250 holes μ L/, are incubated for 1.5h by 37 DEG C.

(4) PBST is washed 3 times, 5min/ times.

(5) serum diluted with PBS is added, 100 holes μ L/, are incubated for 1h by 37 DEG C.

(6) PBST is washed 3 times, 5min/ times.

(7) the rabbit-anti dog IgG for diluting HRP label in proportion with PBS is added, 100 holes μ L/, are incubated for 1h by 37 DEG C.

(8) PBST is washed 4 times, 5min/ times.

(9) soluble one pack system substrate TMB developing solution, 100 holes μ L/ are added into 96 hole elisa Plates, room temperature is protected from light incubation 20min。

(10) H of 2mol/L is added₂SO₄, 100 holes μ L/ terminate reaction.

(11) 96 orifice plates are placed in microplate reader, measure its OD value (λ=450nm).

2, condition optimizing

(1) optimal antigen coat concentration and serum-concentration are determined: referring to Checkerboard titration method, it is dense that 6 antigen coats being set Degree is such as: (20.20 μ g, 10.10 μ g, 5.05 μ g, 2.53 μ g, 1.26 μ g and the 0.63 every hole μ g/) and 4 serum dilutions (1:20, 1:40,1:80 and 1:160), after completing test according to 2.8.1 method, in measuring reading in microplate reader, P/N value is calculated, is determined Optimal antigen coat concentration and serum-concentration.With positive serum OD450 close to the maximum condition of 1, P/N as best.

(2) it determines optimal confining liquid: according to optimal antigen coat concentration and serum-concentration, using 5% degreasing respectively Milk powder and 5% BSA as confining liquid, complete to calculate P/N value in measuring reading in microplate reader, determine optimal after test Confining liquid.With positive serum OD450 close to the maximum condition of 1, P/N as best.

(3) optimal primary antibody incubation time is determined: according to optimal antigen coat concentration, serum-concentration and confining liquid, if 4 unused incubation times (0.5h, 1h, 1.5h and 2h) are stood, is read after completing test in measurement in microplate reader, calculates P/N Value, determines optimal primary antibody incubation time.With positive serum OD450 close to the maximum condition of 1, P/N as best.

(4) determine that optimal secondary antibody is incubated for concentration: when being incubated for according to optimal antigen coat concentration, serum-concentration and primary antibody Between, set up 5 different secondary antibody dilutions (1:1000,1:2000,1:3000,1:4000 and 1:5000), complete after test in Reading is measured in microplate reader, calculates P/N value, determines that optimal secondary antibody is incubated for concentration.With positive serum OD450 close to 1, P/N Maximum condition is as best.

(5) determine optimal developing time: according to above optimum condition, set up 5 different developing times (10min, 15min, 20min, 25min, 30min), it is read after completing test in measurement in microplate reader, calculates P/N value, determine optimal Developing time.With positive serum OD450 close to the maximum condition of 1, P/N as best.

3, the determination of critical value

It is tested according to the experimental condition optimized in 2.8.2, critical value is determined using cutoff value method.Measure 24 portions of dogs Dirofilariasis negative serum OD450 calculates the average and standard deviation of all serum OD450.Cutoff value=average value+3 Times standard deviation, is arranged 3 repetitions.

4, the determination of specificity and sensibility

It is tested according to the experimental condition optimized in 2, respectively to the collected dog Echinococcus granulosus in this laboratory sun Property serum (8 parts), dog cysticercus tenuicollis positive serum (2 parts), dog hookworm positive serum (8 parts) and Toxocara canis serum (18 Part) respectively carry out cross reactivity measurement.According to the critical value determined in 3, corresponding specificity and sensibility, meter are calculated It is as follows to calculate formula: specificity=true negative serum number/(true negative serum number+false positive serum number) × 100%, sensibility=true Positive serum number/(true positives serum number+false negative serum number) × 100%, 3 repetitions of every group of setting.

According to the indirect ELISA method of optimization, with rDi-sHSP12.6 Protein Detection dog Echinococcus granulosus positive serum (8 parts), dog cysticercus tenuicollis positive serum (2 parts), dog hookworm positive serum (8 parts) and Toxocara canis serum (18 parts), knot Fruit shows, does not hand over dog Echinococcus granulosus positive serum, dog cysticercus tenuicollis positive serum and dog hookworm positive serum Fork reacts, and slight cross reactions occurs for only 2 parts in 18 parts of Toxocara canis positive serums of detection, then assesses this method Specificity is 94.4% (34/36) (Fig. 7)；

5, the repeatability of detection test

(1) Repeatability checking in criticizing: being coated with the recombinant protein of same concentrations in same 96 hole elisa Plates, detects 6 parts Determining heartworm disease positive serum, every part of serum repeats 3 holes, according to the ELISA method optimized, carries out batch interior repetition Test calculates the coefficient of variation, repeatability in inspection lot.

(2) Repeatability checking between criticizing: being coated with the recombinant protein of same concentrations in 3 96 hole elisa Plates respectively, detects 6 parts Determining heartworm disease positive serum, every part of serum repeats 3 holes, according to the ELISA method optimized, repeat between criticizing Test calculates the coefficient of variation, repeatability between inspection lot.

Interassay coefficient of variation is (5.63%-8.15%), and variation within batch coefficient is (0.96%-3.89%), batch variation For coefficient less than 10%, variation within batch coefficient shows that the test has good repeatability less than 5%.

6, clinical detection

It is negative to 24 parts of heartworm disease positive serums and 24 heartworm diseases respectively with established indirect ELISA method Serum is detected, and according to critical value, specificity and sensibility judge the reliability of ELISA method.

According to the indirect ELISA method of optimization, with 24 parts of heart worm positive serums of rDi-sHSP12.6 Protein Detection and 24 parts of heart worm negative serums, the results show that 22 parts of positive serum OD450 > critical values, 2 parts of positive serums and 24 parts of feminine genders Serum OD450 < critical value (0.699), then the sensibility for assessing this method is 91.6% (22/24) (Fig. 8).

Primary Study of the embodiment 9:rDi-sHSP12.6 as vaccine

First immunisation recombinant protein (rDi-sHSP12.6) (100 μ g/ml)+saponin adjuvant (5 μ g/ml), 1ml/ only into Row dog (6) is immunized；Second is carried out after 7 days with same dose to be immunized.

The anti-rDi-sHSP12.6 protein antibodies level of dog, antigen coat concentration are detected by envelope antigen of rDi-sHSP12.6 23.3 μ g/ml, serum dilution 1:80；

Testing result is shown in Fig. 9: antibody reach to peak value after 2 weeks immune still maintains higher antibody water in 3 months after immune in dog body It is flat, in conjunction with foregoing immune trace and result of indirect ELISA, show that the albumen has the potentiality of vaccine development.

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.

Sequence table

<110>Sichuan Agricultural University

<120>a kind of heart worm disease vaccine

<130> MP1908396

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 113

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 1

Met Glu Glu Lys Val Val Glu Leu Thr His Asn Trp Ser Ala Asp Gln

1 5 10 15

Trp Asp Trp Pro Leu Gln His Asn Asp Asp Val Val Lys Val Thr Asn

20 25 30

Thr Asn Asp Lys Phe Glu Val Gly Leu Asp Ala Ser Phe Phe Thr Pro

35 40 45

Lys Glu Ile Glu Val Lys Val Cys Gly Asp Asn Leu Val Ile His Cys

50 55 60

Arg His Glu Thr Arg Thr Asp Gln Tyr Gly Glu Ile Lys Arg Glu Ile

65 70 75 80

Ser Arg Thr Tyr Lys Leu Pro Ser Asp Val Asp Thr Lys Thr Leu Thr

85 90 95

Ser Asn Leu Thr Lys Arg Gly His Leu Val Ile Ala Ala Lys Lys Lys

100 105 110

Ala

Claims (6)

1. a kind of heart worm disease vaccine, which is characterized in that including heart worm small heat shock protein and immunologic adjuvant.

2. vaccine according to claim 1, which is characterized in that the heart worm small heat shock protein sequence such as SEQ ID Shown in NO:1.

3. vaccine according to claim 1, which is characterized in that the heart worm small heat shock protein concentration is 100-200 μ g/mL。

4. vaccine according to claim 1, which is characterized in that the immunologic adjuvant is incomplete Freund's adjuvant, Freund is complete Adjuvant or saponin.

5. vaccine according to claim 4, which is characterized in that the incomplete Freund's adjuvant and Freund's complete adjuvant concentration are 100-200μg/mL。

6. vaccine according to claim 4, which is characterized in that the saponin concentration is 3-6 μ g/mL.